| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 282, Issue 9, 6292-6299, March 2, 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1
2
From the
Departments of Biochemistry and Chemistry, University of Alberta, Edmonton, Alberta T6G 2H7, Canada
Received for publication, December 1, 2006 , and in revised form, January 3, 2007.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
The Na+/H+ exchanger consists of two domains: a membrane domain of 
500 amino acids and a 315-amino acid hydrophilic, carboxyl-terminal cytosolic domain. The cytosolic domain regulates the membrane domain with phosphorylation having been shown to occur in the distal region of the cytosolic domain, within the last 178 amino acids (9, 10). We have demonstrated that the MAP kinases extracellular signal-regulated kinases 1 and 2 (ERK1/2) are implicated in growth factor activation of NHE1. This was shown in skeletal muscle tissues (11), in smooth muscle (11), in the intact myocardium (10), in isolated cardiomyocytes (10), and in Chinese hamster ovary cells (11). The ERK-dependent pathway was activated in several models of ischemic heart disease, and this resulted in further activation of the Na+/H+ exchanger in the myocardium (12). We recently demonstrated that ERK phosphorylates the NHE1 cytosolic domain at one or more of the following amino acids, Ser693, Ser766, Ser770, Thr779, and Ser785 (13) in vitro. In another report we also showed that amino acids Thr717, Ser722, Ser725, and Ser728 are phosphorylated in vitro by a p38 MAP kinase-dependent pathway (14). In this report, we characterized the role of these amino acids in the ERK-dependent pathway of phosphorylation and regulation of the Na+/H+ exchanger. Our results are the first to define and elucidate this mechanism of regulation of the Na+/H+ exchanger in vivo.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Site-directed Mutagenesis—Mutations in the cytosolic tail of the NHE1 isoform of the Na+/H+ exchanger were made to an expression plasmid containing a HA-tagged human NHE1. The plasmid pYN4+ contains the cDNA of the entire coding region of NHE1 (15). Site-directed mutagenesis was performed using amplification with PWO DNA polymerase followed by use of the Stratagene (La Jolla, CA) QuikChangeTM site-directed mutagenesis kit as recommended by the manufacturer. Mutations were designed to create a new restriction enzyme site for use in screening transformants. Mutations were made to four regions of the cytosolic regulatory domain of the Na+/H+ exchanger (see Fig. 1). The mutants were as follows (only one of each primer pair is shown): Mutant 1, S693A, 5'-GCCCACAAGCTTGACGCACCCACCATG-3'; Mutant 2, T718A/S723/726/729A, 5'-ATCGACCCGGCTGCCCCGCAGGCACCCGAGGCTGTAGATCTGGTGAAT-3' and 5'-AAGGAGGACCTACCGGTCATCGCCATCGACCCGGCT-3'; Mutant 3, S766/770/771A, 5'-GCATCATGATGCGGGCCAAGGAGACTGCAGCCCCAGGAACCGAC-3'; Mutant 4, T779A/S785A, 5'-CCGACGATGTCTTCGCCCCCGCCCCGAGTGACGCCCCCAGCTCCCAG-3', (underlined residues indicate newly introduced restriction sites). Site-specific mutagenesis was also done on individual amino acids Ser766, Ser770, and Ser771 using the following primers: CATCATGATGCGGGCCAAGGAGACTAGTTCCCCAGGAACCG, GGAGCAAGGAGACTGCTAGCCCAGGAACCGACG, and GCAAGGAGACTTCGGCCCCGGGAACCGACGATG, respectively. DNA sequencing was by the DNA core services laboratory of the Department of Biochemistry to confirm the accuracy of the mutations and the fidelity of the product.
Cell Culture and Stable Transfection—AP-1 cells that lack an endogenous Na+/H+ exchanger were used to examine NHE1 activity. Stable cell lines were made of all mutants by transfection with LipofectamineTM 2000 reagent as described earlier (15). The cells were selected using 800 µg/ml geneticin (G418), and stable cell lines were regularly re-established from frozen stocks at passage numbers between 5 and 15 whenever necessary. For some experiments the MEK inhibitor U0126 was included (10 µM in dimethyl sulfoxide). The inhibitor was included in normal Na+-containing medium for 10 min prior to NHE1 assay and in all subsequent steps.
To examine in vivo phosphorylation of NHE1 proteins AP-1 cells were plated on 100-mm dishes. One day prior to experimentation, the cells were incubated in complete 
-minimum essential medium supplemented with 0.5% bovine growth serum overnight at 37 °C in 5% CO2. The day of experimentation the media was replaced with phosphate-free Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 0.5% bovine growth serum and incubated at 37 °C in 5% CO2 for 30 min. The medium was removed and replaced with 2 ml of the same medium, to which H 323PO4 was added to a final concentration of 100 µCi/ml medium. The cells were then incubated at 37 °C in 5% CO2 for 3 h.
SDS-PAGE and Immunoblotting—Immunoblot analysis using anti-HA antibody was used to confirm NHE1 expression in samples from total cell lysates of AP-1 cells. The cell lysates were made as described earlier (12, 16). For Western blot analysis equal amounts of each sample (50 µg of total protein) were resolved on 10% SDS-PAGE. The gel was transferred onto a nitrocellulose membrane and immunostained with peroxidase-conjugated goat anti-mouse antibody (Bio/Can, Mississauga, Canada). The Amersham Biosciences enhanced chemiluminescence Western blotting and detection system was used to detect immunoreactive proteins on x-ray film. Densitometric analysis of x-ray films was carried out using ImageJ 1.35s software (National Institutes of Health, Bethesda, MD).
Cell Surface Expression—Cell surface expression was measured as described earlier (15). Briefly described, the cells were labeled with Sulfo-NHS-SS-Biotin (Pierce), and immobilized streptavidin resin was used to remove surface-labeled Na+/H+ exchanger. Equal amounts of the total and unbound proteins were analyzed by SDS-PAGE and Western blotting against the HA tag. Relative amounts of NHE1 on the cell surface were calculated by comparing both the 110- and 95-kDa forms of NHE1.
Na+/H+ Exchange Activity—Na+/H+ exchange activity was measured using a PTI Deltascan spectrofluorometer. The initial rate of Na+-induced recovery of cytosolic pH (pHi) was measured after acute acid load using 2',7-bis (2-carboxyethyl)-5(6) carboxyfluorescein acetoxymethyl ester (Molecular Probes Inc.) as described earlier (15). Ammonium chloride (50 mM x 3 min.) was used to transiently induce an acid load. The coverslip was then removed from the NH4Cl containing buffer and placed in a Na+-free buffer (135 mM N-methyl glucamine, 5 mM KCl, 1.8 mM CaCl2, 1 mM MgSO4, 5.5 mM glucose, 10 mM HEPES, pH 7.3) for 30 s or until the pHi had reached a minimum, at which point the coverslip was removed and placed in a normal Na+ buffer (135 mM NaCl) and allowed to recover for 3 min. There were no differences in buffering capacities of stable cell lines as indicated by the degree of acidification induced by ammonium chloride applications (not shown). Following the pHi recovery, a three-point pH calibration using Na+-free calibration buffers (135 mM N-methyl glucamine, 135 mM KCl, 1.8 mM CaCl2, 1 mM MgSO4, 5.5 mM glucose, 10 mM HEPES, at pH 6, 7, and 8) was completed. For some experiments we used a two-pulse assay to induce prolonged intracellular acidosis (17) and to stimulate ERK-dependent pathways and the activity of NHE1. For these experiments the cells were initially acidified with ammonium chloride as described above and then immediately allowed to recover in normal Na+-containing medium. The cells were then acidified with a second ammonium chloride pulse either with or without a 3-min period in Na+-free medium. Following pHi recovery in Na+ normal buffer, a three-point calibration was completed.
The NHE1 protein activity was determined by measuring the slope of the first linear 20 s of the recovery period and was expressed as 
pH/s. To calculate the effect of the stimulatory treatment, the rate of recovery for the first pulse was set at 100%, and the rate of recovery of the second pulse was expressed as a percentage relative to the first pulse. Using the percentage values of the second pulse, we compared the effect of sustained acidosis-treated cells to control treated cells (cells that had no sustained acidosis and immediate recovery after the second ammonium chloride induced acidification). The results are shown as the means ± S.E., and statistical significance was determined using a Mann-Whitney U test.
Immunoprecipitation of NHE1 Protein—Cell lysates were used for the immunoprecipitation of exogenously expressed NHE1 from AP-1 cells. The lysates were precleared by incubation with 20 µl of 100 mg/ml protein A-Sepharose beads at 4 °C for 30 min in detergent-containing radioimmune precipitation assay buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1% Nonidet P-40, 0.25% SDS, 0.1% Triton X-100, 1 mM EGTA, and protease inhibitors (0.1 mM phenylmethylsulfonyl fluoride, 0.1 mM benzamidine, and 0.1% (v/v) protease inhibitor mixture (12)) and 1% (w/v) bovine serum albumin. After removal of beads by centrifugation, the supernatant was incubated with 1.4 µg/ml of an anti-HA antibody for 2 h at 4 °C. Protein A-Sepharose beads were blocked in detergent-containing radioimmune precipitation assay buffer with 1% (w/v) bovine serum albumin for 30 min at 4 °C. The blocking solution was removed by centrifugation, and a sample with HA antibody was added and rotated end-over-end overnight at 4 °C. The samples were centrifuged to remove the supernatant, and after washing the bound protein was eluted from the washed beads by incubating with 45 µl of 1x SDS-PAGE sample loading buffer. After SDS-PAGE, samples were transferred to nitrocellulose membranes and radioactivity was detected by exposure of x-ray film. Immunoblotting with anti-HA antibody was used to check the level of NHE1 in the samples and correct for any variation in immunoprecipitation efficiency. The results are the means ± S.E. of at least three experiments, and statistical significance was determined using a Mann-Whitney U test.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
To study the effect of these mutations, we made stable cell lines of control and mutant NHE1 proteins in AP-1 cells that lack their own endogenous NHE1 protein. At least two stable cell lines were made of each protein type. Fig. 2 illustrates some of the characteristics of each type of protein. The mutants displayed varying levels of expression and cell surface targeting, but all were functionally active at levels that were similar to that of controls (Fig. 2C). The expression levels varied from 40 to 118% of that of the wild type Na+/H+ exchanger (Fig. 2A). AP-1 cells that were either mock or untransfected showed no HA tag immunoreactivity and no NHE1 activity. Our laboratory has earlier observed that with protein mistargeting, the NHE1 protein may be found predominantly as an 85-kDa protein that is bereft of glycosylation (15). This was not the case with these mutant proteins because the majority of the immunoreactive species were present as the larger size of about 105 kDa. We also examined the surface targeting of the various mutants. We found (Fig. 2B) that all targeted to the plasma membrane in amounts similar to that of the wild type. 69% of the wild type NHE1 protein was at the cell surface, whereas 45–81% of the expressed mutant protein targeted to the plasma membrane.
|
|
|
To assess the effect of MEK inhibition on NHE1 phosphorylation, four sets of experiments were completed: a control treatment, a stimulatory treatment, a control treatment plus 10 µM U0126 in Me2SO, a stimulatory treatment plus 10 µM U0126 in Me2SO. The phosphorylation levels of each treatment were corrected for loading, and the level of phospho-NHE1 after positive stimulation was plotted (Fig. 4, b and c). In the absence of the MEK inhibitor, U0126, the stimulated/control ratio of phospho-NHE1 was 1.7 ± 0.3, whereas in the presence of 10 µM U0126, the ratio was 0.97 ± 0.08. The phospho-NHE1 ratio in the presence of the inhibitor was significantly lower than that observed for phospho-NHE1 in the absence of the inhibitor.
|
We then compared the phosphorylation levels of the wild type NHE1 to the mutants. Preliminary experiments demonstrated that mutant 1 and 2 were comparable with wild type in their phosphorylation levels and did not differ in response to sustained intracellular acidosis (not shown). We examined the phospho-NHE1 levels of the wild type and mutants 3 and 4 in more detail, and they were 1.74 ± 0.32, 0.75 ± 0.07, and 1.28 ± 0.29, respectively. Fig. 5B illustrates a representative autoradiograph of the results, whereas Fig. 5C summarizes the results of at least six independent experiments. With mutation 3, the stimulated/control phospho-NHE1 ratio is significantly lower than that that observed for wild type NHE1. Mutation 4 did not significantly reduce the level of phospho-NHE1 after sustained acidosis treatment.
To determine which amino acids of mutant 3 were responsible for mediating the effects of sustained intracellular acidosis, individual mutations to alanine were made to amino acids Ser766, Ser770, and Ser771. Stable cell lines expressing these mutant proteins were then established. Fig. 6A is a Western blot demonstrating the expression of the three mutant cell lines. Expression levels were similar to that of the wild type NHE1. We also determined that surface targeting of the NHE1 mutants was not changed in comparison with the wild type protein (not shown). The three mutant cells lines and the mutant NHE1 protein with all three amino acids mutated to alanine were examined in the two-pulse assay. We determined the ability of sustained intracellular acidosis to stimulate the NHE1 protein during the second recovery from acidosis. The results are shown in Fig. 6B. The triple mutant, with all three amino acids mutated to alanine, was not activated by sustained intracellular acidosis. In addition, mutation of either Ser770 or Ser771 eliminated activation of these mutants by sustained acidosis. In contrast, mutation of Ser766 to alanine did not eliminate activation of the protein by prolonged acidosis.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
50% of the stimulatory effect of growth factors (9). Although kinase consensus and phosphorylation sites have been identified in the cytoplasmic domain in vitro (10, 18, 19), only Ser703 has been identified as a residue phosphorylated in vivo (20). The present study identifies a novel set of residues that play a critical role in vivo in NHE1 stimulation via sustained intracellular acidosis. We examined ERK-dependent phosphorylation because in several earlier studies we have shown both ERK-dependent phosphorylation of the NHE1 protein and ERK-dependent stimulation of activity (10, 11). Sustained intracellular acidosis was earlier shown to be a reliable method of stimulation of Na+/H+ exchanger activity by ERK-dependent pathways (17). In preliminary experiments we found that it was a more reliable method of activation of NHE1 in this cell type in comparison with receptor-mediated activation.
|
|
Mutation of the selected residues did not have large effects on the normal functioning of the NHE1 protein. Although the expression and targeting levels varied somewhat, in all cases the mutant protein was expressed and properly targeted. Evaluation of the functional state of the mutated proteins proved that the mutations did not abolish basal Na+/H+ exchanger ability. We concluded that the mutations do not cause severe detrimental effects to the functional state of the protein and that the mutant proteins can be used to further study the role of specific residues in NHE1 regulation.
We have shown earlier that stimulation of NHE1 activity results in phosphorylation of the protein and that MEK inhibition results in decreased phosphorylation of the protein in vivo (10). Previously, we used hormonal stimulation of phosphorylation in isolated cardiomyocytes, whereas in this study, we used sustained acidosis to stimulate NHE1 activity in this cell type. We found that this method of stimulation of these cells resulted in increased activity and phosphorylation of the protein that could be blocked by MEK inhibition. Our results on stimulation of activity of NHE1 were similar to those of Haworth et al. (17). It should be noted that our results differ from those Hayashi et al. (22), who did not find that sustained intracellular acidosis stimulates NHE1 activity. However, in their study they did not serum-deprive NHE1 prior to treatment. We found that this is necessary for the effects of sustained intracellular acidosis. The cells that were not serum-starved were not stimulated by sustained intracellular acidosis (not shown). This suggests that NHE1 needs to be in a resting or basal state for acidosis-mediated stimulation to be effective.
When we stimulated the ERK pathway by sustained intracellular acidosis, we found that of the four sets of amino acids that we mutated, only mutant 3 (S766A/S70A/S71A) was significantly affected in its stimulation of NHE1 activity. In addition, with mutation of these residues, NHE1 is not phosphorylated in response to sustained intracellular acidosis treatment. This implicated one or all of these residues as being specifically phosphorylated by the ERK-dependent pathway, resulting in the activation of NHE1. Mutant 3 contained three phosphorylatable amino acids, Ser766, Ser770, and Ser771. Individual mutations to alanine of each of these amino acids demonstrated that either amino acid Ser770 or Ser771 is required for sustained acidosis to activate the NHE1 protein. Mutation of Ser766 had little to no effect on this activation of the NHE1 protein. These results suggest that these two amino acids are necessary to mediate phosphorylation-dependent activation of NHE1 via the ERK2/p90RSK pathway.
Our results differ from that of a previous report, where Ser703 (20) was found to be important in NHE1 regulation. However, in that study a different cell type was used, and cells were stimulated with serum, which could act to enhance NHE1 activity through a large number of pathways. In our hands, we have found that the level of in vitro phosphorylation by ERK or p90rsk of a fusion protein of the NHE1 cytosolic domain did not vary with a S703A mutation (unpublished observations). Similarly, we demonstrated that p38-dependent phosphorylation does not vary with the S703A mutation (14). These results suggest that Ser703 is not critical, at least for MAP kinase-dependent pathways in these cell types. We have also earlier demonstrated that amino acids Thr717 and Ser722/725/728 of rabbit NHE1 are involved in p38-mediated activation of NHE1 in some cell types. We therefore examined the effects of mutation of these amino acids in the present study. However, mutation of these amino acids did not affect activation of NHE1 or phosphorylation levels. We have previously examined the effects of p38 inhibition on NHE1 activity and phosphorylation in the myocardium and were unable to demonstrate any significant effects of p38 inhibition in the myocardium (12). The present results are in keeping with the idea that the Thr717 and Ser722/725/728 region is not significant in ERK-mediated activation of NHE1 but is involved in p38 activation of NHE1 in some specific cell types (12, 14).
To draw a connection between the activation of ERK and p90RSK kinases and the stimulation of NHE1 activity, the MEK1 specific inhibitor U0126 was used to block the activation of ERK1/2 and subsequently p90RSK activation. U0126 is a selective inhibitor of MEK1 activation by the Raf protein kinase (23). It inhibited sustained acidosis enhancement of the activity of the Na+/H+ exchanger plus its phosphorylation. Based on these results we suggest a pathway whereby sustained acidosis activates ERK2 and subsequently p90RSK via the Raf
MEK1 cascade, leading to NHE1 phosphorylation at residues Ser770 and Ser771 (Fig. 7). It seems likely also that hormonal activation of the ERK-dependent pathway, which leads to activation of NHE1, likely proceeds through this same pathway. Further experiments are necessary to demonstrate this. We have earlier shown that serum activation of isolated cardiomyocytes leads to increased phosphorylation of NHE1 in vivo. In addition, MEK inhibition blocked this activation (10).
The canonical consensus sequence of ERK is generalized as Pro-Xaa-Ser/Thr-Pro where Xaa is a neutral or basic amino acid and n = 1 or 2 (24). Nevertheless, ERK-dependent phosphorylation and regulation of the other membrane proteins such as the tumor necrosis factor- receptor has been reported at nonconsensus ERK phosphorylation sites such as a minimal S/TP. This was demonstrated by others both in vivo and in vitro with purified ERK2 (25). Within the mutant 3 region (Fig. 1), Ser771 is followed by a proline residue, which makes it most likely that this is the residue that is directly recognized by ERK2. ERK-dependent phosphorylation can precede and be a prerequisite for phosphorylation of other nearby residues by other protein kinases such as glycogen-synthase kinase 3 (26). The glycogen-synthase kinase consensus sequence ((S/T)XXX(p(S)/p(T))) would be optimal for amino acid Ser766 being phosphorylated if Ser770 was phosphorylated (27). However, because we found that this amino acid is not critical to sustained acidosis activation of NHE1, it seems unlikely that this pathway is involved or is critical for this activation of the NHE1 protein. In the case of p90RSK, a consensus site of RXRXXS (28) is similar to amino acids 765–770, with Ser770 being a possible site of phosphorylation. Because we found that Ser770 is necessary for activation of NHE1 by sustained acidosis, it is possible that p90rsk activation of NHE1 is necessary for some of the response we demonstrated. It is interesting that both amino acids, Ser770 or Ser771, were necessary for sustained acidosis activation of NHE1. Mutation of either one to alanine was sufficient to eliminate the effect of sustained acidosis. The co-requirement of these amino acids is similar to that observed in some other membrane proteins. For example in the voltage-dependent calcium channel, Ser409 and Ser447 are substrates for ERK1/2-mediated phosphorylation and are required for activation of the channel. Mutation of either amino acid reduces the ERK-stimulated calcium current (29). Having a requirement for two phosphorylated amino acids adjacent to each other for a physiological response represents an interesting control mechanism that is perhaps tightly regulated. Overall, the clustering and requirement of phosphorylatable residues in this region is intriguing but requires further experimentation to elucidate the interrelationships of these amino acids.
|
|
FOOTNOTES |
|---|
1 Supported by the Canadian Institutes of Health Research strategic training initiative in membrane proteins and cardiovascular disease.
2 To whom correspondence should be addressed. Tel.: 780-492-1848; Fax: 780-492-7751; E-mail: lfliegel{at}ualberta.ca.
3 The abbreviations used are: NHE1, Na+/H+ exchanger isoform 1; HA, hemagglutinin; MAP, mitogen-activated protein; ERK, extracellular signal-regulated kinase; MEK, MAP kinase/ERK kinase.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  H. C. Zaun, A. Shrier, and J. Orlowski Calcineurin B Homologous Protein 3 Promotes the Biosynthetic Maturation, Cell Surface Stability, and Optimal Transport of the Na+/H+ Exchanger NHE1 Isoform J. Biol. Chem., May 2, 2008; 283(18): 12456 - 12467. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Luo, D. B. Kintner, G. E. Shull, and D. Sun ERK1/2-p90RSK-mediated Phosphorylation of Na+/H+ Exchanger Isoform 1: A ROLE IN ISCHEMIC NEURONAL DEATH J. Biol. Chem., September 21, 2007; 282(38): 28274 - 28284. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
