JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M607509200 on December 27, 2006

J. Biol. Chem., Vol. 282, Issue 8, 5404-5412, February 23, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/8/5404    most recent
M607509200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Freshour, J.
Right arrow Articles by Mitchell, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freshour, J.
Right arrow Articles by Mitchell, D. R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Chlamydomonas Flagellar Outer Row Dynein Assembly Protein Oda7 Interacts with Both Outer Row and I1 Inner Row Dyneins*Formula

Judy Freshour, Ruth Yokoyama1, and David R. Mitchell2

From the Department of Cell and Developmental Biology, State University of New York Upstate Medical University, Syracuse, New York 13210

Received for publication, August 7, 2006 , and in revised form, October 18, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We previously found that a mutation at the ODA7 locus in Chlamydomonas prevents axonemal outer row dynein assembly by blocking association of heavy chains and intermediate chains in the cytoplasm. We have now cloned the ODA7 locus by walking in the Chlamydomonas genome from nearby molecular markers, confirmed the identity of the gene by rescuing the mutant phenotype with genomic clones, and identified the ODA7 gene product as a 58-kDa leucine-rich repeat protein unrelated to outer row dynein LC1. Oda7p is missing from oda7 mutant flagella but is present in flagella of other outer row or inner row dynein assembly mutants. However, Oda7 levels are greatly reduced in flagella that lack both outer row dynein and inner row I1 dynein. Biochemical fractionation and rebinding studies support a model in which Oda7 participates in a previously uncharacterized structural link between inner and outer row dyneins.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bend propagation in eukaryotic cilia and flagella requires coordination among multiple dynein motors. These organelles typically have ten or more unique dynein isoforms whose properties combine to support a range of motile activities. The loss of different dynein isoforms has been correlated with reductions in beat frequency (1), altered waveform regulation (2), loss of resistance to viscous load (3), or reduced responsiveness to tactic signals (4). Although most of our current understanding of the functional contribution of dynein diversity results from mutant analysis in the green alga Chlamydomonas, similar results are seen in the ciliate Tetrahymena (5), the excavate Trypanosoma (6), and in chemically treated sea urchin spermatozoa (7). Sequence comparisons also support the evolution of axonemal dyneins into multiple isoforms prior to divergence of all present day organisms from the last common eukaryotic ancestor (8, 9), suggesting that dynein functional diversity plays a fundamental role in flagellar motility.

Flagellar dyneins fall into two broad groups: outer row dyneins, which are essential for maintaining normal beat frequency and for some calcium-dependent waveform changes, and inner row dyneins, which are needed for normal waveform and for some tactic responses (10). These two groups of motors also differ in their distribution along the doublet surface (11). The outer row consists of a single complex that repeats every three tubulin dimers (24 nm) along each doublet, whereas several different inner row dyneins each appear only once in every twelve tubulin dimers (96 nm). This 96-nm unit appears to correspond to one regulatory interval, as it contains one dynein regulatory complex and one set of radial spokes. Although dyneins in these two groups must be coordinately regulated, links between inner and outer row dyneins have not been identified.

Mutations that disrupt assembly of outer row dyneins in Chlamydomonas map to over 16 loci, most of which encode subunits in one of three complexes. The largest complex is the dynein motor itself, composed of three catalytic heavy chains, two intermediate chains, and at least nine light chains (12). Mutations in most motor subunits interfere with association of the remaining subunits into a complex in the cytoplasm and block subsequent attachment of this motor complex to flagellar doublet microtubules (13). The docking complex consists of three proteins that assemble on the doublet surface separately from the motor complex (14). This complex is essential for attachment of the motor complex to doublet microtubules but not for its assembly in the cytoplasm. The Oda5 protein may form part of a third complex that associates with outer row dyneins (15) and may help anchor outer row dyneins to doublet microtubules. However, not all dynein assembly loci encode proteins that function directly in the anchoring of motors to axonemal microtubules. We recently determined that the ODA16 gene product localizes to the soluble flagellar matrix and may act specifically as an assembly factor for intraflagellar transport-dependent transport of outer row dynein motor complexes to the flagellar compartment (16). Two additional dynein assembly loci, ODA7 and ODA8, remain uncharacterized at the molecular level, and their exact roles in dynein assembly have not been determined. Here, we characterize the ODA7 gene and the axonemal location of its product.

The oda7 mutation blocks outer row dynein assembly and fails to complement mutations in outer row dynein motor subunits in temporary diploid (dikaryon) analysis (17). Surprisingly, oda7 cells lack any observable pool of outer row dynein heavy chain {alpha} (the oda11 gene product), although they retain normal levels of other motor subunits (13), suggesting that oda7 interacts in some unique way with this heavy chain. The {alpha} heavy chain is a phosphoprotein (18) whose absence correlates with loss of beat frequency differences between the two flagella of Chlamydomonas (19), indicating a likely role for this heavy chain in motility regulation. Because of these unique properties, we sought to identify the ODA7 gene product and determine its role in outer row dynein assembly and function. Sequence analysis of the ODA7 gene shows that the gene product is a leucine-rich repeat (LRR)3 protein in the SDS22 protein phosphatase 1 regulatory subunit family, with orthologs among organisms that have motile cilia. Biochemical analysis indicates that the Oda7 protein interacts with both outer row dynein and I1 inner row dynein and forms a bridge between these two motors on the doublet surface. Its location suggests a role in coordination of dynein isoforms during flagellar motility.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Strains and Culture—Chlamydomonas reinhardtii wild type strains 137c, RFLP strain S1D2, and mutant strains arg7, pf9-2, ida2, ida4, ida7, oda1, pf28 (an allele of oda2), oda3, oda4, oda5, oda6, oda7, oda8, oda9, oda11, and oda12 are available from the Chlamydomonas Genetics Center (Duke University, Durham, NC). Double mutant strain oda7,arg7 was constructed and used for chromosome walking experiments and transformation rescue. Strain WS4 (pf28,pf30,ssh1) was constructed by Gianni Piperno (20) and was obtained from Winfield Sale, Emory University, Atlanta, GA. Strain OS12C (pf28,ssh1) was selected from a non-parental ditype tetrad out of a cross of WS4 with pf28 and has normal length paralyzed flagella. The other genotype represented in this tetrad had short paralyzed flagella, typical of strains that contain both an inner row I1 mutation (pf30) and an outer row dynein assembly mutation (pf28). Strain ssh1 (suppressor of short) was selected from a tetratype tetrad out of a cross between OS12C and 137c and shows motility with an altered swimming pattern and a reduced beat frequency. All strains were maintained on minimal M medium (21) supplemented as needed with 0.05% L-arginine. For high density liquid cultures and for transformation experiments, cells were grown on acetate-enriched MII medium (21).

Cloning and Sequencing ODA7—To initiate a walk to the ODA7 locus, strain oda7,arg7 was crossed with wild type RFLP strain S1D2, and 31 random oda7 progeny were selected on minimal medium. All 31 selected strains contain a crossover between the ARG7 and ODA7 loci, which are separated by ~8 centimorgans on linkage group I. DNA prepared from these strains was used for genomic Southern blots to map the relative positions of RFLP markers and oda7. RFLP marker clones CNC41 and CNA73 (obtained from Carolyn Silflow, University of Minnesota, Minneapolis), Gbp1 (obtained from Judith Berman, University of Minnesota, Minneapolis), and PBT302 (obtained from John Jarvik, Carnegie Mellon University, Pittsburgh, PA) were labeled with digoxigenin (Roche Applied Science) for use as hybridization probes on Southern blots and to screen a Chlamydomonas genomic BAC library (available from the Clemson University Genomics Institute, Clemson, SC). BAC end fragments were prepared by gel-isolating unique HindIII fragments or by vectorette PCR (22) and were random prime labeled for use as hybridization probes.

Genomic sequences surrounding the PBT302 marker, as reported in the Chlamydomonas genome Data Base Version 2.0 (//genome.jgi-psf.org/chlre2/chlre2.home.html), were examined to identify candidate ODA7 genes, and BAC clones corresponding to the regions of interest were co-transformed with pARG7.8 (arginosuccinate lyase gene plasmid) (23) into an oda7,arg7 strain by glass bead transformation (24). The resulting colonies were transferred to MI medium in flat bottomed microtiter wells and examined, on an Olympus SZ60 stereoscope with substage darkfield illumination, for restoration of wild type swimming speed. Beat frequency was measured on free swimming cells grown in MI for 18 h with aeration under a 10-h dark, 14-h light cycle, using a Zeiss Axioskop with a x20 objective under stroboscopic dark field illumination as previously described (25). The light source was passed through a 635-nm band pass filter to reduce phototactic responses.

After determining that BAC clone 17H5 could rescue the oda7 mutation, smaller genomic clones were isolated by hybridization screening of a phage genomic library in EMBL4 with a PCR-generated fragment of 17H5. Primer sequences oda7r5 (CCATTTACTTGCAGTCGGTC) and oda7f5 (GCTATGCCTAGCCATTTGAG) used to amplify the probe were selected from the predicted ODA7 coding region, based on Chlamydomonas expressed sequence tag sequences that matched predicted exons of gene model C_410113. Two overlapping phage clones, ODA7{lambda}1 and ODA7{lambda}4, were purified and tested for their ability to rescue the mutation by glass bead transformation as described above. A 5-kb NotI-BamI fragment that spanned the predicted gene was subcloned from ODA7{lambda}4 into pBluescript II (Stratagene) to create pODA7-NB5.

cDNA clones were isolated by hybridization screening of a Lambda ZapII cDNA library prepared from vegetative cells (Stress II library, available from the Chlamydomonas Genetics Center, Duke University) with the same probe used to isolate genomic clones (above). The inserts of two selected phage were cloned as pBluescript II plasmids by phagmid excision, sequenced by primer walking on both strands, and determined to be identical to each other. Sequences were assembled and translated using Vector NTI Advance, version 9.0 (Invitrogen) and have been deposited in GenBankTM under accession number DQ886489 [GenBank] .

Data base comparisons used BLAST (26) at NCBI with default parameters. Expressed sequence tag sequences that align with ODA7 were identified through analysis of tracks on the Chlamydomonas Genome v2.0 Internet site and confirmed by BLAST searches of Chlamydomonas expressed sequence tags. Sequence data available on the genome browser were produced by the U.S. Department of Energy Joint Genome Institute, www.jgi.doe.gov/, and are provided for use in this publication only.

Antibody Production and Purification—The coding region of cDNA clone pODA7-3 was amplified with primers oda7-3AGf (CCGCGAATTCTGACTAAGGAAGCTCTTCTAGAGG), which introduces an EcoRI site at codon 4, and oda7-3AGr (CCATGGCCTAATTCCAGGTCGTT), which extends beyond the stop codon of the 432-codon Oda7 coding sequence. The amplified product was digested with EcoRI and SalI to generate a 1270-bp fragment (ODA7 codons 4–427), which was cloned into pGEX-4T-2 (Amersham Biosciences), and a glutathione S-transferase fusion protein was expressed in Escherichia coli BL21 (DE3) pLysS cells (Stratagene), gel-purified, and used to raise polyclonal antibodies in rabbits (Covance, Princeton, NJ). For antibody purification, the fusion protein was digested with thrombin, separated by SDS-PAGE on a 7% acrylamide gel, and blotted, and a strip of the blot containing only Oda7p was used as an affinity matrix.

Flagellar Isolation and Fractionation—Cells grown in liquid medium were deflagellated by treatment with dibucaine as previously described (27). All subsequent steps were at 4 °C or on ice. Flagella were purified by differential centrifugation and rinsed once in HMDEK (30 mM Hepes, 5 mM MgSO4, 1 mM dithiothreitol, 0.5 mM EGTA, 25 mM potassium acetate, 1 mM phenylmethylsulfonyl fluoride, pH 7.4) before preparation for SDS-PAGE (or further fractionation). To remove membranes, flagella were resuspended in HMDEK and then mixed with an equal volume of HMDEK containing a detergent, either Nonidet-P40 (Fluka) or octylglucopyranoside (Sigma) as indicated under "Results." After trituration with a micropipet, samples were pelleted in a microfuge (16,000 x g) for 10 min and pellets were resuspended to the same volume as supernatant solutions prior to mixing with an equal volume of 2x SDS sample buffer. Demembranation was monitored by the appearance of a high molecular weight membrane glycoprotein (28) in the supernatant, as observed by protein stain after SDS-PAGE. Dynein was extracted into high salt by resuspension of demembranated axonemes in HMDEK supplemented with the indicated concentrations of salts. All extractions proceeded for 30 min on ice, followed by a 20-min spin in a microfuge. Salt extracts were dialyzed versus HMDEK and clarified (16,000 x g, 20 min) prior to further use. Alternatively, to extract dyneins by low ionic strength dialysis (29), flagella were resuspended in 1 mM Tris, 0.1 mM EDTA, 5 mM KCl, 0.1 mM dithiothreitol, 0.01 mM phenylmethylsulfonyl fluoride, pH 8.0, dialyzed against this solution for 24 h, and centrifuged (16,000 x g, 20 min) to generate pellet and supernatant fractions. To further separate dyneins, extracts were sedimented on 12.5-ml gradients of 5–20% sucrose in HMDEK at 155,000 x g (35,000 rpm in a Beckman SW40 rotor) for 15 h (standard conditions) or on 4.5-ml gradients at 181,000 x g (42,000 rpm in a Beckman SW 60 rotor) for 4.5 h (alternate conditions to preserve intact outer row dynein) (30). Fractions collected from the bottom of the tube were precipitated with 2 volumes acetone and dissolved in SDS sample buffer.

Dynein heavy chains (average Mr = 500,000) and Benchmark Protein Ladder (Invitrogen) were used as protein size standards. For immunoblotting, proteins were transferred to Immobilon-P membranes (Millipore Corp). Affinity-purified polyclonal rabbit antibodies to I1 subunits IC140, IC138, and IC97 were provided by Winfield Sale. A monoclonal antibody against outer row dynein IC2 has been previously described (31). Antibodies were detected with peroxidase-labeled secondary antibodies (Bio-Rad) using Super Signal West Dura Extend Duration substrate (Pierce). Images were scanned into Adobe Photoshop 6.0 and cropped.

Electron Microscopy—Specimens for thin section electron microscopy were prepared as previously described (32). Images were taken using a JEOL 100CXII microscope operated at 80 kV. Negatives were scanned and imported in Adobe Photoshop 6.0; the images were then inverted and adjusted for contrast and median density. Axoneme cross-sections were reoriented so the dyneins projected clockwise.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Chromosome Walk to ODA7—Many dynein genes in Chlamydomonas have been identified through analysis of insertional mutants by using the inserted sequence as a tag to clone the disrupted gene. However, despite analysis of 28 insertional mutants that prevented outer row dynein assembly, we were unable to identify insertional mutants at the ODA7 locus. As an alternative we used the one available mutation at oda7, which was generated by ultraviolet irradiation (17), for a genomic walk. Molecular markers that map in the vicinity of ODA7 on linkage group I, including Gbp1, PBT302, CNC41, and CNA73 (33), were used to probe DNA from 31 random recombinants in the ARG7-ODA7 interval. These recombinants were selected from a cross between RFLP strain S1D2 and double mutant strain arg7,oda7. For the Gbp1 and CNA73 markers, all recombinants gave an identical pattern consistent with a marker location telomeric to the test interval. In contrast, the PBT302 and CNC41 markers lay within the interval, as seen by the presence of recombinations between both markers and the oda7 locus in 2 of the 31 strains. Based on this recombination frequency, these markers are within 1 centimorgan of ODA7 (Fig. 1A), which translates on average in the Chlamydomonas genome to ~100 kb.

The PBT302 marker was used to select clones from an indexed BAC library to start the walk. A 200-kb region covered by 17 BAC clones extended this walk beyond one of the two crossovers in the PBT302-ODA7 interval to orient the walk and also identified the relative locations of PBT302 and CNC41 (Fig. 1B), but probes from the end of this walk closest to ODA7 failed to select additional clones in either of two BAC libraries. Compiled genomic sequence data (Chlamydomonas Genome Data Base v2.0) placed PBT302 on sequence scaffold 41 and provided an additional likely contiguous sequence that extended 200 kb beyond the gap at the end of our walk. Because some sequences at the end of scaffold 41 also appear on scaffold 139, portions of this region of the genome data base may retain assembly errors. However, most of the BAC end sequences for clones in our walk appeared at appropriate locations in the scaffold 41 sequence.

To identify ODA7 gene candidates, genome data base annotations for appropriate regions of scaffold 41 were analyzed to identify genes whose homologs are expressed exclusively in organisms that have motile cilia or flagella. A single gene met this criterion, C_410113, based on the similarity of its predicted gene product to those of expressed sequence tags derived from mammalian testis cDNA libraries. Sequences from scaffold 41 were used to BLAST the data base of BAC end sequences and identified BAC 17H5 (PTQ6356) as the smallest BAC clone that spanned predicted gene C_410113. Co-transformation of BAC 17H5 and an ARG gene plasmid into an arg7,oda7 strain resulted in rescue of the slow swimming phenotype in 12 of 189 ARG+ colonies, showing that 17H5 can complement the oda7 mutation. Restoration of outer row dyneins was confirmed in one of these co-transformants by both transmission electron microscopy of isolated flagellar axonemes and Western blot of axonemal proteins with an antibody against outer row dynein intermediate chain IC2.


Figure 1
View larger version (15K):
[in this window]
[in a new window]

  		FIGURE 1.
Chromosome walk to identify the ODA7 locus. Recombinants between ARG7 and ODA7 on the right arm of linkage group (L. G.) I were tested for segregation of markers PBT302, CNC41, Gbp1, and CNA73. A, the number of recombinants in each interval is shown below a map of this region of L.G. I and indicates that PBT302 is the molecular marker closest to ODA7. B, three PBT302-selected BACs are shown below a diagram of sequence scaffolds 41 and 139, as well as the locations of marker CNC41, the ODA7 locus, and BAC clone 17H5, which spans the ODA7 locus. An enlarged diagram of BAC 17H5 (C) shows the location of presumed transcription units (arrows), including ODA7. Lines below the 17H5 diagram indicates equence regions spanned by genomic {lambda} and plasmid clones that were selected with a probe from the ODA7 coding region and found to complement the oda7 mutation.

 
To further determine whether C_410113 corresponds to ODA7, we amplified a small region of the presumed coding sequence from BAC 17H5 and used it as a hybridization probe to select smaller genomic and cDNA clones from phage {lambda} libraries. Two overlapping genomic clones selected with this probe were able to rescue the mutant phenotype when transformed into an oda7 strain. The region of overlap between these clones, which spans the presumptive ODA7 gene, was subcloned into a plasmid (Fig. 1C) that also rescued the mutant phenotype. The selected cDNA clone (pODA7-3) was sequenced and contained the complete coding region predicted in the annotation for gene C_410113.

Exon I Is Deleted in the oda7 Mutation—Exons of the presumptive ODA7 gene, identified by comparing our cDNA sequence with the reported genomic sequence (supplemental Fig. S1A), were amplified from wild type and oda7 mutant genomic DNA, and amplification products were characterized to confirm the presence of a mutation in the oda7 gene copy. Exons 2–5 amplified from the oda7 strain contained no differences from wild type genomic sequences. However, we were unable to amplify exon 1 from mutant DNA with any of three separate primer pairs, all of which successfully amplified bands of the expected size from wild type DNA (supplemental Fig. S1B).4 A genomic Southern blot probed with the complete cDNA also indicated that the genomic region spanning exon 1 contained an estimated 1.2-kb deletion in the oda7 strain (supplemental Fig. S1C).


Figure 2
View larger version (34K):
[in this window]
[in a new window]

  		FIGURE 2.
Sequence analysis of the Oda7 protein. Six leucine-rich repeats (LRR) appear near the N terminus of Oda7 (A). All six repeats contain elements typical of SDS22 family LRR units (B), including alternating {alpha} helix-beta sheet regions and an LRR cap sequence (underlined). Residues in the SDS22 family consensus pattern are shown in bold. Sequence comparison with other LRR proteins that were selected from phylogenetically diverse organisms indicates that most organisms contain a single Oda7 homolog and that Oda7 homologs group in a separate subfamily from dynein light chain 1 (LC1) and protein phosphatase regulatory subunit SDS22, as illustrated by an unrooted tree (C). For panel C, alignments were generated with ClustalW using the following sequences: Urchin LC1, BBA24184; Giardia LC1, XP_767743; Canine LC1, XP_853805; Human LC1, AAQ11377; Xenopus LC1, AAH82218; Fly LC1, NP_610483; Chlamy LC1, AAD41040; Cerevisiae SDS, P36047; pombe SDS, S43988; Fly SDS, AAM50611; Human SDS, AAD26610; Mouse SDS, BAE26253; Chlamy SDS, C_1490024 (chlamydomonas genome v2.0); Giardia Oda7, EAA42565; Fly Oda7, AAN11119; Malaria Oda7, AAX86879; Zebrafish Oda7, AAH45963; Human Oda7, AAH24009; Mouse Oda7, AAH50751; Chlamy Oda7, ABI63572.

 
Oda7 Is an LRR Protein in the SDS22 Family—Our 1812-bp ODA7 cDNA sequence contains a 140-bp 5'-untranslated region, a 376-bp 3'-untranslated region, and an open reading frame that encodes a predicted protein of 432 amino acids (47 kDa). The CD search algorithm (34) identified an LRR domain in the N-terminal half of Oda7 (Fig. 2A). Comparison to known LRR proteins shows that Oda7 is an ortholog of the uncharacterized LRRC50 sequences of mammals (e.g. mouse AAH50751 [GenBank] ) and puts Oda7p in the SDS22 family (35). The 6 LRR repeats in Oda7 are followed by sequences that typically cap the C terminus of the LRR structure (Fig. 2B). Although axonemal dynein light chains such as Chlamydomonas outer row dynein LC1 are also SDS22 family LRR proteins, Oda7 groups with other related sequences in a subfamily that has diverged from LC1 within the LRR repeat domain and shows no sequence similarity to LC1 within the C-terminal non-LRR domain. Genomes from a wide diversity of eukaryotic phyla each retained only a single gene encoding a protein that grouped with Oda7 by ClustalW analysis (Fig. 2C).


Figure 3
View larger version (48K):
[in this window]
[in a new window]

  		FIGURE 3.
Distribution of Oda7 protein in flagellar assembly mutants. A, an affinity-purified antibody to Oda7 recognizes an ~58-kDa flagellar protein. After fractionation of flagella (F) with Nonidet P-40 into insoluble axoneme (A) and soluble membrane/matrix (M), most of Oda7 becomes soluble. B, immunoblots of whole flagella from wild type (WT) and outer row dynein assembly mutants (oda strain) show that Oda7 is only missing from oda7 flagella. C, immunoblots of flagella from representative inner row dynein mutants (ida strains), all of which retain Oda7. The ida7 strain consistently shows a slight reduction in Oda7 levels. D, comparison of Oda7 in flagella that lack only I1 inner row dynein (ida7) or both outer row dynein and I1 dynein (WS4). The WS4 strain also contains a suppressor mutation (ssh1), which has no apparent effect on Oda7 assembly.

 
Biochemical Characterization of Oda7—Antibodies raised against a bacterially expressed GST-Oda7 fusion protein identify a single 58-kDa band on blots of wild type Chlamydomonas flagellar proteins that partitions after detergent treatment into both insoluble (axonemal) and soluble (membrane/matrix) fractions (Fig. 3A). Comparison of wild type flagella with those of oda mutants shows that Oda7 is retained by all other tested strains except oda7 (Fig. 3B). The strains used in this comparison include several that are only defective in assembly of the dynein catalytic complex (e.g. oda2, 4, 6, 9), strains that disrupt the outer row dynein docking complex (oda1, 3), and strains that disrupt dynein assembly without affecting either of these complexes (oda5, 8) (13). Although the amount of Oda7p retained by oda mutant flagella (other than oda7) was variable, this variability was not related to the strain under analysis but appeared to be due to uncontrollable differences between preparations. In addition, we tested for the retention of Oda7 in flagella from strains lacking radial spokes (pf14, not shown) and inner row dyneins (ida4, ida6, ida7) and only observed a slight reduction in flagellar Oda7 in the ida7 strain, which is defective for assembly of I1 inner row dynein (36) (Fig. 3, C and D). This result was unexpected, as oda7 has no effect on I1 assembly (17). However, at least three other dynein subunits are thought to function as subunits in both outer row and I1 dyneins, light chains LC7a and LC7b (12, 37) and LC8 (12), raising the possibility that Oda7 is present in both complexes.

To test the combined effects of loss of outer row and I1 dyneins, we compared flagellar Oda7 levels in wild type and ida7 to those in WS4 flagellar samples (Fig. 3D). WS4, a triple mutant (pf28,pf30,ssh1), is defective in assembly of both outer row and I1 dyneins and contains a suppressor mutation (suppressor of short1) to support the assembly of full-length flagella when both outer row and I1 dyneins are missing. To control for the effects of ssh1, flagella from a strain containing only the ssh1 mutation were also examined. The combination of both dynein mutations (Fig. 3D, lane WS4) has a consistently greater effect on Oda7 levels than either single dynein assembly defect alone but does not completely prevent flagellar targeting of Oda7. The ssh1 mutation has no apparent effect on the assembly of Oda7.

Oda7 Is an Axonemal Protein Associated with Both I1 and Outer Row Dyneins—Most of Oda7 was extracted during demembranation of flagella with Nonidet P-40 detergent (Fig. 3A). When a range of Nonidet P-40 concentrations were compared, more than half of Oda7 was extracted into a soluble fraction at the lowest Nonidet P-40 concentration tested (supplemental Fig. S2A), indicating either that Oda7 resides in part in the matrix or as a membrane-associated protein or that its axonemal association is detergent-sensitive. We tested alternative non-ionic detergents and identified octylglucopyranoside as a detergent that could solubilize the flagellar membrane (as monitored by solubility of the major membrane glycoprotein) but leave most of the Oda7p in the particulate fraction (supplemental Fig. S2B). Thus, Oda7 should be considered an axonemal protein whose association is sensitive to detergent rather than a membrane-associated or soluble matrix protein.

Reduced levels of Oda7 in oda/I1 double mutants could result from either a single population of Oda7 that bridges between these two dyneins or two separate pools that each interact with or rely upon one or the other of these dyneins for proper assembly. Standard conditions for extraction of axonemal dyneins (treatment with 0.6 M NaCl) extract most of the axonemal Oda7p, but no additional Oda7p was extracted by higher concentrations of NaCl (Fig. 4A). These high salt extracts preserve the interaction of several outer row dynein subunits, including three heavy chains, two intermediate chains, and eight or more light chains. This complex further separates under standard conditions for sucrose gradient centrifugation into two peaks, one that sediments at 12 S and contains dynein heavy chain {gamma} and light chain LC1 and another that sediments at 19–20 S and contains heavy chains {alpha} and beta and the remaining smaller subunits (38). Extracts from wild type axonemes produced a single peak of Oda7 near the bottom of the gradient, coincident with the distribution of I1 dynein but overlapping slightly with the 19–20 S peak of outer row dynein subunits as well (Fig. 4B). This result is consistent with a single pool of Oda7 associated with I1 dynein alone and does not explain the reduction in Oda7 seen when both I1 and outer row dynein assembly are disrupted.

When similar gradient fractions were analyzed using extracts from pf28 axonemes, which lack outer row dynein but retain I1 dynein (1), Oda7 was still seen to co-sediment with I1 proteins near the bottom of the gradient (Fig. 5A), confirming an interaction between Oda7 and I1 dynein. In extracts from ida7 axonemes, which lack I1 dynein but retain outer row dynein (36), Oda7 sedimented in two peaks of similar abundance, one near the top of the gradient and one broadly distributed over several fractions with an average sedimentation rate of ~15 S (Fig. 5B). Extracts from the WS4 strain, lacking both I1 and outer row dyneins, retained a small peak of Oda7 near the top of the gradient but no faster sedimenting peak (Fig. 5C). One explanation for the faster sedimenting peak observed in ida7 extracts may be that Oda7 interacts with both I1 and outer row dyneins but that the interaction with outer row dynein is disrupted during lengthy centrifugation at high g forces. Previous work has shown that outer row dynein itself will sediment as a single, larger complex when isolated in the presence of Mg2+ and fractionated on a smaller gradient for a shorter time (12, 30). When ida7 extracts were sedimented under these altered conditions, the Oda7 protein appeared in a single peak that co-sedimented with outer row dynein (Fig. 6A). However, when extracts from wild type axonemes were sedimented under these conditions, Oda7 co-sedimented with I1 dynein rather than outer row dynein (Fig. 6B).


Figure 4
View larger version (67K):
[in this window]
[in a new window]

  		FIGURE 4.
Salt-extracted Oda7 sediments as a large complex. A, axonemes, created by treating flagella with 1.0% octylglucopyranoside, were extracted with the indicated concentrations of NaCl. The gel and immunoblot of extracted pellets show that most of the Oda7p is removed by 0.6 M NaCl treatment. B, sedimentation of a 0.6-M NaCl extract on a sucrose gradient reveals co-sedimentation of Oda7 with I1 inner arm proteins. Blots show distribution of Oda7p and I1 subunit IC140. IC1 and IC2 are outer row dynein intermediate chains; IC138/140 and IC97 are I1 inner row dynein intermediate chains.

 


Figure 5
View larger version (37K):
[in this window]
[in a new window]

  		FIGURE 5.
Sedimentation properties of Oda7 in 0.6-M NaCl extracts of flagella that lack outer row dynein (A), I1 inner row dynein (B), or both dyneins (C). A, in the absence of outer row dynein, Oda7 co-sediments with I1 dynein. B, when I1 dynein is absent, Oda7 sediments in two peaks, one at the top of the gradient and one distributed over several fractions. C, when both dyneins are missing, most of the residual Oda7 sediments near the top of the gradient.

 
These results are consistent with a single pool of Oda7 that associates with both I1 and outer row dyneins simultaneously as part of a linking complex but suggest that the affinity of Oda7 for outer row dynein is not strong enough to maintain this connection during prolonged high g force centrifugation. However, our inability to maintain all of Oda7 on axonemes during detergent treatment, or to extract all of Oda7 from axonemes with high salt, contributes to a small uncertainty about the distribution of the pool of Oda7 that is not represented in high salt extracts. We therefore checked Oda7 distribution after an alternative, single step extraction. Flagella were treated by low ionic strength dialysis, a method known to extract dyneins from Tetrahymena cilia and sea urchin spermatozoa in a single step (29). After dialysis and centrifugation, thin section electron microscopy of the pellet shows that both inner and outer row dyneins have been extracted (supplemental Fig. S3A), and Western blots show that all of the Oda7 has been solubilized (supplemental Fig. S3B). Fractionation of the soluble extract on a sucrose gradient under standard conditions generated a single peak of Oda7 with an estimated sedimentation rate of 17 S (supplemental Fig. S3C), consistent with a single flagellar pool of Oda7.


Figure 6
View larger version (80K):
[in this window]
[in a new window]

  		FIGURE 6.
Sedimentation under non-standard conditions. 0.6-M NaCl extracts of octylglucopyranoside-demembranated axonemes were sedimented on sucrose gradients at 181,000 x g for 4.5 h to maintain outer row dynein as a single complex. A, Oda7 co-sediments with outer row dynein in ida7 extracts (absence of I1 dynein). B, Oda7 co-sediments with I1 dynein in wild type extracts. Outer row dynein docking complex subunits (DC1, DC2) co-sediment with outer row dynein intermediate chains (IC1, IC2) and light chains (LC).

 
Oda7 Protein Rebinds with Outer Row Dynein to oda7 Mutant Axonemes—Previous reports have shown that outer row dynein, extracted from wild type axonemes with 0.6 M salt, can rebind to oda axonemes (including oda7) to restore outer row dynein structures and activity (39). To see whether the Oda7 protein also rebinds, we repeated those experiments and tested the reconstituted axonemes by Western blot for the presence of Oda7. As shown previously (17), oda7 axonemes alone retain very low levels of outer row dynein (Fig. 7A) and lack outer row dynein structures (Fig. 7B, upper panel). Incubation of oda7 axonemes with an extract from wild type axonemes restored both Oda7 and IC2 proteins to approximately wild type levels (Fig. 7A). By thin section electron microscopy, the re-associated proteins have restored outer row arm structures as well (Fig. 7B, lower panel).


Figure 7
View larger version (127K):
[in this window]
[in a new window]

  		FIGURE 7.
Re-association of Oda7 protein with oda7 axonemes. Axonemes from oda7 flagella were incubated in the presence of a 0.6-M NaCl extract (HSE) of wild type axonemes (+) or in buffer alone (-) and centrifuged. A, pellets analyzed by SDS-PAGE and immunoblot show the rebinding of both outer row dynein (IC2) and Oda7 to levels similar to those in wild type axonemes (WT AX). B, thin section electron microscopy shows restoration of outer row dynein structures. Bar, 100 nm.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The flagellar axoneme functions as a single macromolecular motor complex that must coordinate the activity of multiple dynein ATPase isoforms to generate motility. Among the mysteries of this system is the way in which inner and outer row dyneins are regulated in a coordinated fashion. Inner row dyneins are thought to be regulated in part through the action of regulatory complexes such as radial spokes and the dynein regulatory complex, which do not appear to come into close contact with the outer dynein row. One potential way of coordinating these motors would be through protein complexes on the doublet microtubule surface that could physically bridge the space between inner and outer rows and interact with both motors, but direct evidence for such proteins has been lacking. Two recent reports suggest the existence of functional and structural interactions between these motors in the Chlamydomonas flagellum. The Tctex2b light chain co-purifies with I1 dynein and its absence destabilizes I1 dynein, but the effect of its absence on motility includes a reduction in beat frequency, which suggests that it may influence outer row dynein activity (40). Another light chain, LC7b, associates with both outer row and I1 dynein, but available evidence does not show whether this protein is merely a subunit in two different dyneins or is part of a complex that physically links these dyneins (12). Here we show that the ODA7 gene product functions as a link between inner row and outer row dyneins on the axoneme and may have an additional role as a cytoplasmic assembly factor.

Recently, cryoelectron microscopy of Chlamydomonas axonemes has revealed the presence of two new structures (Outer-Inner Dynein linkers, or OIDs) that appear to interconnect one of the four outer row dyneins in each 96-nm repeat unit with the base of the I1 dynein, and another with the dynein regulatory complex (41). Based on the results presented above, the ODA7 gene product likely contributes to the I1 OID, which is ideally positioned to coordinate regulation of I1 and outer row dyneins during physiological responses to environmental cues.

In favor of this view of Oda7 function, we show that when Oda7 is extracted from either wild type axonemes or from axonemes that lack outer row dyneins all of the protein co-sediments with I1 dynein. Axonemes that lack I1 dynein retain Oda7, apparently through an interaction with outer row dynein, but when both inner row and outer row dynein are missing most of the Oda7p also fails to assemble; the small amount of Oda7 that remains on axonemes in an extractable pool sediments as a small complex. After extraction from an I1 mutant and centrifugation under conditions that cause outer row dyneins to dissociate, Oda7 sediments as a heterodisperse complex, suggesting that its interaction with outer row dynein subunits requires the intact dynein motor. Under conditions that maintain outer row dynein as a single three-headed complex, Oda7 extracted from an I1 mutant does co-sediment with outer row dynein subunits. However, Oda7 appears to bind with higher affinity to I1 dynein than to outer row dynein and quantitatively co-purifies with I1 dynein when both dyneins are present.

Oda7 conforms closely to the preferred sequence motif for SDS22 family LRR proteins, which fold to form a curved surface of parallel beta sheets linked by {alpha} helices (35). Surfaces typically participate in subunit-subunit interactions, but sequence characteristics of LRR interaction domains have not been characterized as identifiable sequence motifs (42). The LC1 LRR domain has been structurally modeled and is known to interact with the globular head of outer row dynein heavy chain {gamma} (43, 44). Because Oda7 is essential for cytoplasmic stability of outer row heavy chain {alpha} (13), the Oda7 LRR domain could interact in a similar fashion with this outer row subunit. Alternatively, the Oda7 LRR domain could interact with either of the two I1 heavy chain head domains, which would be more in keeping with our observation that all of the Oda7 protein co-purifies with I1 dynein, even though there is only one I1 for every four outer row dyneins along the axoneme.

At present it is somewhat difficult to reconcile the view that Oda7 interacts with I1, which would suggest that it occurs in one copy/96-nm repeat unit and that it is essential for assembly of outer row dyneins, which bind with a 24-nm repeat period (four copies/96-nm unit). Our evidence suggests that Oda7 and outer row dynein complexes are not 1:1 stoichiometric in the axoneme. When outer row dynein intermediate chain bands were visualized in gradient fractions with Coomassie blue stain, bands with the molecular weight and distribution expected of Oda7 (as determined by immunoblot) were not seen at an intensity compatible with 1:1 stoichiometry (Fig. 6A). Oda7 could span four outer row dyneins along the doublet surface and form part of the binding site for outer row dyneins, which would explain the rebinding of Oda7 protein seen in Fig. 7. Alternatively, we have shown previously (13) that outer row dynein motor subunits fail to assemble in oda7 mutant cytoplasm, and this failure alone could account for lack of flagellar outer row dynein assembly in this mutant. If Oda7 functions as a subunit in a regulatory complex, that complex could function catalytically in the cytoplasm during formation of the motor complex and need not occur at a 1:1 ratio with outer row dynein proteins in the axoneme. Further experimentation will be required to establish the cytoplasmic mechanism of dynein assembly and the role of Oda7 in this process, as well as the role of Oda7 in dynein attachment to outer doublet microtubules and motility regulation.


   FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the DDBJ/GenBankTM/EBI Data Bank with accession number(s) DQ886489 [GenBank] .

* This work was supported by National Institutes of Health Grant GM44228 (to D. R. M.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1–S3. Back

1 Present address: Dept. of Biology, Emory University, Atlanta, GA 30322. Back

2 To whom correspondence should be addressed: Dept. of Cell and Developmental Biology, 1133 WH, SUNY Upstate Medical University, 750 E. Adams St., Syracuse, NY 13210. Tel.: 315-464-8575; Fax: 315-464-8535; E-mail: mitcheld{at}upstate.edu.

3 The abbreviations used are: LRR, leucine-rich repeat; RFLP, restriction fragment length polymorphism; BAC, bacterial artificial chromosome. Back

4 D. R. Mitchell and J. Freshour, unpublished observations. Back


   ACKNOWLEDGMENTS
 
We thank Winfield Sale for antibodies to I1 subunits, Sathya Theodore for early work on the library walk, and Daniela Nicastro for discussing results ahead of publication. Masako Nakatsugawa, William Houser, and Karly Judson provided technical assistance.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Mitchell, D. R., and Rosenbaum, J. L. (1985) J. Cell Biol. 100, 1228-1234[Abstract/Free Full Text]
  2. Brokaw, C. J., and Kamiya, R. (1987) Cell Motil. Cytoskeleton 8, 68-75[CrossRef][Medline] [Order article via Infotrieve]
  3. Yagi, T., Minoura, I., Fujiwara, A., Saito, R., Yasunaga, T., Hirono, M., and Kamiya, R. (2005) J. Biol. Chem. 280, 41412-41420[Abstract/Free Full Text]
  4. King, S. J., and Dutcher, S. K. (1997) J. Cell Biol. 136, 177-191[Abstract/Free Full Text]
  5. Liu, S., Hard, R., Rankin, S., Hennessey, T., and Pennock, D. G. (2004) Cell Motil. Cytoskeleton 59, 201-214[CrossRef][Medline] [Order article via Infotrieve]
  6. Kohl, L., and Bastin, P. (2005) Int. Rev. Cytol. 244, 227-285[Medline] [Order article via Infotrieve]
  7. Gibbons, B. H., and Gibbons, I. R. (1973) J. Cell Sci. 13, 337-357[Abstract/Free Full Text]
  8. Asai, D. J., and Wilkes, D. E. (2004) J. Eukaryot. Microbiol. 51, 23-29[CrossRef][Medline] [Order article via Infotrieve]
  9. Asai, D. J., and Koonce, M. F. (2001) Trends Cell Biol. 11, 196-202[CrossRef][Medline] [Order article via Infotrieve]
  10. Kamiya, R. (2002) Int. Rev. Cytol. 219, 115-155[Medline] [Order article via Infotrieve]
  11. Porter, M. E., and Sale, W. S. (2000) J. Cell Biol. 151, F37-F42[Abstract/Free Full Text]
  12. DiBella, L. M., Sakato, M., Patel-King, R. S., Pazour, G. J., and King, S. M. (2004) Mol. Biol. Cell 15, 4633-4646[Abstract/Free Full Text]
  13. Fowkes, M. E., and Mitchell, D. R. (1998) Mol. Biol. Cell 9, 2337-2347[Abstract/Free Full Text]
  14. Takada, S., Wilkerson, C. G., Wakabayashi, K., Kamiya, R., and Witman, G. B. (2002) Mol. Biol. Cell 13, 1015-1029[Abstract/Free Full Text]
  15. Wirschell, M., Pazour, G., Yoda, A., Hirono, M., Kamiya, R., and Witman, G. B. (2004) Mol. Biol. Cell 15, 2729-2741[Abstract/Free Full Text]
  16. Ahmed, N. T., and Mitchell, D. R. (2005) Mol. Biol. Cell 16, 5004-5012[Abstract/Free Full Text]
  17. Kamiya, R. (1988) J. Cell Biol. 107, 2253-2258[Abstract/Free Full Text]
  18. King, S. M., and Witman, G. B. (1994) J. Biol. Chem. 269, 5452-5457[Abstract/Free Full Text]
  19. Sakakibara, H., Mitchell, D. R., and Kamiya, R. (1991) J. Cell Biol. 113, 615-622[Abstract/Free Full Text]
  20. LeDizet, M., and Piperno, G. (1995) Mol. Biol. Cell 6, 697-711[Abstract]
  21. Sager, R., and Granick, S. (1953) Ann. N. Y. Acad. Sci. 466, 18-30
  22. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990) Nucleic Acids Res. 18, 2887-2890[Abstract/Free Full Text]
  23. Debuchy, R., Purton, S., and Rochaix, J.-D. (1989) EMBO J. 8, 2803-2809[Medline] [Order article via Infotrieve]
  24. Kindle, K. L. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 1228-1232[Abstract/Free Full Text]
  25. Mitchell, D. R., and Kang, Y. (1991) J. Cell Biol. 113, 835-842[Abstract/Free Full Text]
  26. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389-3402[Abstract/Free Full Text]
  27. Mitchell, B. F., Pedersen, L. B., Feely, M., Rosenbaum, J. L., and Mitchell, D. R. (2005) Mol. Biol. Cell 16, 4509-4518[Abstract/Free Full Text]
  28. Bloodgood, R. A., and Salomonsky, N. L. (1994) J. Cell Biol. 127, 803-811[Abstract/Free Full Text]
  29. Gibbons, I. R. (1965) Arch. Biol. 76, 317-352
  30. Takada, S., Sakakibara, H., and Kamiya, R. (1992) J. Biochem. (Tokyo) 111, 758-762[Abstract/Free Full Text]
  31. Mitchell, D. R., and Rosenbaum, J. L. (1986) Cell Motil. Cytoskeleton 6, 510-520[CrossRef][Medline] [Order article via Infotrieve]
  32. Mitchell, D. R., and Sale, W. S. (1999) J. Cell Biol. 144, 293-304[Abstract/Free Full Text]
  33. Silflow, C. D., Kathir, P., and Lefebvre, P. A. (1995) Methods Cell Biol. 47, 525-530[Medline] [Order article via Infotrieve]
  34. Marchler-Bauer, A., and Bryant, S. H. (2004) Nucleic Acids Res. 32, W327-W331[Abstract/Free Full Text]
  35. Kajava, A. V., and Kobe, B. (2002) Protein Sci. 11, 1082-1090[Abstract/Free Full Text]
  36. Perrone, C. A., Yang, P. F., O'Toole, E., Sale, W. S., and Porter, M. E. (1998) Mol. Biol. Cell 9, 3351-3365[Abstract/Free Full Text]
  37. Bowman, A. B., Patel-King, R. S., Benashski, S. E., McCaffery, J. M., Goldstein, L. S. B., and King, S. M. (1999) J. Cell Biol. 146, 165-179[Abstract/Free Full Text]
  38. Pfister, K. K., Fay, R. B., and Witman, G. B. (1982) Cell Motility 2, 525-547[CrossRef][Medline] [Order article via Infotrieve]
  39. Sakakibara, H., and Kamiya, R. (1989) J. Cell Sci. 92, 77-83[Abstract/Free Full Text]
  40. DiBella, L. M., Smith, E. F., Patel-King, R. S., Wakabayashi, K., and King, S. M. (2004) J. Biol. Chem. 279, 21666-21676[Abstract/Free Full Text]
  41. Nicastro, D., Schwartz, C., Pierson, J., Gaudette, R., Porter, M. E., and McIntosh, J. R. (2006) Science 313, 944-948[Abstract/Free Full Text]
  42. Kobe, B., and Kajava, A. V. (2001) Curr. Opin. Struct. Biol. 11, 725-732[CrossRef][Medline] [Order article via Infotrieve]
  43. Wu, H. W., Blackledge, M., Maciejewski, M. W., Mullen, G. P., and King, S. M. (2003) Biochemistry 42, 57-71[CrossRef][Medline] [Order article via Infotrieve]
  44. Benashski, S. E., Patel-King, R. S., and King, S. M. (1999) Biochemistry 38, 7253-7264[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Am. Soc. Nephrol.Home page
E. van Rooijen, R. H. Giles, E. E. Voest, C. van Rooijen, S. Schulte-Merker, and F. J. van Eeden
LRRC50, a Conserved Ciliary Protein Implicated in Polycystic Kidney Disease
J. Am. Soc. Nephrol., June 1, 2008; 19(6): 1128 - 1138.
[Full Text] [PDF]

Home page
 J. Cell Sci.Home page
D. M. Baron, Z. P. Kabututu, and K. L. Hill
Stuck in reverse: loss of LC1 in Trypanosoma brucei disrupts outer dynein arms and leads to reverse flagellar beat and backward movement
J. Cell Sci., May 1, 2007; 120(9): 1513 - 1520.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/8/5404    most recent
M607509200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Freshour, J.
Right arrow Articles by Mitchell, D. R.
Right arrow Search for Related Content
PubMed
Right arrow