Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M609726200 on December 20, 2006

J. Biol. Chem., Vol. 282, Issue 8, 5608-5616, February 23, 2007
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/8/5608    most recent
M609726200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, C.-Y.
Right arrow Articles by Liu, S.-T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, C.-Y.
Right arrow Articles by Liu, S.-T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Nonribosomal Synthesis of Fengycin on an Enzyme Complex Formed by Fengycin Synthetases*Formula

Cheng-Yeu Wu{ddagger}1, Chyi-Liang Chen{ddagger}1, Yu-Hsiu Lee{ddagger}, Yu-Chieh Cheng{ddagger}, Ying-Chung Wu{ddagger}, Hung-Yu Shu{ddagger}, Friedrich Götz§, and Shih-Tung Liu{ddagger}2

From the {ddagger}Molecular Genetics Laboratory, Department of Microbiology and Immunology, Chang-Gung University, 259 Wen-Hwa 1st Road, Kwei-Shan, Taoyuan 333, Taiwan and §Biologisches Institut, AG Mikrobielle Genetik, Der Universtät Tübingen, Waldhäuser Strasse 70/8, 70276 Tübingen, Germany

Received for publication, October 16, 2006 , and in revised form, December 14, 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Fengycin, a lipopeptidic antibiotic, is synthesized nonribosomally by five fengycin synthetases (FenC, FenD, FenE, FenA, and FenB) in Bacillus subtilis F29-3. This work demonstrates that these fengycin synthetases interlock to form a chain, which coils into a 14.5-nm structure. In this chain, fengycin synthetases are linked in the order FenC-FenD-FenE-FenA-FenB by interactions between the C-terminal region of an upstream enzyme and the N-terminal region of its downstream partner enzyme, with their amino acid activation modules arranged colinearly with the amino acids in fengycin. This work also reveals that fengycin is synthesized on this fengycin synthetase chain, explaining how fengycin is synthesized efficiently and accurately. The results from this investigation demonstrate that forming a peptide synthetase complex is crucial to nonribosomal peptide synthesis.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Fengycin, a lipopeptidic antibiotic, is formed by Bacillus subtilis F29-3 (1, 2) and contains a cyclic peptide of 10 amino acids with a 14–18-carbon fatty acid residue attached to the N terminus of the peptide (Fig. 1A) (3). Earlier works have established that fengycin is synthesized nonribosomally by five fengycin synthetases, FenC (287 kDa), FenD (290 kDa), FenE (286 kDa), FenA (406 kDa), and FenB (146 kDa) (4, 5), which are encoded by the five fengycin synthetase genes in the fengycin synthetase operon (Fig. 1B). These enzymes typically contain from one to several amino acid activation modules that are about 1000 amino acids long, activating a specific amino acid for peptide synthesis (610). In each module, an adenylation domain of ~550 amino acids recognizes and adenylates a specific amino acid (5, 1114). Following adenylation, the amino acid forms a thioester bond with the cofactor 4'-phosphopantetheine bound to the thiolation domain located C-terminal to the adenylation domain in the module (1519). Subsequently, a transpeptidation process transfers the activated amino acid in the initiating module, FenC1, in the initiating enzyme, FenC, to the activated amino acid at the thiolation domain in the next module, FenC2, ultimately forming a dipeptide, L-Glu-L-Orn, on FenC (5, 20, 21). In the next step, the dipeptide synthesized on FenC is translocated to FenD; during this process, L-Orn is racemized to D-Orn (22) and linked with L-Tyr activated by the FenD1 module (14, 21, 23). This process continues from one module to another and from one peptide synthetase to another peptide synthetase until the elongating peptide chain reaches FenB (12), which contains a thioesterase domain that terminates peptide synthesis and releases the peptide chain from the enzyme (24, 25). During fengycin synthesis, the elongating fengycin peptide must be transferred from one peptide synthetase to another in a particular order; otherwise, a fengycin molecule with a particular sequence cannot be synthesized. Given the amino acid sequence in fengycin (Fig. 1A) and the amino acid activated by each fengycin synthetase, fengycin synthesis is predicted to begin from FenC and to proceed via FenD, FenE, and FenA finally to FenB. This investigation demonstrates that the five fengycin synthetases interact to form a chain, in which the amino acid-activating modules are lined up colinearly with the amino acids in the fengycin molecules. Formation of this peptide synthetase chain explains why fengycin is synthesized efficiently and accurately.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial Strains and Media—B. subtilis F29-3 was a fengycin-producing strain (2). Mutant strains of B. subtilis F29-3, including FX12, FX10, FX14, FE6, and FE5, contained a transposon insertion in fenC, fenD, fenE, fenA, and fenB, respectively (Fig. 1B) (4, 26). LB broth and agar (27) were used to culture Escherichia coli. Soybean-mannitol-nitrate and nHA media (3) were used to culture B. subtilis F29-3. E. coli HB101 (28) was used as a host for gene cloning.

Plasmids—A 1433-bp EcoRV-BglII fragment from pFC6A5 (5) that encoded the C-terminal region of FenC was inserted into the EcoRV-BamHI sites in pET20b(+) to generate pFC010. Then a 4850-bp SphI-PstI fragment that encoded the region between amino acids 630 and 2245 in FenC was inserted into the SphI-PstI sites in pGEM-3Z to form pFC020. A 1.4-kb EcoRV-DraIII fragment from pFC010 was then inserted into the EcoRV site in pFC020 to generate pFC030. A 2580-bp SphI fragment from pFC6A5, which contained the promoter of the fengycin operon and a sequence that encoded the N-terminal region in FenC, was inserted into the SphI site in pFC030 to generate pFC100. Finally, a 3-kb AccI fragment from pHY300PLK that contained a tetracycline resistance gene and a replicon that allowed replication of the plasmid in B. subtilis was inserted into the BamHI site in pFC100 to generate pFC200. Plasmid pFC240 was identical to pFC200 except in that a frameshift mutation was generated at the SphI site in fenC. Plasmids pFB200 expressed histidine-tagged FenB in E. coli (12). A DNA fragment amplified with primers FenB-dTeF (5'-CCCGGATCCTCTCATCACCATCACCACACTAAGCTTAATTA) and FenB-dTeR (5'-CCCGGATCCTGACAGCTGATTAGAATAAAGCTTTTCCGC), using pFC6A5 as a template, was inserted into the BamHI site in pQE60 (Qiagen) to form pFB230 to express histidine-tagged FenB without its thioesterase domain (FenB-dTE). PCR fragments amplified, using B. subtilis F29-3 chromosomal DNA as a template, with primers FenC-N-F (5'-GGGGTACCATCCTCTTATAAATTAGAATTGG) and FenC-N-B (5'-GGATCCCATGGCATCAACGGTTGCTTCTGTCGG); FenD-N-F (5'-GAGGATCCTGGAAAAGGTGTGTGGAATTGATGACG) and FenD-N-B (5'-CTTCTAGACTTATCGTCGTCATCCTTGTAATCATTTGGATAATGGCGCTC), FenE-N-F (5'-GGGGATCCAACCGCGAATGGAGTGCCGCTG) and FenE-N-Bfg (5'-GCTCTAGACTTATCGTCATCCTTGTAATCCTCGAGGAATTCAACCAACCTGTCCG); FenA-N-F (5'-GGGGTACCTGGACAGTATATCCAGCTTGG) and FenA-fgN (5'-GTTAAAGCTTATCGTCGTCATCCTTGTAATCCATGGTATATGCCGACACTACATGAG); and FenB-N-F (5'-GGGGTACCGAGGACGCGCTCCAAGAAATCG) and FenB-N-Bfg (5'-GAAGATCTTATCGTCGTCATCCTTGTAATCCATGGACCCTGTCAGGATAAACCGG) were inserted at the BamHI site in pUC18 to form pFC210, pFD210, pFE210, pFA210, and pFB210, which expressed the N-terminal 700-amino acid region in FenC, 700-amino acid region in FenD, 900-amino acid region in FenE, 800-amino acid region in FenA, and 700-amino acid region in FenB, respectively, with a FLAG tag at the C terminus. PCR fragments amplified, using B. subtilis F29-3 chromosomal DNA as a template, with FenC-C-F (5'-CAGGATCCGGTACCAATGTAAAACTGTGCGTAC) and FenC-C-B (5'-CGGGATCCAGAAGATCTTTAACGAGATTTTC); FenD-C-F (5'-GAGGATCCGGTACCGAGCTGTATATTGGCGGAG) and FenD-C-B (5'-GCGGATCCAGTACTTTGTTGACGGCCCCCAT); FenE-C-F (5'-GAGGATCCCGATTACAAGGATGACGACGATAAGCTAGATCTGGCACGCTGGCTACCGG) and FenE-C-B (5'-GGGTCTAGACTCGAGCAAGTCTTCCACCAAGCTGG); FenA-C-F (5'-GAAGATCTCGATTACAAGGATGACGACGATAAGGTCGACAAGCTCGGCGTAACAAGG) and FenA-C-B (5'-GTTTAAGCTTACTCGAGAACCATGGCGTGAAAACTGAGCATATCAGCG); and FenB-C-F (5'-GAAGATCTCGATTACAAGGATGACGACGATAAGCTGGCCAGAACATTGTATGAAAACG) and FenB-C-B (5'-CTTACTCGAGTTAAACCATGGCATGCTTATTTGGCAGCACTTTTTGAT) were inserted at the BamHI site in pET30 (Novagen) to construct pFC220, pFD220, pFE220, pFA220, and pFB220, which expressed C-terminal 700-amino acid regions in FenC, FenD, and FenE, a 1200-amino acid region in FenA, and an 800-amino acid region in FenB, respectively, with a histidine tag at the C terminus.


Figure 1
View larger version (22K):
[in this window]
[in a new window]

 
FIGURE 1.
Structure of fengycin (A) and map (B) of the fengycin synthetase operon. Fengycin contains 10 amino acids with a lactone bond connecting the L-Tyr at the position 3 and L-Ile at position 10. FA, fatty acid residue attached to the N terminus of the peptide (A). The fengycin synthetase operon (37 kb) contains five fengycin synthetase genes, fenC, fenD, fenE, fenA, and fenB, which were transcribed from a promoter, Pfen. FX10, FX12, and FX14 are mutants with a Tn917lux insertion, and FE5 and FE6 are mutants with a Tn917 insertion. S, SphI; E, EcoRV; P, PstI; Bg, BglII; N, NcoI; B, BamHI (B).

 
Transformation—E. coli was transformed using the CaCl2 transformation method of Cohen and Chang (29). B. subtilis F29-3 was transformed according to the method of Imanaka et al. (30).

Binding of Fengycin Synthetases to Histidine-tagged FenC E. coli HB101(pFC200) and B. subtilis F29-3 were cultured in 1 liter of LB broth and soybean-mannitol-nitrate medium, respectively, to the mid-log phase. Cells were pelleted by centrifugation and suspended in 30 ml of a homogenization buffer that contained 50 mM NaH2PO4, pH 8.0, 300 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, and 10 mM imidazole. Cells were homogenized three times with an Amicon French Press (Thermo Spectronic, Rochester, NY) at 1200 p.s.i. The lysate was centrifuged at 31,000 x g for 1 h at 4 °C to remove debris. E. coli HB101(pFC200) and B. subtilis F29-3 lysates were mixed, and Ni2+-NTA3-agarose beads (Qiagen) (1 ml) were added to the lysate mixture to demonstrate the binding of fengycin synthetases to histidine-tagged FenC (His-FenC). After the mixture had been mixed on a rotator for 1 h at 4 °C, the beads were poured into a 5-ml polypropylene column. The column was washed twice with 60 ml of a wash buffer that contained 50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0. Proteins that bound to the beads were then eluted with 2 ml of elution buffer that contained 50 mM NaH2PO4, pH 8.0, 300 mM NaCl, and 250 mM imidazole. Eluted proteins were finally separated by SDS-PAGE and analyzed by immunoblotting or MALDI-TOF mass spectrometry. Ni2+-NTA-agarose beads were added to the lysate prepared from 1 liter of cells to isolate the fengycin synthetase complex from B. subtilis F29-3(pFC200). Proteins that bound to the beads were purified and analyzed by the same methods as described above. Lysates from 5 liters of cells were used in a study of strains that contained a mutated fengycin synthetase gene.

Sucrose Gradient Sedimentation—A 10-ml linear 25–65% sucrose gradient was prepared in a Beckman SW41 centrifuge tube with a Gradient Station (BioComp, New Brunswick, Canada). Cell lysate (1 ml) was loaded on the top of the gradient and centrifuged at 30,000 rpm for 24 h at 4 °C with a Beckman SW41 rotor. The gradient was fractionated into 10 fractions with the gradient station, and proteins in the fractions were separated by SDS-PAGE and analyzed by immunoblotting or MALDI-TOF mass spectrometry.

SDS-PAGE and Immunoblot Analysis—Fengycin synthetases were separated by SDS-PAGE with 6% gels and stained by a silver stain method (31). Proteins in the gels were electroblotted onto an Immoblon-P transfer membrane (Millipore, Billerica, MA) following a method described elsewhere (32). Anti-FenC and anti-FenA antibodies were generated in rabbits; anti-FenB antibody was monoclonal. Polyclonal antibodies were purified with an Affi-Gel 10 column (Bio-Rad), using antigens purified from E. coli. Anti-FLAG antibody was purchased from Sigma. Immunoblotting was performed following a method reported elsewhere (32). Protein bands were finally detected using a SuperSignal kit (Pierce).

MALDI-TOF Mass Spectrometry—Proteins in polyacrylamide gel were digested with trypsin according to a method described elsewhere (33). The resulting peptides were analyzed using a Brooker Biflex III MALDI-TOF mass spectrometer (Billarica, MA). The m/z ratios of the digested peptides and their fragmented ions were used to search the annotated B. subtilis genome in the mass spectrometry protein sequence database (MSDB) through Mascot search software, version 1.8 (Matrix Science Inc., Boston, MA). A maximum of one missed trypsin cleavage, variable modification including carbamidomethylation, and 1 Da peptide mass tolerance were the search criteria used. The proteins were unambiguously identified as significant hits (p < 0.05) by Mascot peptide mass fingerprint search.

Immunofluorescence Analysis—B. subtilis cells were immunostained following a method described elsewhere (34) with some modifications, including a fixation step that involved 30% acetone and 70% methanol rather than glutaldehyde. Additionally, cells underwent a second round of lysozyme treatment for 3 h after they were fixed. Furthermore, cells were treated with 4% Triton X-100 rather than Tween 20. Immunostaining was performed with polyclonal anti-FenC antibody and monoclonal anti-FenB antibody diluted by a factor of 200. The cells were then treated with 200-fold diluted Alexa 488-conjugated anti-rabbit IgG antibody and 500-fold diluted Alexa 598-conjugated anti-mouse IgG antibody (Molecular Probes, Inc., Eugene, OR). Cells were finally examined using a Leica model TCS SP2 confocal laser-scanning microscope.

Electron Microscopy—Fengycin synthetase complexes purified using Ni2+-NTA-agarose beads from B. subtilis F29-3(pFC200) were adsorbed to a glow-discharged carbon copper grid (Agar Scientific, Essex, UK) and stained with 0.75% uranyl formate (Electron Microscopy Sciences). The enzyme complexes were imaged at room temperature using a JEOL JEM-1230 electron microscope operated at an acceleration voltage of 120 kV.

Peptide Synthesis Assay—Ni2+-NTA beads were added to a mixture of the lysates prepared from 500 ml of E. coli HB101(pFB230) and 500 ml of B. subtilis F29-3 culture to reconstitute and purify a fengycin synthetase complex that contained a mutant FenB, FenB-dTE, which lacks the thioesterase domain. Proteins that were bound to the beads were purified according to the method described above and dialyzed against a buffer that contained 50 mM Tris-HCl, pH 7.8, 0.5 mM Na4P2O7, and 20% sucrose. Reconstituted fengycin synthetase complexes with FenB-dTE (2.6 µg) were added to a reaction mixture that contained 2 mM MgCl2; 2 mM 1,4-dithiothreitol; 2 mM ATP; 2 mM EDTA; 20 mM Mes-Hepes, pH 7.5; 100 µM coenzyme A; 2 mM each of L-alanine, L-glutamic acid, L-isoleucine, L-ornithine, L-threonine, L-tyrosine, and L-valine; 1 µCi each of L-[C14]ornithine (57 mCi/mmol), L-[C14]tyrosine (473 mCi/mmol), and L-[C14]proline (252 mCi/mmol) (Amersham Biosciences). The reaction mixture (200 µl) was incubated at 25 °C for 30 min. Following the reaction, 1 ml of a denaturation buffer, which contained 100 mM Na2HPO4, 10 mM Tris-HCl, pH 8.0, and 8 M urea was added to terminate the reaction and to dissociate fengycin synthetases. Ni2+-NTA-agarose beads (50 µl) were then added. After they had been washed three times with 1 ml of a wash buffer that contained 100 mM Na2HPO4, 10 mM Tris-HCl, pH 6.3, 8 M urea, Ni2+-NTA-agarose beads were collected on a GF/C glass fiber filter (Whatman, Maidston, UK), which was then dried. Then the radioactivity was counted in 15 ml of Fluroansafe 2 (BDH, Poole, UK) using a liquid scintillation counter (LS5000TD; Beckman).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Interactions among Fengycin Synthetases in Vitro—Peptide synthetases are known to comprise conserved sequences and domains. Therefore, antibodies generated with fengycin synthetases often lack specificity. Even monoclonal anti-FenE antibodies produced in this laboratory nonspecifically detected all of the fengycin synthetases in immunoblot analysis (data not shown). Among the antibodies used in this study, only a monoclonal anti-FenB antibody, which recognizes an epitope in the thioesterase domain, specifically recognized FenB. The lack of antibody specificity, while not a problem in the analysis of FenA and FenB by immunoblotting, caused particular difficulty in determining the interactions among FenC, FenD, and FenE by immunoblotting, since these three enzymes had similar molecular masses of about 290 kDa. Therefore, this work adopted both immunoblotting and MALDI-TOF mass spectrometry to analyze the interactions among fengycin synthetases. This study first investigated whether FenA in the B. subtilis F29-3 lysate interacted with recombinant His-FenC in vitro. Adding Ni2+-NTA-agarose beads into the lysate from E. coli HB101(pFC200), as expected, caused His-FenC to bind to the beads (Fig. 2A, lane 5). However, none of the fengycin synthetases in the B. subtilis F29-3 lysate was bound to the beads, because the enzymes lack a histidine tag (Fig. 2, A, lane 3, and B, lane 3). However, the binding of FenA to the beads became evident after the E. coli HB101(pFC200) and B. subtilis F29-3 lysates were mixed with each other (Fig. 2A, lanes 6 and 7). On the other hand, FenA is unstable, explaining why the FenA band that was detected by immunoblotting was faint (Fig. 2A, lane 6) unless a large amount of sample was loaded to a lane (Fig. 2A, lane 7). Therefore, this 406-kDa band was also studied using MALDI-TOF mass spectrometry. The 406-kDa band in a lane loaded with the proteins eluted from Ni2+-NTA-agarose beads added to the E. coli HB101(pFC200)-B. subtilis F29-3 lysate mixture was excised from a gel that had been stained by silver stain. Analyzing this band by MALDI-TOF mass spectrometry analysis, after the proteins in the gel slice were digested with trypsin, revealed a peptide fingerprint matching that of FenA (Table 1). Meanwhile, in parallel experiments, the 406-kDa band was undetected after silver staining in the lanes loaded with the proteins that had been eluted from the beads that were added to the E. coli HB101(pFC200) lysate or the E. coli HB101(pFC240)-B. subtilis F29-3 lysate mixture. Analysis of the proteins in gel pieces excised from the 406-kDa positions by MALDI-TOF mass spectrometry did not yield a peptide fingerprint that matched that of FenA (Table 1). These results verified the immunoblot result that Ni2+-NTA-agarose beads retained FenA in the B. subtilis F29-3 lysate when His-FenC was present. Meanwhile, similar experiments were conducted to detect the interaction between His-FenC and FenB. FenB in the B. subtilis F29-3 lysate (Fig. 2B, lane 1) did not bind to Ni2+-NTA-agarose beads (Fig. 2B, lane 3) unless the lysate was mixed with the E. coli HB101(pFC200) lysate (Fig. 2B, lane 6). Besides, mixing the lysates from B. subtilis F29-3 and E. coli HB101(pFC240) did not result in a binding of FenB to the beads (Fig. 2B, lane 4). MALDI-TOF spectrometry analysis also confirmed that the 146 kDa band contained FenB (Table 1). After demonstrating the interactions among FenA, FenB, and His-FenC in vitro, this study further investigated whether FenD and FenE interacted with His-FenC. Analyzing the 290 kDa band in a lane loaded with the proteins eluted from Ni2+-NTA-agarose beads added to the E. coli HB101(pFC200) lysate by MALDI-TOF mass spectrometry, as expected, revealed a peptide fingerprint that matched that of FenC (Table 1; supplemental Table 1). Meanwhile, a similar experiment was performed by adding the beads to an E. coli HB101(pFC200)-B. subtilis F29-3 lysate mixture. Analysis of the 290-kDa band in this case revealed peptide fingerprints that matched those of FenC, FenD, and FenE (Table 1; supplemental Table 2), indicating that His-FenC, FenD, and FenE were bound to the beads. Additionally, the peptides with m/z at 1215.60, 1260.66, and 1383.67 (supplemental Table 2) were further selected for MALDI-TOF-TOF analysis. The analysis revealed sequences of AVLPDFMVPAR, IHDEVPFTTFR, and DSGAALLLTQPGK, which matched the amino acid sequence in the regions from 1962 to 1972 in FenD, from 1119 to 1128 in FenC, and from 559 to 572 in FenE, respectively, confirming that the peptide mass fingerprint data obtained by MALDI-TOF analysis indeed detected FenC, FenD, and FenE. Meanwhile, a parallel experiment was conducted using a B. subtilis F29-3-E. coli HB101(pFC240) lysate mixture; not only did immunoblotting not detect the binding of the 290-kDa proteins to the Ni2+-NTA-agarose beads (Fig. 2A, lane 4), but also MALDI-TOF mass spectrometry analysis of a piece of gel excised from the 290-kDa region failed to detect any peptide fingerprint matching those of FenC, FenD, and FenE (Table 1; supplemental Table 2).


View this table:
[in this window]
[in a new window]

 
TABLE 1
MALDI-TOF mass spectrometry analysis of 146-, 290-, and 406-kDa proteins that were bound to His-FenC

 


Figure 2
View larger version (27K):
[in this window]
[in a new window]

 
FIGURE 2.
Binding of FenA and FenB to histidine-tagged FenC in vitro. Lysates prepared from B. subtilis F29-3 (lane 1), E. coli HB101(pFC200) (lane 2), and E. coli HB101(pFC240) were mixed. Ni2+-NTA-agarose beads (Ni) were then added to the mixtures (lanes 3–6). Both lanes 6 and 7 were loaded with the proteins that were eluted from Ni2+-NTA-agarose beads that had been added to the E. coli HB101(pFC200)-B. subtilis F29-3 lysate mixture. However, the amount of proteins loaded in lane 7 was 5 times that in lane 6. Proteins eluted from the beads were separated with 6% SDS-polyacrylamide gels and analyzed by immunoblotting (IB) with anti-FenA (A) and anti-FenB antibodies (B).

 
Analyzing the Interactions among Fengycin Synthetases in Vivo—After demonstrating that fengycin synthetases interacted with His-FenC in vitro, this work added Ni2+-NTA-agarose beads to the B. subtilis F29-3(pFC200) lysate to investigate whether fengycin synthetases in the cell were retained by the beads. After the proteins were eluted from the beads and the eluted proteins were separated by SDS-PAGE, bands of 406, 290, and 146 kDa were observed by staining with a silver stain. MALDI-TOF spectrometry confirmed that the 406-kDa band contained FenA (Table 1; supplemental Table 3); the 290 kDa band contained FenC, FenD, and FenE (Table 1; supplemental Table 3), and the 146 kDa band contained FenB (Table 1; supplemental Table 3). Meanwhile, a parallel experiment, which used a lysate from B. subtilis F29-3(pFC240), revealed that not only did staining and immunoblotting fail to detect the three fengycin synthetase bands, but also MALDI-TOF mass spectrometry of the gel pieces sliced from the 406-, 290-, and 146-kDa regions failed to detect peptides with a molecular mass that matched that of peptides from fengycin synthetases digested with trypsin (Table 1).

Analyzing the Interactions of Fengycin Synthetases in Fengycin Synthetase Mutants—B. subtilis F29-3 mutants that contained a transposon insertion in fenC, fenD, fenE, fenA, and fenB, called FX12, FX10, FX14, FE6, and FE5, respectively (Fig. 1B), were transformed with pFC200 to elucidate how mutations in a fengycin synthetase gene affected the interactions among fengycin synthetases. In the case of the FX12 mutant, which contained a defective fenC, none of the fengycin synthetases in the lysate mutant bound to Ni2+-NTA-agarose beads (Table 1). However, MALDI-TOF mass spectrometry analysis of the 406-, 290-, and 146-kDa bands in an SDS-polyacrylamide gel stained by silver staining revealed binding of all five fengycin synthetases to the beads when the mutant was transformed with pFC200 (Table 1). Meanwhile, using the FX10(pFC200) lysate yielded a different outcome; only His-FenC, and not the other fengycin synthetases, bound to the beads (Table 1). Additionally, both His-FenC and FenD in the FX14(pFC200) lysate; His-FenC, FenD, and FenE in the FE6(pFC200) lysate; and His-FenC, FenD, FenE, and FenA in the FE5(pFC200) lysate bound to the Ni2+-NTA-agarose beads (Table 1).

Specific Interactions among Fengycin Synthetases in Vitro To investigate how fengycin synthetases interact, the N-terminal and C-terminal regions in fengycin synthetases that were fused with a FLAG tag and a histidine tag, respectively, were expressed in E. coli. After the lysates were mixed, Ni2+-NTA-agarose beads were added. Proteins eluted from the beads were then separated by SDS-PAGE. Immunoblot analysis using anti-FLAG antibody indicated the binding of a protein that contains the N-terminal 700-amino acid region in FenD (N-FenD) to a protein that contains the C-terminal 700-amino acid region in FenC (C-FenC) (Fig. 3). However, C-FenC did not interact with the N-terminal 900-amino acid region in FenE (N-FenE), the N-terminal 800-amino acid region in FenA (N-FenA), or the N-terminal 700-amino acid region in FenB (N-FenB) (Fig. 3). Similar experiments demonstrated that N-FenE interacted with the C-terminal 700-amino acid region in FenD (C-FenD), N-FenA interacted with the C-terminal 700-amino acid region in FenE (C-FenE), and N-FenB interacted with the C-terminal 800-amino acid region in FenA (C-FenA) (Fig. 3). Additionally, the C-terminal 800-amino acid region in FenB (C-FenB) did not interact with the N-terminal regions of other fengycin synthetases (Fig. 3).

Sucrose Gradient Sedimentation Analysis of Fengycin Synthetase Complex—In a control experiment, a lysate from E. coli HB101(pFC200) was loaded to a 25–65% sucrose gradient. Following centrifugation, His-FenC was present on the top of the gradient in fractions 2, 3, and 4 (Fig. 4A). However, fengycin synthetases in the B. subtilis F29-3 lysate were distributed between fractions 3 and 9 (Fig. 4A). Meanwhile, fengycin synthetases in the FX10 lysate were distributed between fractions 2 and 6. Furthermore, FenB in the lysate from E. coli HB101(pFB200) was present on the top of the gradient from fraction 2 to 4 (Fig. 4B). FenB in the lysate from B. subtilis F29-3 was found in fractions 3–9 (Fig. 4B). FenB in the lysate from the FX10 mutant was present in fractions 2–5 (Fig. 4B). Immunoblot and MALDI-TOF mass spectrometry analyses confirmed that fraction 8 from the gradient loaded with the B. subtilis F29-3 lysate contained all five fengycin synthetases (data not shown).


Figure 3
View larger version (41K):
[in this window]
[in a new window]

 
FIGURE 3.
Interactions among fengycin synthetases. Recombinant proteins that contained histidine-tagged C-terminal regions of FenC (C-FenC), FenD (C-FenD), FenE (C-FenE), FenA (C-FenA), and FenB (C-FenB) were mixed with the proteins that contained FLAG-tagged N-terminal regions of FenC (N-FenC), FenD (N-FenD), FenE (N-FenE), FenA (N-FenA), and FenB (N-FenB). Ni2+-NTA-agarose beads were then added to the mixture. Proteins that were bound to the beads were analyzed by immunoblotting with anti-FLAG antibody.

 


Figure 4
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 4.
Sedimentation of the fengycin synthetase complex by sucrose-gradient centrifugation. Cell lysates prepared from E. coli HB101(pFC200), E. coli HB101(pFB200), B. subtilis F29-3, and B. subtilis FX10 were centrifuged through a 25–65% sucrose gradient. After centrifugation, fractionated proteins were analyzed by immunoblotting with anti-FenC antibody (A) and anti-FenB antibody (B).

 
Electron Microscopy of Fengycin Synthetase Complex— Fengycin synthetase complex purified from B. subtilis F29-3(pFC200) with an Ni2+-NTA-agarose column was studied by electron microscopy. The fengycin synthetases formed a chain that coiled into a structure with an average size of about 14.5 nm (Fig. 5). Meanwhile, complexes that are smaller than 14.5 nm were observed and probably did not contain all of the fengycin synthetases.


Figure 5
View larger version (84K):
[in this window]
[in a new window]

 
FIGURE 5.
Microscopy of the fengycin synthetase complex. Fengycin synthetase complexes purified from E. coli HB101(pFC200) and B. subtilis F29-3(pFC200), respectively, by Ni2+-NTA-agarose beads were negatively stained and observed using a JEOL JEM-1230 electron microscope. Five regions of the image are selected and magnified (15). Meanwhile, histidine-tagged FenC purified from E. coli HB101(pFC200) was also shown (6) as a comparison. Bar, 50 nm.

 


Figure 6
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 6.
Localization of fengycin synthetases in B. subtilis F29-3. Immunostaining of B. subtilis F29-3 cells was performed with polyclonal anti-FenC ({alpha}-FenC) and monoclonal anti-FenB antibody ({alpha}-FenB). The cells were then treated with Alexa 488-conjugated anti-rabbit IgG antibody and Alexa 598-conjugated anti-mouse IgG antibody. Finally, cells were examined using a Leica model TCS SP2 confocal laser-scanning microscope (A). A region of the image is selected and magnified (B).

 
Localization of Fengycin Synthetases—Immunofluorescence analysis of B. subtilis F29-3 cells was performed by confocal microscopy with polyclonal anti-FenC and monoclonal anti-FenB antibody to locate the fengycin synthetases in the cell. Among the cells that had been cultured for 24 h in nHA broth, FenB and FenC appeared to aggregate and frequently colocalized along the membrane (Fig. 6).

Synthesis of Fengycin on the Fengycin Synthetase Complex The synthesis of fengycin on the fengycin synthetase complex was studied using enzyme complexes that were reconstituted in vitro using a mutant FenB protein, FenB-dTE, which lacks a thioesterase domain. After the complex had been purified by Ni2+-NTA-agarose affinity chromatography, the enzyme complex was added to a reaction mixture that contained the seven substrate amino acids that were involved in fengycin synthesis, including 14C-labeled L-Orn, L-Tyr, and L-Pro. After the reaction completed, urea was added to the reaction mixture to dissociate the enzymes from FenB-dTE. FenB-TE, which contained a histidine tag, was then captured with Ni2+-NTA-agarose beads. Because FenB-dTE did not contain a thioesterase domain, radioactively labeled fengycin elongated to FenB-dTE could not be released. Therefore, fengycin synthesis on the enzyme chain could be determined by monitoring the radioactivity of fengycin elongated to FenB-dTE. The results indicated that in the experiment that involved FenB-dTE but not the other fengycin synthetases, only a background level of labeling of FenB-dTE was detected (Fig. 7). However, when the fengycin synthetase complex reconstituted with FenB-dTE was added to the reaction mixture, the detected radioactivity increased by a factor of about 4 (Fig. 7).


Figure 7
View larger version (10K):
[in this window]
[in a new window]

 
FIGURE 7.
Synthesis of fengycin on fengycin synthetase complex. FenB-dTE, H2O(Blank) or fengycin synthetase complex that had been reconstituted with FenB-dTE and purified in vitro (Complex(FenB-dTE)) was added to a mixture of ATP, coenzyme A, and the seven amino acids in fengycin, including 14C-labeled L-Orn, L-Pro, and L-Tyr. Following the reaction, FenB-dTE was dissociated from the complex by adding a urea solution to the reaction mixture. FenB-dTE was finally captured by Ni2+-NTA-agarose beads. Radioactively labeled fengycin peptide elongated to FenB-dTE was then measured using a liquid scintillation counter.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Microorganisms often synthesize small peptides nonribosomally. During the synthesis, an elongating peptide must be transferred from one peptide synthetase to another in a specific order; otherwise, a peptide with a correct sequence will not be synthesized (18, 35, 36). Hence, forming a peptide synthetase complex is probably the most efficient way for nonribosomal peptide synthesis. In fact, Kleinkauf and von Döhren (37, 38) postulated that peptide synthetases may form such a complex to facilitate peptide synthesis. However, the presence of such a complex has not been experimentally established. The only work that might have suggested that peptide synthetases form a complex involved a sucrose gradient sedimentation study on gramicidin synthetases and demonstrated that the two gramicidin synthetases were present in the same fractions in the gradient (39). Since fengycin synthesis involves five fengycin synthetases, the system enables the interaction among these enzymes, whether they are linked in a specific order, and how the absence of an enzyme affects the complex formation to be investigated. This study reveals that fengycin synthetases directly or indirectly interact with His-FenC both in vitro and in vivo (Table 1 and Fig. 2). Meanwhile, these enzymes appear to form a chain, which coils into a uniform structure of about 14.5 nm (Fig. 5). The size of the fengycin synthetase complex is smaller than cyclosporine synthetase, a 1.6-megadalton protein with 11-amino acid activation modules and a size of 25 nm (40). Observations of fengycin synthetases and the cyclosporin synthetase indicate that the enzyme modules and enzymes themselves, rather than stretching out in a line, may bond to each other at particular angles and ultimately form an enzyme or an enzyme complex with a defined shape (Fig. 5). Additionally, two partner fengycin synthetases can bind to each other in the absence of other fengycin synthetases in vitro,4 revealing that any two-partner fengycin synthetases may interact in the cell to begin assembling the fengycin synthetase chain.

The immunofluorescence work reveals that FenB and FenC form aggregates and frequently colocalize at the membrane in the cells that had been cultured for 24 h (Fig. 6). However, only about half of the cell population in the log phase formed such aggregates; the rest of the population contain these enzymes distributed evenly in the cells (data not shown), indicating that the stages of cell growth affect the distribution of the enzymes. Earlier studies have demonstrated that cyclosporin synthetase and gramicidin synthetase 2 are also associated with the vascular membrane in Tolypocladium inflatum (40) and the membrane in Bacillus cereus, respectively (41). The association of the fengycin synthetases with the membrane is unsurprising, because the interaction may facilitate the synthesis of the fatty acid that is incorporated in fengycin.

After establishing that fengycin synthetases bind to Ni2+-NTA-agarose beads when His-FenC is present, this study further explores how these enzymes interact with His-FenC in the mutants that contain a mutation in a fengycin synthetase gene. The results indicated that FenE, FenA, and FenB do not interact with His-FenC in FX10(pFC200), a mutant that contains a defective fenD (Table 1). This result indicates the important fact that His-FenC does not directly interact with FenE, FenA, and FenB; the binding of FenE, FenA, and FenB to His-FenC and Ni2+-NTA-agarose beads depends on FenD. Meanwhile, a similar study of FX14(pFC200), which contains a defective fenE, reveals a binding of His-FenC and FenD but not FenA and FenB to Ni2+-NTA-agarose beads (Table 1). Since FenD does not bind to Ni2+-NTA-agarose beads, the binding of FenD in the FX14(pFC200) lysate to the beads (Table 1) reveals a direct interaction between His-FenC and FenD. Moreover, the observation also shows that FenE is required for the binding of FenA and FenB to FenD. Furthermore, in the study that involves FE6(pFC200), which contains a defective fenA, His-FenC, FenD, and FenE in the lysate bind to Ni2+-NTA-agarose beads (Table 1). Since FenE in the FX10(pFC200) lysate does not bind to Ni2+-NTA-agarose beads (Table 1), the results indicate that the binding of FenE to the beads depends on His-FenC and FenD. Additionally, the fact that FenE does not bind to FenC in the FX10(pFC200) lysate (Table 1) demonstrates that FenE indirectly interacts with His-FenC through a direct binding to FenD. Moreover, the study on FE6(pFC200) (Table 1) revealed that the interaction between FenB and His-FenC depends on FenA. Likewise, an analysis of the fengycin synthetases in the FE5(pFC200) lysate (Table 1) reveals that FenE binds to FenA. The fact that FenB is present in the fengycin synthetase complex in B. subtilis F29-3 (Fig. 2B) and that FenB does not bind to Ni2+-NTA-agarose beads in the absence of FenA (Table 1) demonstrates that FenB directly interacts with FenA. Additionally, this work finds that transposon insertions in the fengycin synthetase operon reduce but do not completely eliminate the expression of the genes downstream of the insertions. Hence, a lack of binding of fengycin synthetases to Ni2+-NTA-agarose beads is not attributable to a lack of fengycin synthetase in the mutant cells. In fact, our investigation reveals that two partner fengycin synthetases in the enzyme chain are indeed linked via a specific interaction between the C-terminal region of an upstream enzyme and the N-terminal region of a downstream partner enzyme (Fig. 3). These findings indicate that fengycin synthetases form a chain in the order FenC-FenD-FenE-FenA-FenB, with the 10-amino acid activation modules arranged colinearly with the amino acids in fengycin. The fact indicating that physical interactions among peptide synthetases are crucial to nonribosomal peptide synthesis also came from a work on tyrocidine synthesis. The study indicated that substituting the regions containing the epimerase domains of TycA and TycB (tyroscidine synthetase A and B) prevents the translocation of the elongating tyrocidine peptide from TycA to TycB (42), suggesting that the absence of peptide translocation may be attributable to the possibility that the C-terminal epimerase domain in TycA is critical to a specific interaction with TycB. Additionally, the work also artificially linked TycA and TycB to form a single protein chain and showed that tyrocidine was synthesized on the recombinant enzyme, indicating the importance of physical contact between these two enzymes (42). Furthermore, although direct contacts among the three tyrocidine synthetases have not been established, the interaction between a donor and an acceptor COM domain at the C terminus and the N terminus of TycA and TycB, respectively, are crucial for tyrocidine synthesis; changing the sequences in these domains or replacing the sequence with COM sequences from other enzymes prevents the elongation of tyrocidine peptide chain (24, 43). Whether fengycin synthetases interact via the COM domains is under investigation.

FenB contains a thioesterase domain, which is required to terminate fengycin synthesis. In an enzyme complex that contains an intact FenB, fengycin synthesized on the enzyme complex is terminated and released from the enzyme complex. Under such circumstances, radioactively labeled fengycin synthesized by the fengycin synthetase complex will be difficult to recover and identify. However, fengycin should not be released from the enzyme complex if the thioesterase domain in FenB is removed. Therefore, radioactively labeled fengycin elongated to FenB-dTE can be measured after dissociating the enzyme complex with urea and capturing FenB-dTE by Ni2+-NTA-agarose beads (Fig. 7). This study demonstrated by SDS-PAGE that fengycin synthetases form a complex with FenB-dTE (data not shown). Additionally, results of this study demonstrate that fengycin is indeed synthesized on the enzyme complex that had been purified by Ni2+-NTA-agarose beads (Fig. 7). Our results further demonstrate that forming a fengycin synthetase complex is crucial to the nonribosomal synthesis of fengycin.


    FOOTNOTES
 
* This research was supported by Chang-Gung Memorial Hospital Grant CMRPD33004, National Science Council of the Republic of China Grant NSC 95-3112-B-182-002, Chang-Gung Molecular Medicine Research Center Grant CMRPD140041, and a grant for study visits for foreign academics to the Federal Republic of Germany from Deutscher Akademischer Austauschdienst, Germany. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Tables 1–3. Back

1 These authors contributed equally to this work. Back

2 To whom correspondence and reprint requests should be addressed. Tel./Fax: 886-32118292; E-mail: cgliu{at}mail.cgu.edu.tw.

3 The abbreviations used are: NTA, nitrilotriacetic acid; MALDI, matrix-assisted laser desorption ionization; TOF, time-of-flight; Mes, 2-(N-morpholino)ethanesulfonic acid; COM, communication-mediating. Back

4 Y.-C. Cheng and S.-T. Liu, unpublished results. Back


    ACKNOWLEDGMENTS
 
We thank Erh-Min Lai for critiques and suggestions.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Loeffler, W., Tschen, J. S.-M., Vanittanakom, N., Kulger, M., Konorpp, E., and Wu, T. G. (1986) J. Phytopathol. 115, 204-213
  2. Tschen, J. S. M. (1987) Trans. Mycol. Soc. Japan 28, 483-493
  3. Vanittanakom, N., Loeffler, W., Koch, U., and Jung, G. (1986) J. Antibiot. (Tokyo) 39, 888-901[Medline] [Order article via Infotrieve]
  4. Chen, C. L., Chang, L. K., Chang, Y. S., Liu, S. T., and Tschen, J. S. (1995) Mol. Gen. Genet. 248, 121-125[CrossRef][Medline] [Order article via Infotrieve]
  5. Lin, T. P., Chen, C. L., Chang, L. K., Tschen, J. S., and Liu, S. T. (1999) J. Bacteriol. 181, 5060-5067[Abstract/Free Full Text]
  6. Stachelhaus, T., and Marahiel, M. A. (1995) FEMS Microbiol. Lett. 125, 3-14[CrossRef][Medline] [Order article via Infotrieve]
  7. Schwarzer, D., Finking, R., and Marahiel, M. A. (2003) Nat. Prod. Rep. 20, 275-287[CrossRef][Medline] [Order article via Infotrieve]
  8. Sieber, S. A., and Marahiel, M. A. (2003) J. Bacteriol. 185, 7036-7043[Free Full Text]
  9. Finking, R., and Marahiel, M. A. (2004) Annu. Rev. Microbiol. 58, 453-488[CrossRef][Medline] [Order article via Infotrieve]
  10. Grunewald, J., and Marahiel, M. A. (2006) Microbiol. Mol. Biol. Rev. 70, 121-146[Abstract/Free Full Text]
  11. Conti, E., Stachelhaus, T., Marahiel, M. A., and Brick, P. (1997) EMBO J. 16, 4174-4183[CrossRef][Medline] [Order article via Infotrieve]
  12. Lin, G. H., Chen, C. L., Tschen, J. S., Tsay, S. S., Chang, Y. S., and Liu, S. T. (1998) J. Bacteriol. 180, 1338-1341[Abstract/Free Full Text]
  13. Shu, H. Y., Lin, G. H., Wu, Y. C., Tschen, J. S., and Liu, S. T. (2002) Biochem. Biophys. Res. Commun. 292, 789-793[CrossRef][Medline] [Order article via Infotrieve]
  14. Lin, T. P., Chen, C. L., Fu, H. C., Wu, C. Y., Lin, G. H., Huang, S. H., Chang, L. K., and Liu, S. T. (2005) Biochim. Biophys. Acta 1730, 159-164[Medline] [Order article via Infotrieve]
  15. Schlumbohm, W., Stein, T., Ullrich, C., Vater, J., Krause, M., Marahiel, M. A., Kruft, V., and Wittmann-Liebold, B. (1991) J. Biol. Chem. 266, 23135-23141[Abstract/Free Full Text]
  16. Lambalot, R. H., Gehring, A. M., Flugel, R. S., Zuber, P., LaCelle, M., Marahiel, M. A., Reid, R., Khosla, C., and Walsh, C. T. (1996) Chem. Biol. 3, 923-936[CrossRef][Medline] [Order article via Infotrieve]
  17. Stachelhaus, T., Huser, A., and Marahiel, M. A. (1996) Chem. Biol. 3, 913-921[CrossRef][Medline] [Order article via Infotrieve]
  18. Stein, T., Vater, J., Kruft, V., Otto, A., Wittmann-Liebold, B., Franke, P., Panico, M., McDowell, R., and Morris, H. R. (1996) J. Biol. Chem. 271, 15428-15435[Abstract/Free Full Text]
  19. Kleinkauf, H. (2000) Biofactors 11, 91-92[Medline] [Order article via Infotrieve]
  20. Mootz, H. D., and Marahiel, M. A. (1997) J. Bacteriol. 179, 6843-6850[Abstract/Free Full Text]
  21. Stachelhaus, T., Mootz, H. D., Bergendahl, V., and Marahiel, M. A. (1998) J. Biol. Chem. 273, 22773-22781[Abstract/Free Full Text]
  22. Luo, L., Kohli, R. M., Onishi, M., Linne, U., Marahiel, M. A., and Walsh, C. T. (2002) Biochemistry 41, 9184-9196[CrossRef][Medline] [Order article via Infotrieve]
  23. Linne, U., and Marahiel, M. A. (2000) Biochemistry 39, 10439-10447[CrossRef][Medline] [Order article via Infotrieve]
  24. Samel, S. A., Wagner, B., Marahiel, M. A., and Essen, L. O. (2006) J. Mol. Biol. 359, 876-889[CrossRef][Medline] [Order article via Infotrieve]
  25. Sieber, S. A., Tao, J., Walsh, C. T., and Marahiel, M. A. (2004) Angew. Chem. Int. Ed. Engl. 43, 493-498
  26. Chang, L. K., Chen, C. L., Chang, Y. S., Tschen, J. S., Chen, Y. M., and Liu, S. T. (1994) Gene (Amst.) 150, 129-134[CrossRef][Medline] [Order article via Infotrieve]
  27. Sambrook, J., and Russell, D. W. (2001) Molecular Cloning: A Laboratory Manual, 3rd Ed., pp. A2.2, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  28. Boyer, H. W., and Roulland-Dussoix, D. (1969) J. Mol. Biol. 41, 459-472[CrossRef][Medline] [Order article via Infotrieve]
  29. Cohen, S. N., and Chang, A. C. (1973) Proc. Natl. Acad. Sci. U. S. A. 70, 1293-1297[Abstract/Free Full Text]
  30. Imanaka, T., Fujii, M., Aramori, I., and Aiba, S. (1982) J. Bacteriol. 149, 824-830[Abstract/Free Full Text]
  31. Blum, H., Beier, H., and Gross, H. J. (1987) Electrophoresis 8, 93-99[CrossRef]
  32. Chang, L. K., Lee, Y. H., Cheng, T. S., Hong, Y. R., Lu, P. J., Wang, J. J., Wang, W. H., Kuo, C. W., Li, S. S., and Liu, S. T. (2004) J. Biol. Chem. 279, 38803-38812[Abstract/Free Full Text]
  33. Shevchenko, A., Wilm, M., Vorm, O., and Mann, M. (1996) Anal. Chem. 68, 850-858[Medline] [Order article via Infotrieve]
  34. Harry, E. J., Pogliano, K., and Losick, R. (1995) J. Bacteriol. 177, 3386-3393[Abstract/Free Full Text]
  35. Stachelhaus, T., and Marahiel, M. A. (1995) J. Biol. Chem. 270, 6163-6169[Abstract/Free Full Text]
  36. von Döhren, H., Keller, U., Vater, J., and Zocher, R. (1997) Chem. Rev. 97, 2675-2706[CrossRef][Medline] [Order article via Infotrieve]
  37. Kleinkauf, H., and von Döhren, H. (1997) Prog. Drug. Res. 48, 27-53[Medline] [Order article via Infotrieve]
  38. Kleinkauf, H., and von Döhren, H. (1995) J. Antibiot. (Tokyo) 48, 563-567[Medline] [Order article via Infotrieve]
  39. Koischwitz, H., and Kleinkauf, H. (1976) Biochim. Biophys. Acta 429, 1041-1051[Medline] [Order article via Infotrieve]
  40. Hoppert, M., Gentzsch, C., and Schorgendorfer, K. (2001) Arch. Microbiol. 176, 285-293[CrossRef][Medline] [Order article via Infotrieve]
  41. Hori, K., and Kurotsu, T. (1997) J. Biochem. (Tokyo) 122, 606-615[Abstract/Free Full Text]
  42. Linne, U., Stein, D. B., Mootz, H. D., and Marahiel, M. A. (2003) Biochemistry 42, 5114-5124[CrossRef][Medline] [Order article via Infotrieve]
  43. Chiocchini, C., Linne, U., and Stachelhaus, T. (2006) Chem. Biol. 13, 899-908[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Bacteriol.Home page
W.-J. Ke, B.-Y. Chang, T.-P. Lin, and S.-T. Liu
Activation of the Promoter of the Fengycin Synthetase Operon by the UP Element
J. Bacteriol., July 15, 2009; 191(14): 4615 - 4623.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
282/8/5608    most recent
M609726200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, C.-Y.
Right arrow Articles by Liu, S.-T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, C.-Y.
Right arrow Articles by Liu, S.-T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2007 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement