HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 282, Issue 7, 4711-4718, February 16, 2007

This Article Abstract Full Text (PDF) All Versions of this Article: 282/7/4711    most recent M606283200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Thakur, K. G. Articles by Gopal, B. Search for Related Content PubMed PubMed Citation Articles by Thakur, K. G. Articles by Gopal, B. Social Bookmarking                      What's this?

Structural and Biophysical Studies on Two Promoter Recognition Domains of the Extra-cytoplasmic Function Factor ^C from Mycobacterium tuberculosis^*

From the Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560 012, India

Received for publication, June 30, 2006 , and in revised form, September 11, 2006.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
factors are transcriptional regulatory proteins that bind to the RNA polymerase and dictate gene expression. The extracytoplasmic function (ECF) factors govern the environment dependent regulation of transcription. ECF factors have two domains ₂ and ₄ that recognize the -10 and -35 promoter elements. However, unlike the primary factor ^A, the ECF factors lack ₃, a region that helps in the recognition of the extended -10 element and _1.1, a domain involved in the autoinhibition of ^A in the absence of core RNA polymerase. Mycobacterium tuberculosis ^C is an ECF factor that is essential for the pathogenesis and virulence of M. tuberculosis in the mouse and guinea pig models of infection. However, unlike other ECF factors, ^C does not appear to have a regulatory anti- factor located in the same operon. We also note that M. tuberculosis ^C differs from the canonical ECF factors as it has an N-terminal domain comprising of 126 amino acids that precedes the ^C₂ and ^C₄ domains. In an effort to understand the regulatory mechanism of this protein, the crystal structures of the ^C₂ and ^C₄ domains of ^C were determined. These promoter recognition domains are structurally similar to the corresponding domains of ^A despite the low sequence similarity. Fluorescence experiments using the intrinsic tryptophan residues of ^C₂ as well as surface plasmon resonance measurements reveal that the ^C₂ and ^C₄ domains interact with each other. Mutational analysis suggests that the Pribnow box-binding region of ^C₂ is involved in this interdomain interaction. Interaction between the promoter recognition domains in M. tuberculosis ^C are thus likely to regulate the activity of this protein even in the absence of an anti- factor.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
The slow growing pathogen, Mycobacterium tuberculosis, has only one ribosomal RNA operon. An efficient transcription mechanism is thus essential for the survival and pathogenecity of this bacillus. Although a third of the human population are carriers of this pathogen, only a few contract this disease. This bacillus can lie latent in the host for prolonged periods of time till a mycobacterial infection gets triggered, most often in the setting of decreased host immunity. Studies that help further our understanding of the latent phase of this bacillus are thus vital to understand the mechanisms of pathogenesis and virulence in this organism. This ability of M. tuberculosis to survive in the hostile environmental conditions in the carrier is brought about by adaptability to rapidly changing environmental conditions. The survival mechanism is thus crucially dependent on efficient communication between the mechanism that senses the environment and the molecules that regulate transcription.

The DNA-dependent RNA polymerase (RNAP)³ that controls gene expression consists of five domains-two subunits, one subunit and the and ' domains. The factor reversibly associates with the RNAP and provides the RNAP enzyme with the ability to recognize promoter regions on the DNA template. M. tuberculosis has a total of 13 factors: three primary factors and 10 extracytoplasmic function (ECF) factors. Differences in the promoter specificity of these factors lead to differential gene expression (1, 2). The task of environment-dependent transcription modulation is performed by the ECF factors. Regulatory mechanisms, in turn, dictate which factors get activated to bind to the apo-RNAP and initiate transcription and which ones are not. This regulatory mechanism is coupled to a signal transduction system that senses the environment. The interplay between signal transduction and the transcriptional regulatory mechanisms allows the bacillus to respond to changes in the environment by synthesizing new proteins or down-regulating others.

Studies on the transcription mechanism in Escherichia coli have shown that a factor directs promoter-specific transcription initiation by specific interactions between two hexamers of a consensus DNA sequence, the Pribnow box (-10 element) and the -35 element. The crystal structure and limited proteolysis experiments on the principal factor ^A revealed a structural arrangement comprising of a series of domains connected by flexible linkers. The utility of this structural arrangement is borne out by the observation that substantial structural rearrangements take place in the factor during transcription initiation. Exposed surfaces of each of these domains were found to be important for RNAP binding (3). Interaction with the core RNAP has been demonstrated to structurally rearrange the factor into an active conformation in which the DNA-binding regions of ₂ and ₄ domains are exposed and appropriately positioned to recognize the -10 and -35 elements (3–6).

Two distinct types of mechanisms have been proposed to describe the regulation of the activity of the factors that belong to the ⁷⁰ family. Thus while autoinhibition by the N-terminal domain mediates the activity of the principal factor, ^A, protein-protein interactions mediated by the anti- and anti-anti- factors control factor concentrations in the case of the ECF factors. Other regulatory mechanisms have been proposed wherein factor activity is controlled by stimulatory signals (such as the phosphorylation and de-phosphorylation processes controlled by the kinases and phosphatases) or mechanisms that can control the intracellular factor concentration by localizing it on the inner surface of the cell membrane. In the case of the E. coli factor ^E (7) for example, many of the key regulators of ^E activities (products of the rse genes) are co-transcribed with RpoE to form an operon: rpoE, rseA, rseB, and rseC. The protein RseA is an anti- factor for ^E, whereas the periplasmic RseB protein enhances its activity. The activity of ^E can also be regulated by cytoplasmic factors like guanosine 3',5'-bispyrophosphate (ppGpp). The signaling pathway employed in this process is distinct from the pathway that is activated upon extracytoplasmic stress (8). Very little is known of these processes in mycobacteria, although recent reports indicate that work to delineate the regulatory mechanism of ^E and another ^E-like factor ^H are presently in progress (9–11). The anti- factor, as seen in the cases of the SpoIIAB (12) and the ^E-RseA complex (4), appears to bind the free factor, thereby preventing its interaction with the core RNAP. The ²⁸/FlgM complex (6) on the other hand is different from the others in that FlgM can also form a ternary complex with the ²⁸ holoenzyme, thereby destabilizing the ²⁸/RNAP interaction. The modes of factor anti- factor interactions also differ between the ⁷⁰ and ²⁸ families. The anti- factor RseA is sandwiched between ^E₂ and ^E₄ domains of ^E, whereas the FlgM protein wraps around the outside of ²⁸ and occludes the core RNAP-binding determinants on ²⁸₂ and ²⁸₄.

M. tuberculosis has about 190 transcription regulators (13), which include 13 factors, 11 two-component systems, 5 unpaired response regulators, 11 protein kinases, and 140 other proteins. The resulting interaction among these proteins suggests a complex system of overlapping functions and redundancies (9). Four factors, ^A, ^B, ^C, and ^E, of the 13 in M. tuberculosis are conserved in all the pathogenic mycobacteria. Only four factors in M. tuberculosis, ^A, ^C, ^D, and ^L, have been examined in detail for their roles in virulence and pathogenecity. The ECF factor ^C is essential for lethality in mice but is not required for bacterial survival in this species (14). Based on genomic microarray data, ^C was demonstrated to modulate the expression of several key virulence associated genes including hspX, senX3, and mtrA, a two-component sensor kinase, and a two-component response regulator. The phenotype of the ^C mutant of M. tuberculosis can thus persist in tissues but is attenuated in its ability to elicit lethal immunopathology (14). A recent report also suggests ^C to be a key regulator of pathogenesis and adaptive survival in the lung and spleen of guinea pigs (15). These in vivo studies in two different animal models thus demonstrate the role of^C in the pathogenesis and virulence of M. tuberculosis. Although ^C does not appear to have an anti- factor located in the same operon, in silico analysis for the identification of potential interacting partners for ^C suggested two proteins SirR and the un-annotated protein Rv0093c. However, the interaction between these proteins and^C could not be substantiated by experimental evidence.

In this manuscript, we report the biochemical and structural analysis of the domain organization of ^C. Despite the low sequence similarity between the promoter recognition domains of ^C with the primary factor ^A, we observe that the crystal structure of the two promoter recognition domains are conserved. Spectroscopic studies using the intrinsic tryptophan fluorescence as well as surface plasmon resonance experiments suggest that the ^C₂ and ^C₄ domains interact in vitro. Interactions between the two promoter recognition domains of ^C which involves the occlusion of the Pribnow box recognition region of ^C₂ suggests that substantial interdomain rearrangements would be needed to activate ^C even in the absence of an anti factor.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Cloning, Expression, and Purification of ^C, and the ^C₂ and ^C₄ Domains—The details of the expression constructs used in this study are compiled in Table 1. After transforming the plasmid into BL21 (DE3) or Rosetta origami cells (Novagen, Inc.), the cells were grown in Luria broth with an antibiotic selection (100 µg/ml ampicillin and 30 µg/ml chloramphenicol) to an A₆₀₀ nm of 0.5–0.6. The cells were induced with 0.2 mM IPTG (final concentration). Subsequently, the growth temperature was lowered to 290 K, and cells were grown for further 12–18 h before they were spun down and stored at 193 K. Full-length ^C (311 amino acids) was purified in denaturing conditions using 8 M urea. Refolding of the denatured protein was carried out in a stepwise fashion with five buffer changes (each lasting about 3–4 h) with decreasing concentration of urea. The recombinant proteins from the other three constructs were purified under native conditions as described earlier (16). The proteins were further purified by size exclusion chromatography using a Superdex S-200 column (Amersham Biosciences) after the affinity chromatography step. The proteins were concentrated using membrane based centrifugal ultra filtration (Amicon). L-Arginine and L-glutamic acid were added to the final concentration of 50 mM each during the concentration step (17). The purity of the samples was analyzed using SDS-PAGE followed by Coomassie Blue staining. Both full-length ^C as well as the ^C₄ domain have poor solubility and are very unstable. These proteins were freshly purified prior to each biochemical experiment. The molecular weights of the recombinant proteins were also verified by mass spectrometry on a MALDI-TOF (Bruker Daltonics, Inc.) mass spectrometer.

View this table: [in this window] [in a new window]   TABLE 1 List of expression constructs used in the analysis of the domain organization of M. tuberculosis C

Site-directed mutagenesis experiments were performed using a PCR-based method (19). The primers GATAGGCGACGAACCGCGCCACGTCTTGCTGGG (for W164A) and CGATGGCCAGCAACGCAGTTCGGGCGCTGG (for the W203A point variant) were used. These mutations were confirmed by DNA sequencing.

Fluorescence Spectroscopy—All fluorescence studies were performed on a JOBIN YVON FlouroMax-3 fluorimeter at room temperature. The fluorescence excitation was set at 280 nm, and emission spectra were recorded from 300 to 400 nm at a bandwidth of 1 nm. The excitation and emission slit widths were set to 3 and 5 nm, respectively. Each spectrum is an average of five scans. The spectra were obtained at a protein concentration of 3 µM in 10 mM Tris-HCl, 50 mM NaCl, pH 7.5. Interactions between the ^C₂ and ^C₄ domains were monitored after the two protein samples were mixed and incubated at room temperature for 2 min prior to data acquisition.

Surface Plasmon Resonance Experiments—Surface plasmon resonance (SPR) assays were performed on a BIAcore 2000 instrument (BIAcore AB). All experiments were conducted at 25 °C. SPR experiments were performed with either the ^C₂ and ^C₄ domains immobilized onto carboxylated dextran chips (sensor chip CM5 from BIAcore AB) using the standard amine coupling procedure as recommended by the manufacturer. Immobilization resulted in a change in the refractive index corresponding to 700 and 640 resonance units for ^C₂ and ^C₄ respectively. Binding and kinetic assays were performed in 50 mM sodium phosphate, pH 7.4, 100 mM NaCl at flow rate of 20 µl/min. The proteins were diluted in this buffer, and experiments were carried out at concentrations ranging from 0.8 to 200 µM. Freshly purified protein samples were used for these binding assays. Dissociation was initiated by replacing the analyte with buffer. The association and dissociation curves were monitored for 120 s. Sensograms were analyzed with BIAevaluation software version 2 (BIAcore AB). A 1:1 langmuir binding model was used to fit the curves.

Model Building and Refinement of the Two Domains of ^C— Crystallization conditions and data collection strategies have been reported previously (16). The data collection and refinement statistics for both the domains are reported in Table 2. The N- and C-terminal domains of E. coli ^E (Protein Data Bank code 1OR7) were used as starting model(s) for molecular replacement. The sequence identity between ^C₂ and N-terminal ^E is 23%, whereas that between the C-terminal ^E and ^C₄ domain is 45%. Molecular replacement calculations were performed using the program PHASER (20). The solution for ^C₂ and ^C₄ had log likelihood gains of 71.52 and 489.97 with corresponding Z-scores of 5.21 and 15.53, respectively. There were two molecules in the asymmetric unit in the case of ^C₂ and three in the asymmetric unit for the ^C₄ domain. Both structures were refined using tight non-crystallographic symmetry restraints. Iterated cycles of model building using Coot (21) and refinement using Refmac (22) led to the final model for ^C₂ with an R_cryst of 18.9% and R_free of 24.3%. The final model ^C₄ had R_cryst of 21.0% and R_free of 26.7% The final model of ^C₂ consists of 88 residues, 4 sulfate ions, and 20 water molecules, whereas that for the ^C₄ domain has 60 residues, 8 sulfate ions, and 17 water molecules.

(Eq. 1)

(Eq. 2)

To predict all the interacting proteins/anti- factor(s) for ^C, we examined all the transcription regulatory genes that are present in Myobacterium leprae (M. leprae has only four factors ^A, ^B, ^C, and ^E). An amino acid sequence based search was also performed to locate putative anti- factors on the basis of the sequence signature (HXXXCXXC) (27). Transmembrane protein prediction was done using the program Conpred (28). These results are compiled in supplemental Table 1.

	RESULTS AND DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Characterization of the Domain Organization of M. tuberculosis ^C—Differences in the annotation of ^C in the two M. tuberculosis strains H37Rv (13) and CDC1551 (29) led to the identification of an N-terminal 126 residue long polypeptide preceding the structured domain ^C₂. The ^C₂ and ^C₄ domains are connected by a flexible 25-amino acid-long linker. Sequence-based prediction of low complexity regions (30) in this protein (Fig. 1A) suggests that the N-terminal domain preceding ^C₂ is largely unfolded. M. tuberculosis extra-cytoplasmic ^C thus appears to be more primary factor-like in terms of the domain organization except that it lacks the region 3.2 that lies between the ^C₂ and ^C₄ domains and is involved in extended -10 promoter recognition. The structure-based sequence alignment of M. tuberculosis ^C is shown in Fig. 2 (adapted from Ref. 2). Interestingly, M. leprae ^C does not have this N-terminal region. Based on the sequence alignment and patterns of protease sensitivity, four expression constructs of ^C were examined: the full-length ^C, the smaller construct containing only the ^C₂ and ^C₄ domains, and the two independent domains ^C₂ and ^C₄ (Table 1 and Fig. 3). In a Western blot experiment using a cell-free lysate of M. tuberculosis H37Rv (obtained from the Tuberculosis Research Center, Colorado State University), the polyconal antibody raised against the shorter length construct (lacking the 126-amino acid polypeptide at the N terminus) recognized the full-length ^C. ^C is thus a 311-amino acid-long protein in both the laboratory (H37Rv) as well as the clinical (CDC1551) strains of M. tuberculosis (Fig. 3).

Structure Determination of the ^C₂ and the ^C₄ Domains—The ^E₂ and ^E₄ domains of E. coli ^E were used as search models to solve the structures of M. tuberculosis ^C₂ and ^C₄ domains by Molecular Replacement. Overall, these two proteins have 32% identity in the amino acid sequence although the C-terminal region is more conserved than the N-terminal polypeptide. Thus while M. tuberculosis ^C₂ and E. coli ^E₂ have 23% identity, M. tuberculosis ^C₄ and E. coli ^E₄ are more similar with 44% sequence identity. The crystallization of the ^C₂ and the ^C₄ domains has been reported earlier (16). The data collection and refinement statistics are compiled in Table 2 (more details in supplemental Fig. 1). Despite the low sequence similarity, the overall topology of the ^C₂ and the ^C₄ domains is similar to that of the known factors reported till date (3, 4, 5, 6). The backbone C superposition between ^C₂ with E. coli ^A₂ shows a root-mean-square deviation of 2.97 Å (8% identity over 77 amino acid residues), whereas ^C₂ superposes better with E. coli ^E₂ with an rootmean-square deviation of 1.4 Å (24% identity over 88 residues). The ^C₄ domain that interacts with the -35 promoter element is structurally more conserved with a backbone rmsd of 1.6 Å with the corresponding domain of the primary factor ^A₄. Molecular modeling and docking based on the structure of the Thermus aquaticus RNAP suggests that the ^C₂ and ^C₄ domains would be spatially separated by a distance of 50 Å (data not shown) when bound to the RNAP. This distance is compatible with the 25-residue linker joining the ^C₂ and ^C₄ domains. Studies on the primary factor ^A have shown that aromatic and charged residues in region 2 are involved in recognizing the -10 element and subsequent strand separation (31). On the basis of multiple sequence alignment, Trp-203 was found to be universally conserved and is likely to be involved in interactions with the Pribnow box element. Based on a model of E. coli ^E-holoenzyme and the ^E-RseA structure, Campbell et al. (4) proposed that the E. coli anti- factor RseA functions by sterically occluding the two primary RNAP-binding regions on ^E. Activation of the ^E regulon occurs when ^E is released from RseA upon degradation by the Hho (DegS) protease. In the ^E-RseA structure, the anti- factor was found to be sandwiched between the ^E₂ and the ^E₄ domains. Several substitutions in E. coli ^E₄, R178G, I181A, and V185A, were identified as those that led to defective RseA binding (4). In the case of M. tuberculosis, the equivalent Arg residue is conserved, whereas the other two positions (E. coli/M. tuberculosis) are replaced by (Ile/Leu) and (Val/Ala).

View larger version (33K): [in this window] [in a new window]   FIGURE 1. Domain organization of M. tuberculosis C. A, estimate of the folded nature of the three domains of C calculated using the program Fold Index (30). These estimates are consistent with presently available biochemical data on the principal factor A. The top panel shows the pI of different domains inC. B, molecular surface representation of the two domains of C. Residues that interact with the -10 promoter element (C2) and the -35 element (C2) are highlighted in a ball-and-stick representation. These two domains are connected by a flexible linker.

View larger version (32K): [in this window] [in a new window]   FIGURE 2. Structure based sequence alignment of 70 families of factors. The top three sequences correspond to those of the principal factors with the secondary elements that correspond to the T. aquaticus A (3). The two sequences below those of the principal factors correspond to ECF factors. The secondary structure representation in this case is based on M. tuberculosis C. Regions of the factor that have been implicated in promoter recognition are highlighted. The residues crucial for the interactions with RseA in case of E. coli E are shown in red. The abbreviations used are: MtbC, M. tuberculosis C; MtbA, M. tuberculosis A; EcolA, E. coli A; EcolE, E. coli E; TaqA, T. aquaticus A.

View larger version (59K): [in this window] [in a new window]   FIGURE 3. M. tuberculosisC has an N-terminal polypeptide preceding the C2 and C4 domains. A, Western blot analysis using the cell free lysate of M. tuberculosis H37Rv. The size of the protein corresponds to that of the full-length 311-residue protein of C. Lane 1, prestained protein marker; lane 2, M. tuberculosis H37RV cell-free lysate; lane 3, purified C1–311aa. B, 12% SDS-PAGE gel showing different constructs used in the present study. Lane 1, protein marker; lane 2, C1–311aa (35.3 kDa); lane 3, C127–311aa (22.5 kDa); lane 4, C2 (14.7 kDa); lane 5, C4 (9.5 kDa). The details of these expression constructs are given in Table 1.

View this table: [in this window] [in a new window]   TABLE 3 Computational analysis of proteins that can interact with C Results compiled from the program STRING (32) are shown.

View this table: [in this window] [in a new window]   TABLE 4 Computational analysis of proteins that can interact with C Analysis of co-expression levels of known /anti- pairs in M. tuberculosis is shown. Expression levels are correlated under different conditions. Stationary, stationary phase of growth; low oxygen, anaerobic conditions; 7h9, growth in 7H9 medium; Balb, M. tuberculosis isolated from immune competent BALB/c mice; Scid, M. tuberculosis isolated from severe combined immune-deficient (Scid) mice.

Interaction between the Two Promoter Recognition Domains ^C₂ and ^C₄—Fluorescence measurements using the intrinsic tryptophan residue in ^C₂ were used to monitor the interactions between the two promoter recognizing domains of ^C. The fluorescence spectra are shown in Fig. 4. There are two tryptophans in ^C₂ (region 2) and none in ^C₄ (region 4) (Fig. 4B). This fortuitous distribution of tryptophan residues helped us examine the interactions between the ^C₂ and ^C₄ domains. A fluorescence spectrum of native ^C (127–311 residues) showed an emission maximum at 342 nm while ^C₂ showed an emission maximum at 349 nm. Upon the addition of ^C₄ in stoichiometric ratio, a blue shift (7 nm) in the fluorescence spectrum was observed with a reduction in the emission intensity. A representative binding reaction wherein the ^C₄ domain is titrated into the ^C₂ domain is shown in Fig. 4A. This fluorescence titration suggests a weak interaction between the ^C₄ and ^C₂ domains (K_d 2 µM).

Of the two tryptophans in ^C₂, Trp-203 is involved in DNA melting (Pribnow box element). Based on molecular modeling analysis (data not shown) Trp-164 is likely to interact with the RNAP. These observations led us to investigate the specificity of interactions (given the fact that the two domains are connected by a flexible linker of 25 amino acids long) and identify the region where ^C₄ binds ^C₂. To address these questions, two point variants of ^C, viz. W164A and W203A, were constructed in ^C_127–311 (medium length ^C that lacks the positively charged N-terminal domain, which contains three tryptophan residues). The W164A mutant protein had a fluorescence emission maximum at 335 nm, whereas the W203A variant had its emission maximum at 353 nm (Fig. 4B). The blue shift seen in the W164A variant suggests that ^C₄ interacts ^C₂ in the region that would lead to the partial burial of W203 (Fig. 4C). Interactions between the ^C₂ and ^C₄ domains thus result in the occlusion of the Pribnow box recognition element.

The interaction between the ^C₂ and ^C₄ domains was also monitored by surface plasmon resonance experiments (Fig. 4D). SPR studies of the interaction between the ^C₂ and ^C₄ domains suggest a low affinity binding between these two domains (K_d = 1.81 ± 0.03 µM). The binding affinity and kinetic parameters were comparable when either the ^C₂ and ^C₄ domain was immobilized. The highly polar nature of this interdomain interaction was apparent from a size exclusion chromatography experiment performed at medium salt concentrations (250 mM NaCl) where the two domains migrate separately. This was also supported by fluorescence quenching experiments where increasing salt concentrations not only reduced the fluorescence quenching but also resulted in a red shift in the emission maximum (supplemental Fig. 3).

View larger version (30K): [in this window] [in a new window]   FIGURE 4. The C2 and C4 domains of C interact with each other in the absence of core RNA polymerase. A, interaction between the C2 and C4 domains monitored by the fluorescence spectroscopy. In this experiment the quenching of the intrinsic tryptophan flurescence was monitored as a titration with increasing concentrations of the C4 domain (that has no tryptophan residues). These data were analyzed using the SigmaPlot software suite (Systat, Inc.). B, changes in the intrinsic tryptophan fluorescence suggests an interaction between the C2 and C4 domains. C, spatial orientations of the two tryptophan and one tyrosine residues on C2. The probable site for interaction is shown with the circle. D, a representative SPR sensogram that shows interactions between the C2 and C4 domains. In this experiment, C4 was immobilized on the CM-5 chip (Amersham Biosciences), while the C2 domain was used as the analyte. The experiments were performed with different concentrations of C2.

	FOOTNOTES

 
The atomic coordinates and structure factors (code 2O7G and 2O8X) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).

^* This work was supported in part by grants from the Council for Scientific and Industrial Research (CSIR), Government of India, and the Wellcome Trust (UK). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. 1–4 and Table 1.

¹ Senior Research Fellow of the CSIR.

² To whom correspondence should be addressed. Tel.: 91-80-2293-3219; Fax: 91-80-23600535; E-mail: bgopal{at}mbu.iisc.ernet.in.

³ The abbreviations used are: RNAP, RNA polymerase; ECF, extracytoplasmic function; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight.

	ACKNOWLEDGMENTS

 
We thank Drs. S. Vijaya, E. Davis, and K. G. Papavinasasundaram for the kind gifts of M. tuberculosis genomic DNA.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 

1. Helmann, J. D. (2002) Adv. Microbial. Physiol. 46, 47-109[CrossRef][Medline] [Order article via Infotrieve]
2. Waagmeester, A., Thompson, J., and Reyrat, J. M. (2005) Trends Microbiol. 13, 505-509[CrossRef][Medline] [Order article via Infotrieve]
3. Campbell, E. A., Muzzin, O., Chlenov, M., Sun, J. L., Olson, C. A., Weinman, O., Trester-Zedlitz, M. L., and Darst, S. A. (2002) Mol. Cell. 9, 527-539[CrossRef][Medline] [Order article via Infotrieve]
4. Campbell, E. A., Tupy, J. L., Gruber, T. M., Wang, S., Sharp, M. M., Gross, C. A., and Darst, S. A. (2003) Mol. Cell. 11, 1067-1078[CrossRef][Medline] [Order article via Infotrieve]
5. Murakami, K., and Darst, S. A. (2003) Curr. Opin. Struct. Biol. 13, 131-139
6. Sorenson, M. K., Ray, S. S., and Darst, S. A. (2004) Mol. Cell. 14, 127-138[CrossRef][Medline] [Order article via Infotrieve]
7. Lonetto, M., Gribskov, M., and Gross, C. A. (1992) J. Baceriol. 174, 3843-3849
8. Costanzo, A., and Ades, S. E. (2006) J. Bacteriol. 188, 4627-4634[Abstract/Free Full Text]
9. Manganelli, R., Dubnau, E., Tyagi, S., Kramer, F. R., and Smith, I. (1999) Mol. Microbiol. 31, 715-724[CrossRef][Medline] [Order article via Infotrieve]
10. Manganelli, R., Voskuil, M. I., Schoolnik, G. K., Dubnau, E., Gomez, M., and Smith, I. (2002) Mol. Microbiol. 45, 365-374[CrossRef][Medline] [Order article via Infotrieve]
11. Manganelli, R., Proveddi, R., Rodrigue, S., Beaucher, J., Gaudreau, L., and Smith, I. (2004) J. Bacteriol. 186, 895-902[Free Full Text]
12. Campbell, E. A., Masuda, S., Sun, J. L., Muzzin, O., Olson, C. A., Wang, S., and Darst, S. A. (2002) Cell 108, 795-807[CrossRef][Medline] [Order article via Infotrieve]
13. Camus, J. C., Pryor, M. J., Medigue, C., and Cole, S. T. (2002) Microbiology 148, 2967-2973[Abstract/Free Full Text]
14. Sun, R., Converse, P. J., Ko, C., Tyagi, S., Morrison, N. E., and Bishai, W. R. (2004) Mol. Microbiol. 52, 25-38[CrossRef][Medline] [Order article via Infotrieve]
15. Karls, R. K., Guarner, J., McMurray, D. N., Birkness, K. A., and Quinn, F. D. (2006) Microbiology 152, 1591-1600[Abstract/Free Full Text]
16. Thakur, K. G., and Gopal, B. (2005). Acta Crystallogr. Sect. F 61, 779-781[CrossRef]
17. Golovanov, A. P., Hautbergue, G. M., Wilson, S. A., and Lian, L. Y. (2004) J. Am. Chem. Soc. 126, 8933-8939[CrossRef][Medline] [Order article via Infotrieve]
18. Sambrook, J., and Russell, D. W. (2001) in Molecular Cloning: A Laboratory Manual, pp. A8.52-A8.55, 3rd Ed., Cold Spring Harbor Press, Cold Spring Harbor, NY
19. Shenoy, A. R., and Visweswariah, S. S. (2003) Anal. Biochem. 319, 335-336[CrossRef][Medline] [Order article via Infotrieve]
20. Storoni, L. C., McCoy, A. J., and Read, R. J. (2004). Acta Crystallogr. Sect. D Biol. Crystallogr. 60, 432-438[CrossRef][Medline] [Order article via Infotrieve]
21. Emsley, P., and Cowtan, K. (2004). Acta Crystallogr. Sect. D Biol. Crystallogr. 60, 2126-2132[CrossRef][Medline] [Order article via Infotrieve]
22. Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Acta Crystallogr. Sect. D Biol. Crystallogr. 53, 240-255[CrossRef][Medline] [Order article via Infotrieve]
23. Raman, S., Hazra, R., Dascher, C. C., and Husson, R. N. (2004) J. Bacteriol. 186, 6605-6616[Abstract/Free Full Text]
24. Manganelli, R., Voskuil, M. I., Schoolnik, G. K., and Smith, I. (2001) Mol. Microbiol. 41, 423-437[CrossRef][Medline] [Order article via Infotrieve]
25. Beaucher, J., Rodrigue, S., Jacques, P.-E., Smith, I., Brzezinski, R., and Gaudreau, L. (2002) Mol. Microbiol. 45, 1527-1540[CrossRef][Medline] [Order article via Infotrieve]
26. Song, T. S. L., Dove, K. H., Lee, and Husson, R. N. (2003) Mol. Microbiol. 50, 949-959[CrossRef][Medline] [Order article via Infotrieve]
27. Hahn, M. Y., Raman, S., Ananya, M., and Husson, R. N. (2005) J. Bacteriol. 187, 7062-7071[Abstract/Free Full Text]
28. Arai, M., Mitsuke, H., Ikeda, M., Xia, J.-X., Kikuchi, T., Satake, M., and Shimizu, T. (2004) Nucleic Acids Res. 32, W390-W393[Abstract/Free Full Text]
29. Fleischmann, R. D., Alland, D., Eisen, J. A., Carpenter, L., White, O., Peterson, J., DeBoy, R., Dodson, R., Gwinn, M., Haft, D., Hickey, E., Kolonay, J. F., Nelson, W. C., Umayam, L. A., Ermolaeva, M., Salzberg, S. L., Delcher, A., Utterback, T., Weidman, J., Khouri, H., Gill, J., Mikula, A., Bishai, W., Jacobs, W. R., Jr., Venter, J. C., and Fraser, C. M. (2002). J. Bacteriol. 184, 5479-5490[Abstract/Free Full Text]
30. Priluski, J., Felder, C. E., Zeev-Ben-Mordehai, T., Rydberg, E. H., Man, O., Beckmann, J. S., Silman, I., and Sussman, J. L. (2005) Bioinformatics 21, 3435-3438[Abstract/Free Full Text]
31. Tomsic, M., Tsujikawa, L., Panaghie, G., Wang, Y., Azok, J., and deHaseth, P. L. (2001) J. Biol. Chem. 276, 31891-31896[Abstract/Free Full Text]
32. Von Mering, C., Jensen, L. J., Snel, B., Hooper, S. D., Krupp, M., Foglierini, M., Jouffre, N., Huynen, M. A., and Bork, P. (2005) Nucleic Acids Res. 33, D433-D437[Abstract/Free Full Text]
33. Strong, M., Graeber, T. G., Beeby, M., Pellegrini, M., Thomson, M. J., Yeates, T. O., and Eisenberg, D. (2003) Nucleic Acids Res. 31, 7099-7109[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				A. Francez-Charlot, J. Frunzke, C. Reichen, J. Z. Ebneter, B. Gourion, and J. A. Vorholt Sigma factor mimicry involved in regulation of general stress response PNAS, March 3, 2009; 106(9): 3467 - 3472. [Abstract] [Full Text] [PDF]

				K. L. Smollett, A. S. Fivian-Hughes, J. E. Smith, A. Chang, T. Rao, and E. O. Davis Experimental determination of translational start sites resolves uncertainties in genomic open reading frame predictions - application to Mycobacterium tuberculosis Microbiology, January 1, 2009; 155(1): 186 - 197. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 282/7/4711    most recent M606283200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Thakur, K. G. Articles by Gopal, B. Search for Related Content PubMed PubMed Citation Articles by Thakur, K. G. Articles by Gopal, B. Social Bookmarking                      What's this?