Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M802133200 on April 29, 2008

J. Biol. Chem., Vol. 283, Issue 26, 18024-18031, June 27, 2008
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
283/26/18024    most recent
M802133200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DuBois, K. N.
Right arrow Articles by Sajid, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DuBois, K. N.
Right arrow Articles by Sajid, M.
Related Collections
Right arrow Related Webpages
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

F1000 image F1000 Biology *Must Read* - FREE!

Identification of the Major Cysteine Protease of Giardia and Its Role in Encystation*Formula

Kelly N. DuBois{ddagger}§1, Marla Abodeely{ddagger}§, Judy Sakanari{ddagger}, Charles S. Craik, Malinda Lee{ddagger}, James H. McKerrow{ddagger}, and Mohammed Sajid{ddagger}2

From the {ddagger}Department of Pathology, the Sandler Center for Basic Research in Parasitic Diseases, the §Biomedical Sciences Graduate Program, and the Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94158

Received for publication, March 18, 2008 , and in revised form, April 18, 2008.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Giardia lamblia is a protozoan parasite and the earliest branching clade of eukaryota. The Giardia life cycle alternates between an asexually replicating vegetative form and an infectious cyst form. Encystation and excystation are crucial processes for the survival and transmission of Giardia. Cysteine proteases in Giardia have been implicated in proteolytic processing events that enable the continuance of the life cycle throughout encystation and excystation. Using quantitative real-time PCR, the expression of twenty-seven clan CA cysteine protease genes in the Giardia genome was measured during both vegetative growth and encystation. Giardia cysteine protease 2 was the most highly expressed cysteine protease during both life cycle stages measured, with a dramatic expression increase during encystation. The mRNA transcript for Giardia cysteine protease 2 was 7-fold up-regulated during encystation and was greater than 3-fold higher than any other Giardia protease gene product. Recombinant Giardia cysteine protease 2 was expressed, purified, and biochemically characterized. The activity of the recombinant cysteine protease 2 protein was confirmed to be identical to the dominant cysteine protease activity found in G. lamblia lysates. Giardia cysteine protease 2 was co-localized with cyst wall protein in encystation-specific vesicles during encystation and processed cyst wall protein 2 to the size found in Giardia cyst walls. These data suggest that Giardia cysteine protease 2 is not only the major cysteine endoprotease expressed in Giardia, but is also central to the encystation process.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Giardia lamblia is a protozoan parasite that inhabits the upper small intestine of many vertebrate hosts and is the most commonly isolated intestinal parasite world wide (1). In addition to its medical importance, Giardia is of interest as a model cell system because it represents the most early branching clade of eukaryota (2, 3). Giardia has a simple two-stage life cycle consisting of a vegetative replicating trophozoite and an infectious cyst. Infection is initiated with cyst ingestion by a vertebrate host. After passage through the acidic host stomach, vegetative trophozoites emerge from the cyst by the process of excystation, asexually divide by binary fission, establish the duodenal infection, and give rise to the characteristic symptoms of giardiasis. Trophozoites can form infective cysts that are passed in the host feces and ingested by another host to propagate the life cycle (1).

The process of encystation is a coordinated secretion of cyst wall materials to the periphery of a cell to form the cyst wall (4, 5). In response to environmental cues, trophozoites produce abundant cyst wall proteins that are packaged into encystation-specific vesicles (ESVs).3 These vesicles grow, mature, and eventually traffic to the plasma membrane of the trophozoite, where cyst wall precursor material is secreted to form the environmentally stable cyst wall (4, 6, 7). The expression of many proteins is up-regulated during the encystation process (4).

Cysteine proteases have been found to be essential to the life cycles of several parasitic organisms, catalyzing diverse processes such as parasite immunevasion, tissue invasion, and encystment/excystment in addition to well established roles in protein processing and catabolism (8, 9). Indeed, in G. lamblia (10) indispensable roles for cysteine proteases have been documented in the processes of encystation and excystation. Ward et al. (10) validated a role for cysteine endoprotease activity in the excystation process by demonstrating that excystation was inhibited by the addition of small molecule cysteine protease inhibitors to the excystation media. Touz et al. (11) implicated a cysteine exoprotease in the process of encystation. Processing of cyst wall protein 2 (CWP2), one of the main cyst wall proteins that form the structure of the cyst wall, was also blocked by cysteine protease inhibitors.

Whereas the role of these chemical knock-out experiments focused attention on clan CA cysteine proteases in Giardia, the recent completion of the Giardia genome indicated that there are twenty-seven candidate clan CA cysteine protease genes in Giardia. To address the question of which gene product(s) was responsible for key events in the life cycle, such as cyst wall processing, we analyzed the transcription levels of all twenty-seven genes and found that G. lamblia cysteine protease 2 (GlCP2) was in fact the major expressed cysteine protease gene in Giardia. We therefore cloned, heterologously expressed, and biochemically characterized this protease, and specifically evaluated its role in encystation.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture, Transfection, and Differentiation—WB isolated G. lamblia trophozoites (ATCC number 30957) were maintained in a modified TYI-S-33 medium supplemented with 10% fetal bovine serum (Omega Scientific, Inc.), penicillin-streptomycin (UCSF CCF), vitamins (Invitrogen), and Fungizone (UCSF CCF). The pGFP.pac vector (gift from Theodore Nash, National Institutes of Health; modified by Lei Li from the C. C. Wang laboratory, UCSF) was used to episomally express C-terminal GFP fusion proteins in Giardia. The transfection protocol used by Singer et al. (12) was followed with modifications: 1–2 x 106 trophozoites were electroporated with 50 µg of plasmid DNA (GenePulser XCell, Bio-Rad) at 0.45 kV, 950 µF. Transfectants were selected with puromycin dihydrochloride (Sigma) and increased in 5–20 µg/ml increments to a final concentration of 80–120 µg/ml. Trophozoites were induced to encyst as indicated by Abel et al. (13).

Transformation and Expression of GlCP2 in Pichia pastoris—The GlCP2 gene was re-synthesized to optimize for yeast codon usage (DNA 2.0). The rGlCP2 gene was amplified by PCR from the pJ31:7972 vector into which the full-length cDNA had previously been cloned and modified to include a polyhistidine tag using the forward primer GlCP2pPicF: CTCGAGAAAAGACATCATCATCATCATCATGAGTTGAATCATATTACTC and the reverse primer GlCP2pPicR: TCTAGATTACTCATCGAAAAATCCAGCATAGGCC. The 920-bp amplicon was subcloned in the XhoI/XbaI site of the P. pastoris expression vector pPicZ{alpha}B (Invitrogen). The plasmid was linearized by digestion with SalI and introduced into P. pastoris by electroporation (GenePulser XCell, Bio-Rad) according to the manufacturer's specifications. Transformants were screened by growth on YPD+100 µg/ml zeocin (Invitrogen).

Purification of rGlCP2—P. pastoris was grown under expression induction conditions in a BioFlo 110 Fermentor/Bioreactor (New Brunswick Scientific) for 3 days according to the manufacturer's specifications. Methanol was maintained at 0.5% (calculated by a methanol sensor) by addition of 100% methanol 2x/day. 0.2-µm filtered supernatant was lyophilized. 8 g of lyophilized material was resuspended in 40 ml of ddH2O + 1 mM Pefabloc (Sigma). Solution was filtered at 0.2 µm, dialyzed in 10,000 MWC dialysis tubing (Pierce) against 10 mM Tris-HCl, pH 8.0 at 4 °C, and fractionated by ion exchange chromatography with Fast Flow Q resin (GE Healthcare) followed by dialysis to desalt and a Mono Q anion exchange column (GE Healthcare).

Purification of Cysteine Protease Activity from G. lamblia Lysates—Giardia cells were incubated in a 20 mM Tris-HCl, pH 7.2 and 0.2% Triton X-100 (Sigma-Aldrich) buffer at 4 °C with stirring for 2 h. Debris was pelleted, and supernatant was 0.2-µm filtered and subjected to anion exchange chromatography using a Mono Q column.

Expression and Purification of CWP2—The open-reading frame for CWP2 was amplified from genomic DNA, and a C-terminal polyhistidine tag was added using the primers CWP2pMalF: TCTAGAATGGCTTGCCCTGCCACCGAGG and CWP2pMalR: GCGGCCGCTTTAATGATGATGATGATGATGCCTTCCCTGGATCCTTCTGCGGACAATAG and inserted into the NotI/XbaI site of the expression vector pCMVTnT (Promega). 1 µg of plasmid DNA was used as a template for in vitro transcription using the TNT Quick-coupled Transcription/Translation kit according to the manufacturer's specifications (Promega). [35S]rCWP2 was further purified on a nickel-nitrilotriacetic acid column (Qiagen).

Protease Activity Assays—40 µM of the fluorogenic substrates Z-FR-AMC (N-carbobenzoxy-phenylalanyl-arginyl-7-amido-4-methylcoumarin) and Z-RR-AMC (N-carbobenzoxy-arginyl-arginyl-7-amido-4-methylcoumarin; excitation/emission of AMC: 360 nm/470 nm) (Bachem) were incubated with Giardia lysates or recombinant enzyme in Tris-HCl buffer (pH 7.2) or citrate/dibasic sodium phosphate buffers (pH 4.0–8.0) containing 4 mM DTT, 1 mM Pefabloc, and 10 mM EDTA. Subsequent protease activity was measured by monitoring the increase in relative fluorescence units (RFU) over time.

rGlCP2 was incubated for 30 min with 50 µg of casein-resorufin (Molecular Probes) in 200 µl of citrate/dibasic sodium phosphate buffers. 960 µl of 5% (w/v) trichloroacetic acid was added, samples were incubated 10 min, and centrifuged. 400 µl of supernatant were added to 600 µl of 0.5 M Tris, pH 8.8. Hydrolysis was quantified by measuring fluorescence (excitation/emission: 574 nm/584 nm).

Purified rCWP2 was incubated with enzyme in Tris-HCl buffer, pH 7.2, 4 mM DTT at 25 °C. The sample was fractionated by SDS-PAGE, dried, and visualized by phosphorimaging (Typhoon Trio, GE Healthcare).

DCG04 (radio125I-iodinated or BODIPY-labeled), the clan CA cysteine protease inhibitor (14), was incubated with enzyme and 4 mM DTT for 30 min. Proteins were fractionated by SDS-PAGE, dried, and visualized by phosphorimaging (Typhoon Trio, GE Healthcare).

To determine the Km of GlCP2, the fluorogenic peptide substrates Z-FR-AMC, Z-RR-AMC, and Z-VLK-AMC (Bachem) were incubated with enzyme at a range of concentrations, and the Vmax units/s was recorded. The non-linear regression and Km calculations were determined using Prism 4 software (Graphpad).

rGlCP2 was fractionated on a Novex® 10% zymogram (gelatin) gel (Invitrogen) under native conditions as recommended by the manufacturer. The gel was stained with SimplyBlueTM Safestain (Invitrogen) and destained in water to visualize bands of protease activity.

rGlCP2 was fractionated by SDS-PAGE under non-reducing conditions on a 15% Tris-HCl gel. The gel was washed 2x in 20 mM Tris-HCl, 0.2% Triton X-100. The gel was incubated in 20 mM Tris-HCl, 0.2% Triton X-100, 5 mM DTT, and 10 µM Z-FR-MNA (N-carbobenzoxy-phenylalanyl-arginyl-4-methoxy-β-naphthylamide) for 2 h at room temperature. Two volumes (compared with substrate) of 2 M coupling reagent (5-nitro-2-salicylaldehyde) was added to the reaction, and the reaction was incubated for an additional 4 h at room temperature. Fluorescence was visualized on a Typhoon Trio (GE Healthcare).

Positional Scanning Synthetic Combinatorial Library (PS-SCL)—Protease activity was assayed at 25 °C in a buffer containing 20 mM Tris-HCl, pH 7.2, 5 mM DTT, 0.2% Triton X-100 (Sigma-Aldrich), and 1% Me2SO (from the substrates) or in buffer with NaOAc replacing Tris-HCl (pH 5.5) as referenced in the text. Assays were performed as previously described using 250 µM substrate in each assay (15).

RNA Methods—Total RNA from vegetative or encysting Giardia cells was isolated with TRIzol reagent (Invitrogen). 2 µg of RNA was treated with 1 unit of amplification grade DNase I (Sigma). cDNA was synthesized with Superscript III reverse transcriptase according to the manufacturer's specifications (Invitrogen). cDNA samples were stored at -80 °C until use. Control samples were prepared as above using nuclease-free ddH2O in place of RNA.

Real-time PCR—PCR was performed in an Mx3005PTM QPCR system using MxProTM QPCR software (Stratagene). Amplification was performed in a final volume of 25 µl, containing cDNA from the reverse-transcribed reaction, primer mixture (0.3 µM each of sense and antisense primers), and 12.5 µl of 2x SYBR Green Master Mix (Applied Biosystems). The final mRNA levels of the genes studied were normalized to GAPDH expression using the comparative CT method (Stratagene).

The sequences of Giardia cysteine proteases were obtained from the Giardia genome project. For the GenBankTM protein accession numbers and primers see supplemental Table S1.

Microscopy—A confocal microscope (LSM510 META; Carl Zeiss MicroImaging, Inc.) equipped with multiline (458, 477, 488, and 514 nm) Ar, Diode 405 nm, 543 nm HeNe, and 633 nm HeNe visible lasers with a "Plan-Apochromat" 63x/1.40 Oil DIC oil immersion lens (Carl Zeiss MicroImaging, Inc.) was used for fluorescence imaging. Cells were pulsed with oxygen at 37 °C for 1–3 h, fixed in 3% paraformaldehyde (Electron Microscopy Sciences) for 40 min, and mounted with ProLong Gold mounting media (+ or - DAPI) (Molecular Probes). LSM Image Browser software (Carl Zeiss MicroImaging, Inc.) was used for confocal image acquisition and analysis. Adobe Photoshop CS (Adobe Systems, Inc.) was used for subsequent processing.

Antibodies and Reagents—Anti-Giardia cyst wall protein polyclonal was used at 1:100 (Waterborne, Inc.) Anti-GlCP2 peptide polyclonal (raised against the peptide SSKVHLATATSYKDYGLDI) was used at 1:500. Inhibitors: phenylmethylsulfonyl fluoride (Sigma), EDTA (Sigma), aprotinin (Sigma), pepstatin A (Calbiochem), leupeptin (Sigma), TLCK (1-chloro-3-tosylamido-7-amino-2-heptanone HCl) (Sigma), TPCK (1-chloro-3-tosylamido-4-phenyl-2-butanone) (Sigma), E64 (Sigma), CA074 (Sigma), lactacystin (Sigma), {alpha}-1 antitrypsin (Sigma), calpain inhibitor I (ALLN, Sigma), calpain inhibitor II (ALLM, Sigma). R. norvegicus cathepsin C was a gift from John Pederson (Unizyme, Denmark).

Mass Spectrometry—Tryptic digest sample was analyzed by liquid chromatography-mass spectrometry/mass spectrometry. Analyses were performed with an LTQ ion trap (Thermo Scientific) and a QSTAR (Applied Biosystems). The data base search was conducted using Mascot (Matrix Science Inc) on the full NCBI protein data base. Mass accuracy for the QSTAR data: 100 ppm in MS; 0.2 Da in MS/MS. Mass accuracy for the LTQ data: 3 Da in MS; 0.8 Da in MS/MS.

Two-dimensional Gel Electrophoresis—Protein samples were de-salted with Centricon spin columns (Millipore). Two-dimensional gel electrophoresis was performed according to the manufacturer's specifications using the Zoom IPGRunner system (Invitrogen). Gels were silver-stained with the Silver Stain Plus kit (Bio-Rad), and protein spots were excised and trypsin-digested.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
There Are Twenty-seven Clan CA Cysteine Proteases in the Genome of Giardia lamblia—Prior to the completion of the Giardia genome, only four cysteine proteases from Giardia had been identified (10, 11). Three of these genes encode cathepsin B-like cysteine proteases, the fourth a cathepsin C-like protease. Using these papain family enzymes as a query, the Giardia genome was mined for additional genes coding for cysteine proteases. In total, twenty-seven clan CA cysteine protease genes were located in the Giardia genome, and these could be classified by sequence homology into cathepsin B-like, cathepsin C-like, or cathepsin K/L-like categories (Fig. 1). Three of these (GenBankTM accession number EAA38990) are greater than 95% identical to each other and yet are found in three discrete regions of the genome. There is also a set of four genes greater than 95% identical and assigned to the same GenBankTM accession number (AAK92150 [GenBank] ).

GlCP2 Is the Most Highly Expressed Cysteine Protease of the Twenty-seven in the Giardia Genome—RT-PCR was used to determine if each of these genes was expressed in the vegetative and encysting stages of the Giardia life cycle. It was found that twenty-five of these twenty-seven genes are expressed, while no expression could be seen for the genes with GenBankTM accession numbers EAA37191 and EAA39030 (data not shown). Quantitative RT-PCR was performed to determine the relative levels of gene expression among the expressed Giardia cysteine proteases in the vegetative and encysting life stages. Expression was normalized to the expression of the housekeeping gene glutaraldehyde phosphate dehydrogenase (GAPDH), which has been found to have stable expression during the Giardia life cycle (5, 16). It is notable that the cathepsin B-like cysteine proteases are more highly expressed than the cathepsin C-like or K/L-like proteases (Fig. 1). Expression of all of the cysteine protease genes was increased marginally during encystation. GlCP2 was the most highly expressed transcript in both vegetative and encysting life stages by 1.6-fold and 3.5-fold, respectively, over the next most highly expressed transcript (Giardia cysteine protease 3, with 89% homology to GlCP2). This is consistent with GlCP2 being the only cysteine protease Ward et al. (10) biochemically identified from the parasite by affinity purification and N-terminal sequencing. The expression of this gene was also increased by 7-fold during encystation (Fig. 1).

GlCP2 Is Identified in Lysate Fractions Enriched for Cysteine Protease Activity—Biochemical characterization of total cysteine protease activity found in Giardia lysates was concurrently undertaken to complement the gene expression analysis. Giardia lysates were fractionated by ion exchange chromatography, and each fraction tested against an array of N-terminally blocked fluorescent peptide substrates (data not shown). Two main peaks of cysteine protease activity were resolved against the substrates Z-FR-AMC and Z-RR-AMC (Fig. 2A). The first peak eluted (Peak A) exhibited activity against both Z-RR-AMC and Z-FR-AMC, while the second peak (Peak B) had activity against Z-FR-AMC but far less against Z-RR-AMC. The activity-containing fractions from each peak were subsequently enriched with two additional rounds of ion exchange chromatography, concentrated, probed with a labeled irreversible cysteine protease active site inhibitor and resolved by one-dimensional SDS-PAGE or two-dimensional gel electrophoresis. The active site probe labeled two discrete protein bands in Peak A and only one protein band in Peak B (Fig. 2B). Protein bands from one-dimensional SDS-PAGE or spots from two-dimensional gel electrophoresis were subjected to tryptic digest and analyzed using liquid chromatography-mass spectrometry/mass spectrometry. The only cysteine protease identified from these methods was GlCP2, of which peptides were identified in both Peak A and Peak B (Table 1). This was consistent with the observation that GlCP2 was the major cysteine protease transcript expressed by G. lamblia.


View this table:
[in this window]
[in a new window]

  		TABLE 1
Amino acid sequences of peptide fragments of cysteine protease activity Peak A and Peak B Sequences were identified by liquid chromatography-mass spectrometry/mass spectrometry of cysteine protease activity Peak A and Peak B eluted from anion exchange chromatography of Giardia lysates.

 


Figure 1
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 1.
By quantitative RT-PCR, GlCP2 is the dominant transcript of twenty-seven Giardia clan CA cysteine protease genes. Genes were classified by sequence homology into cathepsin B-like (8), cathepsin C-like (4), and cathepsin K/L-like (10) categories. GenBankTM accession number EAA38990 represents three greater than 95% identical genes and GenBankTM accession number AAK92150 [GenBank] represents four genes with greater than 95% homology. Gene expression was measured during vegetative growth and 24 h after induction of encystation. The transcript level is expressed relative to the housekeeping gene GAPDH. Two genes, both cathepsins K/L-like, were not expressed (GenBankTM accession numbers EAA37191 and EAA39030). GlCP2 was the most highly expressed cysteine protease gene in both vegetative and encysting life cycle stages.

 
Expression and Characterization of Recombinant GlCP2—To further analyze the activity and biological role of GlCP2, a resynthesized GlCP2 (rGlCP2) gene (resynthesized to optimize for yeast codon bias) of 34 kDa was expressed heterologously in P. pastoris (Fig. 3A). The polyhistidine-tagged rGlCP2 was purified by affinity and anion exchange chromatography and was found to autoactivate during the purification process to the mature form of 28 kDa (Fig. 3A). The full-length and mature forms of rGlCP2 had activity on a 10% gelatin zymogram native gel and migrated to an apparent mobility of 60-kDa marker (supplemental Fig. S1).

To compare rGlCP2 activity to that predominantly seen in Giardia lysates, the activity profile of rGlCP2 by ion exchange chromatography was examined against Z-FR-AMC and Z-RR-AMC. The two activity peaks seen in Giardia lysates were reproduced with purified recombinant protein; the peaks of activity represent the pro and mature forms of the protease in Peak A and the mature protease alone in Peak B (Fig. 4A). This is consistent with the two protein bands labeled with the cysteine protease active site probe in Peak A, and the single band labeled in Peak B (Fig. 4B). To determine if full-length rGlCP2 has activity against a peptide substrate, protein from Peak A and Peak B was fractionated by SDS-PAGE under non-reducing conditions. In-gel activity was tested against the fluorogenic substrate Z-FR-MNA. Two bands of activity could be visualized in Peak A, while only one band of endoprotease activity was resolved in Peak B (Fig. 4B). A Western blot of these fractions using an antibody against GlCP2 also demonstrates that two bands in Peak A and one in Peak B are identified as GlCP2 (Fig. 4C). These data are consistent with the biochemical and mass spectrometry evidence that GlCP2 is responsible for the activity found in both peaks A and B. Purified peak B was utilized for further biochemical studies.

An array of protease inhibitors was tested for their ability to inhibit rGlCP2 activity against Z-FR-AMC and Z-RR-AMC. Leupeptin and E64 were the most effective inhibitors of rGlCP2 (Table 2). The pH profile of rGlCP2 was elucidated using the peptide substrates Z-FR-AMC and Z-RR-AMC and the macromolecular substrate casein-resorufin. The pH optimum for rGlCP2 was found to be in the neutral range for each of these substrates (Fig. 3B). This is consistent with the localization of GlCP2 in non-acidified compartments and its absence in the acidified peripheral vacuoles (PVs) (data not shown). The Km and kcat/Km of Z-FR-AMC for GlCP2 were found to be 40 µM and 17.5 µM/s, respectively. The Km and kcat/Km of Z-RR-AMC for GlCP2 were found to be 9 µM and 72 µM/sec, respectively.


View this table:
[in this window]
[in a new window]

  		TABLE 2
Inhibition of rGlCP2 activity against the N-terminally blocked fluorogenic peptides substrate Z-FR-AMC and Z-RR-AMC Activity is expressed as percent activity relative to a control reaction.

 
To characterize the substrate specificity of rGlCP2, a positional scanning synthetic combinatorial library was used to determine the substrate preference of the substrate binding sites for P1-P4 (15) (supplemental Fig. S2). rGlCP2 displays an amino acid preference at subsites P1 and P2 (P1: K>>R, Q, P; P2: L, M, V, F) while subsites P3 and P4 have relaxed specificity. These libraries were tested both at the optimal pH for the enzyme (7.2) and at pH 5.5, the conventional pH for this class of enzymes. The substrate specificity did not change over this pH range, though the level of enzyme activity was decreased by approximately 50% at the lower pH (data not shown). Based on the substrate specificity, an ideal substrate (Z-VLK-AMC) was used to measure the Km and kcat/Km, which were found to be 19 µM and 1,473 µM/s, respectively.


Figure 2
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 2.
Two distinct cysteine protease activities were resolved by anion exchange chromatography of Giardia lysates. A, protease activity from eluates was tested against the N-terminally blocked fluorogenic peptide substrates Z-FR-AMC (FR {blacktriangleup}) and Z-RR-AMC (RR{blacksquare}). The two cysteine protease activity peaks exhibited distinct substrate preferences. Peak A had higher activity against Z-RR-AMC, while Peak B had higher activity against Z-FR-AMC and far less activity against Z-RR-AMC. B, eluates from the cysteine protease activity peaks A and B were incubated with the 125I-labeled active site probe DCG04. The probe labeled two protein bands in Peak A while only one band could be seen in Peak B.

 


Figure 3
View larger version (27K):
[in this window]
[in a new window]

  		FIGURE 3.
Resynthesized GlCP2 (rGlCP2) was heterologously expressed, purified, and biochemically characterized. A, Western blot probed with anti-GlCP2 peptide antibody showed that rGlCP2 was expressed as a zymogen of 34 kDa. During the process of purification rGlCP2 was autoactivated to the mature form of 28 kDa. B, pH profile of rGlCP2 against the fluorogenic substrates Z-FR-AMC ({blacktriangleup}) and Z-RR-AMC ({blacksquare}) and against the macromolecular substrate casein-resorufin ({diamondsuit}) demonstrated that the pH optimum was 6–7 for activity against all substrates. The pH optimum rGlCP2 with Z-RR-AMC, Z-FR-AMC, and casein is different (B). This may reflect the pH dependence of the side-chain charge of the peptide substrates and the corresponding cleavage sites within casein. Alternatively, the charge at the bottom of the S2 pocket may be pH-dependent as was demonstrated structurally for the homologous cysteine protease cruzain (25).

 
GlCP2 Is Found in Giardia ESVs and Can Proteolytically Process CWP2 to the Predicted Size Found in the Cyst Wall—The localization of GlCP2 during encystation was determined by episomal expression of a GlCP2-GFP fusion in Giardia. Encysting cells were probed with an antibody against cyst wall protein to highlight the ESVs, and GlCP2-GFP was found to localize to ESVs (Fig. 5). Ward et al. (10) previously implicated GlCP2 in Giardia excystation. However, whether this protease could also play a role in the encystation process was not addressed directly.

Total Giardia lysates or purified rGlCP2 was incubated with recombinant CWP2 (rCWP2). In the presence of either Giardia lysates or rGlCP2, rCWP2 was processed from its original 39-kDa size to a 26-kDa fragment, the same size of the protein found in the cyst wall and shown to be produced by incubation with a purified fraction of cysteine protease activity containing encystation-specific cysteine protease (ESCP) (Fig. 6, A and B) (4, 11). rCWP2 was also processed to this 26-kDa fragment in the presence of the endopeptidases trypsin and chymotrypsin, suggesting that the processing of CWP2 is not dependent on protease specificity but instead dependent on the structure of CWP2 and the protein segments accessible to an endopeptidase (Fig. 6B). The exact sequence at the cleavage site has not been experimentally determined, but the 26-kDa fragment is clearly the cyst wall building block (4, 7, 11). Rattus norvegicus cathepsin C was also tested and no processing of rCWP2 was seen in the presence of this enzyme (Fig. 6B). At high concentrations of rGlCP2, trypsin, or chymotrypsin the 26-kDa fragment of rCWP2 is further degraded to small peptides (data not shown). Interestingly, only rGlCP2 Peak B and not Peak A from the anion exchange column exhibited proteolytic activity against rCWP2 in the time frame of this assay (Fig. 6B). rCWP2 processing was inhibited by K11777, an endopeptidase inhibitor (17), but not by Y01, a cathepsin C selective inhibitor (18) (Fig. 6C).


Figure 4
View larger version (25K):
[in this window]
[in a new window]

  		FIGURE 4.
Fractionated rGlCP2 activity was identical to cysteine protease activity from Giardia lysates. A, rGlCP2 eluates from anion exchange chromatography were tested against the N-terminally blocked fluorescent peptide substrates Z-FR-AMC (FR{blacktriangleup}) and Z-RR-AMC (RR {blacksquare}). As found with protease activity from lysates, two cysteine protease activity peaks were resolved and exhibited distinct substrate preferences. Peak A had higher activity against Z-RR-AMC, while Peak B had higher activity against Z-FR-AMC and far less activity against Z-RR-AMC. B, left panel, fractions of cysteine protease activity Peaks A and B were incubated with the 125I-labeled active site probe DCG04 and fractionated by SDS-PAGE. The probe labeled two protein bands in Peak A while only one labeled protein band could be seen in Peak B (arrowheads). Right panel, Peaks A and B proteins were fractionated by SDS-PAGE under native conditions, and the resulting gel was incubated with the fluorogenic peptide substrate Z-FR-MNA. Two bands of fluorescence, indicative of endoprotease activity, were observed in Peak A and one band in Peak B (arrowheads). C, Western blot probed with anti-GlCP2 peptide antibody demonstrated that two protein bands in Peak A and one protein band in Peak B were identified as GlCP2.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Because G. lamblia is an early diverging branch of the eukaryotic evolutionary tree, as defined by 16 S ribosomal RNA sequence and protein coding sequences, it is an intriguing model system to investigate the evolution of protein families and their functions (2, 12, 19). The clan CA cysteine protease family has essential functions in numerous organisms including well characterized lysosomal protein degradation and a wide array of other indispensable cellular tasks (20). There are twenty-seven gene sequences for the Giardia clan CA cysteine protease family. Twenty-five of these genes are expressed in vegetative and encysting life cycle stages. Of these expressed genes, GlCP2 emerges as the most highly expressed cysteine protease and exhibits developmental regulation, with expression increasing dramatically during encystation (Fig. 1). It is also the only cysteine protease that was identified in protein fractions enriched for cysteine protease activity.

GlCP2 is a cathepsin B-like cysteine protease (10). The protein is produced as a zymogen and is activated by proteolytic removal of an N-terminal propeptide of 51 amino acids. Giardia cathepsin B-like cysteine proteases lack the "occluding loop" that is characteristic of cathepsin B-like enzymes of higher eukaryotes (8). This loop endows the protease with exopeptidase activity by stabilizing the free carboxyl at the C terminus of a peptide substrate (21). Therefore, the Giardia cathepsin B-like enzyme exhibits only endopeptidase activity (data not shown). Though the mammalian orthologues of this enzyme are lysosomal enzymes and are optimally active at an acidic pH, Giardia cysteine protease activity, and in particular the activity of GlCP2, exhibits optimal substrate degradation at neutral pH (Fig. 3B) (20, 22, 23).


Figure 5
View larger version (17K):
[in this window]
[in a new window]

  		FIGURE 5.
GlCP2 co-localized with cyst wall protein in encystation-specific vesicles (ESVs) during Giardia encystation. A C-terminal GFP fusion of GlCP2 (green) was expressed episomally in Giardia. Cells were fixed 24 h after induction of encystation and probed with an antibody against cyst wall proteins (red). Image represents a three-dimensional projection of confocal images taken along the Z axis. GlCP2 clearly co-localized with CWP in ESVs. Bar, 5 µm.

 


Figure 6
View larger version (57K):
[in this window]
[in a new window]

  		FIGURE 6.
rGlCP2 processes recombinant cyst wall protein 2 (rCWP2) to the predicted 26-kDa size necessary for incorporation into the cyst wall. A, in-solution cleavage of 35S-labeled rCWP2 by purified rGlCP2. rCWP2 was exposed to rGlCP2 in Tris buffer, pH 7.6, and incubated at 25 °C for 0, 5, 15, 45, 90, and 120 min rGlCP2 can cleave the 39-kDa rCWP2 to a 26-kDa fragment (arrowheads) in a time-dependent manner. B, rCWP2 was incubated for 35 min with various proteases. Peak A from anion exchange purification of rGlCP2 (lane 1) and R. norvegicus cathepsin C (lane 6) did not process rCWP2 from its full-length size of 39 kDa (arrowhead). rGlCP2 (lane 2) and Giardia lysates (lane 3) exhibited identical processing patterns of rCWP2. Other endopeptidases, such as trypsin (lane 4) and chymotrypsin (lane 5), can also process rCWP2 to 26 kDa (arrowhead). Lanes 5 and 6 are set apart as these samples were run on separate gels. C, an endopeptidase inhibitor, K11777 (panel C) (17) blocks processing of rCWP2, whereas an inhibitor of cathepsin C, Y01, (18) does not (panel B). Panel A is an uninhibited control.

 
During purification of enzyme activity, in both native lysates and with rGlCP2, a unique specificity was seen in fractions containing both the pro enzyme and the mature enzyme not observed in those fractions containing only mature GlCP2. As seen in Fig. 4B, Peak A contains predominantly the proform of the protease and exhibits much higher activity against Z-RR-AMC than against Z-FR-AMC. Peak B, which has more mature protease, efficiently cleaves CWP2 (Fig. 6). There are two mechanistic considerations to this substrate specificity difference based on the crystal structure of the proform of homologous cathepsin L proteases (24). The proform of cathepsin L contains a peptide segment that binds to the active site of the enzyme in reverse orientation to substrate. The presence of this inhibitory segment in the proform, therefore, explains the inability of the proform in Peak A to cleave protein substrates like CWP. However, proforms of cathepsin L can "breathe" in solution whereby portions of the prodomain may be in equilibrium between bound and unbound with the active site. Thus small peptide substrates and active sites tags have been reported to be bound by proforms of cathepsins (14). While foci of the prodomain inhibitory peptide can therefore release from the active site, the rest of the segment remains in place, sterically hindering the approach of large protein substrates such as CWP.

As to the difference in substrate specificity between Z-RR-AMC and Z-FR-AMC between the two peaks, there are two possible explanations. First, it is common for the proforms of cathepsin L-like cysteine proteases to auto-activate at lower pH. This is presumably due to disruption of interactions between the prodomain and the active site with increase in hydrogen ion concentration. The Z-RR-AMC substrate may be more likely to produce disruption of the prodomain-enzyme interaction than the less charged Z-FR-AMC. Alternatively, the presence of the proform peptide in the active site may induce different conformation from mature protease whereby a negative charge is now present in the bottom of the S2 pocket favoring the binding of the Z-RR-AMC substrate. This conformational difference in S2 specificity was reported in crystal structures of the related cathepsin L, cruzain, when S2 pocket conformation was observed at different pH values (25).

Previously it was reported that a cathepsin C-like enzyme, encystation-specific cysteine protease (ESCP) was responsible for the essential proteolytic processing of CWP2 from a 39-kDa protein to 26-kDa fragment. This processing step removes a highly basic C-terminal domain, allowing polymerization and formation of the cyst wall (4, 11, 26). However, ESCP has all of the conserved domains of cathepsin C-like proteins including the N-terminal exclusion domain that limits cathepsin C to dipeptidyl exopeptidase activity (20, 22, 23, 27, 28). Therefore, it would not be predicted to possess any endopeptidase activity, such as would be necessary to accomplish CWP2 processing. Recombinant R. norvegicus cathepsin C, with the same fold and conserved active site residues as ESCP, did not process CWP2 (Fig. 6B). Furthermore, Y01, a specific inhibitor of Giardia cathepsin C does not inhibit cyst wall processing whereas an inhibitor of G1CP2 does (Fig. 6C). Because Touz et al. used ESCP purified from Giardia lysates and not recombinant protein, the possibility exists that the enzyme preparation was contaminated with one of the other much more abundant Giardia clan CA cysteine endopeptidases. In this study we show that GlCP2 is capable of processing CWP2 to the expected 26-kDa fragment and is found in ESVs with cyst wall protein. GlCP2 is expressed at levels 20-fold higher than ESCP during encystation (Fig. 1) so a small amount of the active GlCP2 could easily contaminate the "purified" preparation of ESCP (7). Indeed, the protease inhibitors demonstrated by Touz et al. to interfere with cyst production (E64, ALLN, ALLM) (11) also efficiently inhibit GlCP2 activity (Table 2). The ability of trypsin and chymotrypsin, but not cathepsin C, to accurately process CWP2 suggests that it is the structure of CWP2 that presents specific endoprotease processing sites. The exact cleavage site in Giardia has not been experimentally determined. The processing of CWP2 may be redundant, as other cysteine endopeptidases in Giardia were localized to the ESVs during encystation, such as EAA37074 (supplemental Fig. S3). However, the high level of GlCP2 expression strongly suggests that GlCP2 is a key proteolytic constituent of the CWP2 processing machinery.

During the proteolytic processing of rCWP by recombinant GlCP2 (Fig. 6A), several intermediate products are visualized. This is not unexpected given the multiple potential cleavage sites observed in the segment of CWP, processed to the 26-kDa form. There are at least 7 sites that correspond to the optimal substrate specificity of GlCP2 which is hydrophobic side chains in P2 (F,V,I,L,M) and a positive charge at P1(R,K).4

The fact that GlCP2 can, at high concentrations, degrade CWP2 to small peptides suggests that there must be a mechanism in place for regulating the activity of GlCP2 against CWP2 in the ESVs. This may be accomplished by delayed activation of GlCP2, because it was found that the zymogen-containing fractions of rGlCP2 did not exhibit any proteolytic activity against CWP2 in the degradation assay (Fig. 6B). It could also be regulated by acidification of the ESVs, as it has been suggested that ESVs fuse with PVs prior to formation of the cyst wall and the activity of GlCP2 toward protein substrates is greatly reduced in an acidic compartment (11) (Fig. 3B). The ability of GlCP2 to completely degrade CWP2 under other conditions, as would be expected if GlCP2 were released from ESVs into the extracellular space between the trophozoite and the cyst wall supports a second role for this enzyme in the process of excystation, as was previously postulated by Ward et al. (10).


   FOOTNOTES
 
* This work was supported, in whole or in part, by National Institutes of Health Grant AI35707 from the Tropical Disease Research Unit. This work was also supported by the Sandler Family Supporting Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1–S3 and Table S1. Back

1 Supported by a NIAID, National Institutes of Health Training Fellowship in Microbial Pathogenesis. Back

2 To whom correspondence should be addressed: 1700 4th St., QB3/UCSF 509, San Francisco, CA 94158-2550. Fax: 415-502-8193; E-mail: sajid{at}ucsf.edu.

3 The abbreviations used are: ESVs, encystation-specific vesicles; CWP2, cyst wall protein 2; ESCP, encystation-specific cysteine protease; GAPDH, glutaraldehyde phosphate dehydrogenase; GlCP2, G. lamblia cysteine protease 2; DTT, dithiothreitol; AMC, amino-methylcoumarin; Z, benzyloxycarbonyl; GFP, green fluorescent protein. Back

4 K. N. Dubois (2007) Thesis, University of California. Back


   ACKNOWLEDGMENTS
 
We thank Drs. C. C. Wang, Srini Garlapati, and Lei Li for reporter constructs (UCSF). We thank John Pederson (Unizyme, Denmark) for the gift of the R. norvegicus cathepsin C. We thank Katalin Medzihradsky at the UCSF mass spectrometry facility for the mass spectrometry data, and Chris Franklin (UCSF) for assistance in generating some of the figures.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Adam, R. D. (2001) Clin. Microbiol. Rev. 14, 447-475[Abstract/Free Full Text]
  2. Hedges, S. B. (2002) Nat. Rev. Genet. 3, 838-849[CrossRef][Medline] [Order article via Infotrieve]
  3. Sogin, M. L., Gunderson, J. H., Elwood, H. J., Alonso, R. A., and Peattie, D. A. (1989) Science 243, 75-77[Abstract/Free Full Text]
  4. Lujan, H. D., Mowatt, M. R., and Nash, T. E. (1997) Microbiol. Mol. Biol. Rev. 61, 294-304[Abstract]
  5. Hehl, A. B., Marti, M., and Kohler, P. (2000) Mol. Biol. Cell 11, 1789-1800[Abstract/Free Full Text]
  6. Reiner, D. S., McCaffery, M., and Gillin, F. D. (1990) Eur. J. Cell Biol. 53, 142-153[Medline] [Order article via Infotrieve]
  7. Lujan, H. D., Mowatt, M. R., Conrad, J. T., Bowers, B., and Nash, T. E. (1995) J. Biol. Chem. 270, 29307-29313[Abstract/Free Full Text]
  8. Sajid, M., and McKerrow, J. H. (2002) Mol. Biochem. Parasitol. 120, 1-21[CrossRef][Medline] [Order article via Infotrieve]
  9. McKerrow, J. H. (1999) Int. J. Parasitol. 29, 833-837[CrossRef][Medline] [Order article via Infotrieve]
  10. Ward, W., Alvarado, L., Rawlings, N. D., Engel, J. C., Franklin, C., and McKerrow, J. H. (1997) Cell 89, 437-444[CrossRef][Medline] [Order article via Infotrieve]
  11. Touz, M. C., Nores, M. J., Slavin, I., Carmona, C., Conrad, J. T., Mowatt, M. R., Nash, T. E., Coronel, C. E., and Lujan, H. D. (2002) J. Biol. Chem. 277, 8474-8481[Abstract/Free Full Text]
  12. Singer, S. M., Yee, J., and Nash, T. E. (1998) Mol. Biochem. Parasitol. 92, 59-69[CrossRef][Medline] [Order article via Infotrieve]
  13. Abel, E. S., Davids, B. J., Robles, L. D., Loflin, C. E., Gillin, F. D., and Chakrabarti, R. (2001) J. Biol. Chem. 276, 10320-10329[Abstract/Free Full Text]
  14. Greenbaum, D., Medzihradszky, K. F., Burlingame, A., and Bogyo, M. (2000) Chem. Biol. 7, 569-581[CrossRef][Medline] [Order article via Infotrieve]
  15. Choe, Y., Leonetti, F., Greenbaum, D. C., Lecaille, F., Bogyo, M., Bromme, D., Ellman, J. A., and Craik, C. S. (2006) J. Biol. Chem. 281, 12824-12832[Abstract/Free Full Text]
  16. Mowatt, M. R., Lujan, H. D., Cotten, D. B., Bowers, B., Yee, J., Nash, T. E., and Stibbs, H. H. (1995) Mol. Microbiol. 15, 955-963[CrossRef][Medline] [Order article via Infotrieve]
  17. Jacobsen, W., Christians, U., and Benet, L. Z. (2000) Drug. Metab. Dispos. 28, 1343-1351[Abstract/Free Full Text]
  18. Yuan, F., Verhelst, S. H., Blum, G., Coussens, L. M., and Bogyo, M. (2006) J. Am. Chem. Soc. 128, 5616-5617[CrossRef][Medline] [Order article via Infotrieve]
  19. Hashimoto, T., Nakamura, Y., Nakamura, F., Shirakura, T., Adachi, J., Goto, N., Okamoto, K., and Hasegawa, M. (1994) Mol. Biol. Evol. 11, 65-71[Abstract]
  20. Turk, B., Turk, D., and Turk, V. (2000) Biochim. Biophys. Acta 1477, 98-111[CrossRef][Medline] [Order article via Infotrieve]
  21. Mort, J. S., and Buttle, D. J. (1997) Int. J. Biochem. Cell Biol. 29, 715-720[CrossRef][Medline] [Order article via Infotrieve]
  22. Turk, V., Turk, B., and Turk, D. (2001) EMBO J. 20, 4629-4633[CrossRef][Medline] [Order article via Infotrieve]
  23. Mottram, J., North, M., Sajid, M., Edit, Barrett, A. J., Rawlings, N. D., and Woessner, J. F. (1998) Trichomonad and Giardia Cysteine Endopeptidases, Handbook of Proteolytic Enzymes, pp. 1170-1173, Academic Press, San Diego
  24. Coulombe, R., Grochulski, P., Sivaraman, J., Menard, R., Mort, J. S., and Cygler, M. (1996) EMBO J. 15, 5492-5503[Medline] [Order article via Infotrieve]
  25. Gillmor, S. A., Craik, C. S., and Fletterick, R. J. (1997) Protein Sci. 6, 1603-1611[Medline] [Order article via Infotrieve]
  26. Gillin, F. D., Reiner, D. S., Gault, M. J., Douglas, H., Das, S., Wunderlich, A., and Sauch, J. F. (1987) Science 235, 1040-1043[Abstract/Free Full Text]
  27. Que, X., Engel, J. C., Ferguson, D., Wunderlich, A., Tomavo, S., and Reed, S. L. (2007) J. Biol. Chem. 282, 4994-5003[Abstract/Free Full Text]
  28. Turk, D., Janjic, V., Stern, I., Podobnik, M., Lamba, D., Dahl, S. W., Lauritzen, C., Pedersen, J., Turk, V., and Turk, B. (2001) EMBO J. 20, 6570-6582[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


Related Webpages:

F1000 Biology *Must Read* - FREE!


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
283/26/18024    most recent
M802133200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DuBois, K. N.
Right arrow Articles by Sajid, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DuBois, K. N.
Right arrow Articles by Sajid, M.
Related Collections
Right arrow Related Webpages
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2008 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement