Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M707347200 on December 26, 2007

J. Biol. Chem., Vol. 283, Issue 12, 7962-7971, March 21, 2008
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
283/12/7962    most recent
M707347200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Karcher, A.
Right arrow Articles by Hopfner, K.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karcher, A.
Right arrow Articles by Hopfner, K.-P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

X-ray Structure of the Complete ABC Enzyme ABCE1 from Pyrococcus abyssi*Formula

Annette Karcher, Alexandra Schele, and Karl-Peter Hopfner1

From the Center for Integrated Protein Science and Center for Advanced Photonics at the Gene Center, Ludwig-Maximilians-University Munich, D-81377 Munich, Germany

Received for publication, August 31, 2007 , and in revised form, December 6, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The ATP binding cassette enzyme ABCE1 (also known as RNase-L (ribonuclease L) inhibitor, Pixie, and HP68), one of the evolutionary most sequence-conserved enzymes, functions in translation initiation, ribosome biogenesis, and human immunodeficiency virus capsid assembly. However, its structural mechanism and biochemical role in these processes have not been revealed. We determined the crystal structure of Pyrococcus abyssi ABCE1 in complex with Mg2+ and ADP to 2.8Å resolution. ABCE1 consists of four structural domains. Two nucleotide binding domains are arranged in a head-to-tail orientation by a hinge domain, suggesting that these domains undergo the characteristic tweezers-like powerstroke of ABC enzymes. In contrast to all other known ABC enzymes, ABCE1 has a N-terminal iron-sulfur-cluster (FeS) domain. The FeS domain contains two [4Fe-4S] clusters and is structurally highly related to bacterial-type ferredoxins. However, one cluster is coordinated by an unusual CX4CX3/4C triad. Surprisingly, intimate interactions of the FeS domain with the adenine and ribose binding Y-loop on nucleotide binding domain 1 suggest a linkage between FeS domain function and ATP-induced conformational control of the ABC tandem cassette. The structure substantially expands the functional architecture of ABC enzymes and raises the possibility that ABCE1 is a chemomechanical engine linked to a redox process.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
ATP binding cassette (ABC)2 ATPases constitute one of the most abundant families of proteins in life and are found in many central biological reactions (1, 2). For instance, ABC transporters are membrane-spanning transport proteins that conduct the directional transport of specific substrates through membranes (3). Other ABC enzymes are found in DNA repair and chromosome maintenance processes and include the DNA repair enzymes Rad50 and MutS (4). Finally, ABC enzymes function in translation and are involved in translation elongation in fungi (eEF3) (5) and eukaryotic translation initiation (ABC50) (6).

ABCE1, the only member of subclass E of ABC enzymes, is arguably the most evolutionary conserved member of ABC enzymes and is present in all Archaea and eukaryotes. ABCE1 is essential in all organisms tested (7-9). ABCE1 is predominantly found in the cytoplasm and was first identified by its inhibition of the antiviral, interferon-activated ribonuclease L (10, 11). Because ribonuclease L is found only in humans, rats, and mice (12), the evolutionary conserved function of ABCE1 is likely distinct from its inhibition of ribonuclease L. Subsequently, it was shown that assembly of immature HIV1 capsids from viral genomic RNA and Gag polypeptides requires ATP hydrolysis by ABCE1 (13). Recent data suggest that the cellular and perhaps evolutionary conserved and essential function of ABCE1 is found in ribosome biogenesis, translation initiation, and/or formation of translation initiation components (9, 14-19). In this process yeast ABCE1 interacts with eukaryotic translation initiation factors as well as ribosomal subunits and is required for rRNA maturation and nuclear export of 40 S and 60 S subunits (14-16, 18, 19). The mechanistic basis for the role of ABCE1 in all of these processes is not known, but it has been recently observed that Drosophila ABCE1 (pixie) binds to 40 S ribosomes in an ATP-dependent manner (18).

ABCE1 is a 68-kDa ABC enzyme consisting of a cysteine-rich N-terminal region followed by two ABC type nucleotide binding domains (NBDs). The crystal structure of this tandem cassette NBD region of ABCE1 has been determined (20). Both NBDs possess the typical bi-lobed fold of ABC-type ATPase domains (21) and contain ATP binding sites with Walker A, Walker B, Q-loop, and signature motifs. The two NBDs are arranged in the typical ABC enzyme head-to-tail orientation (22-27) by a "hinge" domain. This arrangement creates two composite nucleotide binding sites formed by Walker A/B and Q-loops from one NBD and by the signature motifs from the respective opposing NBD. In the ATP binding subunit of the bacterial maltose transporter MalK, ATP binding by the two composite active sites induces a tweezer-like powerstroke between the two NBDs (28) that is suggested to trigger conformational changes in associated function-specific domains (29-31).

The highly conserved cysteine-rich N-terminal region of ABCE1 is unique among ABC enzymes. Sequence analysis as well as genetic interactions with iron-sulfur ([Fe-S]) cluster biogenesis enzymes indicated that this motifs of yeast ABCE1 are [Fe-S] binding sites most likely comprising a ferredoxin-like fold and coordination (15, 32). [Fe-S] clusters, composed of non-heme iron and acid-labile inorganic sulfide, constitute one of the most ancient, widely distributed, and structurally and functionally diverse class of prosthetic groups. [Fe-S] clusters can occur in a variety of stoichiometries, including [2Fe-2S], [3Fe-4S], and [4Fe-4S] clusters. Many [Fe-S] clusters mediate electron transfer in redox reactions. However, other functions can include fold stabilization, substrate binding, and substrate activation (33-35). Mutations in the predicted [Fe-S] cysteine ligands of the ABCE1 in general lead to cell inviability in yeast, demonstrating that not only the NBDs but also the cysteine-rich domain is essential for ABCE1 function (15, 32). Thus, a structural framework for this domain and its physical and functional interaction with the NBDs is the key for understanding the biochemical function of ABCE1.

To derive the complete multidomain functional architecture of ABCE1, we determined the crystal structure of the complete ABCE1 protein from Pyrococcus abyssi in complex with Mg2+ and ADP to 2.8 Å resolution. The fold and double [4Fe-4S] binding environment of the N-terminal FeS domain is structurally similar to bacterial-type ferredoxin domains, which are found in a variety of oxidoreductases. However, the FeS domain of ABCE1 also possesses some uncharacteristic features, such as unique loop insertions that could indicate functional sites. The short 12 Å distance of the two [4Fe-4S] clusters, typically associated with efficient electron transfer reactions, raises the possibility that ABCE1 is involved in an electron transfer process reaction.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Protein Expression and Purification—The coding sequence of P. abyssi ABCE1 (pabABCE1) was amplified from genomic DNA by the polymerase chain reaction using oligonucleotides AAAAAAAACATATGGTGAGGAAAATGAGGATCGCG and TTTTTTGCGGCCGCGGCGTAGTAGTATTCTCCCCTTGC. The purified PCR product was cloned into a modified pET28 vector (Novagen). The vector pET28-N-strep containing the pabABCE1 gene was constructed in several steps. Two annealed oligonucleotides (5'-CATGGCTAGCTGGAGCCACCCGCAGTTCGAAAAAGGCGCTCA-3' and 5'-TATGAGCGCCTTTTTCGAACTGCGGGTGGCTCCAGCTAGC-3') that contain the DNA sequence for the short Strep-tag II peptide (MASWSH-PQFEKGAH) were ligated into a pET28 vector (Novagen) using NcoI and NdeI restriction sites. The coding sequence for pabABCE1 was inserted into the plasmid using NdeI and NotI restriction sites. Escherichia coli Rosetta (DE3) (Novagen, T7 promoter) cells were transformed with the resulting plasmid. Cells were grown at 37 °C in the presence of the appropriate antibiotics to an A600 = 0.6-0.8. Gene expression was induced by adding 0.4 mM isopropyl 1-thio-β-D-galactopyranoside. After incubation at 37 °C for 4 h, cells were harvested by centrifugation, resuspended in 20 mM Tris (pH 8.0), 200 mM NaCl, 4 mM dithiothreitol and disrupted by sonication. After sedimenting cell debris and other insoluble material, pabABCE1 was purified aerobically by heat denaturation of the lysate (70 °C for 10 min), Resource Q ion exchange chromatography (Amersham Biosciences), and Strep-Tactin (IBA) affinity chromatography using standard/manufacturer suggested protocols.

Reconstitution of the [Fe-S] Cluster—All experimental steps of the reconstitution procedure were made anaerobically inside a glove box (Coy Laboratories) in an atmosphere containing 95% nitrogen and 5% hydrogen. The atmosphere contained less than 2 ppm 02, and all buffer solutions were degassed and pre-incubated in the glove box for at least 48 h. Purified pabABCE1 was transferred into the anaerobic chamber, and the buffer containing purified ABCE1 was exchanged to 50 mM Tris (pH 8.0), 200 mM NaCl, 5 mM dithiothreitol using a disposable PD10 gel filtration column (Bio-Rad). For reconstitution of the [Fe-S] cluster, pabABCE1 was concentrated to 5 mg/ml (1.5 ml) and incubated overnight at 6 °C in the presence of 0.2 mM pyridoxal phosphate, 2 mML-cysteine, 2 mM FeCl2, and 2.5-5 µM E. coli IscS (separately expressed and purified as described (36)). Reconstituted pabABCE1 was purified in the anaerobic chamber by Strep-Tactin (IBA) affinity chromatography. After buffer exchange (PD10, Bio-Rad) to 50 mM Tris (pH 8.0), 150 mM NaCl, 5 mM dithiothreitol, the protein was concentrated with Centricon-10 ultrafiltration units (Amicon) to a final concentration of 15 mg/ml and used in crystallization trials.

Crystallization, Crystallographic Data Collection, Model Building, and RefinementpabABCE1 crystallized in the space group p43212 with cell dimensions a = b = 63.2, c = 319.4 Å. Crystals were obtained by mixing 1 µl of protein solution (50 mM Tris (pH 8.0), 150 mM NaCl, 5 mM dithiothreitol) with 1 µl of reservoir solution (0.2 M calcium acetate (pH 7.3) and 20% polyethylene glycol 3350) and grew after incubation for several days at 20 °C under anaerobic conditions inside a glove box (Coy Laboratories). Crystals were transferred to a stabilizing buffer (0.2 M calcium acetate (pH 7.3) and 20% polyethylene glycol 3350, 20% glycerol) and flash-frozen in liquid nitrogen. A data set to 2.8 Å resolution collected at beamline PX1 at the Swiss Light Source (SLS, Villingen, Switzerland) was processed with XDS (37). Phases were determined by molecular replacement with the program MolRep (38) using the coordinates of the previously determined Pyrococcus furiosus {Delta}FeS-ABCE1 structure as the search model (20). Electron density for the protein residues as well as for the two [Fe-S] clusters was clearly apparent in 2Fo - Fc and Fo - Fc density maps and was used to trace the missing N-terminal 75 residues with MAIN (39). The model was completed by rounds of manual model building with MAIN and automated refinement with CNS (40). Refinement included overall anisotropic B factor and bulk solvent corrections, simulated annealing, positional refinement, and restrained individual B factor refinement. The solvent was generated with CNS and verified by manual inspection. We omitted 5% of the reflection data from the beginning of refinement on to calculate Rfree for cross-validation. Crystallographic data and model statistic are summarized in Table 1.


View this table:
[in this window]
[in a new window]

 
TABLE 1
Crystallographic data collection and model refinement statistics

 
Three-dimensional Alignment of Coordinates—Three-dimensional alignment of coordinates and calculation of root mean square deviations were performed with LSQMAN (Uppsala Software Factory). After initial "brute force" alignment, the dynamic programming-based operator was used with standard settings. The quality and correctness of the alignment was verified by graphical inspection.


Figure 1
View larger version (111K):
[in this window]
[in a new window]

 
FIGURE 1.
Electron densities. a, stereo view of a portion of the electron density at the two [4Fe-4S] clusters with superimposed final model. The model is shown as a stick representation with green (FeS) or orange (NBD1) carbons, blue nitrogens, red oxygens, yellow sulfurs, and ruby iron atoms. The final 2Fo - Fc density, contoured at 1{sigma}, is shown in light brown. A Fo - Fc density, contoured at 3{sigma} and calculated after simulated annealing with omitted [4Fe-4S] clusters atoms and coordinating cysteine sulfurs, is shown in dark magenta. Both [4Fe-4S] clusters as well as their coordinating residues are well defined. b, stereoview of a portion of the electron density (2 Fo - Fc, contoured at 1{sigma}) around the ATP binding site (Walker A motif). The final model is superimposed and shown as color-coded sticks. Me2+ represents the active site metal, either Mg2+ or Ca2+ from the crystallization conditions.

 
Figures and Coordinates—Structural figures were prepared with PYMOL (DeLano Scientific).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Purification and Reconstitution of the [Fe-S] Cluster Containing ABCE1—Initial attempts to crystallize full-length P. abyssi (pab)ABCE1 out of a standard E. coli overexpression system were unsuccessful, presumably because of incomplete [Fe-S] cluster formation and additional oxidation of the [Fe-S] clusters during protein purification. To facilitate [Fe-S] cluster formation during overexpression, we co-overexpressed the E. coli ISC (iron-sulfur-cluster) operon on a separate plasmid (41). Furthermore, we subsequently reconstituted/repaired the [Fe-S] clusters of the purified protein in vitro in an anaerobic chamber containing a 95% nitrogen plus 5% hydrogen atmosphere by adding the E. coli IscS protein (separately expressed and purified (36)) along with Fe2+, cysteine, and pyridoxal phosphate. IscS catalyzes the formation of S2- from cysteine. S2- and Fe2+ assemble into the [Fe-S] clusters. The reconstituted ABCE1 showed a strong 418-nm absorption peak characteristic for proteins containing [4Fe-4S] clusters and was further used for crystallization.

Crystallization and Structure DeterminationpabABCE1 crystallized under anaerobic conditions in the space group P43212, with one molecule per asymmetric unit (Table 1). The crystals diffracted x-rays to a resolution of 2.8 Å. The structure was solved by the molecular replacement method using the previously determined pfu{Delta}FeS-ABCE1 structure as the search model. The residues for the ironsulfur cluster domain (residues 1-75) along with two [4Fe-4S] clusters were clearly visible in 2Fo - Fc and Fo - Fc electron density maps and could be readily interpreted (Fig. 1). The final model, refined at 2.8 Å resolution, comprised all 593 protein residues along with two Mg2+-ADP moieties, two [4Fe-4S] clusters, and 124 solvent molecules (Fig. 2).

Structural Overview—ABCE1 is a bowl-shaped molecule with overall dimensions of ~80 x 65 x 50 Å. It consists of four structural domains; that is, an N-terminal [Fe-S] cluster containing domain (FeS domain), two ABC ATPase-type nucleotide binding domains (NBD1 and NBD2), and a hinge domain (Fig. 2). The structures of the NBDs and the hinge region are similar to the equivalent regions in the previously reported structure of pfu{Delta}FeS-ABCE1 and are described in detail in Karcher et al. (20). NBD1 and NBD2 face each other in the typical head-to-tail orientation of ABC enzymes, creating a roughly 10-14-Å-wide interface cleft (backbone positions). This interface cleft harbors two composite ATP binding sites that are formed by the conserved Walker A, Walker B/D-loop, and Q-loop motifs of one NBD and the signature motif of the opposing NBD.


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 2.
Structural overview. a, stereo plot of a ribbon representation of pabABCE1 with highlighted secondary structure ("top view"). The FeS domain is shown in green, along with Corey-Pauling-Koltun models of the two [4Fe-4S] clusters (red iron, yellow sulfur). The two nucleotide binding domains NBD1 and NBD2 are displayed in yellow and orange, respectively. NBD1 contains a helix-loop-helix insertion (HlH, blue). The two NBDs are oriented into the head-to-tail orientation by the ABCE1-specific hinge domain (pale blue). The FeS domain binds to NBD1 and is situated at the lateral opening of the nucleotide binding cleft. The two experimentally bound ADP molecules (color coded stick model with cyan carbon, red oxygen, blue nitrogen, and white phosphor atoms) and magnesium ions (magenta spheres) highlight the position of the two composite nucleotide binding sites (P, P-loop/Walker A; S, signature motif). b, same as a but viewed along the nucleotide binding cleft ("front view").

 
In the obtained crystal form, both active sites contain an Mg2+-ADP moiety (or Ca2+-ADP because of the crystallization solution), retained from the heterologous expression (Figs. 1b and 2). Stably bound ADP molecules have also been found in other ABC-type ATPases (23, 42) and have been observed with other crystal forms of ABCE1 from different organisms (20).3 It is possible that nucleotide exchange in ABCE1 necessitates allosteric control by binding to a yet to be identified substrate or interacting partner, perhaps similar to the mismatch DNA provoked ADP -> ATP exchange of the mismatch sensor MutS (43).

The orientation of NBD1 and NBD2 is mediated by the hinge domain, formed by highly conserved sequence regions between the two NBDs and at the C terminus of ABCE1 (Fig. 3 and supplemental Fig. 1). The hinge domain is tightly bound along the NBD1:NBD2 interface and may form a pivot point for the putative ATP-driven conformational changes between NBD1 and NBD2. The signature motifs, which bind to the opposing ATP {gamma}-phosphates in the ATP-bound conformation of ABC enzymes, are ~11 Å away from their expected position in the presence of ATP. Because mutations in both invariant serine residues of the signature motifs of Saccharomyces cerevisiae RLI1p are lethal in S. cerevisiae (20), it is likely that the NBDs of ABCE1 undergo a tweezer-like motion similar to that of MalK (28).

The most intriguing and unique feature of ABCE1 is the FeS domain (residues 1-75, Fig. 2). The FeS domain is a small ellipsoid domain of 20 Å x 20 Å - 30 Å dimensions. It is positioned at the lateral opening of the cleft between NBD1 and NBD2 and directly binds to the outside of Lobe I of NBD1 (β5, β6, β11, β12). We observe no direct contacts of the FeS domain to the clamp and NBD2. However, lobe II of NBD2 and the FeS domain are only separated by 5 Å, and it is possible that the FeS domain also interacts with NBD2 during the ATP-dependent conformational cycle of ABCE1.

The FeS Domain Has a Ferredoxin-fold and Possesses Two [4Fe-4S] Clusters—The structure of ABCE1 reveals that the FeS domain has the (β{alpha}β)2 fold of the "bacterial type" ferredoxins (Fig. 4a). Ferredoxins function as electron-transfer mediators in diverse biological redox systems and are grouped into "plant" and bacterial types (44). The two-stranded antiparallel β-sheets β1+β4 and β2+β3 along with two {alpha}-helices {alpha}1 and {alpha}3 form the core ferredoxin fold (Fig. 4a). However, ABCE1 has two notable differences from the canonical fold. One is an additional helical turn ({alpha}2) that is inserted after Cys-29, the first coordinating cysteine of cluster II (Fig. 4a). The second difference is the geometry of the cysteine triad that coordinates cluster I (Fig. 4b). Both insertions are located at positions that have been suggested to mediate electron entry and exit in electron relay active ferredoxin-like domains (45, 46) and may be a specific functional adaptations with ABCE1.

The two [4Fe-4S] clusters are situated in the core of the FeS domain. The electron density shows an eight-atom distorted cube for each of the two clusters (Fig. 1a). Distances of 2.2-2.3 Å between the iron and sulfur atoms and 2.7-2.8 Å between the iron atoms correspond well with values derived from x-ray absorption spectroscopy (32). Both [4Fe-4S] clusters are surrounded by a hydrophobic cocoon (Ile-10, Pro-17, Phe-23, Leu-24, Pro-48, Pro-66, Phe-67, Ala-69, Ile-70 for cluster I and Pro-30, Val-31, Ala-38, Ile-39, Ile-50, Ile-60, Ile-72 for cluster II) and do not directly interact with solvent (Fig. 4c). The lethal pixie mutants L17 (Ala-77dme -> Thr, Ala-69 in P. abyssi) and L24 (Pro-38 -> Leu, Pro-30 in P. abyssi) map to the hydrophobic cocoon of cluster II and I, respectively (8). These mutations likely perturb the cluster environment if not prohibit cluster assembly. In any case, these mutations demonstrate the requirement of both clusters and the surrounding cocoon for ABCE1 function in flies.


Figure 3
View larger version (94K):
[in this window]
[in a new window]

 
FIGURE 3.
Sequence alignment of ABCE1 from P. abyssi (Pab), S. solfataricus (Sso), S. cerevisiae (Sce), Homo sapiens (Hsa), and Drosophila melanogaster (Dme). Domains are highlighted by color coded shading (using the color code of Fig. 2). Annotated secondary structure is shown above the alignment and functional motifs below (most functional motifs are present in both NBDs). The coordinating cysteines for the [4Fe-4S] clusters I and II are annotated.

 
The sequence invariance of the eight coordinating cysteine ligands among known ABCE1 sequences suggests that the two [4Fe-4S] clusters are conserved in ABCE1 across Archaea and eukaryotes (Fig. 3). The cysteine ligands are grouped in two motifs of four cysteines. In di-cluster bacterial-type ferredoxin domains, these motifs usually have a CX2CX2CXnC consensus. Hereby, the first three cysteines bind one cluster, whereas the fourth binds to the other cluster. In ABCE1, [4Fe-4S] cluster I is ligated by Cys-15, Cys-20, Cys-25 of motif I, and by Cys-65 of motif II. [4Fe-4S] cluster II is ligated by Cys-55, Cys-58, Cys-61 of motif II, and by Cys-29 of motif I. Thus, the second cysteine motif of ABCE1 has the consensus spacing of ferredoxins, whereas the first set diverged into the highly unusual CXCX3/4CXnC spacing (Fig. 4b), a feature that also has been observed by bioinformatics analysis (32).

Careful mutational analysis in yeast indicated that six of eight coordinating cysteines are essential for ABCE1 function (32). Notable exceptions were Cys-58sce and Cys-29sce. The former coordinates cluster I, whereas latter coordinates cluster II. Mutational analysis (32), supported by our structural analysis, suggests that the coordinating function of Cys-29 can be taken over by Cys-38 in yeast. This cysteine residue (which is an alanine in P. abyssi) is well positioned to bind to the iron atom and could easily restore coordination of cluster II in the absence of Cys-29. Cys-58, on the other hand, is located between two conserved glycine residues, and this loop appears to be stabilized predominantly by the Fe-Cys interaction. Thus, a lack of Cys-58 might not interfere with FeS domain fold and could, for instance, still allow formation of a partially active [3Fe-4S] cluster.


Figure 4
View larger version (58K):
[in this window]
[in a new window]

 
FIGURE 4.
The FeS domain. a, comparison of the FeS domain of P. abyssi ABCE1 (green with color-coded cysteine side chains and [4Fe-4S] clusters) with the bacterial type ferredoxin domain from adenylylsulfate reductase (purple, PDB code 1JNR (46)), which is the closest structural match according to a DALI search of the protein data base. Two insertions in the ABCE1 FeS domain compared with the canonical ferredoxin fold are shown in magenta. One notable cysteine coordination difference is indicated (arrow). These loop insertions are near the proposed locations of electron entry and exit in bacterial-type ferredoxin domains with electron relay functions. b, detailed view of the C-X4-C-X4-C cysteine triad at cluster I of ABCE1 (green, top) with the canonical C-X2-C-X2-C motif (wheat, bottom, taken from PDB entry 1IQZ (54)). Only backbone atoms along with cysteine side chains and [4Fe-4S] cluster atoms are shown as stick models. c, stereo plot of the FeS domain (tube model) with highlighted and annotated cluster coordination cysteines and hydrophobic cocoon residues (magenta sticks).

 
Similar to some bacterial ferredoxins, the [4Fe-4S] clusters of ABCE1 are stable down to redox potentials below -500 to -600 mV (32, 47). Reasons for such low potentials are solvent-shielding of the clusters, side-chain features, cavity sizes and N-H···S hydrogen bonds (48). For instance, a bulky amino acid (e.g. Leu, Met) at X4 of the CX1X2CX3X4C ligation triad motif has been associated with a low redox potential. Cluster II of ABCE1 carries a conserved isoleucine (Ile-60) at this position, the bulky nature of which could contribute to the negative potentials.

The FeS Domain and the ATPase Active Site of NBD1 Are Tightly Linked—The FeS domain binds to NBD1 via a 1360 Å2 substantial interface (Fig. 2). Strands β1 and β4 form a flat anti-parallel sheet that covers the outside sheet (strands β5, β6, β11, β12) of NBD1. In addition, a prominent loop (residues 87-92; denoted Y-loop; Fig. 3) between β5 and β6 bridges FeS and NBD1 with a net of polar interactions (Fig. 5a). Notably, Asn-90 at the tip of the Y-loop interacts with the main chain of the FeS domain, whereas the base of this loop is attached to the FeS domain via interaction between Arg-86 and Glu-52. The Y-loop was previously identified as a central element of the ATP binding site of ABCE1 (20). Tyr-87 forms the major interaction site for ADP via an aromatic stack with the adenine moiety, whereas Phe-92 provides a hydrophobic face for the ADP-ribose. Thus, the Y-loop appears to be a structural bridge between the ATP/ADP binding moiety on NBD1 and the FeS domain. Such a tight direct link between the ATP binding site and an associated domain has to our knowledge not been observed in ABC enzymes and could have important functional consequences for the often seen allosteric control of the ATPase activity of ABC enzymes by substrate interactions.

Model for ATP-induced Conformational Changes—Previous results from others and us have shown that ATP binding and hydrolysis motifs in both NBDs are essential for the function of ABCE1 in yeast and Drosophila in vivo. The precise role of ATP binding and hydrolysis for the functional cycle of ABCE1 remains to be established. However, because Drosophila ABCE1 binds to the 43 S ribosomal subunit in an ATP-dependent manner (18), a likely explanation is that ATP could control the interaction with molecular partners of ABCE1 by inducing different conformational states in the enzyme. We have not been able to crystallize ABCE1 in the presence of ATP or ATP analogs. However, the ATP-bound conformations of NBDs from several ABC enzymes are structurally characterized and can be used to obtain a preliminary model ABCE1 in the presence of ATP (Fig. 5b). To obtain such a model, we used the structure of the homodimeric ABC domains of the bacterial ABC transporter MJ0796 (25) and the procedure as described for {Delta}FeS-ABCE1 (20). We rigid-body superimposed MJ0798 and ABCE1 via NBD1 (the resulting root mean square deviation is 1.3 Å over 150 C{alpha} atoms). We then superimposed NBD2 of ABCE1 with the second NBD of MJ0796 (root mean square deviation of 1.3 Å over 159 C{alpha} atoms), leaving the remainder of ABCE1 fixed. The low root mean square deviations demonstrate the overall good fit.

In our modeled orientation, NBD2 swings ~40° with respect to the FeS-NBD1 hinge. This movement is very similar to the observed tweezer-like motion of the NBDs of the ABC transporter MalK (28). Only small side chain rearrangements are necessary in the D-loop between the two NBDs to remove close contacts. The superposition appropriately places the signature motifs of NBD1 and NBD2 to bind the opposing ATP {gamma}-phosphates during ATP hydrolysis, consistent with the in vivo mutational analyses (20).


Figure 5
View larger version (70K):
[in this window]
[in a new window]

 
FIGURE 5.
FeS-NBD1 interaction and model for ATP-bound conformation. a, stereo plot of the interface between FeS and NBD1, shown as stick models with the color code of Fig. 2a. NBD1 (orange) interacts with the FeS domain (green) via a small hydrophobic interface (e.g. Val-9 and Ile-7) and an intimate hydrogen-bonding network as well as salt bridges of the Y-loop (Arg-86—Phe-92) to side chain and backbone atoms of the FeS domain. The Y-loop binds ADP via aromatic stacking (Tyr-87) and hydrophobic interactions (Phe-92) to adenosine and ribose, respectively, and structurally couples the nucleotide binding site to the FeS domain. b, model for the ATP-bound engaged conformation of the two NBDs of ABCE1 (orange and yellow ribbons) obtained by superimposing them onto the structure of the ATP-bound NBDs of the ABC transporter MJ0973 (gray ribbon). The putative orientation of NBD2 in the presence of ATP reveals a structural clash with the FeS domain (dashed circle), raising the possibility that nucleotide-dependent conformational changes of the NBDs and functions of the FeS domain are mechanistically linked.

 
Interestingly, in the modeled orientation lobe II of NBD2 substantially clashes with the FeS domain (Fig. 5b). We cannot formally rule out that ATP binding and hydrolysis by ABCE1 involves conformational changes between NBD1 and NBD2 not seen in other ABC enzymes. However, such a different mechanism would not explain the functional significance of the signature motif mutants. A plausible and perhaps more likely explanation is that ATP-induced conformational changes between the NBDs could be linked to a repositioning of the FeS domain. Such structural changes could also explain the effect of Lys453sce -> Ala point mutation on the surface of lobe II of NBD2. The lethal effect of this Lys-453sce -> Ala mutation in S. cerevi siae has remained unexplained because this surface residue has no evident architectural function and is not close to any known functional motif. Because Lys-443pab (corresponding to Lys-453sce) is located near the cleft between NBD2 and the FeS domain, the lethal effect of Lys-453sce -> Ala could stem from defunct ATP conformational changes or a disruption of macromolecular interactions in this region.

Surface Features of pabABCE1—To learn more about the functional architecture of ABCE1 and potential macromolecular interfaces, we analyzed the molecular surface of pabABCE1. Mapping of sequence conservation across archaeal and eukaryotic species revealed at least three notable conserved patches (Fig. 6a). Two of them, the nucleotide binding cleft (patch 1) between the two NBDs and the conserved patch 2 on the hinge domain have been previously observed and attributed to functional sites associated with nucleotide-dependent conformational changes (patch 1 and 2) and potential macromolecular interactions (patch 2) (20). We noticed third patch on the surface of the FeS domain at the side facing NBD2. This patch could be an important binding site for macromolecular partners. The opposing side of NBD2 harbors Lys-443, the alanine mutation of which is lethal in yeast (Fig. 6a). Interestingly, this conserved patch co-localizes with strong positive electrostatic surface potential (Fig. 6b), a feature that could be important in the interaction with negatively charged components of 43 S ribosomal particles, RNA molecules, or other translation initiation intermediates.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
ABCE1 is one of the most conserved enzymes in evolution and present in all Archaea and eukaryotes. Current data suggest that ABCE1 has key cellular roles in translation or ribosome biogenesis and interacts with several translation initiation factors (eIF3/Hcr1, eIF5, eIF2B) and ribosomal subunits (14-16, 18, 19). Additional functions of ABCE1 demonstrated are the assembly of HIV1 capsids (13) and inhibition of ribonuclease L (10). A second paralog of ABCE1 in plants is an endogenous suppressor of RNA interference (49). However, despite efforts in several laboratories, understanding the essential biological role of ABCE1 is currently hampered by several shortcomings, including the unknown target for the mechanistic action of ABCE1 and the unknown biochemical function of ABCE1.


Figure 6
View larger version (84K):
[in this window]
[in a new window]

 
FIGURE 6.
Molecular surface analysis. a, molecular surface of pabABCE1 colored according to sequence conservation among different ABCE1 species. Conservation was derived from the AMAS server and varies from dark red (invariant) to white (unconserved). Two views of pabABCE1 are shown. The left view shows the "top" side of the particle using the orientation of Fig. 2a. The right view shows the "bottom" side of the particle, obtained by rotating the model around the vertical axis. We observed three conserved regions. Patch 1 is located in the active site cleft, whereas patch 2 is located at the hinge domain. Patch 3 is on the FeS domain, near the interface cleft to NBD2. b, molecular surface of pabABCE1 colored according to electrostatic potential at the solvent-accessible region (red, -5 kT/e-; blue, +5 kT/e-). The electrostatic potential was calculated with the program APBS (Adaptive Poisson-Boltzmann Solver), using the experimentally determined charge of +2 for each of the clusters (32). Strong positive patches co-localize with the conserved surface patches, indicating they could have important functions in e.g. nucleic acid interactions.

 
To guide future research, we provide here a structural frame-work for the complete multidomain ABCE1 molecule from P. abyssi. The overall high conservation of the entire polypeptide chain argues that our structure is also a valid model for eukaryotic ABCE1. The unique N terminus of ABCE1, distinct from all other known ABC enzymes, has striking structural similarity to bacterial ferredoxin domains, which are typically involved in electron transfer processes. As judged from topological similarities to ABC transporters the three C-terminal domains NBD1, NBD2, and hinge are well positioned to undergo the nucleotide-dependent structural switch and probably form a "chemomechanical engine" module. The mutual interaction of the putative "engine module" with the FeS domain distinguishes ABCE1 from other ABC enzyme structures. In particular, the intriguing position of the FeS domain at the lateral opening of the ATP binding cleft and the tight, unexpected structural connection between the nucleotide binding Y-loop of NBD1 and the FeS domain suggest a mechanistic link between the putative ATP-dependent structural changes in the NBD1-NBD2-hinge engine and the FeS domain.

The role and function of the FeS domain in the cellular biology of ABCE1 is unclear. Many mutations in structurally important residues in the FeS domain are lethal in flies and yeast, indicating the essential role of this domain in the function of ABCE1. Functions of [Fe-S] clusters include electron transfer, substrate binding, and a direct role in catalysis. In addition, some [Fe-S] clusters appear to have a more structural function. Because both [4Fe-4S] clusters of ABCE1 are quite well shielded from solvent and are coordinated by four cysteines each, it is unlikely that the clusters of the FeS domain have a direct role in some sort of catalysis or in substrate binding. This does not rule out that the FeS domain itself interacts with substrates or macromolecular partners. Therefore, an obvious question with regard to the [Fe-S] clusters of ABCE1 is whether they participate in an electron transfer process or whether they have an architectural function. Previous biochemical studies showed that the [4Fe-4S] clusters of ABCE1 from the hyperthermophilic Archaea Sulfolobus solfataricus are resistant to reduction with dithionite and are electronically stable down to redox potentials of -560 mV. This considerable stability could indicate that the [4Fe-4S] clusters of ABCE1 have structural rather than electron transfer functions (32). Here, the FeS domain and its positive surface patch could form an important site for macromolecular interactions, and ABCE1 may act as a chemomechanical engine, for instance to help assemble ribosomal particles, immature HIV capsids, or 48 S translation initiation intermediates.

The stability against reducing agents of the ABCE1 clusters is similar to that of clusters in the DNA repair enzymes endonuclease III and MutY (50, 51). Initially, the clusters of the DNA repair enzymes have been suggested to fulfill a mainly structural function. However, recent data show they become redox active once endonuclease III and MutY bind to DNA substrates (52). It is, therefore, possible that the clusters of ABCE1 also become redox-active only after association with biological partners.

To our knowledge most if not all bacterial ferredoxin type II [4Fe-4S] clusters with known biological functions are associated with electron transfer reactions. In support of an electron transfer role, the two clusters of ABCE1 are separated by the ideal 12 Å (center-to-center) distance that allows magnetic interaction of the clusters and is characteristic of biological relevant electron transfer reactions. Thus, an alternative or additional function of ABCE1 could be the catalysis of electron transfer in a translation/ribosome-associated process. Such a possible a link between ATP-dependent conformational changes and [4Fe-4S] cluster-mediated electron transfer is not unprecedented and well characterized for the nitrogenase enzyme. Here electron transfer is coupled to nucleotide-dependent conformational changes at two ATP/ADP binding domains (53). In this regard ABCE1 may act as a chemomechanical enzyme with structurally linked NBD- and FeS-associated functions, for instance by linking nucleotide-driven association to translation components with a possible role in an electron transfer process. Thus, future experimental approaches should not only address a possible function in the assembly of protein-nucleic acid complexes but should also address the possibility of an ABCE1-mediated electron transfer reaction.

In sum, our crystallographic analysis uncovers new structural features of ABC enzymes, including a surprisingly direct link between the ATP binding site of an NBD to an associated function-specific domain and the location of a FeS domain at the lateral opening of the active site cleft. These results could be important in light of the poorly understood allosteric control of the ATPase of ABC enzymes by substrate interactions. In addition, our results considerably expand the known functional architecture of ABC enzymes and indicate a new mode for how the engine module of ABC enzymes may communicate with function-specific domains.


    FOOTNOTES
 
The atomic coordinates and structure factors (code 3BK7) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).

* This work was supported by Deutsche Forschungsgemeinschaft Grants HO2489/2 and SFB455 (to K. P. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Fig. 1. Back

1 To whom correspondence should be addressed: Feodor-Lynen-Strasse 25, D-81377 Munich, Germany. Tel.: 49-89-2180-76953; Fax: 49-89-2180-76999; E-mail: hopfner{at}lmb.uni-muenchen.de.

2 The abbreviations used are: ABC, ATP binding cassette; HIV, human immunodeficiency virus; NBD, nucleotide binding domain. Back

3 A. Karcher, unpublished data. Back


    ACKNOWLEDGMENTS
 
We thank Berta Martins, Holger Dobbek, Sally Leevers, and David Auble for discussions and advice. We thank Dieter Oesterhelt for support with the anoxic chamber and Peter Roach for providing the ISC operon plasmid. We thank the staff of SLS PXI for help with data collection.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. (2003) ABC Proteins: From Bacteria to Man, Academic Press, Inc., Elsevier, London
  2. Holland, I. B., and Blight, M. A. (1999) J. Mol. Biol. 293, 381-399[CrossRef][Medline] [Order article via Infotrieve]
  3. Schmitt, L., and Tampe, R. (2002) Curr. Opin. Struct. Biol. 12, 754-760[CrossRef][Medline] [Order article via Infotrieve]
  4. Hopfner, K. P., and Tainer, J. A. (2003) Curr. Opin. Struct. Biol. 13, 249-255[CrossRef][Medline] [Order article via Infotrieve]
  5. Andersen, C. B., Becker, T., Blau, M., Anand, M., Halic, M., Balar, B., Mielke, T., Boesen, T., Pedersen, J. S., Spahn, C. M., Kinzy, T. G., Andersen, G. R., and Beckmann, R. (2006) Nature 443, 663-668[CrossRef][Medline] [Order article via Infotrieve]
  6. Tyzack, J. K., Wang, X., Belsham, G. J., and Proud, C. G. (2000) J. Biol. Chem. 275, 34131-34139[Abstract/Free Full Text]
  7. Winzeler, E. A., Shoemaker, D. D., Astromoff, A., Liang, H., Anderson, K., Andre, B., Bangham, R., Benito, R., Boeke, J. D., Bussey, H., Chu, A. M., Connelly, C., Davis, K., Dietrich, F., Dow, S. W., El Bakkoury, M., Foury, F., Friend, S. H., Gentalen, E., Giaever, G., Hegemann, J. H., Jones, T., Laub, M., Liao, H., Liebundguth, N., Lockhart, D. J., Lucau-Danila, A., Lussier, M., M'Rabet, N., Menard, P., Mittmann, M., Pai, C., Rebischung, C., Revuelta, J. L., Riles, L., Roberts, C. J., Ross-MacDonald, P., Scherens, B., Snyder, M., Sookhai-Mahadeo, S., Storms, R. K., Veronneau, S., Voet, M., Volckaert, G., Ward, T. R., Wysocki, R., Yen, G. S., Yu, K., Zimmermann, K., Philippsen, P., Johnston, M., and Davis, R. W. (1999) Science 285, 901-906[Abstract/Free Full Text]
  8. Coelho, C. M., Kolevski, B., Bunn, C., Walker, C., Dahanukar, A., and Leevers, S. J. (2005) Development 132, 5411-5424[Abstract/Free Full Text]
  9. Estevez, A. M., Haile, S., Steinbuchel, M., Quijada, L., and Clayton, C. (2004) Mol. Biochem. Parasitol. 133, 137-141[CrossRef][Medline] [Order article via Infotrieve]
  10. Bisbal, C., Martinand, C., Silhol, M., Lebleu, B., and Salehzada, T. (1995) J. Biol. Chem. 270, 13308-13317[Abstract/Free Full Text]
  11. Bisbal, C., Salehzada, T., Silhol, M., Martinand, C., Le Roy, F., and Lebleu, B. (2001) Methods Mol. Biol. 160, 183-198[Medline] [Order article via Infotrieve]
  12. Kerr, I. D. (2004) Biochem. Biophys. Res. Commun. 315, 166-173[CrossRef][Medline] [Order article via Infotrieve]
  13. Zimmerman, C., Klein, K. C., Kiser, P. K., Singh, A. R., Firestein, B. L., Riba, S. C., and Lingappa, J. R. (2002) Nature 415, 88-92[CrossRef][Medline] [Order article via Infotrieve]
  14. Dong, J., Lai, R., Nielsen, K., Fekete, C. A., Qiu, H., and Hinnebusch, A. G. (2004) J. Biol. Chem. 279, 42157-42168[Abstract/Free Full Text]
  15. Kispal, G., Sipos, K., Lange, H., Fekete, Z., Bedekovics, T., Janaky, T., Bassler, J., Aguilar Netz, D. J., Balk, J., Rotte, C., and Lill, R. (2005) EMBO J. 24, 589-598[CrossRef][Medline] [Order article via Infotrieve]
  16. Yarunin, A., Panse, V. G., Petfalski, E., Dez, C., Tollervey, D., and Hurt, E. C. (2005) EMBO J. 24, 580-588[CrossRef][Medline] [Order article via Infotrieve]
  17. Zhao, Z., Fang, L. L., Johnsen, R., and Baillie, D. L. (2004) Biochem. Biophys. Res. Commun. 323, 104-111[CrossRef][Medline] [Order article via Infotrieve]
  18. Andersen, D. S., and Leevers, S. J. (2007) J. Biol. Chem. 282, 14752-14760[Abstract/Free Full Text]
  19. Chen, Z. Q., Dong, J., Ishimura, A., Daar, I., Hinnebusch, A. G., and Dean, M. (2006) J. Biol. Chem. 281, 7452-7457[Abstract/Free Full Text]
  20. Karcher, A., Buttner, K., Martens, B., Jansen, R. P., and Hopfner, K. P. (2005) Structure 13, 649-659[Medline] [Order article via Infotrieve]
  21. Hung, L. W., Wang, I. X., Nikaido, K., Liu, P. Q., Ames, G. F., and Kim, S. H. (1998) Nature 396, 703-707[CrossRef][Medline] [Order article via Infotrieve]
  22. Hopfner, K. P., Karcher, A., Shin, D. S., Craig, L., Arthur, L. M., Carney, J. P., and Tainer, J. A. (2000) Cell 101, 789-800[CrossRef][Medline] [Order article via Infotrieve]
  23. Obmolova, G., Ban, C., Hsieh, P., and Yang, W. (2000) Nature 407, 703-710[CrossRef][Medline] [Order article via Infotrieve]
  24. Lamers, M. H., Perrakis, A., Enzlin, J. H., Winterwerp, H. H., de Wind, N., and Sixma, T. K. (2000) Nature 407, 711-717[CrossRef][Medline] [Order article via Infotrieve]
  25. Smith, P. C., Karpowich, N., Millen, L., Moody, J. E., Rosen, J., Thomas, P. J., and Hunt, J. F. (2002) Mol. Cell 10, 139-149[CrossRef][Medline] [Order article via Infotrieve]
  26. Locher, K. P., Lee, A. T., and Rees, D. C. (2002) Science 296, 1091-1098[Abstract/Free Full Text]
  27. Dawson, R. J., and Locher, K. P. (2006) Nature 443, 180-185[CrossRef][Medline] [Order article via Infotrieve]
  28. Chen, J., Lu, G., Lin, J., Davidson, A. L., and Quiocho, F. A. (2003) Mol. Cell 12, 651-661[CrossRef][Medline] [Order article via Infotrieve]
  29. van der Does, C., and Tampe, R. (2004) Biol. Chem. 385, 927-933[CrossRef][Medline] [Order article via Infotrieve]
  30. Higgins, C. F., and Linton, K. J. (2004) Nat. Struct. Mol. Biol. 11, 918-926[CrossRef][Medline] [Order article via Infotrieve]
  31. Locher, K. P. (2004) Curr. Opin. Struct. Biol. 14, 426-431[CrossRef][Medline] [Order article via Infotrieve]
  32. Barthelme, D., Scheele, U., Dinkelaker, S., Janoschka, A., Macmillan, F., Albers, S. V., Driessen, A. J., Stagni, M. S., Bill, E., Meyer-Klaucke, W., Schunemann, V., and Tampe, R. (2007) J. Biol. Chem. 282, 14598-14607[Abstract/Free Full Text]
  33. Rees, D. C., and Howard, J. B. (2003) Science 300, 929-931[Abstract/Free Full Text]
  34. Lill, R., and Muhlenhoff, U. (2006) Annu. Rev. Cell Dev. Biol. 22, 457-486[CrossRef][Medline] [Order article via Infotrieve]
  35. Johnson, D. C., Dean, D. R., Smith, A. D., and Johnson, M. K. (2005) Annu. Rev. Biochem. 74, 247-281[CrossRef][Medline] [Order article via Infotrieve]
  36. Cupp-Vickery, J. R., Urbina, H., and Vickery, L. E. (2003) J. Mol. Biol. 330, 1049-1059[CrossRef][Medline] [Order article via Infotrieve]
  37. Kabsch, W. (1993) J. Appl. Crystallogr. 21, 916-924[CrossRef]
  38. Collaborative Computational Project, N. (1994) Acta Crystallogr. 50, 760-763
  39. Turck, D. (1992) Weiterentwicklung eines Programms fuer Molekuelgraphik und Elektrondichte-Manipulation und seine Anwendung auf verschiedene Protein-Strukturaufklaerungen, Ph. D thesis, Technical University Munich
  40. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S., Read, R. J., Rice, L. M., Simonson, T., and Warren, G. L. (1998) Acta Crystallogr. D Biol. Crystallogr. 54, 905-921[CrossRef][Medline] [Order article via Infotrieve]
  41. Kriek, M., Peters, L., Takahashi, Y., and Roach, P. L. (2003) Protein Expression Purif. 28, 241-245[CrossRef][Medline] [Order article via Infotrieve]
  42. Junop, M. S., Obmolova, G., Rausch, K., Hsieh, P., and Yang, W. (2001) Mol. Cell 7, 1-12[CrossRef][Medline] [Order article via Infotrieve]
  43. Acharya, S., Foster, P. L., Brooks, P., and Fishel, R. (2003) Mol. Cell 12, 233-246[CrossRef][Medline] [Order article via Infotrieve]
  44. Sticht, H., and Rosch, P. (1998) Prog. Biophys. Mol. Biol. 70, 95-136[CrossRef][Medline] [Order article via Infotrieve]
  45. Dobritzsch, D., Schneider, G., Schnackerz, K. D., and Lindqvist, Y. (2001) EMBO J. 20, 650-660[CrossRef][Medline] [Order article via Infotrieve]
  46. Fritz, G., Roth, A., Schiffer, A., Buchert, T., Bourenkov, G., Bartunik, H. D., Huber, H., Stetter, K. O., Kroneck, P. M., and Ermler, U. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 1836-1841[Abstract/Free Full Text]
  47. Kyritsis, P., Hatzfeld, O. M., Link, T. A., and Moulis, J. M. (1998) J. Biol. Chem. 273, 15404-15411[Abstract/Free Full Text]
  48. Giastas, P., Pinotsis, N., Efthymiou, G., Wilmanns, M., Kyritsis, P., Moulis, J. M., and Mavridis, I. M. (2006) J. Biol. Inorg. Chem. 11, 445-458[CrossRef][Medline] [Order article via Infotrieve]
  49. Braz, A. S., Finnegan, J., Waterhouse, P., and Margis, R. (2004) J. Mol. Evol. 59, 20-30[Medline] [Order article via Infotrieve]
  50. Kuo, C. F., McRee, D. E., Fisher, C. L., O'Handley, S. F., Cunningham, R. P., and Tainer, J. A. (1992) Science 258, 434-440[Abstract/Free Full Text]
  51. Porello, S. L., Cannon, M. J., and David, S. S. (1998) Biochemistry 37, 6465-6475[CrossRef][Medline] [Order article via Infotrieve]
  52. Boal, A. K., Yavin, E., Lukianova, O. A., O'Shea, V. L., David, S. S., and Barton, J. K. (2005) Biochemistry 44, 8397-8407[CrossRef][Medline] [Order article via Infotrieve]
  53. Tezcan, F. A., Kaiser, J. T., Mustafi, D., Walton, M. Y., Howard, J. B., and Rees, D. C. (2005) Science 309, 1377-1380[Abstract/Free Full Text]
  54. Fukuyama, K., Okada, T., Kakuta, Y., and Takahashi, Y. (2002) J. Mol. Biol. 315, 1155-1166[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
283/12/7962    most recent
M707347200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Karcher, A.
Right arrow Articles by Hopfner, K.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karcher, A.
Right arrow Articles by Hopfner, K.-P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2008 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement