Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M706416200 on November 2, 2007

J. Biol. Chem., Vol. 283, Issue 2, 700-707, January 11, 2008
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/2/700    most recent
M706416200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wong, J.
Right arrow Articles by Brown, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wong, J.
Right arrow Articles by Brown, A. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Endogenous 24(S),25-Epoxycholesterol Fine-tunes Acute Control of Cellular Cholesterol Homeostasis*

Jenny Wong{ddagger}1, Carmel M. Quinn§2, Ingrid C. Gelissen§3, and Andrew J. Brown{ddagger}4

From the {ddagger}School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney 2052, Australia and the §Centre for Vascular Research, University of New South Wales, and the Department of Haematology, Prince of Wales Hospital, Sydney 2032, Australia

Received for publication, August 3, 2007 , and in revised form, October 11, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Certain oxysterols, when added to cultured cells, are potent regulators of cholesterol homeostasis, decreasing cholesterol synthesis and uptake and increasing cholesterol efflux. However, very little is known about whether or not endogenous oxysterol(s) plays a significant role in cholesterol homeostasis. 24(S),25-Epoxycholesterol (24,25EC) is unique among oxysterols in that it is produced in a shunt of the mevalonate pathway which also produces cholesterol. We investigated the role of endogenously produced 24,25EC using a novel strategy of overexpressing the enzyme 2,3-oxidosqualene cyclase in Chinese hamster ovary cells to selectively inhibit the synthesis of this oxysterol. First, loss of 24,25EC decreased expression of the LXR target gene, ABCA1, substantiating its role as an endogenous ligand for LXR. Second, loss of 24,25EC increased acute cholesterol synthesis, which was rationalized by a concomitant increase in HMG-CoA reductase gene expression at the level of SREBP-2 processing. Therefore, in the absence of 24,25EC, fine-tuning of the acute regulation of cholesterol homeostasis is lost, supporting the hypothesis that 24,25EC functions to protect the cell against the accumulation of newly synthesized cholesterol.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In 1978 Kandutsch, Chen, and Heiniger (1) first proposed that the suppressive effect of cholesterol on its own synthesis may be mediated by endogenously produced oxysterols. This led to the formulation of the Oxysterol Hypothesis of Cholesterol Homeostasis, which over time has acquired both its champions and its detractors (1–3). The ability of cholesterol to participate in its own feedback regulation has since become well established (4–6). The recent discovery that the cholesterol biosynthetic precursors, lanosterol (7, 8) and desmosterol (9), are involved in particular aspects of cholesterol homeostasis has added to an already complex picture, highlighting the multiple levels of control. However, oxysterols are the only regulatory molecules described so far to elicit effects on all major levels of cholesterol homeostasis. Most of the physiological oxysterols are tissue-specific, so the idea of a global oxysterol regulator that is present in all cell types is enticing.

The oxysterol, 24(S)25-epoxycholesterol (24,25EC),5 is a strong candidate as its synthesis is unique among other oxysterols in that it is produced de novo in the mevalonate pathway which simultaneously synthesizes cholesterol (Fig. 1A). Hence, any cell type capable of synthesizing cholesterol also has the capacity to produce 24,25EC. 24,25EC has been characterized as one of the most potent physiological oxysterols to elicit effects on multiple levels of cellular cholesterol homeostasis (10–16).

When added to cultured cells, 24,25EC is a potent feedback regulator of cholesterol synthesis and has been shown to reduce the activity of the rate-limiting enzyme in cholesterol biosynthesis, 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase (10, 11, 17) as well as to stimulate HMG-CoA reductase degradation (18). Moreover, 24,25EC is a potent suppressor of the transcription factor sterol regulatory element-binding protein-2 (SREBP-2), the master regulator of cholesterol biosynthetic and uptake genes, including HMG-CoA reductase and the low density lipoprotein receptor (13, 19, 20).

The nuclear receptor, the liver X receptor (LXR), is a key regulator of genes involved in cellular cholesterol export (21). The LXR target gene, the ATP binding cassette transporter, ABCA1, is the main facilitator of active transport of cholesterol from the cell to extracellular acceptors (22, 23). Oxysterols are natural ligands for LXR (24), and 24,25EC has been demonstrated to be the most potent oxysterol activator of LXR and ABCA1 target gene expression (12, 15, 25, 26). Most of these effects have been gleaned from studies in which 24,25EC was added to in vitro systems and/or cultured cells. The precise role(s) of endogenously produced 24,25EC remains to be elucidated.

Synthesis of 24,25EC is dependent on the activity of the enzyme, 2,3-oxidosqualene cyclase (OSC) (17, 27–30). OSC is a monotopic integral membrane protein which possesses a dual substrate recognition function that enables it to convert the cholesterol precursor 2,3(S)-monooxidosqualene (MOS) to lanosterol or the 24,25EC precursor 2,3(S):22(S),23-dioxidosqualene (DOS) to 24(S),25-epoxylanosterol (31, 32). Subsequently, lanosterol and 24(S),25-epoxylanosterol are efficiently converted into cholesterol and 24,25EC, respectively, as the end products of this pathway (33). It is important to note, however, that OSC preferentially cyclizes DOS over MOS (27). One way that we (15, 34) and others (17, 28, 35, 36) have augmented endogenous production of 24,25EC is through partial pharmacological inhibition of OSC. Under normal conditions, cholesterol synthesis is favored (Fig. 1A). Under partial inhibition of OSC, the build up of MOS is converted to DOS by the enzyme squalene epoxidase, explaining how cholesterol precursors can be channeled into 24,25EC synthesis at the expense of cholesterol synthesis (Fig. 1B). However, this approach is not ideal because it artificially raises levels of 24,25EC and also decreases cholesterol synthesis, which may be a confounding factor. In addition, there is the usual concern of specificity of effect associated with the use of pharmacological inhibitors. Moreover, conventional gene silencing approaches would also be problematic since synthesis of 24,25EC and cholesterol require the same enzymes; thus, production of both sterols would be inhibited. In the present study we tested a novel way to selectively inhibit 24,25EC production. Overexpression of OSC should have the opposite effect of partial inhibition, i.e. the abundance of OSC should efficiently convert all MOS into lanosterol before any MOS can be converted into DOS and, hence, into 24,25EC (Fig. 1C). This approach is more selective than using a pharmacological agent and should not inhibit cholesterol synthesis.


Figure 1
View larger version (18K):
[in this window]
[in a new window]

  		FIGURE 1.
Synthesis of 24,25EC depends on the enzyme OSC. A, under normal conditions cholesterol (Chol) synthesis is favored, but some 24,25EC is still produced. B, because OSC preferentially cyclizes DOS over MOS, partial inhibition of OSC favors synthesis of 24,25EC. C, we hypothesized that overexpression of OSC should prevent accumulation of MOS and diversion into the shunt pathway, thus inhibiting 24,25EC synthesis. 24,25EL, 24(S),25-epoxylanosterol.

 
In the current study we have used this approach to determine the precise role of endogenous 24,25EC in cellular cholesterol homeostasis. We previously hypothesized that 24,25EC protects the cell from accumulation of newly synthesized cholesterol rather than exogenous cholesterol, since both sterols are synthesized in parallel under a variety of conditions (34). Here, we show that loss of endogenous 24,25EC removes the fine-tuning in the control of cholesterol synthesis, indicating an important role for this oxysterol in cellular cholesterol homeostasis.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents—Chemicals and reagents used are listed below with the supplier. From GE Healthcare: [1-14C]acetic acid, sodium salt (specific activity, 56 mCi/mmol); Hybond C nitrocellulose membrane; Hyperfilm. From Invitrogen: Dulbecco's modified Eagle's medium/Ham's F-12 medium (1:1 mixture); L-glutamine; Lipofectamine 2000; new born calf serum; penicillin/streptomycin; pcDNA3.1-V5-His using the TOPO TA cloning kit; pcDNA4-Myc-His; zeocin; SuperScript III First Strand cDNA synthesis kit; anti-Myc antibody; Amplex Red Cholesterol assay kit (Molecular Probes). From New England Biolabs: KpnI; NotI. From Promega: BamHI; Dual Luciferase Assay Reporter System. From Sigma: compactin (also called mevastatin); Tri reagent; bovine-serum albumin; protease inhibitor mixture; oligonucleotides were synthesized by Sigma-Genosys. Other reagents were bicinchoninic acid assay (Pierce), anti-β-actin antibody (Cell Signaling), Sensi-Mix dT (Quantace), analytical- or HPLC-grade solvents (EM Science), T4 DNA ligase (Fermentas), ECL reagent (Millipore), and 24(S),25-epoxycholesterol (Steraloids). Lipoprotein-deficient serum was prepared from new born calf serum (37). The Chinese hamster ovary cell line CHO-7 was generously provided by Drs. Michael S. Brown and Joseph L. Goldstein (UT Southwestern, Dallas).

Generation of Plasmid Construct—pCMV4-OSC-Myc was constructed by annealing full-length human OSC into pcDNA3.1-V5-His using the TOPO TA cloning kit according to the manufacturer's instructions. The OSC gene was then excised by restriction endonuclease digestion with NotI and KpnI and ligated into pcDNA4-Myc-His.

Generation of OSC-overexpressing Cell Lines—CHO-7 cells were transfected with pCMV4-OSC-Myc (1 µg) for 24 h using Lipofectamine 2000 transfection reagent (4 µl/well in a 6-well plate), and stable transfectants were selected for zeocin (500 µg/ml) resistance by limiting dilution and screened for OSC-Myc expression by Western blotting.

Cell Culture—All cell lines were grown at 37 °C in a 5% CO2 atmosphere. CHO-7 cells were cultured in Dulbecco's modified Eagle's medium/Ham's F-12 medium (1:1 mixture) containing 5% (v/v) lipoprotein-deficient serum supplemented with penicillin/streptomycin (100 units/100 µg/ml) and L-glutamine (2 mM). Empty vector and OSC-overexpressing cell lines were maintained as CHO-7 cells but always in the presence of 100 µg/ml zeocin. Treatments were conducted for 24 h in media containing 5% (v/v) lipoprotein-deficient serum. All treatments were added to cells either in absolute ethanol or dimethyl sulfoxide and compared with vehicle-only controls. No cell toxicity was observed for any treatment at the concentrations employed.

Reverse Transcriptase PCR and Quantitative Real-time PCR—Cells were harvested for total RNA using Tri Reagent according to the manufacturer's instructions. Concentrations of total RNA were measured by spectrophotometry (Nanodrop ND-100 Spectrophotometer, Biolab). Reverse transcriptase-PCR was performed according to the manufacturer's protocol for SuperScript III First Strand cDNA synthesis kit. Quantitative (real-time) reverse transcriptase-PCR (QRT-PCR) was performed using SensiMix dT on a Corbett Rotorgene 3000 and analyzed using Rotor-Gene 6 Version 6.0 (Build 27) (Corbett Research). Primer pairs used for the amplification of various genes from cDNAs were described previously (19, 38). Primer pairs for human/hamster OSC were: forward, ACCTATGAGACCAAGCGTGG; reverse, TCCAGGCCAAACCAGGTG. PCR products were verified by sequencing. Melting curve analysis was performed to confirm production of a single product in each reaction. The change in gene expression levels was determined by normalizing mRNA levels of the gene of interest to the mRNA level of the housekeeping gene, porphobilinogen deaminase (19).

Western Blotting—To measure OSC-Myc protein expression, total cell lysates were prepared as previously described (5). Briefly, cells in 6-well plates or 60-mm dishes were washed in phosphate-buffered saline, and the cell pellet was resuspended in 1% SDS or 10% SDS lysis buffer containing protease inhibitors. Cell pellets were lysed by passing through a syringe needle (22 gauge, 25 times) and vortexed for 20 min at room temperature. Protein concentrations were determined by the bicinchoninic acid method. Samples of equal protein were analyzed by SDS-PAGE (10% for SREBP-2, OSC-Myc, and β-actin). Protein was transferred onto nitrocellulose membrane and incubated with blocking solution (5% w/v nonfat milk, 0.1% v/v Tween 20 in phosphate-buffered saline; 1 h). SREBP-2 was probed first using IgG-7D4, a mouse monoclonal antibody against hamster SREBP-2 (amino acids 32–250 (39); prepared from a mouse hybridoma cell line), ATCC CRL2198, followed by stripping and reprobing for β-actin and, last, OSC-Myc. Antibodies were incubated with the membranes (4 °C, overnight). After washing, the membranes were incubated for 1 h with peroxidase-conjugated affinity-purified secondary antibodies (anti-mouse (IgG-7D4, Myc) or anti-rabbit (β-actin)). After further washing, bound antibodies were visualized by chemiluminescence and exposed to film at room temperature for 2 s to 1 min.

Cholesterol and 24(S),25-Epoxycholesterol Synthesis Assay—Cells were metabolically labeled with [1-14C]acetic acid for 24 h during treatments as previously described (15). For the acute cholesterol synthesis assay, cells were pretreated with compactin for 24 h, washed, and labeled with [1-14C]acetic acid for 2 h. Cells were harvested and saponified, and the neutral lipid extracts were separated by thin-layer chromatography. Bands corresponding to cholesterol and 24(S),25-epoxycholesterol were visualized by phosphorimaging (18-h exposure). Positive identification of the band corresponding to 24(S),25-epoxycholesterol has previously been performed chemically and by mass spectrometry (see the supplemental data in Wong et al. (15)).

Human ABCA1 Promoter Activity Assay—Promoter analysis was performed as previously described (19). Briefly, reporter plasmids (250 ng/well) were transfected for 24 h into cells using Lipofectamine 2000 (1 µl/well). The phRL-TK Renilla internal control plasmid (25 ng/well) was co-transfected for normalization of transfection efficiency. After treatment (24 h), cells were washed and resuspended in 100 µl of 1x passive lysis buffer. Luciferase assays were performed using the Dual Luciferase Assay Reporter System according to the manufacturer's instructions in a Veritas luminometer (Turner Designs). Results were normalized to the renilla control and expressed as percent changes in luciferase activity relative to the wild-type ABCA1 vehicle-treated control condition.

Cholesterol Mass Assay—Total cellular cholesterol mass was determined using an enzymatic fluorometric assay, employing the Amplex Red Cholesterol assay kit according to the manufacturer's instructions.

Data Analysis and Statistics—All results shown are representative of at least two separate experiments. Data are presented either as mean ± half-range or means ± S.E. unless otherwise stated. Where appropriate, statistical differences were determined by analysis of variance or Student t tests. A p value less than 0.05 (two-tailed) was considered statistically significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Screening and Selection of Stable Cell Lines Over-expressing Human OSC—The enzyme OSC is key to the activity of the shunt pathway that produces 24,25EC. We cloned the human OSC cDNA into a mammalian expression vector containing a C-terminal c-Myc epitope tag and stably transfected it into CHO-7 cells. Stable cell lines with empty vector (EV) or varying levels of OSC expression were created and screened alongside the wild-type CHO-7 cells. In Fig. 2A, a conserved set of primers was employed that detected both the human and hamster gene, showing that overexpression of human OSC was as much as 20-fold above endogenous levels. In all three OSC overexpressing cell lines, protein expression (Fig. 2B) reflected gene expression (Fig. 2A). Synthesis of 24,25EC was then examined, and in line with our prediction, 24,25EC was substantially decreased with increased OSC expression (by >95% in OSC3 cells) (Fig. 2C). No change was observed in cholesterol synthesis or cellular cholesterol mass in all cell lines (Fig. 2, C and D).

To confirm that overexpression of OSC specifically inhibited 24,25EC synthesis in the OSC-overexpressing cell lines, we treated the EV control cell line and the highest OSC-overexpressing cell line, OSC3, with a specific inhibitor of OSC, GW534511X. Similar to our previous observations in CHO cells (34), 0.1–1 nM GW534511X greatly enhanced 24,25EC synthesis in EV cells (Fig. 2E), in line with the scheme depicted in Fig. 1B. In OSC3 cells, a 100-fold higher concentration of inhibitor was required to force the synthesis of 24,25EC, reflecting the higher relative expression of OSC in these cells (Fig. 2A). This result clearly demonstrates that the reduced ability of OSC-overexpressing cells to synthesize 24,25EC was a direct consequence of their overexpression of OSC. The cell lines with the highest expression of OSC, OSC2 and particularly OSC3, together with the empty vector control cell line, EV, were selected for use in subsequent experiments.

ABCA1 Gene Expression Is Decreased in Cells Lacking the LXR Ligand 24,25EC—24,25EC is one of the most potent oxysterol ligands for LXR (15, 25), which regulates expression of a number of genes involved in cholesterol efflux, including ABCA1. When OSC is overexpressed, the decrease in 24,25EC synthesis led to a corresponding decrease in ABCA1 gene expression (Fig. 3A). This is consistent with our previous findings in human macrophages where statin treatment was reported to down-regulate ABCA1 expression by inhibiting the production of 24,25EC (15). When EV cells were treated with the archetypal statin, compactin, ABCA1 gene expression was greatly reduced to levels observed in OSC3 cells (Fig. 3B), consistent with inhibited synthesis of an LXR ligand produced in the mevalonate pathway.


Figure 2
View larger version (35K):
[in this window]
[in a new window]

  		FIGURE 2.
Screening and characterization of stable cell lines overexpressing human OSC. Data are presented for five cell lines: the CHO-7 parental cells, a control cell line containing the EV, and three cell lines expressing human OSC (designated OSC1, OSC2, OSC3). A, mRNA levels for human OSC were determined by QRT-PCR. Values are the mean + half-range presented relative to EV control cells and are averaged from n = 2 separate experiments (each performed in triplicate). B, for protein expression of human OSC-Myc, 20 µg of protein from whole cell lysates were separated by 10% SDS-PAGE and immunoblotted with anti-Myc antibody and β-actin antibody. This blot is representative of at least n = 3 separate experiments. C, cells were incubated with [1-14C]acetate for 24 h. Neutral lipid extracts (with equivalent cell protein levels) were separated by thin-layer chromatography, and bands corresponding to cholesterol (Chol) and 24,25EC were visualized by phosphorimaging. This phosphorimage is representative of at least n = 3 separate experiments. D, total cholesterol content of the cell lines are mean ± S.E. (n = 3 replicate cultures) representative of n = 2 separate experiments. E, EV and OSC3 cells were treated with the indicated concentrations of the OSC inhibitor, GW534511X, in the presence of [1-14C]acetate for 24 h. Neutral lipid extracts (with equivalent cell protein levels) were separated by thin-layer chromatography, and bands corresponding to cholesterol and 24,25EC were visualized by phosphorimaging.

 
When ABCA1 gene expression was examined over time after compactin pretreatment, we observed that ABCA1 mRNA levels increased in the EV control cells (Fig. 3C). In contrast, ABCA1 mRNA expression remained unchanged in OSC3 cells over the first 8 h but increased by 24 h. This suggests that other sterol ligands are insufficient to initially compensate for the lack of 24,25EC with respect to ABCA1 expression. Indeed, when increasing concentrations of 24,25EC were added to EV, OSC2, and OSC3 cell lines, ABCA1 gene expression was restored to control levels at 0.1 µM in the two cell lines lacking 24,25EC (Fig. 3D). All three cell lines responded similarly to higher concentrations of 24,25EC.

To confirm that this effect was mediated transcriptionally at the level of LXR activation, ABCA1 promoter activity was then analyzed by transfecting cells with a luciferase reporter construct driven by a ~1 kilobase fragment of the human ABCA1 promoter (from –928 to +101 bp) (40). OSC3 cells and compactin-treated EV cells both displayed reduced activity of the ABCA1 promoter to levels comparable to those seen when the DR4 motif (where LXR binds) was mutated (Fig. 3E). The decreased ABCA1 promoter activity of OSC3 cells was restored by the addition of 0.1 µM 24,25EC, an effect that was not apparent with the DR4-mutated construct. Taken together, these data indicate that the decrease in ABCA1 expression in OSC3 cells is principally due to the loss of 24,25EC and confirms the importance of this endogenously produced LXR ligand in LXR target gene expression, notably ABCA1.

Inhibition of 24,25EC Synthesis Leads to an Increase in Acute Cholesterol Synthesis—We have proposed that 24,25EC functions as a feedback regulator to protect all cholesterogenic cells against the accumulation of newly synthesized cholesterol (34). Because little difference was observed between the relative synthesis of cholesterol in EV and OSC3 cells over an extended (24-h) period (Fig. 2C), we then examined what effect the loss of 24,25EC had on acute cholesterol synthesis. To investigate this, de novo cholesterol synthesis was stimulated by pretreatment with compactin. The inhibitory effect of compactin on cholesterol synthesis leads to a compensatory increase in expression of several key cholesterol biosynthetic enzymes, including HMG-CoA reductase, which are regulated by SREBP-2 (41, 42). Hence, removal of compactin results in a concentration-dependent surge in cholesterol synthesis (34), which can then be monitored by acute (2-h) metabolic labeling with [14C]acetate. Using this approach, OSC3 cells, lacking 24,25EC, showed an approximate doubling in acute cholesterol synthesis for all statin pretreatment concentrations when compared with EV cells (Fig. 4, A and B). Next, we followed the feedback inhibition of cholesterol synthesis over time, subsequent to compactin pretreatment (5 µM). EV and OSC3 cells showed comparable rates of decrease over time (Fig. 4C), although the initial increase in relative cholesterol synthesis in OSC3 cells after 2 h of statin pretreatment was maintained for the first 8 h.

As mentioned, relative cholesterol synthesis over an extended (24-h) period was similar between OSC3 and EV cells (Figs. 2C and 4D). The addition of 24,25EC decreased cholesterol synthesis in both cell types. However, the response was less pronounced in the OSC3 cells (Fig. 4D), probably reflecting their much lower starting content of 24,25EC.


Figure 3
View larger version (35K):
[in this window]
[in a new window]

  		FIGURE 3.
ABCA1 gene expression is decreased in cells lacking the LXR ligand 24,25EC. For A–D, ABCA1 mRNA levels were determined by QRT-PCR. A, EV, OSC2, and OSC3 cell lines were cultured under standard conditions (see "Experimental Procedures"). B, EV and OSC3 cells were incubated in the absence or presence of compactin (5 µM). C, EV and OSC3 cells were preincubated with compactin (5 µM) for 24 h, which was then removed, and media without compactin was added. Cells were harvested at the time points indicated. D, EV, OSC2, and OSC3 cells were incubated in the indicated concentrations of 24,25EC for 24 h. E, EV and OSC3 cells were transiently transfected for 24 h with phRL-TK Renilla internal control plasmid together with either pGL3-hABCA1 wild-type (wt) or DR4 mutant (mut). After transfection, cells were incubated for 24 h in the absence or presence of compactin (5 µM) or 24,25EC (0.1 µM). For A and B, values are presented as the mean ± S.E. relative to the EV vehicle-treated control condition and are averaged from n = 3 separate experiments (each performed in triplicate). For C, values are the mean ± S.E. (n = 3 replicate cultures) relative to EV cells incubated without compactin and are representative of n = 2 separate experiments (each performed in triplicate). For D, values are mean the ± S.E. relative to the EV vehicle-treated control condition from n = 3 replicate cultures. For E, values are presented as the percentage change relative to the pGL3-hABCA1 wild-type construct of the EV vehicle-treated control condition and are the mean ± S.E. averaged from n = 3 separate experiments (each performed in triplicate). *, ABCA1 gene expression was significantly lower for the OSC2 or OSC3 cells relative to the EV control cells (p < 0.01 by paired t tests for A and B, by two-way analysis of variance for C, and by two-sample t tests for D).

 
These results show that in the absence of 24,25EC, acute feedback regulation of cholesterol synthesis was blunted. Although relative cholesterol synthesis was normal over an extended 24-h period, the lag in feedback regulation after statin pretreatment suggests that 24,25EC is important for regulating acute changes in cholesterol synthesis.

Lack of 24,25EC Synthesis Perturbs Acute Regulation of HMG-CoA Reductase mRNA Expression as Levels of Mature SREBP-2 Increase Acutely—Added 24,25EC has been shown to inhibit cholesterol synthesis by decreasing HMG-CoA reductase activity (11, 17, 43). We determined if the acute increase in cholesterol synthesis in OSC3 cells was the result of increased HMG-CoA reductase gene expression. Basal levels were similar between EV and OSC3 cells, as were the increases in HMG-CoA reductase gene expression levels observed after statin pretreatment (0 h) (Fig. 5A). However, 2 h after removing the statin, HMG-CoA reductase mRNA expression increased significantly, by ~40% in the OSC3 cells relative to the EV cells (Fig. 5B). Whereas EV cells displayed a smooth and gradual decrease over time, OSC3 cells showed after the initial increase an abrupt fall in HMG-CoA reductase mRNA levels up to 8 h and subsequent rebounding of levels by 24 h (Fig. 5C). These results show that with loss of 24,25EC, acute regulation of HMG-CoA reductase gene expression is erratic and suggests that the fine-tuned control of HMG-CoA reductase gene regulation is perturbed.

The transcription factor SREBP-2 is the primary regulator of HMG-CoA reductase gene expression (41, 42). SREBP-2 is synthesized as an inactive precursor that requires proteolytic release of the active N-terminal (mature) transcription factor (44). In both cell types, SREBP-2 processing as assessed by Western blotting was stimulated by compactin treatment and suppressed by the addition of 24,25EC (Fig. 6A). To determine whether the acute increase in HMG-CoA reductase mRNA levels in OSC3 cells (Fig. 5B) was the result of increased SREBP-2 activation, SREBP-2 processing was measured under the same experimental conditions in which the increased HMG-CoA reductase mRNA expression was observed. Processing of SREBP-2 to the mature form was similar for both EV and OSC3 cells after compactin pretreatment (0 h) (Fig. 6, B and C). However, after removal of the statin, a significant increase in the mature form of SREBP-2 was detected in OSC3 cells over 2 h when compared with EV cells (Fig. 6, B and C). This difference in acute processing between EV and OSC3 cells was observed in four separate experiments.


Figure 4
View larger version (47K):
[in this window]
[in a new window]

  		FIGURE 4.
Inhibition of 24,25EC synthesis leads to an increase in acute cholesterol (Chol) synthesis. A and B, EV and OSC3 cells were preincubated with the indicated concentrations of compactin for 24 h, which was then removed. A, cells were then incubated for 2 h in the presence of [1-14C]acetate in media without compactin and harvested. C, EV and OSC3 cells were preincubated with 5 µM compactin for 24 h, which was then removed. Cells were then incubated in the presence of [1-14C]acetate in media without compactin and harvested at the indicated time points. D, EV and OSC3 cells were incubated in the indicated concentrations of 24,25EC in the presence of [1-14C]acetate for 24 h. Neutral lipid extracts (with equivalent cell protein levels) were separated by thin-layer chromatography, and bands corresponding to authentic cholesterol and 24,25EC were visualized by phosphorimaging and quantified by densitometry. For A, the phosphorimages shown for EV and OSC3 cells were run on the same TLC plate and exposed for the same duration and are representative of n = 3 separate experiments. With acute labeling, the band attributed to cholesterol sometimes appears as a double band with the lower band corresponding to a cholesterol biosynthetic precursor, probably zymosterol (on the basis of co-chromatography standards). For B–D, values are the mean ± S.E. presented relative to the EV vehicle-treated control condition and for each panel are averaged from n = 3 separate experiments. *, the OSC3 cells synthesized significantly more cholesterol by concentration (B and D) or time (C) than the EV control cells (p < 0.005 by two-way analysis of variance).

 
When combined, our results suggest that with the loss of 24,25EC, acute suppression of SREBP-2 processing does not occur. In fact, levels of mature SREBP-2 increased, and as a consequence, SREBP target genes such as HMG-CoA reductase are acutely up-regulated. Therefore, acute feedback regulation of cholesterol synthesis is perturbed without 24,25EC.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
We previously proposed that 24,25EC functions as a safety valve to protect the cell against the accumulation of newly synthesized cholesterol, since 24,25EC is produced in parallel with cholesterol, and syntheses of both sterols are subject to feedback regulation in response to added cholesterol (34). In the current study, we tested this hypothesis using a novel approach of overexpressing OSC to selectively inhibit 24,25EC synthesis. Our current work shows that endogenous 24,25EC has an important role in the acute modulation of cholesterol synthesis. Interestingly, no difference was observed in basal levels of cholesterol synthesis or mass between EV cells and OSC3 cells despite the lack of 24,25EC synthesis (Fig. 2, C and D). However, under stimulated conditions where a burst of cholesterol synthesis was induced by statin pretreatment, OSC3 cells showed an approximate doubling in cholesterol synthesis compared with EV cells (Fig. 4, A and B). Although the subsequent rate of decrease in cholesterol synthesis was the same for both OSC3 and EV cells, the initial increase in cholesterol biosynthetic activity of OSC3 cells persisted for at least 8 h (Fig. 4C). Considering that the difference in cholesterol biosynthesis was observed at the earliest time point after statin pretreatment, our data indicates that 24,25EC is important for acute feedback regulation of cholesterol synthesis. Our findings substantiate previous proposals that 24,25EC serves as a feedback regulator of hepatic cholesterol synthesis (28, 45) and helps to generalize it to all cholesterogenic cells.


Figure 5
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 5.
Inhibition of 24,25EC synthesis blunts acute regulation of HMG-CoA reductase mRNA expression. For A, EV and OSC3 cells were incubated in the absence or presence of compactin (5 µM) for 24 h. B and C, EV and OSC3 cells were preincubated with compactin (5 µM) for 24 h followed by media without compactin. Cells were harvested at the time points indicated. mRNA levels for HMG-CoA reductase were determined by QRT-PCR. For A, values are the mean ± S.E. presented relative to the EV vehicle-treated control condition and are averaged from n = 3 separate experiments (each performed in triplicate). For B, values are the means ± S.E. presented relative to the EV cells at time 0 h and are averaged from n = 4 separate experiments (each performed in triplicate). For C, values are the mean ± S.E. (n = 3 replicate cultures) presented relative to the EV cells at time 0 h and are representative of n = 2 separate experiments. *, OSC3 cells were significantly different from EV control cells (p < 0.001 by paired t test for B; p < 0.005 by two-sample t tests for C).

 
In terms of mechanism, loss of 24,25EC appears to stimulate acute cholesterol synthesis at the level of SREBP-2 processing. Analysis of HMG-CoA reductase gene expression and SREBP-2 processing revealed that acute feedback regulation of these processes was lost in OSC-overexpressing cells (Figs. 5B and 6C). Thus, a relative increase in the levels of mature SREBP-2 could account for the increase observed in the expression of the SREBP-2 target gene, HMG-CoA reductase, the rate-limiting enzyme in cholesterol biosynthesis.


Figure 6
View larger version (47K):
[in this window]
[in a new window]

  		FIGURE 6.
Inhibition of 24,25EC synthesis leads to a loss of acute suppression of SREBP-2 processing. A, EV and OSC3 cells were incubated in the absence or presence of compactin (5 µM) or 24,25EC (4 µM) for 24 h. B, EV and OSC3 cells were preincubated with compactin (5 µM) for 24 h followed by media without compactin. Cells were harvested at the indicated time points. 50 µg of protein from whole cell lysates were separated by 10% SDS-PAGE and immunoblotted with anti-Myc antibody, β-actin antibody, and IgG-7D4 directed against the N-terminal portion of hamster SREBP-2. The blots are representative of n = 2 separate experiments (A) and n = 4 separate experiments (B). C, the mature SREBP-2 bands, as indicated in B, were combined, quantified by densitometry, and normalized relative to the β-actin band for each sample. Values are the mean ± S.E. and are averaged from n = 4 separate experiments; *, OSC3 cells exhibited significantly increased levels of mature SREBP-2 over time relative to the EV control cells (p < 0.001 by two-way analysis of variance).

 
It was recently shown that the suppressive effect of oxysterols (including 24,25EC) on SREBP processing was mediated by direct binding to the ER retention protein Insig (20). By contrast, cholesterol is sensed by SCAP in the ER (4–6). Binding of oxysterols to Insig or cholesterol to SCAP causes Insig to retain the SCAP-SREBP complex in the ER, thereby inhibiting SREBP processing. Loss of endogenous 24,25EC leads to impaired feedback of SREBP-2 processing acutely (Fig. 6, B and C) despite the increase in cholesterol synthesis (Fig. 4, A and B). In light of our findings and those of Radhakrishnan et al. (20), we propose that 24,25EC, produced parallel to cholesterol in the mevalonate pathway, may represent an early warning system for newly synthesized cholesterol. 24,25EC allows retention of the SCAP-SREBP complex by Insig in the ER before newly synthesized cholesterol accumulates to sufficient levels to be sensed by SCAP. In contrast to other oxysterols such as 27-hydroxycholesterol, which is synthesized in the mitochondria by CYP27A1, the ER localization of the mevalonate pathway (including HMG-CoA reductase) responsible for 24,25EC synthesis could enable 24,25EC to rapidly inhibit cholesterol synthesis by promoting the retention of the SCAP-SREBP complex. This would, thus, limit accumulation of potentially cytotoxic levels of free cholesterol in the ER (46).

Another way by which 24,25EC could potentially affect acute cholesterol synthesis is by post-translational regulation of HMG-CoA reductase. Indeed, Song and DeBose-Boyd (18) have shown that 24,25EC accelerates HMG-CoA reductase degradation when added to cells. Therefore, it is likely that the increase in cholesterol synthesis observed in cells lacking 24,25EC is due to a combination of increased gene expression and decreased protein degradation of HMG-CoA reductase.

Our results indicate that endogenously produced 24,25EC acts at multiple points in facilitating the control of cholesterol homeostasis. In addition to its effects on acute cholesterol synthesis, it is also likely to stimulate cholesterol efflux by serving as a ligand for LXR. Indeed, selective inhibition of 24,25EC synthesis was associated with reduced expression and transcriptional activity of the LXR target gene, ABCA1 (Fig. 3). This result provides the best evidence to date for previous assertions that 24,25EC is an important natural LXR ligand based on in vitro addition studies (12, 25). Moreover, this work further substantiates our previous studies indicating that statins down-regulate ABCA1 expression by inhibiting synthesis of 24,25EC (15, 47). Considering that loss of 24,25EC increased SREBP-2 processing, it is likely that 24,25EC affects a multitude of SREBP target genes. For example, we found that gene expression of the low density lipoprotein receptor increased acutely after removal of statin,6 similar to HMG-CoA reductase (Fig. 5B), suggesting that 24,25EC probably also reduces receptor-mediated cholesterol influx into the cell.

Further studies are needed to determine precisely how loss of 24,25EC will affect cellular cholesterol homeostasis in vivo. Chen et al. (26) recently showed that certain oxysterols are important ligands for LXR in vivo. They reported that overexpression of a mouse oxysterol-catabolizing enzyme, SULT2B1b, or a triple knock-out of 24-, 25-, and 27-hydroxylase in mice leads to impaired LXR-mediated effects in response to dietary cholesterol, whereas stimulation with the non-sterol LXR agonist TO901317 showed regular increases. Considering the unique nature of 24,25EC synthesis, overexpressing OSC to selectively inhibit its synthesis is a promising approach to study the importance of this potent oxysterol in vivo.

In conclusion, this is the first study to investigate the role of endogenous 24,25EC by selectively inhibiting its synthesis in cells. 24,25EC, as with many oxysterols derived from cholesterol, acts at multiple points in cholesterol homeostasis. However, our work indicates that 24,25EC has a special role in protecting the cell against the accumulation of newly synthesized cholesterol. Thus, we propose that endogenously produced 24,25EC protects against surges in cholesterol synthesis by smoothing the cholesterol homeostatic responses during acute feedback regulation. In the absence of 24,25EC, the controls which fine-tune this acute feedback regulation are lost, and these responses tend to be more exaggerated and erratic, which may be deleterious to the cell.


   FOOTNOTES
 
* This work was supported in part by National Health and Medical Research Council Grant NHMRC 350828. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Supported by an Australian postgraduate award. Back

2 Supported by National Health and Medical Research Council Atherosclerosis Program 222722. Back

3 Supported by a University of New South Wales Vice-Chancellor's postdoctoral fellowship. Back

4 To whom correspondence should be addressed: School of Biotechnology and Biomolecular Sciences, Biosciences Bldg. D26, University of New South Wales, Sydney, 2052, Australia. Tel.: 61-2-9385-2005; Fax: 61-2-9385-1483; E-mail: aj.brown{at}unsw.edu.au.

5 The abbreviations used are: 24,25EC, 24(S),25-epoxycholesterol; ABCA1, ATP binding cassette transporter A1; DOS, 2,3(S):22(S),23-dioxidosqualene; EV, empty vector; HMG-CoA, 3-hydroxy-3-methylglutaryl coenzyme A; LXR, liver X receptor; MOS, 2,3(S)-monooxidosqualene; OSC, 2,3-oxidosqualene cyclase; SREBP, sterol regulatory element-binding protein; SCAP, SREBP cleavage-activating protein; QRT, quantitative (real-time) reverse transcriptase; ER, endoplasmic reticulum; CHO, Chinese hamster ovary. Back

6 J. Wong and A. J. Brown, unpublished data. Back


   ACKNOWLEDGMENTS
 
We thank several researchers for sharing their valuable tools: Drs. Michael S. Brown and Joseph L. Goldstein for the CHO-7 cell line and Dr. Alan Tall for the pGL3-hABCA1 wild-type plasmid. We are also grateful to Dr. Lijuan Xie for preparing the IgG-7D4 anti-SREBP-2 antibody from the hybridoma cell line.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kandutsch, A. A., Chen, H. W., and Heiniger, H. J. (1978) Science 201, 498–501[Abstract/Free Full Text]
  2. Schroepfer, G. J., Jr. (2000) Physiol. Rev. 80, 361–554[Abstract/Free Full Text]
  3. Bjorkhem, I. (2002) J. Clin. Investig. 110, 725–730[CrossRef][Medline] [Order article via Infotrieve]
  4. Brown, A. J., Sun, L., Feramisco, J. D., Brown, M. S., and Goldstein, J. L. (2002) Mol. Cell 10, 237–245[CrossRef][Medline] [Order article via Infotrieve]
  5. Adams, C. M., Reitz, J., De Brabander, J. K., Feramisco, J. D., Li, L., Brown, M. S., and Goldstein, J. L. (2004) J. Biol. Chem. 279, 52772–52780[Abstract/Free Full Text]
  6. Radhakrishnan, A., Sun, L. P., Kwon, H. J., Brown, M. S., and Goldstein, J. L. (2004) Mol. Cell 15, 259–268[CrossRef][Medline] [Order article via Infotrieve]
  7. Song, B. L., Javitt, N. B., and DeBose-Boyd, R. A. (2005) Cell Metab 1, 179–189[CrossRef][Medline] [Order article via Infotrieve]
  8. Nguyen, A. D., McDonald, J. G., Bruick, R. K., and Debose-Boyd, R. A. (2007) J. Biol. Chem. 282, 27436–27446[Abstract/Free Full Text]
  9. Yang, C., McDonald, J. G., Patel, A., Zhang, Y., Umetani, M., Xu, F., Westover, E. J., Covey, D. F., Mangelsdorf, D. J., Cohen, J. C., and Hobbs, H. H. (2006) J. Biol. Chem. 281, 27816–27826[Abstract/Free Full Text]
  10. Saucier, S. E., Kandutsch, A. A., Taylor, F. R., Spencer, T. A., Phirwa, S., and Gayen, A. K. (1985) J. Biol. Chem. 260, 14571–14579[Abstract/Free Full Text]
  11. Taylor, F. R., Kandutsch, A. A., Gayen, A. K., Nelson, J. A., Nelson, S. S., Phirwa, S., and Spencer, T. A. (1986) J. Biol. Chem. 261, 15039–15044[Abstract/Free Full Text]
  12. Lehmann, J. M., Kliewer, S. A., Moore, L. B., Smith-Oliver, T. A., Oliver, B. B., Su, J. L., Sundseth, S. S., Winegar, D. A., Blanchard, D. E., Spencer, T. A., and Willson, T. M. (1997) J. Biol. Chem. 272, 3137–3140[Abstract/Free Full Text]
  13. Janowski, B. A., Shan, B., and Russell, D. W. (2001) J. Biol. Chem. 276, 45408–45416[Abstract/Free Full Text]
  14. Bjorkhem, I., and Diczfalusy, U. (2004) Arterioscler. Thromb. Vasc. Biol. 24, 2209–2210[Free Full Text]
  15. Wong, J., Quinn, C. M., and Brown, A. J. (2004) Arterioscler. Thromb. Vasc. Biol. 24, 2365–2371[Abstract/Free Full Text]
  16. Telford, D. E., Lipson, S. M., Barrett, P. H., Sutherland, B. G., Edwards, J. Y., Aebi, J. D., Dehmlow, H., Morand, O. H., and Huff, M. W. (2005) Arterioscler. Thromb. Vasc. Biol. 25, 2608–2614[Abstract/Free Full Text]
  17. Dollis, D., and Schuber, F. (1994) Biochem. Pharmacol. 48, 49–57[CrossRef][Medline] [Order article via Infotrieve]
  18. Song, B. L., and DeBose-Boyd, R. A. (2004) J. Biol. Chem. 279, 28798–28806[Abstract/Free Full Text]
  19. Wong, J., Quinn, C. M., and Brown, A. J. (2006) Biochem. J. 400, 485–491[CrossRef][Medline] [Order article via Infotrieve]
  20. Radhakrishnan, A., Ikeda, Y., Kwon, H. J., Brown, M. S., and Goldstein, J. L. (2007) Proc. Natl. Acad. Sci. U. S. A. 104, 6511–6518[Abstract/Free Full Text]
  21. Zelcer, N., and Tontonoz, P. (2006) J. Clin. Investig. 116, 607–614[CrossRef][Medline] [Order article via Infotrieve]
  22. Schmitz, G., and Langmann, T. (2005) Biochim. Biophys. Acta 1735, 1–19[Medline] [Order article via Infotrieve]
  23. Soumian, S., Albrecht, C., Davies, A. H., and Gibbs, R. G. (2005) Vasc. Med. 10, 109–119[Abstract/Free Full Text]
  24. Ory, D. S. (2004) Circ.. Res. 95, 660–670[Abstract/Free Full Text]
  25. Janowski, B. A., Grogan, M. J., Jones, S. A., Wisely, G. B., Kliewer, S. A., Corey, E. J., and Mangelsdorf, D. J. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 266–271[Abstract/Free Full Text]
  26. Chen, W., Chen, G., Head, D. L., Mangelsdorf, D. J., and Russell, D. W. (2007) Cell Metab. 5, 73–79[CrossRef][Medline] [Order article via Infotrieve]
  27. Boutaud, O., Dolis, D., and Schuber, F. (1992) Biochem. Biophys. Res. Commun. 188, 898–904[CrossRef][Medline] [Order article via Infotrieve]
  28. Mark, M., Muller, P., Maier, R., and Eisele, B. (1996) J. Lipid Res. 37, 148–158[Abstract]
  29. Eisele, B., Budzinski, R., Muller, P., Maier, R., and Mark, M. (1997) J. Lipid Res. 38, 564–575[Abstract]
  30. Morand, O. H., Aebi, J. D., Dehmlow, H., Ji, Y. H., Gains, N., Lengsfeld, H., and Himber, J. (1997) J. Lipid Res. 38, 373–390[Abstract]
  31. Bloch, K. (1965) Science 150, 19–28[Free Full Text]
  32. Nelson, J. A., Steckbeck, S. R., and Spencer, T. A. (1981) J. Biol. Chem. 256, 1067–1068[Abstract/Free Full Text]
  33. Panini, S. R., Sexton, R. C., Gupta, A. K., Parish, E. J., Chitrakorn, S., and Rudney, H. (1986) J. Lipid Res. 27, 1190–1204[Abstract]
  34. Wong, J., Quinn, C. M., and Brown, A. J. (2007) Lipids Health Dis. 6, e10[CrossRef]
  35. Rowe, A. H., Argmann, C. A., Edwards, J. Y., Sawyez, C. G., Morand, O. H., Hegele, R. A., and Huff, M. W. (2003) Circ. Res. 93, 717–725[Abstract/Free Full Text]
  36. Beyea, M. M., Heslop, C. L., Sawyez, C. G., Edwards, J. Y., Markle, J. G., Hegele, R. A., and Huff, M. W. (2007) J. Biol. Chem. 282, 5207–5216[Abstract/Free Full Text]
  37. Goldstein, J. L., Basu, S. K., and Brown, M. S. (1983) Methods Enzymol. 98, 241–260[Medline] [Order article via Infotrieve]
  38. Kielar, D., Dietmaier, W., Langmann, T., Aslanidis, C., Probst, M., Naruszewicz, M., and Schmitz, G. (2001) Clin. Chem. 47, 2089–2097[Abstract/Free Full Text]
  39. Yang, J., Sato, R., Goldstein, J. L., and Brown, M. S. (1994) Genes Dev. 8, 1910–1919[Abstract/Free Full Text]
  40. Costet, P., Luo, Y., Wang, N., and Tall, A. R. (2000) J. Biol. Chem. 275, 28240–28245[Abstract/Free Full Text]
  41. Horton, J. D., Shimomura, I., Brown, M. S., Hammer, R. E., Goldstein, J. L., and Shimano, H. (1998) J. Clin. Investig. 101, 2331–2339[Medline] [Order article via Infotrieve]
  42. Horton, J. D., Shah, N. A., Warrington, J. A., Anderson, N. N., Park, S. W., Brown, M. S., and Goldstein, J. L. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 12027–12032[Abstract/Free Full Text]
  43. Saucier, S. E., Kandutsch, A. A., Gayen, A. K., Swahn, D. K., and Spencer, T. A. (1989) J. Biol. Chem. 264, 6863–6869[Abstract/Free Full Text]
  44. Goldstein, J. L., DeBose-Boyd, R. A., and Brown, M. S. (2006) Cell 124, 35–46[CrossRef][Medline] [Order article via Infotrieve]
  45. Spencer, T. A., Gayen, A. K., Phirwa, S., Nelson, J. A., Taylor, F. R., Kandutsch, A. A., and Erickson, S. K. (1985) J. Biol. Chem. 260, 13391–13394[Abstract/Free Full Text]
  46. Feng, B., Yao, P. M., Li, Y., Devlin, C. M., Zhang, D., Harding, H. P., Sweeney, M., Rong, J. X., Kuriakose, G., Fisher, E. A., Marks, A. R., Ron, D., and Tabas, I. (2003) Nat. Cell Biol. 5, 781–792[CrossRef][Medline] [Order article via Infotrieve]
  47. Wong, J., Quinn, C. M., Gelissen, I. C., Jessup, W., and Brown, A. J. (2007) Atherosclerosis, in press

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
H. Dang, Y. Liu, W. Pang, C. Li, N. Wang, J. Y.-J. Shyy, and Y. Zhu
Suppression of 2,3-Oxidosqualene Cyclase by High Fat Diet Contributes to Liver X Receptor-{alpha}-mediated Improvement of Hepatic Lipid Profile
J. Biol. Chem., March 6, 2009; 284(10): 6218 - 6226.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Wang, P. M. Rogers, C. Su, G. Varga, K. R. Stayrook, and T. P. Burris
Regulation of Cholesterologenesis by the Oxysterol Receptor, LXR{alpha}
J. Biol. Chem., September 26, 2008; 283(39): 26332 - 26339.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/2/700    most recent
M706416200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wong, J.
Right arrow Articles by Brown, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wong, J.
Right arrow Articles by Brown, A. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2008 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement