|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 282, Issue 50, 36386-36393, December 14, 2007
Daxx-like Protein of Drosophila Interacts with Dmp53 and Affects Longevity and Ark mRNA Level*
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
p53 and its only Drosophila homolog Dmp53 share limited conservation at the sequence level, yet the two proteins are surprisingly similar in domain structure and their residues critical for DNA binding are well preserved (4, 5). Importantly, Dmp53 is able to bind to human p53 recognition sites and activate transcription in vitro (5, 6). Although Dmp53 is nonessential under normal circumstances, null mutants show genomic instability and radiosensitivity (7, 8). In response to genotoxic stimuli, activated Dmp53 induces DNA repair or programmed cell death by activating the expression of its target genes, such as the pro-apoptotic reaper (rpr), Hid and sickle, and the DNA repair genes Ku70 and Ku80 (9). Loss of Dmp53 abolishes radiation-induced apoptosis in larval imaginal discs (6, 8), and overexpression induces cell death (5, 9). Interestingly, a disturbed level of p53 affects aging and longevity both in mouse and Drosophila (7, 10–12). Although little is known about the regulation of Dmp53, the information accumulated so far suggests that Dmp53 is regulated in a partially conserved, ancestral way. MDM2 does not have a Drosophila homolog, and the amino acid residues critical for its binding are not preserved in Dmp53 (4). In contrast, similar to its human counterpart, Dmp53 is phosphorylated, and this modification is necessary for the induction of Dmp53-dependent apoptosis (9, 13).
The death domain-associated factor 6, Daxx, is one of the cofactors modulating p53 functions. Daxx was initially identified as a cytoplasmic Fas receptor-binding protein that potentiates apoptosis (14, 15). More recent studies found that Daxx resides primarily in the nucleus, and participates in transcriptional regulation (16–18). Loss of Daxx results in extensive apoptosis and early embryonic death in mice (19), suggesting that it may also bear anti-apoptotic functions. This view is supported by the finding that the expression of p53, similarly to that of several other proapoptotic proteins, is down-regulated by Daxx in myelocytes (20). Several groups demonstrated the binding of Daxx to p53 but the consequences of this interaction are not clearly elucidated. Tumorigenic mutant forms of p53 were found to bind Daxx and inhibit the activation of the Daxx-dependent ASK1/JNK pathway (21). Other studies showed that Daxx also binds wild-type p53 and modulates its transcriptional activator function in vitro (22–24), although these experiments provided partially conflicting results. Several recent reports indicate that Daxx bears both pro- and anti-cell death activities, and its involvement in malignancies is convincingly demonstrated (18).
Here we show both the physical interaction between Dmp53 and the Drosophila homolog of Daxx, DLP,3 and the genetic interaction of the corresponding genes. Analyzing the effect of DLP mutations we found that, although DLP is required for the transcription of some proapoptotic genes, such as Ark for example, DLP is not required for Dmp53-dependent stress response upon high dose ionizing radiation. Surprisingly, DLP mutants have reduced longevity similarly to Dmp53 mutant flies (7). Altogether, our data suggest a role for DLP regulating both pro- and antiapoptotic pathways.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
N, pBTM116-Dmp53C, pBTM116-Dmp53C1, and pBTM116-Dmp53C2, a Dmp53 cDNA was PCR-amplified using the primer pairs Dmp53F1-Dmp53R1, Dmp53F3-Dmp53R1, Dmp53F3-Dmp53R2, and Dmp53F4-Dmp53R1, respectively. The amplicons were cut with EcoRI and BamHI and inserted into pBTM116. To generate pBTM116-Dmp53
N
C the plasmid pBTM116-Dmp53
N was cut with StyI and BamHI, filled in with Klenow and ligated. Human p53 was cloned into pBTM116 using EcoRI and BamHI, then the transactivation domain was deleted by digestion with EcoRI and NcoI, fill-in and religation. The sequences of the oligonucleotide primers were as follows: Dmp53F1: GGGAATTCTTGCAGGGATTAAACTCCG, Dmp53F3: GCGAATTCAGCAAGAAGCGCAAGTCC, Dmp53F4: GAATTCGGCATGATTAAGGAGGCGGC, Dmp53R1: CGGGATCCTCATGGCAGCTCGTAGGC, Dmp53R2: GGATCCAATCATGCCCTCGATGCTCT. To generate P[UASDLP1.7 kb] plasmid 1.7-kbp fragment of DLP was PCR-amplified using the DLPF2 (ACTGAGTACGCGGCACTTCT) and DLPR (ATGATCCGAACGTATTCAGGA) primers. The fragment was cloned into pUAST vector using the EcoRI and ApaI restriction sites. Yeast Two-hybrid Experiments—The yeast two-hybrid screen was performed using MATCHMAKER lexA Two-Hybrid System (Clontech Laboratories, Inc.), following the supplier's recommendations. Positive clones were validated by β-galactosidase colony-lift filter assay (25). Plasmid DNA was isolated from colonies proved to be positive in both assays (i.e. complementation of auxotrophy and β-galactosidase assay), sequenced, and cDNAs identified by BLAST homology searches (26). Binding of DLP to different domains of Dmp53 was tested by co-transformation of L40 yeast cells with the plasmid DLP-pACT2, identified in the screen, and pBTM116 plasmids carrying cDNA fragments spanning different regions of the Dmp53 open reading frame. To test the potential interactions, transformants were screened for growth in medium lacking histidine and assayed for β-galactosidase activity, as described above.
GST Pull-down Experiments—The C-terminal region of DLP cDNA identified in Y2H screen was inserted into pET28c and transcribed-translated in the presence of [3H]leucine using the TNT T7-coupled reticulocyte lysate system (Promega) following the manufacturer's instructions. Dmp53C was cloned into pGEX-4T-1 vector using EcoRI and SalI sites. Expressed GST-Dmp53C was bound to glutathione-Sepharose beads (Amersham Biosciences) according to the manufacturer's instructions. In vitro translated DLP protein and GST-Dmp53C-bound beads were mixed in PD buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 3 mM EDTA pH8.0, 1 mM β-mercaptoethanol, 1% Nonidet P40) and kept at 4 °C for 2 h. Beads were washed four times with PD buffer containing 0.1% Nonidet P40, and once with PD buffer lacking Nonidet P40. Interactions were analyzed by SDS-PAGE and fluorography (using Amplify Fluorographic Reagent from Amersham Biosciences).
Quantitative RT-PCR—Developmental expression of DLP was determined by measuring DLP transcript levels in synchronized w1118 animals of different developmental stages. Dmp53-dependent transcriptional activation after DNA damage was determined by measuring rpr and Ark mRNA levels of wandering third-instar w1118, Dmp535A-1–4, DLPU26, DLPU32, and DLPU42 larvae without irradiation or 2 h after 4 krad x-ray irradiation (1 krad/min). To measure DLP and Ark transcript levels in flies overexpressing DLP P[hs-GAL4]/EP (2)2108, P[hs-GAL4]/EP (2)2193, P[hs-GAL4]/EP (2)2180, P[hs-GAL4]/P[UASDLP1.7kb], and P[hs-GAL4]/+ (control) adult females were heat-shocked for 60 min at 37 °C. 60 min after heat-shock RNA was isolated and used in Q-PCR. Total RNA was isolated with Qiagen RNeasy mini kit (Qiagen Inc., Valencia, CA) according to the manufacturer's instructions. First-strand cDNA was synthesized from 2 µg of total RNA with random hexamer primers using TaqMan Reverse Transcription Reagent (Applied Biosystems, Foster City, CA). PCR reactions were carried out in duplicates in an ABI Prism 7500 real-time PCR system. cDNAs corresponding 18S rRNA and rpr were amplified using TaqMan Universal PCR Master Mix while SYBR-Green PCR Master Mix (27) was used for the amplification of DLP and Ark cDNA. The sequence of primers and TaqMan probes were as follows: 18S forward: GCCAGCTAGCAATTGGGTGTA, 18S reverse: CCGGAGCCCAAAAAGCTT, 18S probe: TATGGCTCTCTCAGTCGCTTCCGGG, rpr forward: CCAGTTGTGTAATTCCGAACGA, rpr reverse: TCGCCTGATCGGGTATGTAGA, rpr probe: AAGAAAGATAAACCAATGGCAGTGGCA, Ark forward: TGTCGCCAATCAAGACTGAG, Ark reverse: CATCCAAGGCTACCCAAGTC, DLP forward: TCGCCTACGATGCCTTTAAC, DLP reverse: AGATCTTGCTCGAGGGCATA. mRNA expression levels were evaluated by comparing to appropriate control samples after normalization with 18S RNA levels.
In Situ Hybridization—Whole mount in situ hybridization was performed using digoxigenin-labeled, hydrolyzed antisense RNA probes following the manufacturer's recommendations (Roche Applied Science). Probes were prepared from the full-length DLP cDNA clone SD20887 (28) received through the Drosophila Genomics Resource Center. Hybridization and pre- and post-hybridization washes were done at 55 °C, RNA hybrids were detected with anti-digoxigenin-AP antibody followed by NBT/BCIP staining.
Drosophila Stocks and Crosses—Fly stocks were maintained at 25 °C on standard cornmeal-yeast-agar Drosophila medium. The Dmp535A-1–4 line (29) was a generous gift from Yikang S. Rong (National Institutes of Health, Bethesda, MD). The P[UASp53] strain was a kind gift from Michael W. Young (5). The RS-element insertion lines UM-8182-3 and CB-6241-3 (30), the EP insertion lines EP (2)2108, EP (2)2193, and EP (2)2180 were kindly provided by the Szeged Drosophila Stock Centre. The RNAi strains 29374 and 29377 were obtained from Vienna Drosophila RNAi Center. P[act-GAL4] strain (BL-3954) and other stocks were obtained from the Bloomington Drosophila Stock Center. The P[ey-GAL4] strain was kindly provided by J. Mihaly (BRC, Szeged, Hungary).
To generate new DLP alleles the RS elements in the viable insertion lines UM-8182-3 and CB-6241-3 were remobilized using the TM3, ryRK Sb1 Ser1 P(
2-3)99B transposase source. Excision lines were identified based on the loss of the miniwhite marker gene and stocks were established using the y+CyO balancer chromosome. From each homozygous line genomic DNA was prepared, and PCR reactions were performed with primer pairs amplifying sequences upstream and downstream of the insertion site. (Sequences of primers are available upon request.) Deletion lines were selected on the basis of loss of the PCR products. The sizes of deletions were determined by further PCR reactions and in some selected cases molecular break-points were determined by sequencing. In addition to the deletions, precise excision lines (PE) in which precise jumpout of the P element restored the structure of DLP, were also identified by PCR analysis. Lethal mutations were transferred over a Cy-GFP balancer chromosome, the presence of deletions inspected in GFP-negative embryos as described above and allelism tested by complementation analysis. To measure the reduction of viability after ionizing radiation wandering third-instar w1118, p535A-1–4, DLPU26, DLPU32, and DLPU42 larvae were exposed to 2 krad (1 krad/min) x-ray irradiation and transferred into fresh vials, 20 larvae/vial. The number of pupae and eclosed adults were recorded and viability expressed in the percent of the number of irradiated larvae. At least six independent experiments were performed for each genotype. For the longevity assay freshly eclosed males in groups of 20 were put into vials, and the number of survivors was counted daily. For the fertility assay five 48-h-old females with 2 males were put into a vial, and the number of eggs laid in a 24-h period was recorded for 7 days in five independent experiments of each genotype. To observe the effect of DLP mutation on the phenotype resulting from Dmp53 overexpression we performed the following crosses: DLPU26;P[UASp53]/T (2, 3) TSTL, Cy; Tb Hu females were mated to DLPU26; P[act-GAL4]/TSTL males, and DLPU26; P[UASp53]/TSTL females were crossed with PE; P[act-GAL4]/TSTL males as a control. The DLPU26/DLPU26; P[UASp53]/ P[act-GAL4], and DLPU26/PE; P[UASp53]/P[act-GAL4] animals were selected based on the Tb+ phenotype. Three independent experiments were performed and the number of animals reaching specific developmental stages was recorded. Similar experiments were carried out using the eye-specific eyeless-GAL4 driver. For this the crosses were: DLPU26; P[ey-GAL4] females x DLPU26; P[UASp53]/TSTL males and DLPU26; P[ey-GAL4] females x PE; P[UASp53]/TSTL males as a control. The DLPU26/DLPU26; P[UASp53]/P[ey-GAL4], and DLPU26/PE; P[UASp53]/P[ey-GAL4] animals were selected based on the Tb+ phenotype. The largest diameters of the eyes of adult flies (20 in each groups in three parallels) were determined after photography. In loss-of-heterozygosity (LOH) assay DLPU26/DLPU26; mwh Dmp535A-1–4/++, and PE/DLPU26; mwh Dmp535A-1–4/++ (control) late-third-instar (wandering) larvae were x-ray-irradiated with 250 rad (150 kV; 0.5-mm Al filter; 1,000 rad/min). Wings were dissected after eclosion, mounted in 1:1 methyl salicylate/Canada balsam (Sigma) and the number of mwh clones determined. Both genetic combinations were tested in four independent experiments, each involving 8–20 wings.
| RESULTS |
|---|
|
|
|---|
N) as bait. (Fig. 1A) Sequence analysis identified one of the positive clones as a partial cDNA of the Daxx-like protein gene (CG9537). The 810-bp long clone encodes the last 135 amino acids (1524–1659) of DLP indicating that the C-terminal part of the protein mediates the interaction with Dmp53. GST pull-down experiment validated the specific interaction of Dmp53 and the DLP C-terminal region encoded by the cDNA recovered in the Y2H screen (Fig. 1C).
To determine which region of Dmp53 is necessary for DLP interaction, we fused various segments of Dmp53 to lexA and tested for interaction with the identified DLP clone in Y2H experiments. These experiments revealed that the DNA binding domain of Dmp53 (Dmp53
N
C) did not, but the C-terminal part of Dmp53 (Dmp53C) showed strong interaction with DLP (Fig. 1, A and B). When we asked whether either of the two functionally distinguishable C-terminal regions alone are able to bind DLP we found that neither the oligomerization domain (Dmp53C1), nor the basic regulatory domain (Dmp53C2) alone showed interaction (Fig. 1, A and B). Consequently, the entire C-terminal region of Dmp53, containing both the oligomerization and the basic regulatory domain, is necessary and sufficient to mediate DLP binding. These results indicate that, similarly to the interaction of p53 and Daxx (22), the C-terminal region of Dmp53 is responsible for DLP binding.
The similar regions of p53 and Dmp53 involved in Daxx and DLP interaction, respectively, prompted us to test whether DLP can bind human p53. Surprisingly, in Y2H assay we detected strong interaction between the C-terminal region of DLP and human p53 (Fig. 1D). Thus, although the human and fly p53 orthologs have low sequence similarity, the protein features necessary for Daxx/DLP binding are evolutionarily conserved.
Daxx-like Proteins Are Conserved in the Drosophila Genus—The DLP gene has a coding capacity for a putative protein of 1659 amino acids, which shows partial similarity to its 740-residue-long human ortholog, Daxx. Comparison of the two proteins revealed that they share 27% sequence identity and 46% similarity in the Daxx-homology region (residues 1125–1472 of DLP), a region conserved in all known Daxx homologs (Fig. 2A). The Dmp53 interacting region of DLP shows 51% similarity to the part of Daxx reported to mediate p53 binding in vitro (22). Beside the regions mentioned above, DLP bears N-terminal glutamine-, proline-, and alanine-rich regions, which seem to be specific for the Drosophila Daxx homolog. Identifiable DLP-like proteins in members of the Drosophila genus are highly homologous in their Daxx homology regions and share significant sequence similarities outside this domain (Fig. 2A).
|
DLP Is Developmentally Regulated but Is Not Required for Normal Development—To determine whether loss of DLP has any effect on Drosophila development we crossed homozygous DLPU26, DLPU32, and DLPU42 females to heterozygous males and determined the ratio of homozygous and heterozygous offsprings. No significant differences were found in any allele (data not shown), proving that DLP is not essential for execution of the developmental program. Lines expressing DLP siRNA obtained from the VDRC (Vienna Drosophila RNAi Center) collection are also viable and develop normally (data not shown). Therefore, we decided to determine whether DLP is expressed during development or it is silenced under normal circumstances. To measure DLP expression we performed quantitative real-time RT-PCR (Q-PCR) analysis on wild-type developmental series and performed in situ hybridization using DLP-specific probe (Fig. 3). We found that DLP is expressed in all developmental stages. Higher level of expression was detected at the end of the third larval stage, in adult females and in early embryos containing maternally deposited transcripts (Fig. 3A). Zygotic expression of DLP starts at the time of gastrulation after a nearly complete exhaustion of maternally deposited message by cellular blastoderm stage. At later stages of development, specific expression can be detected in tissues containing mitotic cells such as in the brain hemispheres and imaginal discs (Fig. 3, B–F). Thus, unlike murine Daxx, whose loss results in early embryonic lethality (19), DLP mutations do not interfere with the normal developmental program, even though DLP is expressed through development.
|
Next we asked whether DLP modulates genomic stability, by measuring loss of heterozygosity (LOH) provoked by low dose x-ray irradiation. Since the occurrence of mwh phenotype following x-ray irradiation reflects Dmp53 function, as low and high number of mwh clones indicate the presence of functional Dmp53 and the lack of Dmp53 function, respectively (see supplemental Fig. S1), we performed the LOH assays in a sensitized Dmp53/+ background. Late third-instar DLPU26/DLPU26 or PE/DLPU26 (control) larvae heterozygous for Dmp535A-1–4 and mwh mutations were irradiated with a low-level x-ray dose (250 rad). Cells that lost the wild-type copy of mwh display the recessive mwh phenotype, which is easily recognizable and can be scored on the wings (8). The number of mwh clones obtained following x-ray treatment in the DLPU26/DLPU26 was significantly reduced (68%) compared with the control (Fig. 4B).
|
|
We found no differences in reaper mRNA levels (Fig. 5A). However, the Ark mRNA level was significantly decreased in Dmp535A-1–4 and also in DLP larvae (p = 0.003, repeated measures ANOVA; Fig. 5B) suggesting that both Dmp53 and DLP participate in the maintenance of the basal mRNA level of Ark. Next we sought to determine if loss of DLP abolishes Dmp53-dependent transcriptional activation upon radiation-induced DNA damage. We irradiated wild type, Dmp535A-1–4 mutant, and DLP mutant larvae with 4 krad x-ray and after 2-h recovery Ark and reaper mRNA levels were measured by Q-PCR. Ark mRNA level did not increase significantly after irradiation (Fig. 5B). Reaper expression was up-regulated in wild-type larvae, while its transcript level did not change significantly in Dmp53 mutant animals, as expected. In DLP mutants, similarly to the wild-type control, reaper mRNA levels were elevated suggesting that DLP is not required for Dmp53-dependent transcriptional activation at the reaper locus (Fig. 5A). Because these data indicated the involvement of DLP in the regulation of Ark we wondered whether ectopic overexpression of DLP has any effect on the Ark mRNA level. Up-regulation of DLP expression was achieved by either a hs-GAL4-driven ubiquitous expression of a DLP transgene that carries the Daxx homologous region of DLP, or by ectopic expression of the chromosomal DLP gene from a promoter present in an inserted EP transposon (EP (2)2108). DLP overexpression from either transgene resulted in an increase in Ark mRNA level (Fig. 5C). We did not observe an increased level of Ark message in those EP element carrier lines in which the transcription from the transposon promoter runs opposite to the DLP transcription unit (EP (2)2193 and EP (2)2180). Our experimental system did not permit a detailed analysis of the effect of DLP overexpression on the extent of Ark message induction since the variability in the DLP level achieved by its overexpression via the hs driver. However, in parallel experiments the overexpression of Dmp53 and DLP under the control of the same UAS-GAL4 driver combinations resulted in similar levels of Ark RNA, and no synergistic effect was observed upon co-expression of Dmp53 and DLP (see supplemental Fig. S2).
|
|
| DISCUSSION |
|---|
|
|
|---|
Mammalian cell culture experiments provided evidence that Daxx regulates p53 function by modulating its transactivating activity, although the results gained from these experimental systems are often contradictory. Daxx was found to inhibit the activity of p53-responsive reporter constructs directed by the synthetic G5p53 element, the p21WAF1 promoter (23, 24) or the Mdm2 promoter (22). On the other hand, Daxx stimulated p53-dependent transcription from the Bax and PUMA promoters (22) and from a p53-responsive sequence derived from the Mdm2 promoter (32).
To investigate whether DLP is required for Dmp53 functions in Drosophila, we generated mutant alleles of DLP carrying internal deletion in the gene. DLP mutants are homozygous viable and show a decrease in longevity and fertility similarly to mutants of other factors involved in apoptotic response, e.g. Dmp53 (7). We measured reaper transcript levels after x-ray irradiation in DLP mutant and wild-type larvae to determine whether DLP modulates Dmp53-dependent transcriptional activation after DNA damage. We did not find significant changes in rpr activation suggesting that DLP is not required for the Dmp53 activated transcriptional response at the rpr enhancer. In concert with the lack of influence on rpr activation, DLP mutants did not show a radiosensitive phenotype. However, we found that loss of either Dmp53 or DLP reduced the basal level of Ark mRNA suggesting that both proteins are required for the maintenance of the basal activity of some proapoptotic genes. We observed genetic interaction between Dmp53 and DLP, as phenotypes resulting from ectopic overexpression of Dmp53 were enhanced in the DLP mutant background, and in LOH assays the number of clones indicating failure in repair following DNA damage and/or failure in the elimination of damaged cells was lower in DLP mutants. These data suggest a suppressing effect of DLP in some Dmp53-mediated functions. At first, this might seem surprising in the light that the expression of reaper, one of the major proapoptotic targets of Dmp53, is not influenced by DLP. However, apoptosis occuring independently of reaper activation has been observed in the Drosophila system at several cases. Thus, our in vivo data together with the observed mRNA levels, suggest that DLP is involved in a Dmp53-mediated apoptosis pathway different from those including reaper. Dmp53 mutations are known to affect longevity. We observed a similar effect of DLP mutations in repeated experiments comparing the lifespan of DLP mutant combinations to different controls, among them isogenic lines. However, from our data, we cannot determine whether the effect of DLP on lifespan is dependent on its interaction with Dmp53. We note here, that in this respect Dmp53 and p53 seem to behave partly differently because in Drosophila the loss of Dmp53 results in a reduced lifespan while in mice overproduction of a short isoform of p53 accelerates aging (7, 11).
Several distinguishing features of the p53 regulatory networks should be taken into consideration if one would like to explain the differences found between the mammalian and insect systems. The regulation of mammalian p53 is based on its interaction with the repressor protein MDM2. As MDM2 does not have a Drosophila homolog, this control mechanism seems to be a new evolutionary invention and might have fundamental effect on other interactions p53 involved in. Similarly to MDM2, promyelocytic leukemia protein (PML), a critical component of the PML nuclear bodies (PODs), have not been identified in flies. Both Daxx (17) and p53 (33) are recruited to PODs where PML3 relieves p53 from Daxx-mediated repression by competing with Daxx for p53 binding (23). Finally, based on the analyses of predicted protein sequences from five Drosophila species we found that DLP proteins also share conserved sequences outside the Daxx homology region. Although these regions do not contain any described functional domains, they may influence the interactions DLP proteins are involved in.
| FOOTNOTES |
|---|
The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1–S3. ![]()
1 Recipient of the Z. Magyary fellowship from the Foundation for Hungarian Higher Education and Research and the G. Bekesy fellowship provided by the Hungarian Ministry of Education. Present address: BayGen Inst., Bay Zoltan Foundation for Applied Research, Szeged, Hungary. ![]()
2 To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, University of Szeged, Közép fasor 52, H-6726 Szeged, Hungary. Tel.: 36-62-544686; Fax: 36-62-544887; E-mail: borosi{at}bio.u-szeged.hu.
3 The abbreviations used are: DLP, Daxx-like protein; ANOVA, analysis of variance; GST, glutathione S-transferase; Ark, Apaf-1-related-killer; LOH, loss-of-heterozygosity. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
F. Mauri, L. M. McNamee, A. Lunardi, F. Chiacchiera, G. Del Sal, M. H. Brodsky, and L. Collavin Modification of Drosophila p53 by SUMO Modulates Its Transactivation and Pro-apoptotic Functions J. Biol. Chem., July 25, 2008; 283(30): 20848 - 20856. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |