| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 282, Issue 8, 5834-5841, February 23, 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1
From the
Departments of Structural Anatomy and Neuroscience and Dermatology, Asahikawa Medical College, Midorigaoka-Higashi 2-1-1-1, Asahikawa 078-8510, Japan and the ¶Department of Immunology, Berlex Biosciences, Richmond, California 94804-0099
Received for publication, August 21, 2006 , and in revised form, December 18, 2006.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Human tissue kallikreins comprise of a subgroup of 15 serine proteases encoded by a tightly clustered multigene family on chromosome 19q13.4 (2-4). This region is also synthenic to the locus on mouse chromosome 7 where the murine kallikrein gene family cluster is localized (5), and mouse serine proteases share a high degree of sequence and structural similarity with human homologues (2, 5). In this paper, we use the terms of KLK1-KLK15 for human kallikrein genes and hK1-hK15 for the enzyme products from KLK1-KLK15. In addition, we use terms Klk1-Klk15 for mouse homologues of human genes and mK1-mK15 for the products from Klk genes following the nomenclature of kallikreins (6). KLKs have been shown to play critical roles in desquamation as recently reported (7, 8). hK5 and hK7 (previously designated SCTE and SCCE, respectively) have been shown to be involved in skin desquamation through their ability to degrade desmosome and/or corneodesmosome component protein such as desmoglein 1 (DSG1),2 desmocollin 1, and corneodesmosin (CDSN) in vitro (8). Pro-hK7 can be activated by hK5, and pro-hK5 can be activated by hK14 and hK5 itself (7). Furthermore, the expression and activation of hK7 are known to increase in psoriasis and itchy dermatitis (9, 10).
KLK8, also known as neuropsin, has been shown to have a trypsin-like activity (11). In human and mouse skin, hK8 and mK8 are localized from the upper stratum spinosum to the stratum corneum. Increases in KLK8 transcripts and protein were observed in human skin diseases, such as psoriasis vulgaris, lichen planus, and atopic dermatitis (12, 13). These results led to the hypothesis that hK8 is involved in the pathogenesis of inflammatory skin diseases.
There was no remarkable histological difference between the epidermis of wild-type (WT) and Klk8 gene-null (Klk8-/-) mice. However, Klk8-/- mice showed delayed recovery of the epidermis from the UVB-induced inflammation (14). A previous study showed that Klk8 mRNA was induced by an external stimulus, such as the application of 12-O-tetradecanoylphorbol-13-acetate (TPA), which causes epidermal proliferation and hyperkeratosis like psoriasis of human skin (15). In the present study, we used TPA to compare the reaction of WT and Klk8-/- mouse skin. Our results suggest that mK8 is involved in desquamation through a protease cascade reaction leading to the degradation of DSG1 and CDSN.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
RT-PCR—Total RNA was isolated according to the TRIzol protocol (Invitrogen) and incubated with DNase (Promega) for RT-PCR. Two micrograms of total RNA was reverse transcribed with avian myeloblastosis virus reverse transcriptase (Promega), and PCR was performed using Taq DNA polymerase (Promega). The primers used were as follows: Klk8 forward sequence, CCCACTGCAAAAAACAGAAC; Klk8 reverse sequence, TGTCAGCTCCATTGCTGCT; Klk7 forward sequence, GCTGGACAAGGAGAAAGGATT; Klk7 reverse sequence, TGGTACTGACCCATTTTGCA; Klk6 forward sequence, CCCAGATACCATTCAGTGT; Klk6 reverse sequence, CGTGGGGGAGAACTGGATGT; 
2-microglobulin forward sequence, TGCTACTCGGCGCTTCAGT; and 2-microglobulin reverse sequence, TATGTTCGGCTTCCCATTCT. Each reaction was performed at 30 cycles. Real time quantitative PCR was performed following the protocol described for a Light cycler SYBR green kit (Roche Applied Science).
Histopathology—Quantification/counting of the number of cell layers in the stratum corneum was performed as previously reported (17). Briefly, 5-µm fresh frozen sections were stained with 1% aqueous solution of safranin for 1 min and flooded with 2% potassium hydroxide aqueous solution. The number of the corneocyte layers was counted at six randomly selected locations/slide.
For immunohistochemistry, fresh frozen sections (5 µm thick) were incubated with 0.3% H2O2 for 5 min to quench the endogenous peroxidase activity followed by blocking with 5% bovine serum albumin in phosphate-buffered saline for 20 min. The sections were incubated with primary antibodies for 1 h at room temperature. The primary antibodies (Abs) used were anti-mK8 Ab (Medical & Biological Laboratories) diluted at 1:1000, anti-mK6 Ab (18) diluted at 1:2000, anti-Ki67 Ab (Dako Cytomation) diluted at 1:100, anti-DSG1 Ab (BD Bioscience) diluted at 1:100, and anti-CDSN Ab (19), diluted at 1:200. Primary antibodies were detected using a peroxidase or fluorescein isothiocyanate-conjugated secondary antibody (1:1000 dilution). A Vectastain Elite ABC kit (Vector Laboratories) was used for the detection of peroxidase activity.
For proliferation assay, fresh frozen sections (5 µm thick) were incubated with anti-Ki67 Ab (Dako Cytomation) diluted at 1:100 for 1 h at room temperature. The primary antibody was detected using a Vectastain Elite ABC kit. The number of the Ki67-positive cells was counted at four randomly selected locations/slide.
Western Blotting—The incised mouse skin was incubated with 10 mM EDTA in phosphate-buffered saline for 5 min at 56 °C. The epidermis was mechanically separated from the dermis and homogenized in a sample buffer containing 62.5 mM Tris-HCl, 2% glycerol, 1% SDS, 5 mM EDTA, 1 mM PMSF, and a protease inhibitor mixture (Sigma), followed by sonication on ice five times for 3 s and centrifuged at 15,000 x g for 20 min at 4 °C. The supernatant was used as the epidermal extract. Proteins of the epidermal extract were separated by SDS-PAGE and blotted onto polyvinylidene difluoride membranes (Millipore). The membranes were incubated with one of the following antibodies: anti-mK6 Ab, anti-DSG1 Ab (BD Biosciences), anti-CDSN Ab, and anti-
-tubulin Ab (Abcam). The final detection was performed with 1:2000 dilutions of peroxidaseconjugated secondary anti-rabbit or anti-mouse antibodies and visualized using the ECL Advance Western blot detection kit (Amersham Biosciences Bioscience) and luminescent Image Analyzer LAS-3000 (Fuji).
Protease Activity Assays in Mouse Epidermis—The TPA-applied, shaved back skin was incubated in 1 M NaCl at 4 °C for 72 h for separating at the dermal-epidermal junction. Each epidermis was homogenized with the extraction buffer containing 60 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Nonidet P-40, and 5mM EDTA and centrifuged at 15,000 x g for 20 min at 4 °C. The proteolytic activity of the supernatant was measured as described previously (20, 21) with a slight modification. Briefly, 10 µg of protein of the epidermal extract was incubated with 100 mM synthetic substrate Boc-Val-Pro-Arg-MCA (VPR-MCA) (Peptide Institute), Boc-Phe-Ser-Arg-MCA (FSR-MCA) (Peptide Institute), and Meo-Suc-Arg-Pro-Tyr-pNA-HCl (RPY-pNA) (Chromogenix AB) in a total volume of 1 ml at 37 °C for 2 h with shaking. All of the reactions were stopped by the addition of 1 mM PMSF. Released 7-amino-4-methylcoumarin was measured on a F-4500 fluorescence spectrometer (Hitachi) set at 370 nm for excitation and 460 nm for emission. Released pNA was measured on photometer Ultraspec 2100 pro (Amersham Biosciences) set at 405-nm wavelength. All of the measurements were performed in duplicate.
In Situ Zymography—In situ zymography was performed using 5-µm fresh frozen sections as previous described (22). Briefly, the sections were washed with 2% Tween 20 in deionized water and incubated with 2 µg/µl BOPY-FL-conjugated casein (Molecular Probes) at 37 °C for 2 h. PMSF (1 mM) was added to some sections as negative controls. After washing, the sections were examined using fluorescence microscopy.
Construction of Adenovirus Vectors and Transfection in Klk8-/- Mouse Keratinocytes—The cDNA fragment encoding Klk8 was cloned into an expression cosmid cassette designated pAxCAwt, whose foreign gene expression is strongly induced by a CAG promoter. The generated cosmid was used as a transfer vector for adenovirus preparation. For obtaining recombinant adenovirus (AdKlk8), we used Takara adenovirus expression kit, followed by CsCl gradient centrifugation (23). Viral titers (plaque forming unit/ml) were determined using a plaque-forming assay in HEK 293 cells (23). An identical virus, lacking expression of the transgene, but expressing green fluorescent protein (AdGFP) was used as a negative control.
|
|
Statistical Analysis—Student's t test was used for statistical analysis. The data are presented as the means ± S.E.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Number of Proliferating Cells and Cell Layers of the Stratum Corneum of the WT and Klk8-/- Skin after TPA Treatment—We compared morphologic change of the skin of WT and Klk8-/- mice after TPA treatment. TPA induced acanthosis and hyperkeratosis in the dorsal skin of both genotypes (Figs. 2, C and D, and 3A). TPA-treated epidermal keratinocytes in both genotypes were strongly positive for Ki67, a hyperproliferation marker (Fig. 2, C and D). The number of Ki67-positive cells peaked at 48 h after TPA application. WT skin showed significantly more Ki67-positive cells at 0 h, 24 h, 48 h, and 7 days (Fig. 2E). We next compared the number of cell layers of the stratum corneum. The number of cell layers of the stratum corneum in Klk8-/- mice was significantly higher than that in WT mice without TPA application. Five and 7 days after TPA application, the difference became even more prominent (Fig. 3). Therefore, we hypothesized that Klk8 is involved in proliferation of epidermal keratinocytes and corneocyte shedding at the epidermal surface with or without TPA application.
Changes of Klk6 and Klk7 mRNA and Proteins in WT and Klk8-/- Skin after TPA Application—Because kallikreins are thought to function in a cascade reaction with each other, we next investigated the changes of Klk6 and Klk7 mRNA in WT and Klk8-/- epidermis after TPA application. RT-PCR revealed that Klk6 and Klk7 mRNAs were weakly expressed before TPA application in both genotypes. Although Klk6 and Klk7 mRNA of the WT epidermis were markedly increased after TPA application, the increase of these mRNAs in the Klk8-/- epidermis was significantly weaker (Fig. 4A). Using the quantitative RT-PCR, we found that Klk6 mRNA of both genotypes was increased, peaking at 24 h after TPA application. However, the fold increase in Klk6 mRNA was significantly different between the genotypes. Klk6 mRNA was increased up to 35 times in WT, whereas Klk8-/- mice showed only 4-fold increase (Fig. 4B). Klk7 mRNA was up-regulated 2.4-fold at 24 h after TPA application in WT mice, whereas no significant change was observed in Klk8-/- mice (Fig. 4C). These results suggest that Klk8 is involved in the up-regulation of both Klk6 and Klk7 mRNA after TPA treatment.
|
Western blot analysis detected the increased 30-kDa form of mK6 at 24 h after TPA application in both genotypes (Fig. 5M). In WT mice, the 28-kDa form was detected at 72 h after TPA application but not in Klk8-/- mice. This shorter fragment may represent active mK6 from which pro-sequence had been cleaved off.
We tried but failed to detect mK7 by immunohistochemistry and Western blot analysis using anti-mK7 antibody (Santa Cruz). This may be due to relatively weak expression of mK7 in the control epidermis of mice (9).
Protease Activity Assays in the Epidermis after TPA Application—To investigate the difference of protease activity between WT and Klk8-/- mice, we measured proteolytic activity of epidermal extraction toward VPR-MCA and FSR-MCA, both of which were shown to be good substrates of mK8 and mK6 (11, 24), and toward RPY-pNA, a substrate of mK7 (13). Protease activity to VPR-MCA of WT epidermis gradually increased upon TPA treatment peaking at 72 h, whereas the activity to FSR-MCA increased, peaking at 48 h. The proteolytic activities to VPR-MCA and FSR-MCA of the untreated Klk8-/- epidermis were comparable with that of WT epidermis. However, upon TPA treatment, these protease activities in Klk8-/- epidermis increased only slightly and were significantly lower than those of the WT (Fig. 6, A and B). In WT epidermis, the proteolytic activity toward RPY-pNA was increased, peaking at 24 h after TPA application. In contrast, Klk8-/- epidermis showed minimal change (Fig. 6C), consistent with the change of Klk7 mRNA (Fig. 4, A and C). In situ zymography also showed that the protease activity of Klk8-/- mice at 72 h was lower than that of WT (Fig. 6, D and E). Released fluorescence from casein in both genotypes was detected from the stratum granulosum to stratum corneum, where mK8 and mK6 were colocalized (Fig. 5I). PMSF, a serine protease inhibitor, inhibited proteolysis activity toward casein in both genotypes (Fig. 6, F and G). These results suggest that serine protease activity of the Klk8-/- mouse epidermis remained low even after treatment with TPA.
|
|
Reduction in DSG1 and CDSN Processing in Klk8-/- Mice—To address the possible molecular target of the Klk8-related proteases in corneocyte shedding, we investigated the changes of cohesion molecules of the stratum corneum, DSG1 and CDSN, by Western blot analysis and immunohistochemistry. We used anti-DSG1 antibody, which detects the intracellular domain of DSG1, and anti-CDSN antibody, which detects both the mature and proteolyzed forms. Western blot analysis revealed that DSG1 was significantly reduced until 48 h after TPA application in WT epidermis (Fig. 8, A and B). In contrast, there was no significant reduction of DSG1 in Klk8-/- mice at 48 h. Immunohistochemistry showed that the expression of DSG1 at the lower layers of the stratum corneum was stronger at 48 h in Klk8-/- mice than in WT mice (Fig. 8, C and D). The expression of CDSN showed no difference between WT and Klk8-/- mice by immunohistochemistry (data not shown). However, Western blot analysis detected a 32-kDa fragment, which increased along with unprocessed 52- and 46-48-kDa fragments. The 32-kDa fragment is assumed to be a proteolyzed product by hK7, and the 46-48-kDa fragment is assumed to be a proteolyzed product by hK5 (8, 25). Interestingly, the 32-kDa fragment changed following the Klk7 mRNA expression (Fig. 4C). TPA application increased 52- and 46-48-kDa forms to the same extent in WT and Klk8-/- mice. However, despite the prominent increase of 32-kDa form in WT epidermis, Klk8-/- mice epidermis showed much less increase after the TPA application (Fig. 8, E and F).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
To address the possible involvement of other kallikreins in corneocyte shedding, we investigated the relationship of Klk8 and other Klks using Klk8-/- mice. We found that Klk8 is an important factor for inducing Klk6 and Klk7 (Fig. 4). Previous reports suggested that both hK6 and hK7 are involved in the pathogenesis of psoriasis (10, 13). Cascade reactions of KLKs have been suggested to play a critical role in skin desquamation (7, 8). hK5 can activate pro-hK7 to active hK7, which can cleave desmocollin 1 and CDSN. hK5 also has a potential to directly cleave DSG1 and CDSN. In addition, at least eight kallikreins, including hK5, hK6, hK7, and hK8, are thought to be involved in desquamation cascade of the human skin (13).
In the present study, Klk8 mRNA showed parallel up-regulation with Klk6 and Klk7 mRNA after TPA treatment (Figs. 1, 2, 3 and 4), raising the possibility that these enzymes function in an activation cascade. Double immunostaining revealed that mK8 was expressed earlier than mK6 during epidermal differentiation (Fig. 5, F and I). These expressions coincided with the proteolytic activity, namely, WT mice showed stronger proteolytic activity than Klk8-/- mice in the stratum granulosum to the stratum corneum (Fig. 6). However, Klk8 transfection to Klk8-/- keratinocytes did not up-regulate Klk6 or Klk7 mRNA, indicating that mK8 itself is not involved in the transcriptional regulation of Klk6 or Klk7 (Fig. 7). From these findings, we hypothesize that mK8 regulates and activates mK6 post-transcriptionally at the stratum granulosum. We also speculate that Klk6 and Klk7 are regulated by the differentiation status of keratinocytes and indirectly by mK8, possibly through affecting the differentiation status. Proteolytic activity for substrates of mK6 and mK8 of WT but not Klk8-/- mouse epidermis was gradually increased until 72 h (Fig. 6, A and B). At this time point, Klk8 and Klk6 mRNA and mK6 were decreased over the expression peaks (Figs. 1, 4, and 5). It can be assumed that even after mK8 has reached its expression peak, the activated forms of downstream proteases such as mK6 retain their proteolytic activities. This result again implies that mK8 is located in the upper stream of activation cascade. In the human skin, hK7 can be ascribed to a major chymotrypsin-like kallikrein (13, 27). The proteolytic activity to chymotryptic substrates in the WT epidermis was increased at 24 h (Fig. 6C), consistent with the expression of Klk7 mRNA (Fig. 4C). Another kallikrein, hK5 is a major component of the serine proteases of the human skin. We therefore tried, but failed, to detect Klk5 mRNA in the mouse skin (data not shown), suggesting that the expression of Klk5 in the mouse skin may be very low. In addition, there has been no report in the literature on the existence of Klk5 in the mouse skin.
|
|
In summary, we showed that Klk8 and mK8 are involved in proliferation of keratinocytes and desquamation possibly through other kallikreins. The assumed protease cascade may result in the cleavage of DSG1 and CDSN. The phenotype of Klk8-/- skin in this study may be the result of a failure to maintain the balance of proliferation and shedding.
|
FOOTNOTES |
|---|
1 To whom correspondence should be addressed. Tel.: 81-166-68-2300; Fax: 81-166-68-2309; E-mail: syoshida{at}asahikawa-med.ac.jp.
2 The abbreviations used are: DSG1, desmoglein 1; CDSN, corneodesmosin; TPA, 12-O-tetradecanoylphorbol-13-acetate; WT, wild-type; Klk8-/-, Klk8 gene-null; VPR-MCA, Boc-Val-Pro-Arg-MCA; FSR-MCA, Boc-Phe-Ser-Arg-MCA; RPY-pNA, Meo-Suc-Arg-Pro-Tyr-pNA-HCl; PMSF, phenylmethylsulfonyl fluoride; RT, reverse transcription; Ab, antibody; GFP, green fluorescent protein; AdGFP, adenovirus containing GFP; MOI, multiplicity of infection.
3 M. Kishibe and S. Yoshida, unpublished observation.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  F. L. Scott, J. Sun, J. C. Whisstock, K. Kato, and P. I. Bird SerpinB6 is an Inhibitor of Kallikrein-8 in Keratinocytes J. Biochem., October 1, 2007; 142(4): 435 - 442. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
