HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 282, Issue 9, 6075-6089, March 2, 2007

This Article Abstract Full Text (PDF) All Versions of this Article: 282/9/6075    most recent M609039200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yao, J. Articles by Li, X. Search for Related Content PubMed PubMed Citation Articles by Yao, J. Articles by Li, X. Social Bookmarking                      What's this?

Interleukin-1 (IL-1)-induced TAK1-dependent Versus MEKK3-dependent NFB Activation Pathways Bifurcate at IL-1 Receptor-associated Kinase Modification^*

Jianhong Yao, Tae Whan Kim, Jinzhong Qin, Zhengfan Jiang, Youcun Qian, Hui Xiao, Yi Lu, Wen Qian, Muhammet Fatih Gulen, Nywana Sizemore^¶, Joseph DiDonato^¶, Shintaro Sato^||, Shizuo Akira^||, Bing Su^**, and Xiaoxia Li¹

From the Department of Immunology and the ^¶Department of Cancer Biology, Cleveland Clinic Foundation, Cleveland, Ohio 44195, ^||Osaka University, Japan Science and Technology Agency, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan, ^**University of Texas, M. D. Anderson Cancer Center, Houston, Texas 77054, and the Department of Pathology, Case Western Reserve University, Cleveland, Ohio 44106

Received for publication, September 22, 2006 , and in revised form, December 29, 2006.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Interleukin-1 (IL-1) receptor-associated kinase (IRAK) is phosphorylated after it is recruited to the receptor, subsequently ubiquitinated, and eventually degraded upon IL-1 stimulation. Although a point mutation changing lysine 134 to arginine (K134R) in IRAK abolished IL-1-induced IRAK ubiquitination and degradation, mutations of serines and threonines adjacent to lysine 134 to alanines ((S/T)A (131–144)) reduced IL-1-induced IRAK phosphorylation and abolished IRAK ubiquitination. Through the study of these IRAK modification mutants, we uncovered two parallel IL-1-mediated signaling pathways for NFB activation, TAK1-dependent and MEKK3-dependent, respectively. These two pathways bifurcate at the level of IRAK modification. The TAK1-dependent pathway leads to IKK/ phosphorylation and IKK activation, resulting in classical NFB activation through IB phosphorylation and degradation. The TAK1-independent MEKK3-dependent pathway involves IKK phosphorylation and IKK activation, resulting in NFB activation through IB phosphorylation and subsequent dissociation from NFB but without IB degradation. These results provide significant insight to our further understanding of NFB activation pathways.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
IL-1²-mediated signaling begins when IL-1 binds to the receptor complex, consisting of the IL-1 receptor (IL-1R) and its accessory protein (IL-1RAcp) (1–3) (Fig. 1). The cytosolic protein MyD88 (4–6) is then recruited to the receptor complex. MyD88 functions as an adapter, recruiting IRAK4 (IL-1 receptor-associated kinase 4) and IRAK to the IL-1 receptor complex, where IRAK is hyperphosphorylated (7–10) (Fig. 1). The phosphorylation of IRAK is likely to play an important role in IL-1-mediated signaling, although the kinase activity of IRAK is dispensable for its function (11–13). TRAF6 is also part of the IL-1 receptor complex, recruited through its interaction with the phosphorylated IRAK (14) (designated as Complex I in Fig. 1). TAK1 (transforming growth factor--activated kinase 1), a member of the MAPK kinase kinase family, and the proteins that bind to it, TAB1, TAB2, and TAB3, have been implicated in IL-1 signaling (15–24). IL-1 failed to activate TAK1 in IRAK-deficient cells, indicating that IRAK is required for the activation of TAK1. IRAK mediates the activation of TAK1 by bringing TRAF6 to form a complex with TAK1-TAB1-TAB2-TAB3, which are shown to be preassociated on the membrane. This membrane-bound IRAK-TRAF6-TAK1-TAB1-TAB2-TAB3 complex has been designated as Complex II (Fig. 1). Through an unknown mechanism, TRAF6-TAK1-TAB1-TAB2-TAB3 (Fig. 1, Complex II) is dissociated from IRAK and translocated from the membrane to the cytosol, where TAK1 is activated.

Chen and co-workers (23, 24) showed that protein ubiquitination plays an important role in TRAF6-mediated TAK1 and IKK activation. TRAF6, a Ring domain protein, has been shown recently to function as a ubiquitin protein ligase E3, and TRAF6 itself is the target of ubiquitination, which has been shown to activate TAK1 through an unknown mechanism. Once activated, TAK1 leads to the phosphorylation of IKK and MKK6, resulting in the activation of both the JNK and NFB signaling pathways. In addition to TAK1, MEKK2 and MEKK3 have also been implicated in the activation of IKK and MAPK, leading to the activation of NFB and JNK (25–28). The detailed signaling mechanism is not clear. Recently genetic studies have provided further evidence for an essential role of TAK1 in IL-1 signaling. Two groups (29, 30) independently reported that TAK1 deficiency results in defects in IL-1 signaling. Intriguingly, although IL-1-induced JNK activation was completely abolished, NFB activation was only partially impaired in TAK1-deficient cells, implicating an additional NFB activation mechanism for the IL-1 pathway.

Here, through the study of IRAK modification, we uncovered two parallel IL-1-mediated signaling pathways for NFB activation, TAK1-dependent and MEKK3-dependent pathways, respectively (Fig. 1). These two pathways bifurcate at the level of IRAK modification. The TAK1-dependent pathway leads to IKK/ phosphorylation and IKK activation, resulting in classical NFB activation through IB phosphorylation and degradation. The TAK1-independent MEKK3-dependent pathway involves IKK phosphorylation and IKK activation, resulting in NFB activation through IB phosphorylation and subsequent dissociation from NFB but without IB degradation. These results provide significant insight to our further understanding of NFB activation pathways.

View larger version (27K): [in this window] [in a new window]   FIGURE 1. Model of IL-1-induced TAK1-dependent and MEKK3-dependent NFB activation.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Recombinant Plasmids and Transfection—IRAK phosphorylation and ubiquitination mutants were generated by site-directed mutagenesis and cloned into FLAG-tagged pCMV vector (Sigma). Oligonucleotides used for making the phosphorylation mutants were as follows: AGCCGCAGCCGCCGCCTTCCTCGCCCCAGCTTTTCCAGGCGCCCAGACCCATT and GGGCGCCTGGAAAAGCTGGGGCGAGGAAGGCGGCGGCTGCGGCTGGCAACTT. Oligonucleotides used for making the ubiquitination mutants were as follows: GCCCCCGGAGGTTGCCATCCTCAGCCTCC and GGATGGCAACCTCCGGGGGCTCCAGGCCTC. Transfection of the indicated plasmids by FuGENE 6 transfection reagents was done as recommended by the manufacturer (Roche Diagnostics).

Coimmunoprecipitation and Immunoblotting—Cell were harvested and lysed in a Triton-containing lysis buffer (0.5% Triton X-100, 20 mM HEPES (pH 7.4), 150 mM NaCl, 12.5 mM -glycerophosphate, 1.5 mM MgCl₂, 10 mM NaF, 2 mM dithiothreitol, 1 mM sodium orthovanadate, 2 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, and complete protease inhibitor mixture from Roche Diagnostics). Cell extracts were incubated with 1 µg of antibody or preimmune serum (negative control) for 2 h followed by a 2-h incubation with 20 µl of protein A-Sepharose beads (prewashed and resuspended in phosphate-buffered saline at a 1:1 ratio). After incubation, the beads were washed three or four times with lysis buffer and resuspended in 20 µl of lysis buffer. For immunoblotting, the immunoprecipitates were separated by 10% SDS-PAGE, transferred to Immobilon-P membranes (Millipore), and analyzed by immunoblotting.

View larger version (33K): [in this window] [in a new window]   FIGURE 2. Identification of IRAK ubiquitination and phosphorylation sites. A, domains in full-length and truncated form of IRAK. DD, death domain; UD, undetermined domain; KD, kinase domain; C, C-terminal domain. The three lysines in the DD + UD + C1 (including Lys32, Lys134, and Lys179) are indicated. The amino acid sequence of IRAK from 131 to 144 is shown. B, IRAK modification mutants generated in truncated IRAK (DD + UD + C1). IRAK-deficient cells transfected with DD + UD + C1, lysine mutants (K134R, K32R/K134R, and K32R/K179R) and phosphorylation mutant ((S/T)A (131–144)) were either untreated or treated with IL-1 (10 ng/ml). The cells were then lysed and analyzed by immunoblot with antibody against IRAK. C, IRAK ubiquitination. IRAK-deficient cells stably transfected with DD + UD + C1 and K134R were untreated or treated with IL-1 (10 ng/ml). The cells were then lysed and immunoprecipitated (IP) with anti-IRAK, followed by Western analysis with anti-ubiquitin antibody. IB, immunoblot. D, IRAK kinase assay. IRAK-deficient cells stably transfected with DD + UD + C1, (S/T)A (131–144) and K134R were immunoprecipitated with anti-IRAK, followed by a kinase assay using purified recombinant IRAK4. E, IRAK lysine mutant was generated in kinase inactive full-length IRAK. IRAK-deficient cells stably transfected with kinase inactive full-length (IRAK1 KD mt) and lysine mutant (IRAK1 KD ubmt) were either untreated or treated with IL-1 (10 ng/ml). The cells were then lysed and analyzed by immunoblot with anti-IRAK and anti-actin (loading control). F, cell lysate from IL-1-stimulated IRAK-deficient cells transfected with lysine mutant (IRAK1 KD ubmt) was treated with calf intestinal phosphatase (CIP). G, IRAK phosphorylation mutant was generated in kinase-inactive full-length IRAK. IRAK-deficient cells stably transfected with kinase-inactive full-length (IRAK1 KD mt) and phosphorylation mutant (IRAK1 KD pmt) were either untreated or treated with IL-1 (10 ng/ml). The cells were then lysed and analyzed by immunoblot with anti-IRAK and anti-actin (loading control).

TAK1 Inhibitor Treatment—The TAK1 inhibitor (5Z-7-oxozeaenol) was purchased from AnalytiCon Discovery GmbH (catalog number NP-009245). Stock solutions were made up at 10 mM in Me₂SO. To block the TAK1 activity, wild type, MEKK3^–/–, or IKK^–/– MEFs were pretreated with 600 nM of TAK1 inhibitor for 3 h prior to IL-1 treatment.

Virus Infections—MEFs were infected with adenovirus (provided by Frank Mercurio at Celgene (San Diego)) expressing either green fluorescent protein (control), IKK, or kinase-inactive IKK. The titer of each adenovirus stock used for infection was as follows: green fluorescent protein = 3 x 10⁸, IKK = 5 x 10⁸, and kinase-inactive IKK = 1 x 10⁹ virus particles/ml. After 18 h, the infected cells were stimulated with IL-1 or were unstimulated. The production of retrovirus and infection has been described previously (35).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Identification of IRAK Phosphorylation and Ubiquitination Sites—IRAK is a multidomain protein (7, 11, 15, 36–38) (Fig. 2A) containing an N-terminal death domain (DD, residues 1–103), followed by a proline/serine/threonine-rich region (UD, also known as P-ST region, residues 104–198), a kinase domain (KD, residues 199–522), and a two-part C-terminal domain containing TRAF6-binding sites (residues 523–618 for C1 and residues 619–712 for C2). IRAK-deficient cells have been used effectively to study the function of IRAK in IL-1-dependent signaling (11, 15, 37, 39). NFB and JNK activation were greatly reduced in IL-1-treated IRAK-deficient cells, but these responses are restored in IRAK-deficient cells transfected with IRAK, indicating that IRAK is required for both. Analysis of IRAK deletion mutants showed that the truncated IRAK protein DD + UD + C1 (containing the DD, UD, and C1 domains) is sufficient to restore IL-1-induced NFB and JNK activation in IRAK-deficient cells. Like the full-length IRAK, DD + UD + C1 is phosphorylated after it is recruited to the receptor, subsequently ubiquitinated, and eventually degraded upon IL-1 stimulation (11, 15, 37, 37, 39). Treatment with calf intestinal phosphatase leads to loss of several IL-1-induced shifted IRAK bands, confirming that they are phosphorylated forms (11). IL-1-induced IRAK ubiquitination was confirmed by immunoprecipitation with anti-IRAK antibody followed by Western analysis with anti-ubiquitin antibody (39). To investigate the role of IRAK modification in IL-1 signaling, much effort has been devoted to map IRAK phosphorylation and ubiquitination sites. Because protein ubiquitination occurs on lysine residues, we mutated all three lysines in DD + UD + C1 (Fig. 2A, lysines at 32, 134, and 179) individually and in combinations. These mutants were then transfected into IRAK-deficient cells and tested for their modification and degradation in response to IL-1 stimulation. Although DD + UD + C1 was phosphorylated, ubiquitinated, and degraded (degradation is complete 6 h after stimulation (data not shown)), a point mutation changing lysine 134 to arginine completely abolished IL-1-induced IRAK ubiquitination and degradation (Fig. 2, B and C). Importantly, the K134R mutant was still phosphorylated upon IL-1 stimulation (Fig. 2D). We have shown previously that the kinase-inactive mutant of IRAK is still phosphorylated, ubiquitinated, and degraded upon IL-1 stimulation (11). We mutated lysine 134 to arginine in the kinase-inactive full-length IRAK in order to mimic DD + UD + C1 (which does not contain the kinase domain), eliminating modification initiated by IRAK autophosphorylation. The full-length ubiquitination mutant (IRAK1 KD ubmt) was modified upon IL-1 stimulation but with greatly reduced degradation as compared with the full-length IRAK (IRAK1 KD mt) (Fig. 2E). Treatment with calf intestinal phosphatase leads to loss of IL-1-induced shifted IRAK bands of the full-length ubiquitination mutant (IRAK1 KD ubmt), confirming that they are phosphorylated forms (Fig. 2F). These results suggest that the full-length ubiquitination mutant (IRAK1 KD ubmt) is probably still phosphorylated but deficient in ubiquitination in response to IL-1 stimulation, indicating that lysine 134 is an important site for IL-1-induced IRAK ubiquitination and subsequent degradation.

View larger version (92K): [in this window] [in a new window]   FIGURE 3. The impact of mutation in IRAK modification on IL-1-induced NFB and JNK activation. A, Western analysis. Cell lysates from wild type 293, IRAK-deficient (IRAK-null), or IRAK-deficient cells stably transfected with truncated IRAK constructs (DD + UD + C1, (S/T)A (131–144) and K134R) and full-length kinase-inactive IRAK constructs (IRAK KD, IRAK KDubmt, IRAK KD pmt) were analyzed by Western blot with anti-IRAK and anti-actin antibodies. B, gel shift assay. Wild type 293, IRAK-deficient (IRAK-null), and IRAK-deficient cells stably transfected with truncated IRAK constructs (DD + UD + C1, (S/T)A (131–144), and K134R) and IRAK kinase-inactive full-length constructs (IRAK KD mt, IRAK KD ubmt, and IRAK KD pmt) were either untreated or treated with IL-1 (10 ng/ml) for the indicated times. Cell lysates were analyzed by electrophoretic mobility shift assay with a NFB-specific probe. C–E, Western analyses. 293 wild type cells, IRAK-deficient cells, and IRAK-deficient cells stably transfected with IRAK modification mutants in the truncated IRAK (DD + UD + C1, (S/T)A (131–144) and K134R) or kinase-inactive full length (IRAK KD mt, IRAK KD pmt, and IRAK KD ubmt) were either untreated or treated with IL-1 (10 ng/ml) for the indicated times. Cell lysates were analyzed by Western blots with anti-pIB, anti-IB, anti-pJNK, anti-JNK, or anti-actin. D, cells were pretreated with cycloheximide (CHX) (20 µg/ml) for 2 h before stimulation with IL-1. The degradation of IB was analyzed by Scion Image 1.62C alias and presented as relative percentage of the untreated samples.

The Impact of IRAK Modification on IL-1-induced NFB and JNK Activation—To investigate the role of IRAK modification in IL-1 signaling, the above IRAK mutants defective in IRAK modification were examined for their ability to restore IL-1-induced NFB and JNK activation in IRAK-deficient cells. For all of the following experiments, pools of IRAK-deficient cells stably transfected with IRAK modification mutants were used and the expression levels of the IRAK mutants were shown in Fig. 3A. Both ubiquitination (K134R) and phosphorylation ((S/T)A (131–144)) mutants in the truncated form (DD + UD + C1) or the full-length IRAK fully restored IL-1-induced NFB activation in IRAK-deficient cells, as measured by NFB DNA binding activity (Fig. 3B), IB phosphorylation (Fig. 3C), and NFB-dependent luciferase reporter assay (data not shown). However, IL-1-induced IB degradation was greatly reduced in IRAK-deficient cells transfected with these IRAK modification mutants (Fig. 3C), implicating a specific role of IRAK modification in the NFB activation pathway. Because IB expression is induced upon IL-1 stimulation, we used the protein synthesis inhibitor cycloheximide to inhibit the new synthesis of IB so that IL-1-induced IB degradation can be more easily detected. We confirmed the lack of IL-1-induced IB degradation in the presence of protein synthesis inhibition in IRAK-deficient cells transfected with the IRAK modification mutants (Fig. 3D). Furthermore, these IRAK mutants only partially restored IL-1-induced JNK activation in IRAK-deficient cells, indicating the importance of IRAK modification in IL-1 signaling (Fig. 3E).

IRAK Modification Mutants Failed to Activate TAK1—We then carefully examined the impact of these IRAK mutants on IL-1-induced intermediate signaling leading to NFB activation. Previous studies showed that IL-1-induced TAK1 activation plays a critical role in IL-1 signaling (15, 17, 29, 30). As shown in Fig. 4A, whereas modified IRAK forms a complex with TAK1 upon IL-1 stimulation in wild type 293 cells and IRAK-deficient cells transfected with the truncated IRAK (DD + UD + C1), IL-1-induced interaction between IRAK and TAK1 was abolished in IRAK-deficient cells transfected with IRAK phosphorylation and ubiquitination mutants, indicating that IRAK modification is required for the interaction of IRAK with TAK1. Previous studies showed that IL-1 stimulation leads to TAK1 phosphorylation and TAK1 activation in an IRAK-dependent manner (22). Because the IRAK mutants failed to interact with TAK1 upon IL-1 stimulation, we suspect that these mutants have also lost the ability to activate TAK1. As shown in Fig. 4, B–D, the IRAK modification mutants indeed failed to activate the TAK1 in response to IL-1 stimulation, including TAK1 phosphorylation (Fig. 4B) and TAK1 kinase activity (Fig. 4D). IL-1-induced TAK1 phosphorylation was confirmed by treatment with calf intestinal phosphatase (Fig. 4C). These results suggest that IRAK modification is required for the interaction of IRAK with TAK1, thereby mediating the activation of TAK1.

IRAK Modification Mutants Formed Complex with TRAF6 and MEKK3—Whereas IRAK modification mutants displayed defects in IL-1 signaling, including abolished TAK1 activation, reduced JNK activation, and IL-1-induced IB degradation, they are still capable of mediating IL-1-induced IB phosphorylation and NFB activation, implicating that the IRAK mutants mediate an alternative NFB activation pathway. Therefore, we carefully examined the interaction of IRAK mutants with other intermediate signaling components of the IL-1 pathway. TRAF6 is an immediate downstream component of IRAK in IL-1 signaling pathway (14, 15, 39). Although the IRAK mutants failed to interact with TAK1 upon IL-1 stimulation, they were still capable of forming a complex with TRAF6 (Fig. 4E), indicating that these specific IRAK modification mutations do not affect the ability of IRAK to interact with TRAF6. Although previous studies suggested that MEKK3 plays an important role in IL-1-induced NFB activation (28), we recently observed that IL-1 stimulation leads to interaction of IRAK and TRAF6 with MEKK3 (Fig. 4, F and G). Interestingly, the IRAK modification mutants retained the ability to interact with MEKK3 (Fig. 4F) and were also able to mediate the interaction between TRAF6 and MEKK3 (Fig. 4G), implicating a specific role of MEKK3 in IL-1-induced IRAK-mediated signaling. Taken together, the above results suggest that the IRAK modification mutants may mediate the alternative NFB activation pathway through their interaction with MEKK3 and TRAF6. It is important to note that although endogenous IRAK and TRAF6 formed a complex with both TAK1 (Fig. 4A) (15) and MEKK3 (Fig. 4, F and G), the interaction between endogenous TAK1 and MEKK3 was not detected upon IL-1 treatment (Fig. 4F), suggesting that IRAK-TRAF6-TAK1 and IRAK-TRAF6-MEKK3 are probably in two separate IL-1-induced complexes.

View larger version (34K): [in this window] [in a new window]   FIGURE 4. The impact of mutation in IRAK modification on TAK1 activation. 293 wild type cells, IRAK-deficient cells, and IRAK-deficient cells stably transfected with IRAK modification mutants in the truncated IRAK (DD + UD + C1, (S/T)A (131–144), and K134R) were either untreated or treated with IL-1 (10 ng/ml) for the indicated times. A and E–G, co-immunoprecipitation. Cell lysates were immunoprecipitated (IP) with anti-TAK1 (A), anti-TRAF6 (E), or anti-MEKK3 (F and G), followed by Western blots with anti-IRAK, anti-TAK1, anti-TRAF6, and anti-MEKK3. B and C, phosphorylation of TAK1. Cell lysates with or without calf intestinal phosphatase (CIP) were analyzed via Western blots with anti-TAK1 and anti-actin. D, TAK1 kinase assay. Cell lysates were immunoprecipitated with anti-TAK1, followed by a kinase assay using MKK6 as substrate.

The important question is as follows: what is this IRAK-mediated, TAK1-independent, IL-1-induced NFB activation pathway? Although previous studies reported an important role of MEKK3 in IL-1-induced NFB activation (28), we now observe that IL-1 stimulation leads to interaction of IRAK and TRAF6 with MEKK3 (Fig. 4, F and G). Importantly, the IRAK modification mutants did retain the ability to interact with MEKK3 (Fig. 4F) and were also able to mediate the interaction between TRAF6 and MEKK3 (Fig. 4G), implicating a specific role of MEKK3 in IL-1-induced IRAK-mediated signaling. Therefore, we examined the possibility for MEKK3 to be an important player in the TAK1-independent NFB activation pathway. We used the TAK1 inhibitor (5Z-7-oxozeaenol) to abolish the TAK1 activity in both wild type and MEKK3-deficient MEFs. In wild type MEFs, although the TAK1 inhibitor abolished IL-1-induced JNK activation, it had little effect on IL-1-induced IB phosphorylation and partial inhibition on NFB activation. However, this inhibitor completely impaired IL-1-induced IB phosphorylation and NFB activation in addition to the abolishment of IL-1-induced JNK activation in the MEKK3-deficient MEFs (Fig. 5D). These results suggest that IL-1-induced IB phosphorylation is completely abolished only when both TAK1 and MEKK3 are impaired, suggesting that MEKK3 may play a critical role in the IL-1-induced TAK1-independent NFB activation pathway.

View larger version (52K): [in this window] [in a new window]   FIGURE 5. IL-1-induced NFB activation is mediated by both TAK1 and MEKK3. A and B, wild type or TAK1-deficient MEFs were either untreated or treated with IL-1 (10 ng/ml) for the indicated times. B, cells were pretreated with cycloheximide (20 µg/ml) for 2 h prior to IL-1 stimulation. Cell lysates were analyzed by Western blots via anti-pJNK, JNK, pIB, IB, actin, or NFB gel shift assay. C, 293 cells were untreated or pretreated with 600 nM of TAK1 inhibitor for 3 h prior to IL-1 stimulation (10 ng/ml). Cell lysates were analyzed by Western blots via anti-pIB, IB, actin, or NFB gel shift assay. The degradation of IB was analyzed by Scion Image 1.62C alias and presented as relative percentage of the untreated samples. D, wild type or MEKK3-deficient MEFs were pretreated with 600 nM of TAK1 inhibitor for 3 h prior to IL-1 treatment (10 ng/ml). Cell lysates were analyzed by Western blots with anti-pJNK, pIB, or actin.

We next examined whether mutations in IRAK modification have any impact on IL-1-induced activation of the IKK kinase activity. As shown in Fig. 6C, although IL-1 stimulation leads to IKK activation in 293 cells, IL-1-induced IKK activation was abolished in IRAK-deficient cells. Importantly, the IRAK ubiquitination mutant (K134R) and phosphorylation mutant ((S/T)A (131–144)) restored IL-1-induced IKK activation in cells to the similar level as DD + UD + C1 (the truncated IRAK with wild type phenotype) (Fig. 6C). Taken together, these results showed that although mutation in IRAK modification impaired TAK1 activation and IL-1-induced IKK/ phosphorylation, the kinase activity of IKK was still activated in IRAK-deficient cells transfected with IRAK phosphorylation and ubiquitination mutants, confirming that IKK can be activated through a TAK1-independent NFB activation pathway.

Previous studies showed that IL-1 stimulation also leads to IKK phosphorylation (44). Interestingly, the IRAK mutants that failed to mediated IL-1-induced TAK1 activation and IKK/ phosphorylation can still lead to IL-1-induced IKK phosphorylation (Fig. 6D). Furthermore, although the TAK1 inhibitor abolished IL-1-induced IKK/ phosphorylation, it did not affect IL-1-induced IKK phosphorylation (Fig. 6E). The correlation between IL-1-induced IKK phosphorylation and TAK1-independent IKK activation suggests a potential role for IKK in this alternative NFB activation pathway.

IKK Not IKK Is Required for IL-1-induced TAK1-independent NFB Activation Pathway—We then examined the relative contribution of IKK versus IKK in the TAK1-dependent and MEKK3-dependent NFB activation pathways. Interestingly, as observed in TAK1-deficient MEFs (Fig. 5A), IB was phosphorylated, but not degraded, in IKK^–/– MEFs in response to IL-1 stimulation (Fig. 7, A and B), implying that IKK is required for the TAK1-dependent but not for the TAK1-independent NFB activation pathway. Importantly, although wild type IKK restored IL-1-induced IB degradation, the kinase-inactive mutant of IKK did not, indicating that the kinase activity of IKK is required for the IL-1-induced IB degradation (Fig. 7, A and B). The fact that IL-1-induced IB phosphorylation was completely abolished in IKK/^–/– MEFs (Fig. 7D) suggests that IKK is probably responsible for the IL-1-induced IB phosphorylation observed in IKK^–/– MEFs (Fig. 7, A and B). To test whether IKK is indeed responsible for IL-1-induced IB phosphorylation in TAK1-deficient MEFs (Fig. 5A), we used the TAK1 inhibitor to block IL-1-induced TAK1 activation and then examined the role of IKK in TAK1-independent NFB activation pathway (Fig. 7C). Although the TAK1 inhibitor inhibited IL-1-induced JNK activation, it failed to inhibit IL-1-induced IB phosphorylation in wild type MEFs, which is probably because of the intact TAK1-independent pathway in these cells. Interestingly, the TAK1 inhibitor completely inhibited IL-1-induced IB phosphorylation in IKK^–/– MEFs, indicating that IKK is likely to be responsible for IL-1-induced IB phosphorylation in the TAK1-independent NFB activation pathway (Fig. 7C).

View larger version (36K): [in this window] [in a new window]   FIGURE 6. The impact of IRAK modification and TAK1 deficiency on IL-1-induced IKK activation and IKK/ phosphorylation. A and C, 293 wild type cells, IRAK-deficient cells and IRAK-deficient cells stably transfected with IRAK modification mutants in the truncated IRAK (DD + UD + C1, (S/T)A (131–144), and K134R) were either untreated or treated with IL-1 (10 ng/ml) for the indicated times. Cell lysates were either analyzed via Western blots with anti-p-IKK/ and anti-IKK/ (A) or immunoprecipitated with anti-IKK/, followed by a kinase assay using GST-IB-(1–54) as a substrate (C). B, wild type or TAK1-deficient MEFs were either untreated or treated with IL-1 (10 ng/ml) for the indicated times. Cell lysates were analyzed via Western blots with anti-p-IKK/ and IKK. D, 293 wild type cells and IRAK-deficient cells stably transfected with IRAK modification mutants in the truncated IRAK (DD + UD + C1, and (S/T)A (131–144)) were either untreated or treated with IL-1 (10 ng/ml) for the indicated times. Cell lysates were analyzed via Western blots with anti-p-IKK, anti-IKK, and anti-actin. E, human synoviocytes were pretreated with 600 nM TAK1 inhibitor for 3 h prior to IL-1 stimulation. Cell lysates were analyzed by Western blots with anti-p-IKK, anti-IKK, and anti-GRB2.

The important questions for this unique mechanism of NFB activation are how the phosphorylated IB mediated by the MEKK3-dependent pathway escapes the ubiquitination and subsequent degradation and how the phosphorylated IB dissociates from NFB without degradation. Ubiquitination of IB is carried out by a ubiquitin-conjugating enzyme of the UBC4/5 family and SCF-TrCP E3 ligase. IL-1 stimulation leads to IB phosphorylation on both Ser³² and Ser³⁶. TrCP E3 ligase binds specifically to the phosphorylated form of IB (DS(PO₃)GLDS(PO₃)) and brings it the SCF complex for polyubiquitination, which is then selectively degraded by the 26 S proteasome. Interestingly, we found that the phosphorylated IB in I1A cells transfected with IRAK modification mutants failed to bind to -TrcP, suggesting that IB might be phosphorylated differently by the TAK1-independent pathway (Fig. 8C). To address this issue, we performed IKK kinase assay in wild type and TAK1-deficient MEFs using wild type IB and IB mutants (S32A, S36A, and S32A/S36A) as substrates (Fig. 8D). Interestingly, although the IKK complex from both the wild type and TAK1-deficient MEFs can phosphorylate wild type and S32A mutant IB, S36A mutant IB can only be phosphorylated by the IKK complex precipitated from wild type but not TAK1-deficient MEFs. As expected, S32A/S36A cannot be phosphorylated by IKK from either wild type or TAK1-deficient MEFs. Taken together, the above results suggest that Ser³⁶ is probably the major phosphorylation site for the IKK complex in the absence of TAK1.

View larger version (45K): [in this window] [in a new window]   FIGURE 7. The role of IKK and IKK in TAK1-dependent and -independent NFB activation pathways. A and B, wild type, IKK-deficient MEFs, and IKK-deficient MEFs infected with adenovirus containing wild type IKK or kinase-dead IKK were either untreated or treated with IL-1 (10 ng/ml) for the indicated times. Cell lysates were analyzed with anti-pIKK/, pIB, IB, actin, or pJNK. The degradation of IB was analyzed by Scion Image 1.62C alias and presented as relative percentage of the untreated samples. C, IKK is required for IL-1-induced IB phosphorylation mediated by the TAK1-independent pathway. Wild type or IKK-deficient MEFs were either untreated or treated with IL-1 (10 ng/ml), with or without TAK1 inhibitors (600 nM). Cell lysates were analyzed with anti-pIB, pJNK, and actin. D, wild type or IKK/-deficient MEFs were either untreated or treated with IL-1 (10 ng/ml) for the indicated times. Cell lysates were analyzed with anti-pJNK, pIB.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
This study reports the discovery of the co-existence of the two parallel IL-1-mediated TAK1-dependent and MEKK3-dependent signaling pathways for NFB activation (Fig. 1). These two pathways are regulated at the level of IRAK modification. The TAK1-dependent pathway causes IKK/ phosphorylation and IKK activation, leading to classical NFB activation through IB phosphorylation and degradation. The TAK1-independent MEKK3-dependent pathway induces IKK phosphorylation and IKK activation, resulting in NFB activation through IB phosphorylation and subsequent dissociation from NFB but without IB degradation. It is important to note that we recently found that TLR8-mediated NFB and JNK activation are TAK1-independent and MEKK3-dependent (46), suggesting a regulatory mechanism at the level of receptor complexes that determines the usage of TAK1-dependent versus MEKK3-dependent pathways in IL-1R/TLR signaling.

Upon IL-1 stimulation, IRAK becomes heavily phosphorylated. Several phosphorylation sites have been identified in the kinase domain of IRAK, including Thr²⁰⁹ and Thr³⁸⁷ (36). Both of these phosphorylation sites are critical for the kinase activity of IRAK. Although Thr²⁰⁹ phosphorylation regulates the opening of IRAK kinase domain, Thr³⁸⁷ phosphorylation regulates full enzymatic activity of IRAK. In this study, we focused on the UD domain (undetermined domain, amino acids 103–198), also referred to as Pro-ST region (rich in proline, serine, and threonine). The UD domain (Pro-ST region) is the site of IRAK hyperphosphorylation (36, 37). We identified a cluster of six serines and threonines (Ser¹³¹, Ser¹³⁷, Ser¹³⁸, Ser¹⁴⁰, Thr¹⁴¹, and Ser¹⁴⁴) in this UD domain. Mutation of these serines and threonines ((S/T)A (131–144)) severely impaired IL-1-induced IRAK phosphorylation, ubiquitination, and degradation. Previous studies showed that IRAK phosphorylation is required for IRAK ubiquitination (42). The phosphorylation of these sites ((S/T) (131–144)) is probably required for IL-1-induced ubiquitination, because we identified the adjacent lysine 134 as a critical ubiquitination site. Point mutation of lysine 134 to arginine indeed abolished IL-1-induced IRAK ubiquitination. Point mutation of serine 138 to alanine in the truncated form IRAK showed a partial defect in IL-1-induced IRAK phosphorylation.³ Future effort is required to mutate these serines and threonines ((S/T) (131–144)) individually or in combination to identify the specific site required for mediating IRAK ubiquitination. Because the IRAK phosphorylation mutants were all created in the kinase-inactive IRAK molecule, these sites are probably phosphorylated by IRAK4. Our previous studies showed that the kinase activity of IRAK and IRAK4 might be redundant in the IL-1 pathway, suggesting that serines and threonines ((S/T) (131–144)) might also be autophosphorylated by IRAK (12). Nevertheless, it is also possible that different sites are autophosphorylated in the UD domain.

The fact that the IRAK ubiquitination mutants are only defective in IL-1-induced IRAK ubiquitination but not IRAK phosphorylation suggests that it is the lack of ubiquitination not phosphorylation responsible for the abolished IL-1-induced signaling events. The defect in IL-1 signaling observed with the IRAK phosphorylation mutants ((S/T)A (131–144), IRAK1KD pmt) is likely due to the lack of ubiquitination of these mutants, because that IRAK phosphorylation is required for its ubiquitination. The fact that the IRAK ubiquitination mutants retained their interaction with TRAF6, but failed to interact with TAK1 and activate TAK1, suggests that IRAK ubiquitination is necessary for the recruitment of TAK1 to the IRAK-TRAF6 complex, and the formation of IRAK-TRAF6-TAK1 complex is necessary for the activation of TAK1. Polyubiquitination of a target protein with the ubiquitin linked through Lys⁴⁸ is recognized by proteasome and ultimately degraded. However, polyubiquitination chains linked through Lys⁶³ of ubiquitin do not target the substrate for proteasome-mediated degradation, mediating protein-protein interaction and cell signaling instead. It has been reported that TRAF6-mediated Lys⁶³ polyubiquitination plays an essential role in the activation of TAK1, IKK, and NFB. However, TRAF6 is probably not the E3 for IRAK ubiquitination, because IRAK is still ubiquitinated and degraded in TRAF6-deficient MEFs.³ We have found that polyubiquitination chains on IRAK are linked through both Lys⁴⁸ and Lys⁶³.³ We and others recently found that Pellinos proteins can ubiquitinate IRAK, although the precise function of Pellinos in IL-1 signaling is still unclear (47).³ Because Pellinos do not lead to the degradation of IRAK, they are unlikely the ubiquitin protein ligase E3s responsible for the specific IRAK ubiquitination that leads to IRAK degradation (47).³ At the moment, it is unknown which ubiquitin protein ligase E3(s) is responsible for the IL-1-induced ubiquitination of IRAK required for the activation of the TAK1-dependent NFB activation pathway. Although our results suggest that IL-1-induced ubiquitination and degradation of IRAK are required for the TAK1-dependent NFB activation pathway, it is also possible that only the IL-1-induced IRAK ubiquitination is the necessary biochemical modification required for the activation of the TAK1-dependent pathway, and the IL-1-induced IRAK degradation is the consequence of activation. On the other hand, we found that the proteasome inhibitor MG-132 blocked IL-1-induced TAK1 activation, suggesting that IL-1-induced IRAK degradation might be a necessary step in the activation of the TAK1-dependent pathway.³ One possible role for IL-1-induced IRAK degradation in the activation of TAK1 is to release the TAK1 complex from the membrane-associated IRAK-TRAF6-TAK1-TAB2/3 complex, because we have previously shown that modified IRAK is always associated with the membrane, and only the TAK1 complex is released to the cytosol (15).

Another important finding of this study is the identification of the IL-1-induced TAK1-independent NFB activation pathway. Although the IRAK modification mutants are defective in the TAK1-mediated NFB activation pathway, these IRAK mutants are still capable of mediating IL-1-induced IB phosphorylation and NFB activation but not IB degradation, implicating a TAK1-independent NFB activation pathway. Consistent with this conclusion, in TAK1^–/– MEFs, IL-1 stimulation could lead to IB phosphorylation and a significant level of NFB activation without IL-1-induced IKK/ phosphorylation and a lack of IB degradation, confirming a TAK1-independent NFB activation pathway. Importantly, we found that the IRAK modification mutants retained the interaction not only with TRAF6 but also with MEKK3, implicating TRAF6 and MEKK3 in the TAK1-independent NFB activation pathway. Whereas Blonska et al. (48) recently reported that TAK1-MEKK3 forms a complex to mediate tumor necrosis factor--induced NFB activation, direct interaction between endogenous TAK1 and MEKK3 was not detected upon IL-1 stimulation. Although endogenous IRAK and TRAF6 interact with both endogenous TAK1 and MEKK3 in 293 cells in response to IL-1 stimulation, we did not detect any interaction between TAK1 and MEKK3. Our results suggest that IRAK-TRAF6-TAK1 and IRAK-TRAF6-MEKK3 are two independent IL-1-induced complexes. In support of this, we found that the impairment of both TAK1 and MEKK3 completely abolished IL-1-induced NFB activation, by using a TAK1 inhibitor in MEKK3-deficient cells and knockdown of MEKK3 in TAK1-deficient cells with MEKK3 small interfering RNA. The fact that IL-1-induced NFB activation is completely abolished in TRAF6-deficient cells indicates that TRAF6 is probably required for both TAK1-dependent and MEKK3-dependent NFB activation pathways. Taken together, our results imply that IL-1 mediates TAK1-dependent and MEKK3-dependent NFB activation pathways, which bifurcate at the level of IRAK modification.

View larger version (27K): [in this window] [in a new window]   FIGURE 8. Dissociation of IB from NFB in the TAK1-independent pathway. A, cell lysates from wild type and TAK1-deficient MEFs untreated or treated with IL-1 for the indicated times were immunoprecipitated (IP) with anti-p65 (NFB), followed by Western analysis with anti-IB and anti-p65 (NFB) antibodies. The dissociation of IB was analyzed by Scion Image 1.62C alias and presented as relative percentage of the untreated samples. Cell lysates were also analyzed directly by Western blots with anti-IB, anti-p65 (NFB), and anti-actin antibodies. The degradation of IB was analyzed by Scion Image 1.62C alias and presented as relative percentage of the untreated samples. B, cell lysates from IRAK-deficient cells transfected with DD + UD + C1, (S/T)A (131–144), and K134R untreated or treated with IL-1 for the indicated times were immunoprecipitated with anti-p65 (NFB), followed by Western analysis with anti-IB and anti-p65 (NFB) antibodies. The dissociation of IB was analyzed by Scion Image 1.62C alias and presented as relative percentage of the untreated samples. Cell lysates were also analyzed directly by Western blots with anti-IB, anti-p65 (NFB), and anti-actin antibodies. The degradation of IB was analyzed by Scion Image 1.62C alias and presented as relative percentage of the untreated samples. C, IRAK-deficient cells stably transfected with MyC-TrCP and IRAK modification mutants in the truncated IRAK (DD + UD + C1, (S/T)A (131–144), and K134R) were either untreated or treated with IL-1 (10 ng/ml) for the indicated times. Cell lysates were immunoprecipitated with anti-MyC and probed with anti-pIB and anti-MyC. D, cell lysates from wild type (WT)(+/+) and TAK1-deficient (–/–) MEFs were immunoprecipitated with anti-IKK/, followed by a kinase assay using GST-IB-(1–54) or GST-IB-(1–54) mutants (S36A, S32A, S32A/S36A) as substrates.

View larger version (17K): [in this window] [in a new window]   FIGURE 9. Alternative NFB activation pathway in primary colon epithelial cells. A and B, bone marrow-derived macrophages or primary colon epithelial cells were untreated or treated with IL-1 (10 ng/ml, A) or LPS (10 µg/ml, B) for the indicated times. Cell lysates were then analyzed by Western blots with anti-pIB and IB and actin. C, cell lysate 293 cells untreated or treated with different concentrations of IL-1 (10 ng/ml (H) and 0.1 ng/ml (L)) (were analyzed by Western blots with anti-pIB and IB and actin.