Originally published In Press as doi:10.1074/jbc.M606283200 on December 4, 2006
J. Biol. Chem., Vol. 282, Issue 7, 4711-4718, February 16, 2007
Structural and Biophysical Studies on Two Promoter Recognition Domains of the Extra-cytoplasmic Function 
Factor C from Mycobacterium tuberculosis*
Krishan Gopal Thakur1,
Anagha Madhusudan Joshi, and
B. Gopal, International Senior Research Fellow of the Wellcome Trust2
From the
Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560 012, India
Received for publication, June 30, 2006
, and in revised form, September 11, 2006.
 |
ABSTRACT
|
|---|
factors are transcriptional regulatory proteins that bind to the RNA polymerase and dictate gene expression. The extracytoplasmic function (ECF) factors govern the environment dependent regulation of transcription. ECF factors have two domains 2 and 4 that recognize the -10 and -35 promoter elements. However, unlike the primary factor A, the ECF factors lack 3, a region that helps in the recognition of the extended -10 element and 1.1, a domain involved in the autoinhibition of A in the absence of core RNA polymerase. Mycobacterium tuberculosis C is an ECF factor that is essential for the pathogenesis and virulence of M. tuberculosis in the mouse and guinea pig models of infection. However, unlike other ECF factors, C does not appear to have a regulatory anti- factor located in the same operon. We also note that M. tuberculosis C differs from the canonical ECF factors as it has an N-terminal domain comprising of 126 amino acids that precedes the C2 and C4 domains. In an effort to understand the regulatory mechanism of this protein, the crystal structures of the C2 and C4 domains of C were determined. These promoter recognition domains are structurally similar to the corresponding domains of A despite the low sequence similarity. Fluorescence experiments using the intrinsic tryptophan residues of C2 as well as surface plasmon resonance measurements reveal that the C2 and C4 domains interact with each other. Mutational analysis suggests that the Pribnow box-binding region of C2 is involved in this interdomain interaction. Interaction between the promoter recognition domains in M. tuberculosis C are thus likely to regulate the activity of this protein even in the absence of an anti- factor.
|
INTRODUCTION
|
|---|
The slow growing pathogen, Mycobacterium tuberculosis, has only one ribosomal RNA operon. An efficient transcription mechanism is thus essential for the survival and pathogenecity of this bacillus. Although a third of the human population are carriers of this pathogen, only a few contract this disease. This bacillus can lie latent in the host for prolonged periods of time till a mycobacterial infection gets triggered, most often in the setting of decreased host immunity. Studies that help further our understanding of the latent phase of this bacillus are thus vital to understand the mechanisms of pathogenesis and virulence in this organism. This ability of M. tuberculosis to survive in the hostile environmental conditions in the carrier is brought about by adaptability to rapidly changing environmental conditions. The survival mechanism is thus crucially dependent on efficient communication between the mechanism that senses the environment and the molecules that regulate transcription.
The DNA-dependent RNA polymerase (RNAP)3 that controls gene expression consists of five domains-two 
subunits, one 
subunit and the 
and ' domains. The factor reversibly associates with the RNAP and provides the RNAP enzyme with the ability to recognize promoter regions on the DNA template. M. tuberculosis has a total of 13 factors: three primary factors and 10 extracytoplasmic function (ECF) factors. Differences in the promoter specificity of these factors lead to differential gene expression (1, 2). The task of environment-dependent transcription modulation is performed by the ECF factors. Regulatory mechanisms, in turn, dictate which factors get activated to bind to the apo-RNAP and initiate transcription and which ones are not. This regulatory mechanism is coupled to a signal transduction system that senses the environment. The interplay between signal transduction and the transcriptional regulatory mechanisms allows the bacillus to respond to changes in the environment by synthesizing new proteins or down-regulating others.
Studies on the transcription mechanism in Escherichia coli have shown that a factor directs promoter-specific transcription initiation by specific interactions between two hexamers of a consensus DNA sequence, the Pribnow box (-10 element) and the -35 element. The crystal structure and limited proteolysis experiments on the principal factor A revealed a structural arrangement comprising of a series of domains connected by flexible linkers. The utility of this structural arrangement is borne out by the observation that substantial structural rearrangements take place in the factor during transcription initiation. Exposed surfaces of each of these domains were found to be important for RNAP binding (3). Interaction with the core RNAP has been demonstrated to structurally rearrange the factor into an active conformation in which the DNA-binding regions of 2 and 4 domains are exposed and appropriately positioned to recognize the -10 and -35 elements (3–6).
Two distinct types of mechanisms have been proposed to describe the regulation of the activity of the factors that belong to the 70 family. Thus while autoinhibition by the N-terminal domain mediates the activity of the principal factor, A, protein-protein interactions mediated by the anti- and anti-anti- factors control factor concentrations in the case of the ECF factors. Other regulatory mechanisms have been proposed wherein factor activity is controlled by stimulatory signals (such as the phosphorylation and de-phosphorylation processes controlled by the kinases and phosphatases) or mechanisms that can control the intracellular factor concentration by localizing it on the inner surface of the cell membrane. In the case of the E. coli factor E (7) for example, many of the key regulators of E activities (products of the rse genes) are co-transcribed with RpoE to form an operon: rpoE, rseA, rseB, and rseC. The protein RseA is an anti- factor for E, whereas the periplasmic RseB protein enhances its activity. The activity of E can also be regulated by cytoplasmic factors like guanosine 3',5'-bispyrophosphate (ppGpp). The signaling pathway employed in this process is distinct from the pathway that is activated upon extracytoplasmic stress (8). Very little is known of these processes in mycobacteria, although recent reports indicate that work to delineate the regulatory mechanism of E and another E-like factor H are presently in progress (9–11). The anti- factor, as seen in the cases of the SpoIIAB (12) and the E-RseA complex (4), appears to bind the free factor, thereby preventing its interaction with the core RNAP. The 28/FlgM complex (6) on the other hand is different from the others in that FlgM can also form a ternary complex with the 28 holoenzyme, thereby destabilizing the 28/RNAP interaction. The modes of factor anti- factor interactions also differ between the 70 and 28 families. The anti- factor RseA is sandwiched between E2 and E4 domains of E, whereas the FlgM protein wraps around the outside of 28 and occludes the core RNAP-binding determinants on 282 and 284.
M. tuberculosis has about 190 transcription regulators (13), which include 13 factors, 11 two-component systems, 5 unpaired response regulators, 11 protein kinases, and 140 other proteins. The resulting interaction among these proteins suggests a complex system of overlapping functions and redundancies (9). Four factors, A, B, C, and E, of the 13 in M. tuberculosis are conserved in all the pathogenic mycobacteria. Only four factors in M. tuberculosis, A, C, D, and L, have been examined in detail for their roles in virulence and pathogenecity. The ECF factor C is essential for lethality in mice but is not required for bacterial survival in this species (14). Based on genomic microarray data, C was demonstrated to modulate the expression of several key virulence associated genes including hspX, senX3, and mtrA, a two-component sensor kinase, and a two-component response regulator. The phenotype of the 
C mutant of M. tuberculosis can thus persist in tissues but is attenuated in its ability to elicit lethal immunopathology (14). A recent report also suggests C to be a key regulator of pathogenesis and adaptive survival in the lung and spleen of guinea pigs (15). These in vivo studies in two different animal models thus demonstrate the role ofC in the pathogenesis and virulence of M. tuberculosis. Although C does not appear to have an anti- factor located in the same operon, in silico analysis for the identification of potential interacting partners for C suggested two proteins SirR and the un-annotated protein Rv0093c. However, the interaction between these proteins andC could not be substantiated by experimental evidence.
In this manuscript, we report the biochemical and structural analysis of the domain organization of C. Despite the low sequence similarity between the promoter recognition domains of C with the primary factor A, we observe that the crystal structure of the two promoter recognition domains are conserved. Spectroscopic studies using the intrinsic tryptophan fluorescence as well as surface plasmon resonance experiments suggest that the C2 and C4 domains interact in vitro. Interactions between the two promoter recognition domains of C which involves the occlusion of the Pribnow box recognition region of C2 suggests that substantial interdomain rearrangements would be needed to activate C even in the absence of an anti factor.
|
MATERIALS AND METHODS
|
|---|
Cloning, Expression, and Purification of C, and the C2 and C4 Domains—The details of the expression constructs used in this study are compiled in Table 1. After transforming the plasmid into BL21 (DE3) or Rosetta origami cells (Novagen, Inc.), the cells were grown in Luria broth with an antibiotic selection (100 µg/ml ampicillin and 30 µg/ml chloramphenicol) to an A600 nm of 0.5–0.6. The cells were induced with 0.2 mM IPTG (final concentration). Subsequently, the growth temperature was lowered to 290 K, and cells were grown for further 12–18 h before they were spun down and stored at 193 K. Full-length C (311 amino acids) was purified in denaturing conditions using 8 M urea. Refolding of the denatured protein was carried out in a stepwise fashion with five buffer changes (each lasting about 3–4 h) with decreasing concentration of urea. The recombinant proteins from the other three constructs were purified under native conditions as described earlier (16). The proteins were further purified by size exclusion chromatography using a Superdex S-200 column (Amersham Biosciences) after the affinity chromatography step. The proteins were concentrated using membrane based centrifugal ultra filtration (Amicon). L-Arginine and L-glutamic acid were added to the final concentration of 50 mM each during the concentration step (17). The purity of the samples was analyzed using SDS-PAGE followed by Coomassie Blue staining. Both full-length C as well as the C4 domain have poor solubility and are very unstable. These proteins were freshly purified prior to each biochemical experiment. The molecular weights of the recombinant proteins were also verified by mass spectrometry on a MALDI-TOF (Bruker Daltonics, Inc.) mass spectrometer.
The Western blot analysis to determine the molecular weight of C in situ was performed according to the standard procedure outlined in Molecular Cloning (18). Cell free lysate of H37Rv was obtained from the TB vaccine testing and research material contract at the Colorado State University. The cell lysate and purified protein samples were resolved in 10% SDS-PAGE and transferred to a nitrocellulose membrane. A polyclonal antibody raised in rabbit against C127–311 (a smaller construct containing residues 127–311aa based on the annotated sequence of H37Rv) was used as the primary antibody for C detection. Western blots were developed using the AEC (Sigma) substrate with horseradish peroxidase-labeled sheep anti-rabbit IgG (Bangalore Genei Co.).
Site-directed mutagenesis experiments were performed using a PCR-based method (19). The primers GATAGGCGACGAACCGCGCCACGTCTTGCTGGG (for W164A) and CGATGGCCAGCAACGCAGTTCGGGCGCTGG (for the W203A point variant) were used. These mutations were confirmed by DNA sequencing.
Fluorescence Spectroscopy—All fluorescence studies were performed on a JOBIN YVON FlouroMax-3 fluorimeter at room temperature. The fluorescence excitation was set at 280 nm, and emission spectra were recorded from 300 to 400 nm at a bandwidth of 1 nm. The excitation and emission slit widths were set to 3 and 5 nm, respectively. Each spectrum is an average of five scans. The spectra were obtained at a protein concentration of 
3 µM in 10 mM Tris-HCl, 50 mM NaCl, pH 7.5. Interactions between the C2 and C4 domains were monitored after the two protein samples were mixed and incubated at room temperature for 2 min prior to data acquisition.
Surface Plasmon Resonance Experiments—Surface plasmon resonance (SPR) assays were performed on a BIAcore 2000 instrument (BIAcore AB). All experiments were conducted at 25 °C. SPR experiments were performed with either the C2 and C4 domains immobilized onto carboxylated dextran chips (sensor chip CM5 from BIAcore AB) using the standard amine coupling procedure as recommended by the manufacturer. Immobilization resulted in a change in the refractive index corresponding to 700 and 640 resonance units for C2 and C4 respectively. Binding and kinetic assays were performed in 50 mM sodium phosphate, pH 7.4, 100 mM NaCl at flow rate of 20 µl/min. The proteins were diluted in this buffer, and experiments were carried out at concentrations ranging from 0.8 to 200 µM. Freshly purified protein samples were used for these binding assays. Dissociation was initiated by replacing the analyte with buffer. The association and dissociation curves were monitored for 120 s. Sensograms were analyzed with BIAevaluation software version 2 (BIAcore AB). A 1:1 langmuir binding model was used to fit the curves.
Model Building and Refinement of the Two Domains of C— Crystallization conditions and data collection strategies have been reported previously (16). The data collection and refinement statistics for both the domains are reported in Table 2. The N- and C-terminal domains of E. coli E (Protein Data Bank code 1OR7) were used as starting model(s) for molecular replacement. The sequence identity between C2 and N-terminal E is 23%, whereas that between the C-terminal E and C4 domain is 45%. Molecular replacement calculations were performed using the program PHASER (20). The solution for C2 and C4 had log likelihood gains of 71.52 and 489.97 with corresponding Z-scores of 5.21 and 15.53, respectively. There were two molecules in the asymmetric unit in the case of C2 and three in the asymmetric unit for the C4 domain. Both structures were refined using tight non-crystallographic symmetry restraints. Iterated cycles of model building using Coot (21) and refinement using Refmac (22) led to the final model for C2 with an Rcryst of 18.9% and Rfree of 24.3%. The final model C4 had Rcryst of 21.0% and Rfree of 26.7% The final model of C2 consists of 88 residues, 4 sulfate ions, and 20 water molecules, whereas that for the C4 domain has 60 residues, 8 sulfate ions, and 17 water molecules.
Computational Strategies to Identify Potential C-interacting Proteins—In M. tuberculosis the following -anti pairs have been reported: D-Rv3413c, E-Rv1222, F-Rv3287c, H-Rv3222c, and L-Rv0736 (23–27). D, F, H, and their respective anti- factors are canonical in the sense that these pairs occur as a part of one operon. C is the only member in an operon in both the M. tuberculosis strains H37Rv and CDC1551. Assuming that interacting proteins would show correlated expression levels under certain conditions, the correlation coefficients and t values (Student's t test) between a given factor and the corresponding anti- pair were calculated in different conditions (7H9 medium (n = 4), BALB/c mice (n = 4), Scid mice (n = 4), stationary state (n = 6), low oxygen dormancy (n = 9) using following equations.
 | (Eq. 1) |
 | (Eq. 2) |
To predict all the interacting proteins/anti- factor(s) for C, we examined all the transcription regulatory genes that are present in Myobacterium leprae (M. leprae has only four factors A, B, C, and E). An amino acid sequence based search was also performed to locate putative anti- factors on the basis of the sequence signature (HXXXCXXC) (27). Transmembrane protein prediction was done using the program Conpred (28). These results are compiled in supplemental Table 1.
|
RESULTS AND DISCUSSION
|
|---|
Characterization of the Domain Organization of M. tuberculosis C—Differences in the annotation of C in the two M. tuberculosis strains H37Rv (13) and CDC1551 (29) led to the identification of an N-terminal 126 residue long polypeptide preceding the structured domain C2. The C2 and C4 domains are connected by a flexible 25-amino acid-long linker. Sequence-based prediction of low complexity regions (30) in this protein (Fig. 1A) suggests that the N-terminal domain preceding C2 is largely unfolded. M. tuberculosis extra-cytoplasmic C thus appears to be more primary factor-like in terms of the domain organization except that it lacks the region 3.2 that lies between the C2 and C4 domains and is involved in extended -10 promoter recognition. The structure-based sequence alignment of M. tuberculosis C is shown in Fig. 2 (adapted from Ref. 2). Interestingly, M. leprae C does not have this N-terminal region. Based on the sequence alignment and patterns of protease sensitivity, four expression constructs of C were examined: the full-length C, the smaller construct containing only the C2 and C4 domains, and the two independent domains C2 and C4 (Table 1 and Fig. 3). In a Western blot experiment using a cell-free lysate of M. tuberculosis H37Rv (obtained from the Tuberculosis Research Center, Colorado State University), the polyconal antibody raised against the shorter length construct (lacking the 126-amino acid polypeptide at the N terminus) recognized the full-length C. C is thus a 311-amino acid-long protein in both the laboratory (H37Rv) as well as the clinical (CDC1551) strains of M. tuberculosis (Fig. 3).
Structure Determination of the C2 and the C4 Domains—The E2 and E4 domains of E. coli E were used as search models to solve the structures of M. tuberculosis C2 and C4 domains by Molecular Replacement. Overall, these two proteins have 32% identity in the amino acid sequence although the C-terminal region is more conserved than the N-terminal polypeptide. Thus while M. tuberculosis C2 and E. coli E2 have 23% identity, M. tuberculosis C4 and E. coli E4 are more similar with 44% sequence identity. The crystallization of the C2 and the C4 domains has been reported earlier (16). The data collection and refinement statistics are compiled in Table 2 (more details in supplemental Fig. 1). Despite the low sequence similarity, the overall topology of the C2 and the C4 domains is similar to that of the known factors reported till date (3, 4, 5, 6). The backbone C superposition between C2 with E. coli A2 shows a root-mean-square deviation of 2.97 Å (8% identity over 77 amino acid residues), whereas C2 superposes better with E. coli E2 with an rootmean-square deviation of 1.4 Å (24% identity over 88 residues). The C4 domain that interacts with the -35 promoter element is structurally more conserved with a backbone rmsd of 1.6 Å with the corresponding domain of the primary factor A4. Molecular modeling and docking based on the structure of the Thermus aquaticus RNAP suggests that the C2 and C4 domains would be spatially separated by a distance of 50 Å (data not shown) when bound to the RNAP. This distance is compatible with the 25-residue linker joining the C2 and C4 domains. Studies on the primary factor A have shown that aromatic and charged residues in region 2 are involved in recognizing the -10 element and subsequent strand separation (31). On the basis of multiple sequence alignment, Trp-203 was found to be universally conserved and is likely to be involved in interactions with the Pribnow box element. Based on a model of E. coli E-holoenzyme and the E-RseA structure, Campbell et al. (4) proposed that the E. coli anti- factor RseA functions by sterically occluding the two primary RNAP-binding regions on E. Activation of the E regulon occurs when E is released from RseA upon degradation by the Hho (DegS) protease. In the E-RseA structure, the anti- factor was found to be sandwiched between the E2 and the E4 domains. Several substitutions in E. coli E4, R178G, I181A, and V185A, were identified as those that led to defective RseA binding (4). In the case of M. tuberculosis, the equivalent Arg residue is conserved, whereas the other two positions (E. coli/M. tuberculosis) are replaced by (Ile/Leu) and (Val/Ala).
View larger version (59K):
[in this window]
[in a new window]
|
FIGURE 3.
M. tuberculosisC has an N-terminal polypeptide preceding the C2 and C4 domains. A, Western blot analysis using the cell free lysate of M. tuberculosis H37Rv. The size of the protein corresponds to that of the full-length 311-residue protein of C. Lane 1, prestained protein marker; lane 2, M. tuberculosis H37RV cell-free lysate; lane 3, purified C1–311aa. B, 12% SDS-PAGE gel showing different constructs used in the present study. Lane 1, protein marker; lane 2, C1–311aa (35.3 kDa); lane 3, C127–311aa (22.5 kDa); lane 4, C2 (14.7 kDa); lane 5, C4 (9.5 kDa). The details of these expression constructs are given in Table 1.
|
|
Identification and Verification of Potential C-interacting Proteins in M. tuberculosis—M. tuberculosis C is different from other ECF factors as there is no anti- factor located downstream of C in the same operon. To understand the mechanism of regulation of transcription by C, attempts were made to identify the interacting partners that could activate/inactivate this protein. Co-immunoprecipitation using the purified C antibody using the cell free lysate (obtained from the Tuberculosis Research Center, Colorado State University) was used to isolate proteins that interact with C. These proteins were identified by in situ digestion using trypsin followed by peptide mass-fingerprinting using a MALDI-TOF mass spectrometer and analyzed using MAS-COT (Bruker Daltonics, Inc.). Few components of RNAP could be detected at high confidence levels (data not shown). However, no potential anti- factor could be identified in this experiment. Several computational tools were also used to identify proteins that could potentially interact with C. These results including relevant entries from the data base STRING (32) are compiled in Table 3. The application of this tool for the prediction of protein-protein interactions suffers from the problem that functional interaction does not necessarily imply direct physical interaction. Based on the co-occurrence of genes in related species, proteins exhibiting similar phylogenetic profiles can be predicted to be functionally linked i.e. they occur as a structural complex or are involved in a common metabolic pathway. Although 29 potential interacting proteins could be identified using this approach, none showed a significant correlation in their mRNA expression levels with that of C. The Rosetta tool for gene fusion analysis (33) led to the identification of the gene Rv0093c. In this method the existence of a fusion protein in one genome allows the prediction of the interaction between the single domain proteins in other genomes. Rv0093c also has an amino acid sequence signature proposed for anti- factors that regulate oxidative stress (27), and a conditional correlation was observed between the expression level of this protein versus C in one DNA microarray data set. A pertinent observation in this regard is that notwithstanding the large errors involved in the gene expression levels obtained using DNA microarray technology, well characterized -anti pairs exhibit significant correlation ( = 0.05) under specific environmental or growth conditions (Table 4).
View this table:
[in this window]
[in a new window]
|
TABLE 3
Computational analysis of proteins that can interact with C Results compiled from the program STRING (32) are shown.
|
|
A sequence based search for RseA-like proteins in the M. tuberculosis genome led to the identification of a protein SirR (32% identity between the E. coli RseA sequence that interacts with E and M. tuberculosis SirR). The annotation of SirR in the M. tuberculosis genome describes it as an iron-dependent transcription repressor. Two strategies, one involving co-expression using pET-Duet1 vector and the other by in vitro studies using purified recombinant proteins, were adopted to examine interactions between C and the predicted anti- factors SirR and Rv0093c. In the co-expression approach, C was cloned with a polyhistidine tag at the N terminus to enable the complex to be purified by affinity chromatography. No interaction could be detected between either of these proteins and C in vitro (data not shown). This finding could probably be rationalized on the basis of the variations seen in residues that are involved in RseA recognition.
Interaction between the Two Promoter Recognition Domains C2 and C4—Fluorescence measurements using the intrinsic tryptophan residue in C2 were used to monitor the interactions between the two promoter recognizing domains of C. The fluorescence spectra are shown in Fig. 4. There are two tryptophans in C2 (region 2) and none in C4 (region 4) (Fig. 4B). This fortuitous distribution of tryptophan residues helped us examine the interactions between the C2 and C4 domains. A fluorescence spectrum of native C (127–311 residues) showed an emission maximum at 342 nm while C2 showed an emission maximum at 349 nm. Upon the addition of C4 in stoichiometric ratio, a blue shift (7 nm) in the fluorescence spectrum was observed with a reduction in the emission intensity. A representative binding reaction wherein the C4 domain is titrated into the C2 domain is shown in Fig. 4A. This fluorescence titration suggests a weak interaction between the C4 and C2 domains (Kd 2 µM).
Of the two tryptophans in C2, Trp-203 is involved in DNA melting (Pribnow box element). Based on molecular modeling analysis (data not shown) Trp-164 is likely to interact with the RNAP. These observations led us to investigate the specificity of interactions (given the fact that the two domains are connected by a flexible linker of 25 amino acids long) and identify the region where C4 binds C2. To address these questions, two point variants of C, viz. W164A and W203A, were constructed in C127–311 (medium length C that lacks the positively charged N-terminal domain, which contains three tryptophan residues). The W164A mutant protein had a fluorescence emission maximum at 335 nm, whereas the W203A variant had its emission maximum at 353 nm (Fig. 4B). The blue shift seen in the W164A variant suggests that C4 interacts C2 in the region that would lead to the partial burial of W203 (Fig. 4C). Interactions between the C2 and C4 domains thus result in the occlusion of the Pribnow box recognition element.
The interaction between the C2 and C4 domains was also monitored by surface plasmon resonance experiments (Fig. 4D). SPR studies of the interaction between the C2 and C4 domains suggest a low affinity binding between these two domains (Kd = 1.81 ± 0.03 µM). The binding affinity and kinetic parameters were comparable when either the C2 and C4 domain was immobilized. The highly polar nature of this interdomain interaction was apparent from a size exclusion chromatography experiment performed at medium salt concentrations (250 mM NaCl) where the two domains migrate separately. This was also supported by fluorescence quenching experiments where increasing salt concentrations not only reduced the fluorescence quenching but also resulted in a red shift in the emission maximum (supplemental Fig. 3).
In summary, the structural and biophysical studies on the two promoter recognition domains of C shows an interaction between the C2 and C4 domains that is mostly governed by polar residues. This interaction involves the occlusion of the region of C that participates in the recognition of the -10 promoter element. The binding of M. tuberculosis C to the core RNAP would thus involve substantial structural re-arrangement to release C from its autoinhibited state. These observations thus provide an alternate mechanism for the regulation of the ECF factor, C.
|
FOOTNOTES
|
|---|
The atomic coordinates and structure factors (code 2O7G and 2O8X) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).
* This work was supported in part by grants from the Council for Scientific and Industrial Research (CSIR), Government of India, and the Wellcome Trust (UK). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. 1–4 and Table 1.
1 Senior Research Fellow of the CSIR.
2 To whom correspondence should be addressed. Tel.: 91-80-2293-3219; Fax: 91-80-23600535; E-mail: bgopal{at}mbu.iisc.ernet.in.
3 The abbreviations used are: RNAP, RNA polymerase; ECF, extracytoplasmic function; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight.
|
ACKNOWLEDGMENTS
|
|---|
We thank Drs. S. Vijaya, E. Davis, and K. G. Papavinasasundaram for the kind gifts of M. tuberculosis genomic DNA.
|
REFERENCES
|
|---|
- Helmann, J. D. (2002) Adv. Microbial. Physiol. 46, 47-109[CrossRef][Medline]
[Order article via Infotrieve]
- Waagmeester, A., Thompson, J., and Reyrat, J. M. (2005) Trends Microbiol. 13, 505-509[CrossRef][Medline]
[Order article via Infotrieve]
- Campbell, E. A., Muzzin, O., Chlenov, M., Sun, J. L., Olson, C. A., Weinman, O., Trester-Zedlitz, M. L., and Darst, S. A. (2002) Mol. Cell. 9, 527-539[CrossRef][Medline]
[Order article via Infotrieve]
- Campbell, E. A., Tupy, J. L., Gruber, T. M., Wang, S., Sharp, M. M., Gross, C. A., and Darst, S. A. (2003) Mol. Cell. 11, 1067-1078[CrossRef][Medline]
[Order article via Infotrieve]
- Murakami, K., and Darst, S. A. (2003) Curr. Opin. Struct. Biol. 13, 131-139
- Sorenson, M. K., Ray, S. S., and Darst, S. A. (2004) Mol. Cell. 14, 127-138[CrossRef][Medline]
[Order article via Infotrieve]
- Lonetto, M., Gribskov, M., and Gross, C. A. (1992) J. Baceriol. 174, 3843-3849
- Costanzo, A., and Ades, S. E. (2006) J. Bacteriol. 188, 4627-4634[Abstract/Free Full Text]
- Manganelli, R., Dubnau, E., Tyagi, S., Kramer, F. R., and Smith, I. (1999) Mol. Microbiol. 31, 715-724[CrossRef][Medline]
[Order article via Infotrieve]
- Manganelli, R., Voskuil, M. I., Schoolnik, G. K., Dubnau, E., Gomez, M., and Smith, I. (2002) Mol. Microbiol. 45, 365-374[CrossRef][Medline]
[Order article via Infotrieve]
- Manganelli, R., Proveddi, R., Rodrigue, S., Beaucher, J., Gaudreau, L., and Smith, I. (2004) J. Bacteriol. 186, 895-902[Free Full Text]
- Campbell, E. A., Masuda, S., Sun, J. L., Muzzin, O., Olson, C. A., Wang, S., and Darst, S. A. (2002) Cell 108, 795-807[CrossRef][Medline]
[Order article via Infotrieve]
- Camus, J. C., Pryor, M. J., Medigue, C., and Cole, S. T. (2002) Microbiology 148, 2967-2973[Abstract/Free Full Text]
- Sun, R., Converse, P. J., Ko, C., Tyagi, S., Morrison, N. E., and Bishai, W. R. (2004) Mol. Microbiol. 52, 25-38[CrossRef][Medline]
[Order article via Infotrieve]
- Karls, R. K., Guarner, J., McMurray, D. N., Birkness, K. A., and Quinn, F. D. (2006) Microbiology 152, 1591-1600[Abstract/Free Full Text]
- Thakur, K. G., and Gopal, B. (2005). Acta Crystallogr. Sect. F 61, 779-781[CrossRef]
- Golovanov, A. P., Hautbergue, G. M., Wilson, S. A., and Lian, L. Y. (2004) J. Am. Chem. Soc. 126, 8933-8939[CrossRef][Medline]
[Order article via Infotrieve]
- Sambrook, J., and Russell, D. W. (2001) in Molecular Cloning: A Laboratory Manual, pp. A8.52-A8.55, 3rd Ed., Cold Spring Harbor Press, Cold Spring Harbor, NY
- Shenoy, A. R., and Visweswariah, S. S. (2003) Anal. Biochem. 319, 335-336[CrossRef][Medline]
[Order article via Infotrieve]
- Storoni, L. C., McCoy, A. J., and Read, R. J. (2004). Acta Crystallogr. Sect. D Biol. Crystallogr. 60, 432-438[CrossRef][Medline]
[Order article via Infotrieve]
- Emsley, P., and Cowtan, K. (2004). Acta Crystallogr. Sect. D Biol. Crystallogr. 60, 2126-2132[CrossRef][Medline]
[Order article via Infotrieve]
- Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Acta Crystallogr. Sect. D Biol. Crystallogr. 53, 240-255[CrossRef][Medline]
[Order article via Infotrieve]
- Raman, S., Hazra, R., Dascher, C. C., and Husson, R. N. (2004) J. Bacteriol. 186, 6605-6616[Abstract/Free Full Text]
- Manganelli, R., Voskuil, M. I., Schoolnik, G. K., and Smith, I. (2001) Mol. Microbiol. 41, 423-437[CrossRef][Medline]
[Order article via Infotrieve]
- Beaucher, J., Rodrigue, S., Jacques, P.-E., Smith, I., Brzezinski, R., and Gaudreau, L. (2002) Mol. Microbiol. 45, 1527-1540[CrossRef][Medline]
[Order article via Infotrieve]
- Song, T. S. L., Dove, K. H., Lee, and Husson, R. N. (2003) Mol. Microbiol. 50, 949-959[CrossRef][Medline]
[Order article via Infotrieve]
- Hahn, M. Y., Raman, S., Ananya, M., and Husson, R. N. (2005) J. Bacteriol. 187, 7062-7071[Abstract/Free Full Text]
- Arai, M., Mitsuke, H., Ikeda, M., Xia, J.-X., Kikuchi, T., Satake, M., and Shimizu, T. (2004) Nucleic Acids Res. 32, W390-W393[Abstract/Free Full Text]
- Fleischmann, R. D., Alland, D., Eisen, J. A., Carpenter, L., White, O., Peterson, J., DeBoy, R., Dodson, R., Gwinn, M., Haft, D., Hickey, E., Kolonay, J. F., Nelson, W. C., Umayam, L. A., Ermolaeva, M., Salzberg, S. L., Delcher, A., Utterback, T., Weidman, J., Khouri, H., Gill, J., Mikula, A., Bishai, W., Jacobs, W. R., Jr., Venter, J. C., and Fraser, C. M. (2002). J. Bacteriol. 184, 5479-5490[Abstract/Free Full Text]
- Priluski, J., Felder, C. E., Zeev-Ben-Mordehai, T., Rydberg, E. H., Man, O., Beckmann, J. S., Silman, I., and Sussman, J. L. (2005) Bioinformatics 21, 3435-3438[Abstract/Free Full Text]
- Tomsic, M., Tsujikawa, L., Panaghie, G., Wang, Y., Azok, J., and deHaseth, P. L. (2001) J. Biol. Chem. 276, 31891-31896[Abstract/Free Full Text]
- Von Mering, C., Jensen, L. J., Snel, B., Hooper, S. D., Krupp, M., Foglierini, M., Jouffre, N., Huynen, M. A., and Bork, P. (2005) Nucleic Acids Res. 33, D433-D437[Abstract/Free Full Text]
- Strong, M., Graeber, T. G., Beeby, M., Pellegrini, M., Thomson, M. J., Yeates, T. O., and Eisenberg, D. (2003) Nucleic Acids Res. 31, 7099-7109[Abstract/Free Full Text]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
TOP
ABSTRACT
INTRODUCTION
