Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M705815200 on October 17, 2007

J. Biol. Chem., Vol. 282, Issue 51, 37146-37157, December 21, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/51/37146    most recent
M705815200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Puca, A.
Right arrow Articles by Quinto, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Puca, A.
Right arrow Articles by Quinto, I.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

I{kappa}B-{alpha} Represses the Transcriptional Activity of the HIV-1 Tat Transactivator by Promoting Its Nuclear Export*Formula

Antimina Puca{ddagger}1, Giuseppe Fiume{ddagger}1, Camillo Palmieri§, Francesca Trimboli§, Francesco Olimpico{ddagger}, Giuseppe Scala{ddagger}§, and Ileana Quinto{ddagger}§2

From the {ddagger}Department of Biochemistry and Medical Biotechnology, University of Naples "Federico II", 80131 Naples, Italy and the §Department of Experimental and Clinical Medicine, University of Catanzaro "Magna Graecia," 88100 Catanzaro, Italy

Received for publication, July 16, 2007 , and in revised form, October 10, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The long terminal repeat of human immunodeficiency virus, type 1 (HIV-1) contains an NF-{kappa}B enhancer and is potently inhibited by I{kappa}B-{alpha}S32/36A, a proteolysis-resistant inhibitor of NF-{kappa}B transacting factors. The evidence that NF-{kappa}B is dispensable for HIV-1 expression raises the question of whether I{kappa}B-{alpha} represses the HIV-1 transcription by mechanisms distinct from NF-{kappa}B inhibition. Here, we report that I{kappa}B-{alpha} negatively regulates the HIV-1 expression and replication in an NF-{kappa}B-independent manner by directly binding to Tat, which results in the nuclear export and cytoplasmic sequestration of the viral transactivator. The sequence of I{kappa}B-{alpha} required for Tat inhibition spans from amino acids 72 to 287 and includes the nuclear localization signal, the carboxyl-terminal nuclear export signal, and the binding site for the arginine-rich domain of Tat. This novel mechanism of cross-talk between Tat and I{kappa}B-{alpha} provides further insights into the mechanisms of HIV-1 regulation and could assist in the development of novel strategies for AIDS therapy.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The expression of HIV-13 is dependent on the RNA polymerase II complex and is regulated by cellular transacting factors that interact with the viral promoter (1). The HIV-1 LTR contains a basal promoter (nucleotides -78 to -1) with a TATAA box and three Sp1-binding sites, an enhancer (nucleotides -105 to -79) with two tandem {kappa}B sites, and a negative regulatory region (nucleotides -454 to -106) (2). The HIV-1 encoded Tat protein dramatically increases the viral gene expression by binding to the transactivation-responsive region at the 5' leader HIV-1 RNA (nucleotides +1to +59) (3) and promoting transcription initiation (4). In particular, Tat promotes the assembly of the preinitiation complex and nucleosomal remodeling through the interaction with several transcription factors and cofactors including TBP (5, 6), NF-{kappa}B (7), Sp1 (8), and the histone acetyltransferases p300/CBP and P/CAF (9-11). In addition, Tat recruits the cyclin T1/CDK9 complex, which hyperphosphorylates the carboxyl-terminal domain of the large subunit of RNA polymerase II, resulting in processive transcription (12-15).

The NF-{kappa}B transacting factors enhance the HIV-1 transcription by binding to the {kappa}B sites of the HIV-1 LTR (16, 17). The NF-{kappa}B proteins, namely p105/p50, p100/52, p65/RelA, c-Rel, and RelB, share a Rel homology domain that is required for subunit dimerization, nuclear localization, and DNA binding (18, 19). The NF-{kappa}B transcriptional activity is negatively regulated through the association with the I{kappa}B proteins (20). I{kappa}B-{alpha} (21), the best characterized and ubiquitous member of the I{kappa}B family, contains six ankyrins, a nuclear localization signal (NLS) (22-24), and two nuclear export signals located at the amino terminus (N-NES) (25-28) and carboxyl terminus (C-NES) (29, 30). In unstimulated cells, I{kappa}B-{alpha} associates with the p50/p65 NF-{kappa}B complex and inhibits the DNA binding and transcriptional activity of NF-{kappa}B (18, 20). The I{kappa}B-{alpha}/NF-{kappa}B complex shuttles in and out of the nucleus and is prevalently retained in the cytoplasm (25-27, 31). Upon NF-{kappa}B-activating stimuli, I{kappa}B-{alpha} is phosphorylated at serines 32 and 36 by the I{kappa}B kinase complex, ubiquitinated at lysines 21 and 22, and proteolyzed by the 26 S proteasome (18, 20). Following the proteolysis of I{kappa}B-{alpha}, the free NF-{kappa}B complex translocates to the nucleus, where it binds to the {kappa}B sites and activates the transcription of the NF-{kappa}B-dependent genes, including the I{kappa}B-{alpha} gene (18, 20). The newly synthesized I{kappa}B-{alpha} migrates to the nucleus, where it displaces the NF-{kappa}B complex from DNA and promotes its nuclear export, thus terminating the NF-{kappa}B transcriptional activity (29, 31, 32).

I{kappa}B-{alpha} represses the Tat-mediated transactivation of the HIV-1 LTR upon cell transfection (33). Moreover, the mutant I{kappa}B-{alpha}S32/36A, which is resistant to the signaling-induced proteolysis (34, 35), inhibits the expression of HIV-1 (36). Consistent with these findings, we showed that NL-I{kappa}B-M, a recombinant HIV-1 strain expressing the I{kappa}B-{alpha}S32/36A gene integrated in the nef region, is strongly repressed at the transcriptional level and highly attenuated (37). In that study, the inhibition of HIV-1 by I{kappa}B-{alpha}S32/36A was ascribed to the repression of the NF-{kappa}B-dependent expression of HIV-1. However, this mechanism accounts partially for the HIV-1 transcriptional inhibition because viral strains lacking the NF-{kappa}B enhancer are competent for transcription and replication (38-40). The evidence that NF-{kappa}B is dispensable for the transcriptional activation of HIV-1 raises the question of whether I{kappa}B-{alpha} represses other transcription factors, which differ from NF-{kappa}B and are required for HIV-1 expression. To test this possibility, we have analyzed the functional and physical interactions of I{kappa}B-{alpha} with the HIV-1 Tat transactivator, which is indispensable for viral replication (41, 42). Here, we report that I{kappa}B-{alpha} binds to Tat and promotes its nuclear export to the cytoplasm. According to this novel evidence, I{kappa}B-{alpha} acts as a potent repressor of HIV-1 transcription by inhibiting both the NF-{kappa}B and Tat transacting factors, which are major players in the transcriptional activation and elongation of HIV-1 transcripts.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmids—pLTRluc contains the U3 and R regions of the pNL4-3 molecular clone of HIV-1 upstream of the luciferase gene (37). pSV-β-gal was purchased from Promega. To generate p3XFLAG-CMV-Tat, p3XFLAG-CMV-Tat C(22,25,27)A, and p3XFLAG-CMV-Tat R(49-57)A, the sequence of Tat was amplified from the pGEX-2T-Tat expressing vectors (43) and ligated to EcoRI/XbaI-digested p3XFLAG-CMV-7.1 (Sigma). pRc/CMV-HA-I{kappa}B-{alpha}S32/36A was previously described (44). The plasmids expressing the I{kappa}B-{alpha} mutants 120 -317, 1-280, 1-269, 1-242, 72-287, and 72-269 were generated by PCR-mediated amplification of the I{kappa}B-{alpha} sequence from pCMV4-HA-I{kappa}B-{alpha} with appropriate forward and reverse primers followed by ligation to the HindIII/XbaI-digested pCMV4-HA. The mutant I{kappa}B-{alpha} 72-287 L(272,274,277)A was generated by site-directed mutagenesis of the I{kappa}B-{alpha} 72-287 sequence using the forward primer ATACAGCAGCAGCTGGGCCAGGCGACAGCAGAAAACGCGCAGATGCTGCCAGAGA and reverse primer CTGGCCCAGCTGCTGCTGTATCCGGGTGCTTGGGCGGCC with the mutated triplets indicated in bold type. The mutant I{kappa}B-{alpha} N/C NES was generated by site-directed mutagenesis of I{kappa}B-{alpha} 1-317 at the level of the N-NES with the forward primer AAGGAGCTGCAG GAG GCG CGC GCG GAG CCG CAG GAG GTG and reverse primer CTCCTGCAGCTCCTTGACCATGGAGTCCA, and at the level of C-NES with the same primers described for I{kappa}B-{alpha} 72-287 L(272,274,277)A. The mutated nucleotides are shown in bold type. The pGEX-2T-I{kappa}B-{alpha} plasmids were generated by PCR-mediated amplification of the I{kappa}B-{alpha} sequences from the plasmid pCMV4-HA-I{kappa}B-{alpha} followed by ligation to BamHI/EcoRI-digested pGEX-2T (Amersham Biosciences). The pcDNA3 plasmids expressing the I{kappa}B-{alpha} mutants under the T7 promoter were generated by PCR amplification of the I{kappa}B-{alpha} genes from the pCMV4-HA-I{kappa}B-{alpha} plasmids followed by ligation to KpnI/XbaI-digested pcDNA3 (Invitrogen). All of the constructs were verified by automated DNA sequencing. To generate the NF-{kappa}B-deleted pNL4-3.Luc.R-E-, the XhoI/HindIII fragment of pNL4-3.Luc.R-E, which contains the 3' LTR, was replaced with the corresponding fragment from the NF-{kappa}B-deleted pLTRluc. To generate pNL-{Delta}{kappa}B-I{kappa}B-M and pNL-{Delta}{kappa}B-I{kappa}B-as, the viral plasmids pNL-I{kappa}B-M and pNL-I{kappa}B-as (37) were digested with NaeI to isolate the 2.35- and 1.61-kb fragments, which contain the viral sequence from the unique NaeI site within the I{kappa}B-{alpha}S32/36A-FLAG insert in the nef region in sense or antisense orientation, respectively, to the unique NaeI site of pNL4-3 (10,346 nucleotides) in the flanking region downstream to the 3' LTR. The DNA fragments were ligated to the NaeI site of pBlueScript K+ (Stratagene) to generate pBSK-I{kappa}B-M and pBSK-I{kappa}B-as, respectively. The two tandem {kappa}B sites within the 3' LTR of pBSK-I{kappa}B-M and pBSK-I{kappa}B-as were deleted by site-directed mutagenesis using the forward primer FNLDKB CGAGCTTGCTACAAGGGATCTAGATCCAGGGAGGCGTGGCCTGGGC and the reverse primer RNLDKB TCCTTGTAGCAAGCTCGATGTCAGCAGTTCTTGAAGTAC to generate pBSK-{Delta}{kappa}B-I{kappa}B-M and pBSK-{Delta}{kappa}B-I{kappa}B-as, respectively. The mutated sequence of {kappa}B sites is shown in bold type in the forward primer. The viral plasmids pNL-{Delta}{kappa}B-I{kappa}B-M and pNL-{Delta}{kappa}B-I{kappa}B-as were generated by replacement of the NaeI-digested 2.35- and 1.61-kb DNA fragments with the corresponding region from pBSK-{Delta}{kappa}B-I{kappa}B-M and pBSK-{Delta}{kappa}B-I{kappa}B-as, respectively.

Cell Culture, Transfection, and Luciferase Assay—HeLa and MEFs were cultured in Dulbecco's modified Eagle's medium (Invitrogen), Jurkat cells in RPMI (Invitrogen). The culture media were supplemented with 10% heat-inactivated fetal calf serum and 2 mM L-glutamine at 5% CO2 and 37 °C. The cells were transfected with DNA by using FuGENE 6 (Roche Applied Science), and the total amounts of DNA were equalized by transfection of pRc/CMV empty vector (Invitrogen). For luciferase assays, pSV-β-gal plasmid (0.2 µg) was co-transfected with the pLTRluc plasmids to monitor the transfection efficiency. Forty-eight hours post-transfection, the cells were lysed in lysis buffer of Dual Light Luciferase System (Tropix, Bedford, MA). The luciferase and β-galactosidase activities were evaluated by using the Dual Light luciferase system (Tropix, Bedford, MA) in a bioluminometer (Turner Biosystem, Sunnyvale, CA). The ratio of firefly luciferase activity to β-galactosidase activity was expressed as relative light units.

Pseudotyped Virions and Single-round Infection—293-T cells were transfected with wild type or NF-{kappa}B-deleted pNL4-3.Luc.R-E- (10 µg) and pVSV.G (10 µg) expressing the G protein of the vescicular stomatitis virus. Forty-eight hours post-transfection, the cell supernatants were collected, and the virions were measured by p24 enzyme-linked immunosorbent assay. Jurkat cells (4 x 106) were transfected by electroporation with pCMV4-HA-I{kappa}B-{alpha} or empty vector (30 µg) or with I{kappa}B-{alpha} siRNA or control siRNA (500 pmol) (Dharmacon, Lafayette, CO) and 48 h later were infected with VSV-Luc virions (500 ng of p24) by spinoculation (45). The luciferase activity was measured in cell extracts 48 h post-infection.

Viral Integration—Genomic DNA was extracted from aliquots of infected cells (2 x 106) using TRIzol (Invitrogen) and amplified with primers that annealed in the U5 region of the LTR (MH 531) and in the 5' end of the gag gene (MH 532). The reaction mixture (25 µl) contained genomic DNA (200 ng), primers (600 nM), and 1x iQ SYBR Green Supermix (Bio-Rad). Real time PCR was performed by using iCycler Apparatus (Bio-Rad). After an initial denaturation step (95 °C for 8 min), the cycling profile for total HIV-1 DNA was 50 cycles consisting of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 6 s. Viral DNA was normalized to cellular genomic glyceraldehyde-3-phosphate dehydrogenase. Primers were as follows: MH531, TGTGTGCCCGTCTGTTGTGT; MH532, GAGTCCTGCGTCGAGAGAGC; glyceraldehyde-3-phosphate dehydrogenase forward, GAAGGTGAAGGTCGGAGTC; and glyceraldehyde-3-phosphate dehydrogenase reverse, GAAGATGGTGATGGGATTTC. The HIV-1 DNA copy number was measured as reported (46).


Figure 1
View larger version (13K):
[in this window]
[in a new window]

 
FIGURE 1.
I{kappa}B-{alpha} inhibits the transactivation of HIV-1 LTR by Tat independently of the NF-{kappa}B repression. A, HeLa cells (3 x 105) were transfected with pLTRluc wild type or deleted of the NF-{kappa}B or Sp1 sites (0.5 µg). Luciferase activity was measured 48 h post-transfection. The mean values ± S.E. (n = 4) are shown. B-D, HeLa cells (3 x 105) were transfected with pLTRluc wild type (B) or deleted of NF-{kappa}B (C) or Sp1 (D) sites (0.5 µg) in presence or absence of p3XFLAG-CMV-Tat (0.5 µg) and pCMV4-HA-I{kappa}B-{alpha} (0.5, 1, and 2 µg). The luciferase activity was measured 48 h post-transfection. Fold activation was calculated relative to transfection in the absence of Tat and I{kappa}B-{alpha} expression plasmids. The mean values ± S.E. (n = 4) are shown. For NF-{kappa}B-deleted LTR, the asterisks indicate a statistically significant inhibition according to Student's t test (*, p = 0.01; **, p = 0.002; ***, p = 0.0007).

 
Viral Stocks and Cell Culture Infection—293-T cells were transfected with viral plasmids, and the viral production was measured by p24 enzyme-linked immunosorbent assay. Jurkat cells (5 x 104 cells) were infected with p24 (0.3 ng) of viral stocks, and the cell supernatants were collected every 3 days for p24 assay; equal volumes of fresh medium were replaced into the cultures at the same time.

Statistical Analysis—The data were reported as the means ± S.E. and the statistical significance of differences between means was assessed by using the two-tail unpaired Student's t test. The differences between the means were accepted as statistically significant at the 95% level (p = 0.05).

Cell Extracts and Western Blotting—Cells (5 x 106) were harvested, washed in cold PBS, and lysed on ice in 500 µl of lysis buffer containing 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% sodium deoxycholate, 0.2% SDS, 2 mM EDTA, 1% Triton X-100, 5mM DTT, 1x protease inhibitor mixture EDTA-free (Roche Applied Science). After centrifugation at 15,000 x g for 15 min at 4 °C, the supernatant was collected, and aliquots of proteins were resuspended in loading buffer (125 mM Tris-HCl, pH 6.8, 5% SDS, 1% bromphenol blue, 10% β-mercaptoethanol, 25% glycerol), resolved on 10% SDS-PAGE, transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA), and incubated with primary antibodies (1:1000) followed by incubation with horseradish-peroxidase-linked mouse or rabbit IgG (1:2000) (Amersham Biosciences) in PBS containing 5% nonfat dry milk (Bio-Rad). The proteins were detected by chemiluminescence using the Amersham Biosciences ECL system. The primary antibodies were as follows: anti-HA (F7), anti-GST (B-14), anti-I{kappa}B-{alpha} (C-15), and normal mouse serum from Santa Cruz Biotechnology (Santa Cruz, CA); anti-FLAG M2 and anti-{gamma}-tubulin from Sigma-Aldrich; anti-caspase-3 and cleaved poly(ADP-ribose)polymerase (Asp214) antibody from Cell Signaling Technology, Inc. (Danvers, MA).

GST Pulldown—GST fusion proteins were produced in Escherichia coli strain BL21 as previously described (43). Bacterial cultures (500 ml) were grown to exponential phase and induced with 0.25 mM isopropyl-β-D-thiogalactopyranoside (Sigma-Aldrich) for 3 h to express GST fusion proteins. The bacteria were lysed by sonication in buffer A (1x PBS, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, and 1x protease inhibitor mixture EDTA-free), and the lysate was clarified by centrifugation at 27,000 x g for 30 min at 4 °C. The supernatant was incubated with 1 ml of a 50% (v/v) slurry of glutathione-Sepharose beads (Amersham Biosciences) previously equilibrated in buffer A. After incubation on a rotating wheel at 4 °C for 2 h, the beads were washed five times with buffer A and subjected to a high salt wash (0.8 M NaCl) to free the fusion proteins from contaminating bacterial nucleic acids (47). GST fusion proteins were eluted with 500 µl of 50 mM Tris-HCl containing 10 mM glutathione and 1 mM DTT. The eluted GST fusion proteins were dialyzed against dialysis buffer (1x PBS, 1 mM DTT, 10% glycerol), and aliquots (5-10 µg) were conjugated with glutathione-Sepharose (20 µl) in 500 µl of binding buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% sodium deoxycholate, 0.2% SDS, 2 mM EDTA, 3% Triton X-100, 5 mM DTT, 1x protease inhibitor mixture EDTA-free). The GST fusion proteins conjugated with glutathione-Sepharose were collected by centrifugation at 700 x g for 5 min at 4 °C, and aliquots (5-10 µg) were incubated with cell extracts (200 µg) in 500 µl of binding buffer supplemented with 1 µg/µl of bovine serum albumin on a rocking platform for 3 h at 4 °C. To remove nucleic acids, the cell extracts were treated with micrococcal nuclease (0,2 unit/µl) for 30 min at 28 °C. Protein complexes were collected by centrifugation at 700 x g for 5 min at 4 °C, washed in binding buffer, and resuspended in loading buffer (125 mM Tris-HCl, pH 6.8, 5% SDS, 1% bromphenol blue, 10% β-mercaptoethanol, 25% glycerol). The proteins were resolved on 10% SDS-PAGE, transferred to polyvinylidene difluoride membranes, and analyzed by immunoblotting with the indicated antibodies. The pcDNA3 plasmids expressing the I{kappa}B genes under the T7 promoter were used as templates to translate in vitro the [35S]methionine-labeled I{kappa}B proteins by using the TNT Quick Coupled transcription/translation systems (Promega). Aliquots (10 µl) of translation mixture were incubated with GST-Tat or GST proteins (10 µg) in 500 µl of binding buffer supplemented with 1 µg/µl of bovine serum albumin on a rocking platform for 3 h at room temperature. Following GST pulldown, the proteins were separated by 12% SDS-PAGE and analyzed by autoradiography and immunoblotting with antibodies.


Figure 2
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 2.
I{kappa}B-{alpha} inhibits the expression and replication of NF-{kappa}B-deleted viruses. A, p50-/- p65-/- MEFs (3 x 105) were transfected with the NF-{kappa}B-deleted pLTRluc (0.5 µg), with or without p3XFLAG-CMV-Tat (0.5 µg), pRc/CMV-HA-hCycT1 (0.5 µg), and pCMV4-HA-I{kappa}B-{alpha} (0.5, 1, and 2 µg). The luciferase activity was measured 48 h post-transfection. Fold activation was calculated relative to transfection in the absence of Tat, hCycT1, and I{kappa}B-{alpha} expression plasmids. The mean values ± S.E. (n = 4) are shown. The asterisks indicate a statistically significant inhibition according to Student's t test (without hCycT1: *, p = 0.008; **, p = 0.0009; ***, p = 0.0002; with hCycT1: *, p = 0.006; **, p = 0.001; ***, p = 0.0001). B, Jurkat cells (4 x 106) were electroporated with pCMV4-HA-I{kappa}B-{alpha} or empty vector (30 µg), I{kappa}B-{alpha} siRNA, or control siRNA (500 pmol) and infected with VSV-G-pseudotyped NL4-3.Luc.R-E- virions that carry the wild type LTR (left panel) or the NF-{kappa}B-deleted LTR (right panel) (500 ng of p24); virus production was monitored by measuring the luciferase activity in cell extracts 48 h post-infection (top). The expression level of I{kappa}B-{alpha} was detected in cell extracts by Western blotting with anti-I{kappa}B-{alpha} C-15 (bottom). C, schematic representation of the viral genome of NL-I{kappa}B-M and NL-I{kappa}B-as carrying the wild type LTR or NL-{Delta}{kappa}B-I{kappa}B-M and NL-{Delta}{kappa}B-I{kappa}B-as carrying the NF-{kappa}B-deleted LTR. D, Jurkat cells (5 x 104) were infected with equal amounts (0.3 ng of p24) of the wild type LTR viruses, NL-I{kappa}B-M and NL-I{kappa}B-as (left panel), or NF-{kappa}B-deleted LTR viruses, NL-{Delta}{kappa}B-I{kappa}B-M and NL-{Delta}{kappa}B-I{kappa}B-as (right panel). The viral production was measured as p24 level in culture supernatants.

 


Figure 3
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 3.
The sequence of I{kappa}B-{alpha} extending from amino acids 72 to 287 inhibits Tat. A, schematic representation of wild type I{kappa}B-{alpha}. B, p50-/- p65-/- MEFs (3 x 105) were transfected with the NF-{kappa}B-deleted LTRluc (0.5 µg) in presence or absence of p3XFLAG-CMV-Tat (0.5 µg), pRc/CMV-HA-hCycT1 (0.5 µg), and pCMV4-HA-I{kappa}B-{alpha} 1-317 or the indicated I{kappa}B-{alpha} mutants (2 µg); the luciferase activity was measured in cell extracts 48 h post-transfection. Fold activation was calculated relative to transfection in the absence of Tat, hCycT1, and I{kappa}B-{alpha} expression plasmids. The mean values ± S.E. (n = 7) are shown. The asterisks indicate a statistically significant inhibition according to Student's t test (I{kappa}B-{alpha} 1-317, p = 0.0017; I{kappa}B-{alpha} 1-287, p = 0.0001; I{kappa}B-{alpha} 1-280, p = 0.004; I{kappa}B-{alpha} 72-317, p = 0.0036; I{kappa}B-{alpha} 72-287, p = 0.0007). C, cell extracts (20 µg) of p50-/- p65-/- MEFs transfected with p3XFLAG-CMV-Tat and pCMV4-HA-I{kappa}B-{alpha} mutants as shown in B were analyzed by Western blotting (WB) for the expression of transfected genes.

 
Co-immunoprecipitation—Cell extracts were performed in PBS containing 1% Triton X-100 and 1x Protease Inhibitor Mixture EDTA-free. Antibodies (2.5 µg) were preincubated with protein G-Sepharose (Amersham Biosciences) (20 µl) in 50 µl of immunoprecipitation buffer (PBS containing 2% Triton X-100, 300 mM NaCl, 5 mM DTT, 1x Protease Inhibitor Mixture EDTA-free) overnight at 4 °C on a rocking platform. The protein G-Sepharose-coupled antibodies were incubated with cell extract (500 µg) in 500 µl of immunoprecipitation buffer overnight at 4 °C on a rocking platform. The immunocomplexes were collected by centrifugation at 700 x g for 5 min at 4 °C, washed in immunoprecipitation buffer, and resuspended in SDS gel loading buffer. The proteins were separated on 10% SDS-polyacrylamide gel, transferred to polyvinylidene difluoride membrane, and analyzed by immunoblotting with antibodies.

Confocal Microscopy—Confocal microscopy was performed as previously described (48). HeLa cells were seeded on poly-L-lysine-treated glass coverslips, fixed, and permeabilized using Cytofix/Cyto-Perm kit (BD Biosciences Pharmingen, San Diego, CA). To visualize FLAG-Tat and HA-I{kappa}B-{alpha}, the immunostaining was performed with anti-FLAG-M2-FITC mAb (F-4049; Sigma-Aldrich) and anti-HA rabbit antiserum (SC-805; Santa Cruz Biotechnologies) followed by goat anti-rabbit Alexa Fluor568 (A11011; Molecular Probes, Eugene, OR). The nuclei were stained with TO-PRO-3 iodide (T3605; Molecular Probes). The coverslips were mounted on glass slides by using ProLong Antifade Kit (P7481; Molecular Probes). The images were collected on a Leica TCS-SP2 confocal microscope (Leica Mycrosystems, Wetzlar, Germany) with a 63x Apo PLA oil immersion objective (NA 1.4) and 60-µm aperture. Z stacks of images were collected using a step increment of 0.2 µm between planes. FLAG-Tat was visualized by excitation with an argon laser at 488 nm and photomultiplier tube voltage of 420 mV. HA-I{kappa}B-{alpha} was detected using a krypton laser at 568 nm and photomultiplier tube voltage of 650 mV. The nuclei were detected using a krypton laser at 613 nm and photomultiplier tube voltage of 450 mV. Single optical sections using 4X averaging were acquired by sequential scanning to collect the images in three channels. For quantitative analysis of the nuclear and cytoplasmic protein levels, horizontal sections scanned through the nucleus and cytoplasm of thirty representative cells were evaluated. Fluorescence-based assessment of protein levels was performed by image analysis using the LEICA Scan TCS-SP2 software (Leica Mycrosystems). Quantization was performed on 8-bit gray scale images with no saturated pixels. The mean nuclear or cytoplasmic fluorescence was measured as the ratio between total fluorescence/total pixels at the nuclear or cytoplasmic level in individual cells. The relative nuclear or cytoplasmic fluorescence was calculated as the ratio between the mean nuclear or cytoplasmic fluorescence and the mean fluorescence of the whole cell (49).


Figure 4
View larger version (38K):
[in this window]
[in a new window]

 
FIGURE 4.
I{kappa}B-{alpha} binds to the arginine-rich domain of Tat. A, HeLa cells, MEFs and p50-/- p65-/- MEFs (1 x 106) were transfected with pCMV4-HA-I{kappa}B-{alpha} (5 µg), and cell extracts were incubated with GST-Tat or GST. Following GST pulldown, the protein complexes were analyzed by Western blotting (WB) with anti-HA and anti-GST antibodies. B, cell extracts (1 mg) from HeLa cells were incubated with GST-Tat or GST (50 µg). Following GST pulldown, the protein complexes were analyzed by Western blotting with anti-I{kappa}B-{alpha} (C-15) and anti-GST antibodies. C, HeLa cells (1 x 106) were transfected with pCMV4-HA-I{kappa}B-{alpha} (5 µg), and cell extracts (200 µg) were treated with micrococcal nuclease for 30 min at 28 °C or left untreated. The extracts were incubated with GST-Tat or GST; after GST pulldown the protein complexes were analyzed by Western blotting with anti-HA and anti-GST antibodies. D, schematic representation of wild type Tat and the mutants Tat C(22,25,27)A and Tat R(49-57)A. E, HeLa cells (1 x 106) were transfected with p3XFLAG-CMV-Tat, p3XFLAG-CMV-Tat R(49-57)A, or p3XFLAG-CMV-Tat C(22,25,27)A (5 µg). Forty-eight hours post-transfection the cell extracts were incubated with GST-I{kappa}B-{alpha} or GST conjugated with glutathione-Sepharose. The protein complexes were recovered by GST pulldown, separated by 10% SDS-PAGE, and analyzed by Western blotting with anti-FLAG and anti-GST antibodies. F, HeLa cells (1 x 106) were transfected with p3XFLAG-CMV-Tat, p3XFLAG-CMV-Tat R(49-57)A, or p3XFLAG-CMV-Tat C(22,25,27)A (5 µg) in presence or absence of pCMV4-HA-I{kappa}B-{alpha} (5 µg). The cell extracts were performed 48 h post-transfection and immunoprecipitated (IP) with anti-FLAG or normal mouse serum. The immunocomplexes were separated by 10% SDS-PAGE and analyzed by Western blotting with anti-HA and anti-FLAG antibodies.

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
I{kappa}B-{alpha} Represses the Tat-mediated Transactivation and Replication of HIV-1 Independently of NF-{kappa}B Activity—To determine the effect of I{kappa}B-{alpha} on the transcriptional activity of Tat, HeLa cells were transiently transfected with the luciferase gene under the control of the wild type or NF-{kappa}B- or Sp1-deleted HIV-1 LTR in the presence or absence of Tat and I{kappa}B-{alpha}. In agreement with previous observations (39), the deletion of the NF-{kappa}B or Sp1 sites significantly reduced the basal expression (Fig. 1A) and the Tat-mediated transactivation (Fig. 1, B-D) of the HIV-1 LTR. I{kappa}B-{alpha} inhibited the Tat transcriptional activity in a dose-dependent manner up to 80% for the wild type LTR (Fig. 1B) and 60% in the case of NF-{kappa}B-deleted LTR (Fig. 1C). The evidence that I{kappa}B-{alpha} inhibited the Tat-mediated transactivation of the LTR in the absence of the NF-{kappa}B enhancer underscored the existence of mechanisms of LTR inhibition distinct from NF-{kappa}B repression. I{kappa}B-{alpha} completely repressed the Tat-mediated transactivation of the Sp1-deleted LTR (Fig. 1D); this strong inhibition was likely caused by repression of both NF-{kappa}B-dependent and independent transactivation of the LTR. The LTR inhibition was not a consequence of pro-apoptotic activity of I{kappa}B-{alpha} because the cleavage of caspase-3 and poly(ADP-ribose)polymerase was undetected in I{kappa}B-{alpha}-transfected cells (supplemental Fig. S1).


Figure 5
View larger version (39K):
[in this window]
[in a new window]

 
FIGURE 5.
Tat binds to the sixth ankyrin of I{kappa}B-{alpha}. A, schematic representation of I{kappa}B-{alpha} proteins used for the GST-Tat pulldown. B, [35S]methionine-labeled I{kappa}B-{alpha} proteins were incubated with GST-Tat or GST. Following GST pulldown, the protein complexes were separated by 12% SDS-PAGE and analyzed by autoradiography (top panels) and by Western blotting with anti-GST antibody (bottom panels).

 
Next, we analyzed the effect of I{kappa}B-{alpha} on Tat in the absence of NF-{kappa}B activity. To this end, the expression of the NF-{kappa}B-deleted LTR was analyzed in MEFs lacking the p50 and p65 subunits of NF-{kappa}B (50-52). Because the murine cyclin T1 does not allow the generation of the P-TEFb/Tat/transactivation-responsive region complex for efficient transcriptional elongation (53), p50-/- p65-/- MEFs were transfected with or without the hCycT1. I{kappa}B-{alpha} significantly inhibited the Tat-mediated transactivation of the NF-{kappa}B-deleted LTR in a dose-dependent manner in presence or absence of hCycT1 (Fig. 2A), which rules out the possibility that I{kappa}B-{alpha} repressed the Tat activity by interaction with hCycT1.

Further, we analyzed the effect of I{kappa}B-{alpha} on the expression of the single-cycle replication virus NL4-3.Luc.R-E- carrying the wild type or NF-{kappa}B-deleted LTR. Jurkat cells were transfected with the proteolysis-resistant mutant I{kappa}B-{alpha}S32/36A or with I{kappa}B-{alpha} siRNA to up-regulate or down-regulate the intracellular levels of I{kappa}B-{alpha}, respectively. Transfected cells were infected with VSV-G-pseudotyped NL4-3.Luc.R-E- virions that carry the wild type or NF-{kappa}B-deleted LTR. The virion production was significantly reduced by hyperexpression of I{kappa}B-{alpha} and increased by knocking down the endogenous I{kappa}B-{alpha} with I{kappa}B-{alpha} siRNA in both infections with the wild type (Fig. 2B, left panel) or the NF-{kappa}B-deleted virus (Fig. 2B, right panel). No difference in the number of integrated virus among the different samples was observed (supplemental Fig.S2). These results suggest that the levels of endogenous I{kappa}B-{alpha} inversely affected the expression of the integrated HIV-1 genome independently of the presence of the NF-{kappa}B-binding sites in the HIV-1 LTR.

To analyze the effect of I{kappa}B-{alpha} on the HIV-1 replication in the absence of the NF-{kappa}B-binding sites of the HIV-1 LTR, we generated the viral plasmids pNL-{Delta}{kappa}B-I{kappa}B-M and pNL-{Delta}{kappa}B-I{kappa}B-as, which carry the I{kappa}B-{alpha}S32/36A-FLAG cDNA inserted into the nef region in sense or antisense orientation, respectively, and were deleted of the two tandem {kappa}B sites in the LTR (Fig. 2C). These recombinant HIV-1 plasmids were the NF-{kappa}B-deleted derivatives of pNL-I{kappa}B-M and pNL-I{kappa}B-as (37), which express or do not express, respectively, I{kappa}B-{alpha}S32/36A-FLAG. Jurkat cells were infected with the wild type LTR viruses (NL-I{kappa}B-M and NL-I{kappa}B-as) or the NF-{kappa}B-deleted LTR viruses (NL-{Delta}{kappa}B-I{kappa}B-M and NL-{Delta}{kappa}B-I{kappa}B-as), and the viral production was measured by p24 detection in culture supernatants. As previously reported (37), NL-I{kappa}B-M was potently attenuated as compared with the control NL-I{kappa}B-as because of the I{kappa}B-{alpha}S32/36A expression (Fig. 2D, left panel). In the case of NF-{kappa}B-deleted viruses, a significant attenuation of NL-{Delta}{kappa}B-I{kappa}B-M was also observed as compared with the control NL-{Delta}{kappa}B-I{kappa}B-as (Fig. 2D, right panel). These results indicate that I{kappa}B-{alpha} inhibited the HIV-1 replication independently of the NF-{kappa}B enhancer in the HIV-1 LTR and supported the evidence of additional mechanisms of HIV-1 inhibition by I{kappa}B-{alpha} other than NF-{kappa}B repression.

The Sequence of I{kappa}B-{alpha} from Amino Acids 72 to 287 Is Required for Tat Inhibition—The sequence of I{kappa}B-{alpha} encompassing amino acids 1-317 contains six ankyrins (amino acids 72-287), the NLS (amino acids 110-120), the N-NES (amino acids 45-55), and the C-NES (amino acids 265-277) (Fig. 3A). To map the I{kappa}B-{alpha} domains required for Tat inhibition independently of NF-{kappa}B repression, the activity of I{kappa}B-{alpha} mutants was analyzed in p50-/- p65-/- MEFs by transient expression of the NF-{kappa}B-deleted LTR and Tat. The I{kappa}B-{alpha} mutants that were progressively deleted of the carboxyl-terminal from amino acids 317 to 280 significantly inhibited the Tat activity, whereas no inhibition was induced by I{kappa}B-{alpha} 1-269 deleted of the C-NES (Fig. 3B). Further, deletions of the carboxyl-terminal of I{kappa}B-{alpha} from amino acids 269 to 242 did not affect the Tat activity (Fig. 3B). I{kappa}B-{alpha} 72-317 lacking the amino-terminal sequence from amino acids 1 to 72 significantly inhibited Tat, whereas I{kappa}B-{alpha} 120-317, which was deleted of the NLS, lost the inhibitory activity (Fig. 3B). These results indicated that the sequences of I{kappa}B-{alpha} from amino acids 72 to 120 (overlapping the NLS) and from amino acids 269 to 280 (overlapping the C-NES) were both required for Tat inhibition. This was confirmed by experiments where the mutant I{kappa}B-{alpha} 72-287, which contains both the NLS and C-NES, inhibited Tat, whereas the mutants I{kappa}B-{alpha} 72-269 and I{kappa}B-{alpha} 72-287 L(272,274,277)A, which carry deletion or base pair substitutions of critical leucine residues of the C-NES sequence (29), respectively, failed to inhibit Tat (Fig. 3B). Lack of inhibition was confirmed at higher doses of I{kappa}B-{alpha} 120-317, I{kappa}B-{alpha} 72-269, and I{kappa}B-{alpha} 72-287 L(272,274,277)A (supplemental Fig. S3). The I{kappa}B-{alpha} mutants were all expressed in cell extracts, and no correlation was found between the level of expression and the inhibitory activity (Fig. 3C). These results demonstrated that the minimal sequence of I{kappa}B-{alpha} required for Tat inhibition spanned from amino acids 72 to 287; this region encompasses the six ankyrins of I{kappa}B-{alpha} including the NLS and C-NES.


Figure 6
View larger version (35K):
[in this window]
[in a new window]

 
FIGURE 6.
I{kappa}B-{alpha} promotes the nuclear export of Tat. A, HeLa cells (5 x 105) were transfected with p3XFLAG-CMV-Tat (3 µg) in the presence or absence of pCMV4-HA-I{kappa}B-{alpha} 1-317, pCMV4-HA-I{kappa}B-{alpha} 120-317, pCMV4-HA-I{kappa}B-{alpha} 1-269, pCMV4-HA-I{kappa}B-{alpha}72-287, pCMV4-HA-I{kappa}B-{alpha}72-269, or pCMV4-HA-I{kappa}B-{alpha}72-287 L(272,274,277)A (3 µg). The cells were analyzed by confocal microscopy as described under "Experimental Procedures." Scale bar, 10 µm. B, total extracts (25 µg) from transfected HeLa cells as shown in A were analyzed by Western blotting (WB) with anti-HA, anti-FLAG, and anti-{gamma}-tubulin antibodies.

 
I{kappa}B-{alpha} Binds to the Arginine-rich Domain of Tat—To test whether I{kappa}B-{alpha} physically interacts with Tat, the GST pulldown assay was performed with extracts from cells transfected with pCMV4-HA-I{kappa}B-{alpha}. GST-Tat retained I{kappa}B-{alpha} expressed in HeLa and MEFs (Fig. 4A, lanes 1 and 2). The binding of Tat with I{kappa}B-{alpha} was also observed in p50-/- p65-/- MEFs (Fig. 4A, lane 3), which ruled out that I{kappa}B-{alpha} and Tat were recruited in the same complex by associating with the p50 and p65 subunits of NF-{kappa}B. I{kappa}B-{alpha} was not retained by GST protein (Fig. 4A, lanes 4-6). The association of endogenous I{kappa}B-{alpha} with GST-Tat was also observed in HeLa extracts (Fig. 4B, lane 1). The treatment of the cellular extracts with micrococcal nuclease did not affect the binding of I{kappa}B-{alpha} with Tat (Fig. 4C, lane 2), thus ruling out the possibility that the association of the two proteins was bridged by nucleic acids.

To map the Tat domain that binds to I{kappa}B-{alpha}, GST-I{kappa}B-{alpha} was incubated with extracts from HeLa cells transfected with the wild type Tat or the mutants Tat C(22,25,27)A and Tat R(49-57)A fused to the FLAG epitope (Fig. 4D). In pulldown assay, GST-I{kappa}B-{alpha} retained the wild type Tat and Tat C(22,25,27)A (Fig. 4E, lanes 2 and 4), whereas it did not bind to Tat R(49-57)A (Fig. 4E, lane 3); Tat was not retained by GST alone (Fig. 4E, lanes 6-8). The association of I{kappa}B-{alpha} with Tat was further tested by in vivo immunoprecipitation with extracts from HeLa cells transfected with the plasmids expressing FLAG-Tat and HA-I{kappa}B-{alpha}.I{kappa}B-{alpha} immunoprecipitated with the wild type Tat and Tat C(22,25,27)A (Fig. 4F, lanes 2 and 3), whereas it did not associate with Tat R(49-57)A (Fig. 4F, lane 4). Altogether, these results indicate that the arginine-rich region of Tat encompassing amino acids 49-57 is required for the association with I{kappa}B-{alpha}.

Tat Binds to the Sixth Ankyrin of I{kappa}B-{alpha}—To determine the sequence of I{kappa}B-{alpha} binding to Tat, [35S]methionine-labeled I{kappa}B-{alpha} mutants (Fig. 5A) were incubated with GST-Tat or GST. Tat retained I{kappa}B-{alpha} 1-317 and I{kappa}B-{alpha} 1-269 (Fig. 5B, lanes 1 and 2), whereas it did not bind to I{kappa}B-{alpha} 1-263 (Fig. 5B, lane 3). The mutants I{kappa}B-{alpha} 72-287, I{kappa}B-{alpha} 120-317, I{kappa}B-{alpha} 243-317, and I{kappa}B-{alpha} 72-287 L(272, 274, 277)A were efficient binders of Tat (Fig. 5B, lanes 4-7). As control, GST tested negative for the binding to labeled proteins (Fig. 5B, lanes 8-14). These results indicated that the I{kappa}B-{alpha} sequence from amino acids 263 to 269 within the sixth ankyrin of I{kappa}B-{alpha} was required for binding to Tat.


Figure 7
View larger version (35K):
[in this window]
[in a new window]

 
FIGURE 7.
Fluorescence-based image analysis of Tat and I{kappa}B-{alpha}. The fluorescence-based evaluation of FLAG-Tat and HA-I{kappa}B-{alpha} was performed in HeLa cells upon transfection as detailed under "Experimental Procedures." Thirty cells were recorded and analyzed for each transfection. The relative nuclear or cytoplasmic fluorescence was evaluated as the ratio between the mean nuclear or cytoplasmic fluorescence and the mean fluorescence of the whole cell. In the panels, each point represents the values of a single cell; the solid diagonal line indicates equal nuclear and cytoplasmic fluorescence (nuclear/cytoplasmic fluorescence ratio = 1/1); the upper and lower dashed lines indicate, respectively, 10/1 and 1/10 nuclear/cytoplasmic fluorescence ratios.

 
By CLUSTALW-based multiple sequence alignment (align.genome.jp), the amino acid sequence of the I{kappa}B-{alpha} sixth ankyrin is very divergent from the other five ankyrins of I{kappa}B-{alpha} and the ankyrins of the human I{kappa}B family (p100, p105, I{kappa}B-{gamma}, I{kappa}B-{epsilon}, and Bcl-3) (supplemental Fig. S4, A and B). In particular, the sequence TRIQQQL (amino acids 263-269 of I{kappa}B-{alpha}), which is present in the sixth ankyrin and is required for the binding to Tat (Fig. 5B), is absent in ankyrins 1-5 of I{kappa}B-{alpha} as well as in the ankyrins of the I{kappa}B family members (supplemental Fig. S4, A and B). A more extended analysis by using FUZZPRO (bioweb.pasteur.fr/seqanal/interfaces/fuzzpro.html) failed to identify the TRIQQQL motif in the ankyrins of the human proteome except in the sixth ankyrin of I{kappa}B-{alpha}. Accordingly, p100 and p105, two members of the I{kappa}B family showing the highest identity with the sixth ankyrin of I{kappa}B-{alpha}, were unable to bind to Tat (supplemental Fig. S4C, lanes 1 and 4). These results suggest that the sixth ankyrin of I{kappa}B-{alpha} contains a unique diverged sequence as compared with other ankyrins, which might represent a privileged target site for Tat binding. Alternatively, this sequence might contribute to stabilize a peculiar structural domain required for the binding to Tat.

I{kappa}B-{alpha} Exports Tat from the Nucleus to the Cytoplasm—The cellular distribution of I{kappa}B-{alpha} and Tat was visualized by confocal fluorescence microscopy. HeLa cells were transfected with plasmids expressing FLAG-Tat and HA-I{kappa}B-{alpha}. When singularly transfected, Tat was nuclear, whereas I{kappa}B-{alpha} 1-317 was mostly cytoplasmic (Fig. 6A); this was confirmed by the fluorescence-based analysis of 30 cells for each transfection (Fig. 7). When co-transfected, Tat and I{kappa}B-{alpha} 1-317 co-localized within the cytoplasmic and perinuclear regions (Figs. 6A and 7). I{kappa}B-{alpha} 120-317, lacking both the N-NES and the NLS, and I{kappa}B-{alpha} 1-269, lacking the C-NES, were prevalently cytoplasmic and did not affect the nuclear location of Tat (Figs. 6A and 7). I{kappa}B-{alpha} 72-287, lacking the N-NES, was mostly cytoplasmic and promoted the translocation of Tat from the nucleus to the cytoplasm in 50% of the analyzed cells (Figs. 6A and 7). I{kappa}B-{alpha} 72-269 and I{kappa}B-{alpha} 72-287 L(272,274,277)A, which lacked the N-NES and C-NES, were distributed both in the nucleus and cytoplasm and did not affect the nuclear location of Tat (Figs. 6A and 7). No significant differences in the intracellular expression levels of the I{kappa}B-{alpha} mutants were observed in transfected cells (Fig. 6B). These results suggested that I{kappa}B-{alpha} promoted the displacement of Tat from nucleus to cytoplasm and that this activity required the integrity of the NLS and C-NES of I{kappa}B-{alpha}.

To analyze the role of the nuclear export activity of I{kappa}B-{alpha} in Tat inhibition, we generated the mutant I{kappa}B-{alpha} 1-317 N/C NES, which carries crucial base pair substitutions of both the N-NES (I52A,L54A) and C-NES (L272,274,277A), which inactivate the nuclear export activity (25, 29). I{kappa}B-{alpha} N/C NES was prevalently distributed in the nucleus and did not affect the nuclear location of Tat (Fig. 8, A and B). Moreover, I{kappa}B-{alpha} N/C NES did not repress the Tat-mediated transactivation of the NF-{kappa}B-deleted LTR (Fig. 8C), although it was able to bind to Tat in GST-pull down (Fig. 8D, lane 2). These results confirmed that I{kappa}B-{alpha} inhibited Tat through the nuclear export to the cytoplasm.


Figure 8
View larger version (35K):
[in this window]
[in a new window]

 
FIGURE 8.
The nuclear export activity of I{kappa}B-{alpha} is required for nuclear export and inhibition of Tat. A, HeLa cells (5 x 105) were transfected with p3XFLAG-CMV-Tat (3 µg) and pCMV4-HA-I{kappa}B-{alpha} 1-317 N/C NES (3 µg). The cells were analyzed by confocal microscopy as described under "Experimental Procedures." Scale bar, 10 µm. B, the fluorescence-based analysis of FLAG-Tat and HA-I{kappa}B-{alpha} was performed as detailed in Fig. 7. C, p50-/- p65-/- MEFs (3 x 105) were transfected with the NF-{kappa}B-deleted LTRluc (0.5 µg) in presence or absence of p3XFLAG-CMV-Tat (0.5 µg), pRc/CMV-HA-hCycT1 (0.5 µg), and pCMV4-HA-I{kappa}B-{alpha} 1-317 or pCMV4-HA-I{kappa}B-{alpha} N/C NES (2 µg). The luciferase activity was measured in cell extracts 48 h post-transfection. Fold activation was calculated relative to transfection in the absence of Tat, hCycT1, and I{kappa}B-{alpha} expression plasmids. The mean values ± S.E. (n = 4) are shown. The asterisk indicates a statistically significant inhibition according to Student's t test (p = 0.0017). D,[35S]methionine-labeled I{kappa}B-{alpha} wild type and I{kappa}B-{alpha} N/C NES were incubated with GST-Tat or GST. Following GST pulldown, the protein complexes were separated by 12% SDS-PAGE and analyzed by autoradiography (top panel) and by Western blotting with anti-GST antibody (bottom panel).

 
We also verified the effect of leptomycin B, a nuclear export inhibitor (54), on the inhibition of Tat by I{kappa}B-{alpha}. In p50-/- p65-/- MEFs, leptomycin B did not affect significantly the level of Tat-mediated transactivation of the NF-{kappa}B-deleted LTR (supplemental Fig. S5, lanes 2 and 5), whereas it caused the loss of Tat inhibition by the transfected I{kappa}B-{alpha} (supplemental Fig. S5, compare lanes 2 and 3 with lanes 5 and 6). These results indicate that the leptomycin B-mediated arrest of nuclear export released Tat from the I{kappa}B-{alpha} inhibition.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
This study provides further insight into the mechanisms of HIV-1 inhibition by the I{kappa}B-{alpha} repressor. We have shown that I{kappa}{alpha} represses the Tat activity independently of the NF-{kappa}B inhibitory activity by physical association and displacement of Tat from the nucleus to the cytoplasm. The association of I{kappa}{alpha} with the argininerich domain of Tat is not sufficient to interfere with the nuclear distribution and the transcriptional activity of Tat. In fact, the mutants I{kappa}B-{alpha} 120-317 and I{kappa}B-{alpha} 1-269 bind to Tat without affecting the nuclear location and transcriptional activity of the viral transactivator (Fig. 9A). Instead, the inhibition of Tat correlates with the nuclear export activity of I{kappa}B-{alpha}, which requires both the NLS (amino acids 110-120) and the C-NES (amino acids 265-277) together with the binding site for Tat (amino acids 263-269) (Fig. 9A). Consistent with this evidence, the mutant I{kappa}B-{alpha} N/C NES, which contains the full-length sequence of I{kappa}B-{alpha} but lacks the nuclear export signals, does not affect the nuclear location and the transcriptional activity of Tat (Fig. 9A). Altogether, these results suggest that I{kappa}B-{alpha} binds to Tat in the nucleus and exports the viral transactivator to the cytoplasm, where the complex I{kappa}B-{alpha}/Tat is mostly retained (Fig. 9B).

Relevance of I{kappa}B-{alpha}/Tat Interaction in the Viral Cycle—The evidence that I{kappa}B-{alpha} inhibits the transcriptional activity of Tat raises the question of why the endogenous I{kappa}B-{alpha} does not counteract the viral expression in HIV-1-infected cells. Indeed, I{kappa}B-{alpha} is subjected to persistent proteolysis in the course of HIV-1 infection (55-57). The HIV-1 entry through the gp120 envelope protein binding to CD4 receptor activates the I{kappa}B kinase complex, which promotes the proteolysis of I{kappa}B-{alpha} (58). This event leads to the transcriptional activation of NF-{kappa}B-dependent genes, including the HIV-1 genome and pro-inflammatory genes, which in turn sustain the proteolysis of I{kappa}B-{alpha} and the activation of NF-{kappa}B (59). In particular, Tat activates NF-{kappa}B by inducing the degradation of I{kappa}B-{alpha} (47), the up-regulation of NIK (60), and the transactivation of inflammatory cytokines (61-63).


Figure 9
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 9.
Model of Tat inhibition by I{kappa}B-{alpha}. A, summary of inhibition, binding and nuclear export of Tat exhibited by relevant I{kappa}B-{alpha} mutants. B, schematic representation of the mechanism of Tat inhibition by I{kappa}B-{alpha}. The I{kappa}B-{alpha} repressor enters in the nucleus (step 1), where it associates to Tat (step 2) and exports the viral transactivator to the cytoplasm (step 3). The nuclear localization signal, the carboxyl-terminal nuclear export signal, and the Tat-binding site of I{kappa}B-{alpha} are required for the nuclear export of Tat.

 
The physical and functional interaction of I{kappa}B-{alpha} with Tat discloses a novel mechanism of HIV-1 transcriptional regulation. In fact, the ratio between I{kappa}B-{alpha} and Tat could determine the level of expression of the target genes, including HIV-1. In this scenario, whereas the endogenous I{kappa}B-{alpha} does not block the viral expression because it undergoes proteolysis in the course of HIV-1 infection (55-57), a proteolysis-resistant I{kappa}B-{alpha} mutant, such as I{kappa}B-{alpha}S32/36A, would subvert this equilibrium and repress HIV-1 by constitutive inhibition of both NF-{kappa}B and Tat transcriptional activities (36, 37). In this regard, the novel mechanism of Tat inhibition by I{kappa}B-{alpha} described here could assist in the development of a novel class of HIV-1 inhibitors. In particular, the inhibitory sequence of I{kappa}B-{alpha} (amino acids 72-287) represents a model structure to design peptide-based inhibitors acting at the transcriptional step of the HIV-1 life cycle.

The mechanism of Tat inhibition here described mimics the one of NF-{kappa}B inhibition, because in both cases I{kappa}B-{alpha} associates with these transcriptional factors in the nucleus and exports them to the cytoplasm. These events result in the down-regulation of the NF-{kappa}B and Tat transcriptional activities and explain the strong attenuation of HIV-1 by I{kappa}B-{alpha}. In this regard, compounds that increase the stability of endogenous I{kappa}B-{alpha}, such as inhibitors of I{kappa}B kinase and proteasomes, could be additional tools of conventional anti-retroviral therapies by inhibiting the NF-{kappa}B-Tat-dependent HIV-1 transcription.


    FOOTNOTES
 
* This work was supported by grants from Istituto Superiore di Sanità-National Research Program on AIDS, and Ministero dell'Istruzione, dell'Università e della Ricerca-Fondo per gli Investimenti della Ricerca di Base (FIRB). This work was also supported in part by Fondazione Italiana per la Ricerca sul Cancro and Ministero dell'Università e della Ricerca-FIRB fellowships (to A. P., F. T., and G. F.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1-S5. Back

1 These authors contributed equally to this work. Back

2 To whom correspondence should be addressed: Dept. of Experimental and Clinical Medicine, Biosciences Bldg., University of Catanzaro "Magna Graecia," Viale Europa-Germaneto, 88100 Catanzaro, Italy. Tel.: 39-0961-3694057; Fax: 39-0961-3694090; E-mail: quinto{at}unicz.it.

3 The abbreviations used are: HIV-1, human immunodeficiency virus, type 1; LTR, long terminal repeat; NF-{kappa}B, nuclear factor {kappa}B; I{kappa}B, inhibitor {kappa}B; NLS, nuclear localization signal; NES, nuclear export signal; N-NES, amino-terminal NES; C-NES, carboxyl-terminal NES; MEFs, mouse embryonic fibroblasts; PBS, phosphate-buffered saline; DTT, dithiothreitol; GST, glutathione S-transferase; hCycT1, human cyclin T1; siRNA, small interfering RNA; HA, hemagglutinin. Back


    ACKNOWLEDGMENTS
 
We thank Dr. K.-T. Jeang for pRc/CMV-HA-hCycT1 and pLTRluc plasmids; Dr. W. C. Greene for pCMV4-HA expressing I{kappa}B-{alpha} 1-317, elide 72-317, 1-287, and 1-263; Dr. M. Giacca for the pGEX-2T-Tat C(22,25,27)A and pGEX-2T-Tat R(49-57)A; Dr. A. A. Beg for p50-/- p65-/- MEFs; Dr. N. Rice for anti-p105 antibody; and the NIH AIDS Research & Reference Program for the pGEX-2T-Tat (1-86) and pNL4-3.Luc.R-E-.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wu, Y. (2004) Retrovirology 1, 13[CrossRef][Medline] [Order article via Infotrieve]
  2. Pereira, L. A., Bentley, K., Peeters, A., Churchill, M. J., and Deacon, N. J. (2000) Nucleic Acids Res. 28, 663-668[Abstract/Free Full Text]
  3. Berkhout, B., Silverman, R. H., and Jeang, K. T. (1989) Cell 59, 273-282[CrossRef][Medline] [Order article via Infotrieve]
  4. Brady, J., and Kashanchi, F. (2005) Retrovirology 2, 69[CrossRef][Medline] [Order article via Infotrieve]
  5. Kashanchi, F., Piras, G., Radonovich, M. F., Duvall, J. F., Fattaey, A., Chiang, C. M., Roeder, R. G., and Brady, J. N. (1994) Nature 367, 295-299[CrossRef][Medline] [Order article via Infotrieve]
  6. Raha, T., Cheng, S. W., and Green, M. R. (2005) PLoS Biol. 3, e44[CrossRef][Medline] [Order article via Infotrieve]
  7. Liu, J., Perkins, N. D., Schmid, R. M., and Nabel, G. J. (1992) J. Virol. 66, 3883-3887[Abstract/Free Full Text]
  8. Jeang, K. T., Chun, R., Lin, N. H., Gatignol, A., Glabe, C. G., and Fan, H. (1993) J. Virol. 67, 6224-6233[Abstract/Free Full Text]
  9. Benkirane, M., Chun, R. F., Xiao, H., Ogryzko, V. V., Howard, B. H., Nakatani, Y., and Jeang, K. T. (1998) J. Biol. Chem. 273, 24898-24905[Abstract/Free Full Text]
  10. Marzio, G., Tyagi, M., Gutierrez, M. I., and Giacca, M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 13519-13524[Abstract/Free Full Text]
  11. Hottiger, M. O., and Nabel, G. J. (1998) J. Virol. 72, 8252-8256[Abstract/Free Full Text]
  12. Herrmann, C. H., and Rice, A. P. (1995) J. Virol. 69, 1612-1620[Abstract]
  13. Zhu, Y., Pe'ery, T., Peng, J., Ramanathan, Y., Marshall, N., Marshall, T., Amendt, B., Mathews, M. B., and Price, D. H. (1997) Genes Dev. 11, 2622-2632[Abstract/Free Full Text]
  14. Mancebo, H. S., Lee, G., Flygare, J., Tomassini, J., Luu, P., Zhu, Y., Peng, J., Blau, C., Hazuda, D., Price, D., and Flores, O. (1997) Genes Dev. 11, 2633-2644[Abstract/Free Full Text]
  15. Wei, P., Garber, M. E., Fang, S. M., Fischer, W. H., and Jones, K. A. (1998) Cell 92, 451-462[CrossRef][Medline] [Order article via Infotrieve]
  16. Nabel, G., and Baltimore, D. (1987) Nature 326, 711-713[CrossRef][Medline] [Order article via Infotrieve]
  17. Mallardo, M., Dragonetti, E., Baldassarre, F., Ambrosino, C., Scala, G., and Quinto, I. (1996) J. Biol. Chem. 271, 20820-20827[Abstract/Free Full Text]
  18. Ghosh, S., and Karin, M. (2002) Cell 109, (suppl.) S81-S96[CrossRef][Medline] [Order article via Infotrieve]
  19. Perkins, N. D., and Gilmore, T. D. (2006) Cell Death Differ. 13, 759-772[CrossRef][Medline] [Order article via Infotrieve]
  20. Hayden, M. S., and Ghosh, S. (2004) Genes Dev. 18, 2195-2224[Abstract/Free Full Text]
  21. Haskill, S., Beg, A. A., Tompkins, S. M., Morris, J. S., Yurochko, A. D., Sampson-Johannes, A., Mondal, K., Ralph, P., and Baldwin, A. S., Jr. (1991) Cell 65, 1281-1289[CrossRef][Medline] [Order article via Infotrieve]
  22. Sachdev, S., Hoffmann, A., and Hannink, M. (1998) Mol. Cell. Biol. 18, 2524-2534[Abstract/Free Full Text]
  23. Turpin, P., Hay, R. T., and Dargemont, C. (1999) J. Biol. Chem. 274, 6804-6812[Abstract/Free Full Text]
  24. Sachdev, S., Bagchi, S., Zhang, D. D., Mings, A. C., and Hannink, M. (2000) Mol. Cell. Biol. 20, 1571-1582[Abstract/Free Full Text]
  25. Johnson, C., Van Antwerp, D., and Hope, T. J. (1999) EMBO J. 18, 6682-6693[CrossRef][Medline] [Order article via Infotrieve]
  26. Huang, T. T., Kudo, N., Yoshida, M., and Miyamoto, S. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 1014-1019[Abstract/Free Full Text]
  27. Tam, W. F., Lee, L. H., Davis, L., and Sen, R. (2000) Mol. Cell. Biol. 20, 2269-2284[Abstract/Free Full Text]
  28. Prigent, M., Barlat, I., Langen, H., and Dargemont, C. (2000) J. Biol. Chem. 275, 36441-36449[Abstract/Free Full Text]
  29. Arenzana-Seisdedos, F., Turpin, P., Rodriguez, M., Thomas, D., Hay, R. T., Virelizier, J. L., and Dargemont, C. (1997) J. Cell Sci. 110, 369-378[Abstract]
  30. Bachelerie, F., Rodriguez, M. S., Dargemont, C., Rousset, D., Thomas, D., Virelizier, J. L., and Arenzana-Seisdedos, F. (1997) J. Cell Sci. 110, 2883-2893[Abstract]
  31. Rodriguez, M. S., Thompson, J., Hay, R. T., and Dargemont, C. (1999) J. Biol. Chem. 274, 9108-9115[Abstract/Free Full Text]
  32. Arenzana-Seisdedos, F., Thompson, J., Rodriguez, M. S., Bachelerie, F., Thomas, D., and Hay, R. T. (1995) Mol. Cell. Biol. 15, 2689-2696[Abstract]
  33. Harhaj, E., Blaney, J., Millhouse, S., and Sun, S. C. (1996) Virology 216, 284-287[CrossRef][Medline] [Order article via Infotrieve]
  34. Brown, K., Gerstberger, S., Carlson, L., Franzoso, G., and Siebenlist, U. (1995) Science 267, 1485-1488[Abstract/Free Full Text]
  35. Brockman, J. A., Scherer, D. C., McKinsey, T. A., Hall, S. M., Qi, X., Lee, W. Y., and Ballard, D. W. (1995) Mol. Cell. Biol. 15, 2809-2818[Abstract]
  36. Kwon, H., Pelletier, N., DeLuca, C., Genin, P., Cisternas, S., Lin, R., Wainberg, M. A., and Hiscott, J. (1998) J. Biol. Chem. 273, 7431-7440[Abstract/Free Full Text]
  37. Quinto, I., Mallardo, M., Baldassarre, F., Scala, G., Englund, G., and Jeang, K. T. (1999) J. Biol. Chem. 274, 17567-17572[Abstract/Free Full Text]
  38. Leonard, J., Parrott, C., Buckler-White, A. J., Turner, W., Ross, E. K., Martin, M. A., and Rabson, A. B. (1989) J. Virol. 63, 4919-4924[Abstract/Free Full Text]
  39. Berkhout, B., and Jeang, K. T. (1992) J. Virol. 66, 139-149[Abstract/Free Full Text]
  40. Chen, B. K., Feinberg, M. B., and Baltimore, D. (1997) J. Virol. 71, 5495-5504[Abstract]
  41. Dayton, A. I., Sodroski, J. G., Rosen, C. A., Goh, W. C., and Haseltine, W. A. (1986) Cell 44, 941-947[CrossRef][Medline] [Order article via Infotrieve]
  42. Fisher, A. G., Feinberg, M. B., Josephs, S. F., Harper, M. E., Marselle, L. M., Reyes, G., Gonda, M. A., Aldovini, A., Debouk, C., Gallo, R. C., et al. (1986) Nature 320, 367-371[CrossRef][Medline] [Order article via Infotrieve]
  43. Ambrosino, C., Ruocco, M. R., Chen, X., Mallardo, M., Baudi, F., Trematerra, S., Quinto, I., Venuta, S., and Scala, G. (1997) J. Biol. Chem. 272, 14883-14892[Abstract/Free Full Text]
  44. Quinto, I., Puca, A., Greenhouse, J., Silvera, P., Yalley-Ogunro, J., Lewis, M. G., Palmieri, C., Trimboli, F., Byrum, R., Adelsberger, J., Venzon, D., Chen, X., and Scala, G. (2004) J. Biol. Chem. 279, 1720-1728[Abstract/Free Full Text]
  45. O'Doherty, U., Swiggard, W. J., and Malim, M. H. (2000) J. Virol. 74, 10074-10080[Abstract/Free Full Text]
  46. Brussel, A., and Sonigo, P. (2003) J. Virol. 77, 10119-10124[Abstract/Free Full Text]
  47. Demarchi, F., d'Adda di Fagagna, F., Falaschi, A., and Giacca, M. (1996) J. Virol. 70, 4427-4437[Abstract]
  48. Liu, W., Quinto, I., Chen, X., Palmieri, C., Rabin, R. L., Schwartz, O. M., Nelson, D. L., and Scala, G. (2001) Nat. Immunol. 2, 939-946[CrossRef][Medline] [Order article via Infotrieve]
  49. Carlotti, F., Chapman, R., Dower, S. K., and Qwarnstrom, E. E. (1999) J. Biol. Chem. 274, 37941-37949[Abstract/Free Full Text]
  50. Sha, W. C., Liou, H. C., Tuomanen, E. I., and Baltimore, D. (1995) Cell 80, 321-330[CrossRef][Medline] [Order article via Infotrieve]
  51. Beg, A. A., Sha, W. C., Bronson, R. T., Ghosh, S., and Baltimore, D. (1995) Nature 376, 167-170[CrossRef][Medline] [Order article via Infotrieve]
  52. Hoffmann, A., Leung, T. H., and Baltimore, D. (2003) EMBO J. 22, 5530-5539[CrossRef][Medline] [Order article via Infotrieve]
  53. Garber, M. E., Wei, P., KewalRamani, V. N., Mayall, T. P., Herrmann, C. H., Rice, A. P., Littman, D. R., and Jones, K. A. (1998) Genes Dev. 12, 3512-3527[Abstract/Free Full Text]
  54. Coiras, M., Lopez-Huertas, M. R., Rullas, J., Mittelbrunn, M., and Alcami, J. (2007) Retrovirology 4, 56[CrossRef][Medline] [Order article via Infotrieve]
  55. McElhinny, J. A., MacMorran, W. S., Bren, G. D., Ten, R. M., Israel, A., and Paya, C. V. (1995) J. Virol. 69, 1500-1509[Abstract]
  56. DeLuca, C., Roulston, A., Koromilas, A., Wainberg, M. A., and Hiscott, J. (1996) J. Virol. 70, 5183-5193[Abstract/Free Full Text]
  57. Asin, S., Taylor, J. A., Trushin, S., Bren, G., and Paya, C. V. (1999) J. Virol. 73, 3893-3903[Abstract/Free Full Text]
  58. Bossis, G., Salinas, S., Cartier, C., Devaux, C., and Briant, L. (2002) FEBS Lett. 516, 257-264[CrossRef][Medline] [Order article via Infotrieve]
  59. Hiscott, J., Kwon, H., and Genin, P. (2001) J. Clin. Investig. 107, 143-151[CrossRef][Medline] [Order article via Infotrieve]
  60. Li, X., Josef, J., and Marasco, W. A. (2001) Biochem. Biophys. Res. Commun. 286, 587-594[CrossRef][Medline] [Order article via Infotrieve]
  61. Buonaguro, L., Barillari, G., Chang, H. K., Bohan, C. A., Kao, V., Morgan, R., Gallo, R. C., and Ensoli, B. (1992) J. Virol. 66, 7159-7167[Abstract/Free Full Text]
  62. Scala, G., Ruocco, M. R., Ambrosino, C., Mallardo, M., Giordano, V., Baldassarre, F., Dragonetti, E., Quinto, I., and Venuta, S. (1994) J. Exp. Med. 179, 961-971[Abstract/Free Full Text]
  63. Westendorp, M. O., Li-Weber, M., Frank, R. W., and Krammer, P. H. (1994) J. Virol. 68, 4177-4185[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
C. Spatuzza, M. Schiavone, E. Di Salle, E. Janda, M. Sardiello, G. Fiume, O. Fierro, M. Simonetta, N. Argiriou, R. Faraonio, et al.
Physical and functional characterization of the genetic locus of IBtk, an inhibitor of Bruton's tyrosine kinase: evidence for three protein isoforms of IBtk
Nucleic Acids Res., August 1, 2008; 36(13): 4402 - 4416.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/51/37146    most recent
M705815200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Puca, A.
Right arrow Articles by Quinto, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Puca, A.
Right arrow Articles by Quinto, I.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement