Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M708862200 on November 20, 2007

J. Biol. Chem., Vol. 283, Issue 3, 1372-1380, January 18, 2008
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/3/1372    most recent
M708862200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hale, B. G.
Right arrow Articles by Randall, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hale, B. G.
Right arrow Articles by Randall, R. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Binding of Influenza A Virus NS1 Protein to the Inter-SH2 Domain of p85β Suggests a Novel Mechanism for Phosphoinositide 3-Kinase Activation*

Benjamin G. Hale{ddagger}1, Ian H. Batty§, C. Peter Downes§, and Richard E. Randall{ddagger}

From the {ddagger}Centre for Biomolecular Sciences, University of St. Andrews, St. Andrews, Fife KY16 9ST, United Kingdom and the §Division of Molecular Physiology, Faculty of Life Sciences, University of Dundee, Dundee DD1 5EH, United Kingdom

Received for publication, October 26, 2007 , and in revised form, November 19, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Influenza A virus NS1 protein stimulates host-cell phosphoinositide 3-kinase (PI3K) signaling by binding to the p85β regulatory subunit of PI3K. Here, in an attempt to establish a mechanism for this activation, we report further on the functional interaction between NS1 and p85β. Complex formation was found to be independent of NS1 RNA binding activity and is mediated by the C-terminal effector domain of NS1. Intriguingly, the primary direct binding site for NS1 on p85β is the inter-SH2 domain, a coiled-coil structure that acts as a scaffold for the p110 catalytic subunit of PI3K. In vitro kinase activity assays, together with protein binding competition studies, reveal that NS1 does not displace p110 from the inter-SH2 domain, and indicate that NS1 can form an active heterotrimeric complex with PI3K. In addition, it was established that residues at the C terminus of the inter-SH2 domain are essential for mediating the interaction between p85β and NS1. Equivalent residues in p85{alpha} have previously been implicated in the basal inhibition of p110. However, such p85{alpha} residues were unable to substitute for those in p85β with regards NS1 binding. Overall, these data suggest a model by which NS1 activates PI3K catalytic activity by masking a normal regulatory element specific to the p85β inter-SH2 domain.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Lipid second messengers generated by phosphoinositide 3-kinases (PI3Ks)2 regulate an array of protein kinase signaling cascades that, in turn, control diverse cellular processes such as cell survival, metabolism, proliferation, and inflammation/immunity (1, 2). Class IA PI3Ks are dimeric enzymes consisting of a p110 catalytic subunit tethered to a smaller, non-catalytic, regulatory subunit (typically p85{alpha} or p85β). The interaction of p85 with p110 functions to both stabilize heat-labile p110, and suppress its enzymatic activity (3). Thus, within cells, p85 and p110 proteins exist as obligate heterodimers (3, 4), and subsequent activation of PI3K must occur via inter- or intramolecular allosteric changes.

The p85 regulatory subunits contain an N-terminal SH3 (Src homology 3) domain, a BH (B-cell receptor homology) domain flanked by proline-rich sequences, and two SH2 (Src homology 2) domains, which are on either side of the p110-binding inter-SH2 (iSH2) domain (Fig. 1A) (2, 5). All the domains of p85 contribute to the regulation of p110, and stimulatory signals (such as growth factors and hormones) act through multiple mechanisms in order to modulate the basal inhibition of PI3K. For example, tyrosine phosphorylation of consensus YXXM motifs in activated growth factor receptors (or their specific adapter substrates) provides docking sites for the two p85 SH2 domains, and relieves the effect of p85 on p110 (6, 7). Additionally, binding of GTPases (such as Cdc42 and Rac) to the p85 BH domain, or binding of Src family kinases to the p85 proline-rich motifs, have also been shown to increase the activity of the p85:p110 heterodimer (810). In contrast, a novel adapter protein, Ruk, interacts with the N-terminal SH3 domain of p85 and negatively regulates PI3K function (11). Furthermore, direct phosphorylations of p85 also determine p110 activity: Src kinase-mediated phosphorylation of tyrosine 688 alleviates p110 inhibition (12), while autophosphorylation of serine 608 restores inhibition (13). Thus, docking of adapter proteins to particular domains, or phosphorylation of key residues, probably induces conformational changes in p85 that are somehow transmitted to p110 and direct its catalytic activity.

It is clear that many important chronic- and acute-disease causing viruses hijack the PI3K signaling pathway to facilitate their efficient replication (reviewed in Ref. 14). As a parallel to the host-cell regulatory control of PI3K, viruses also activate this pathway by a variety of mechanisms. For example, tyrosine-phosphorylated motifs in the middle-T antigen of polyoma virus act to bind the SH2 domains of p85 and consequently stimulate PI3K activity (15). The NS5A protein of hepatitis C virus interacts with the SH3 domain of p85 to release p85-mediated inhibition of p110 (16), and the HIV-1 Nef protein appears to target a region in the C-terminal-half of p85 (17).

We (and others) (1821) have recently shown that cellular PI3K signaling is also activated during influenza A virus infections. This effect is mediated solely by the viral non-structural (NS1) protein (18, 19), which binds directly and specifically to the p85β regulatory subunit of PI3K (18, 22). NS1 functionally interacts with a plethora of viral and host-cell factors (summarized in Fig. 1B), although in virus-infected cells a major role for NS1 is to limit host innate immunity (reviewed in Ref. 23, 24). Under tissue culture conditions, NS1-mediated PI3K activation is clearly important for the efficient propagation of some (but not all) strains of influenza A virus (18, 19, 25). Indeed, recent data from other groups suggest that active PI3K signaling may contribute to the reduced induction of apoptosis in influenza A virus-infected cells (21, 22, 26). However, given the diverse array of PI3K-regulated physiological processes (2), together with the unique isoform selectivity displayed by NS1 (18, 22), it is likely that other cell type-specific consequences of NS1-activated PI3K may also exist.

Previously, we have demonstrated that two amino acid residues in the C-terminal effector domain of NS1 (tyrosine 89 and methionine 93) are necessary for binding p85β (18). Here, in an attempt to derive the mechanism by which NS1 activates PI3K, we report further on the domains of NS1 and p85β that mediate the interaction.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cells and Antibodies—293T, 1321N1, and 1321N1 cells stably expressing the V5-tagged influenza A virus NS1 protein (strain A/Puerto Rico/8/34; PR8) or the V5-tagged NS1-Y89F mutant, have been detailed previously (18). Mouse anti-V5 and anti-p85β antibodies were purchased from Serotec, mouse anti-HA was from BabCo, and rabbit anti-Myc antibody was from Santa-Cruz Biotechnology. Rabbit anti-NS1 antibody was generated against recombinant full-length PR8/NS1 protein expressed and purified from Escherichia coli (Scottish National Blood Transfusion Service).

Plasmids—Mammalian expression vectors for C-terminally V5-tagged wild-type PR8/NS1 and PR8/NS1-Y89F have been described previously (18). Arginine 38 and lysine 41 were both changed to alanine by PCR mutagenesis of the relevant wild-type PR8/NS1 cDNA. Tyrosine 89 was changed to glutamic acid by a similar procedure. For mammalian expression vectors encoding N-terminally Myc-tagged domains of bovine p85β, cDNA fragments corresponding to each domain (SH3 (amino acids 1–100), nSH2 (amino acids 313–433), iSH2 (amino acids 433–610), and cSH2 (amino acids 611–724)) were amplified by PCR from pMT2.bov.p85β (provided by B. Vanhaesebroeck (Queen Mary University of London, UK)) and ligated between the NcoI and SpeI sites of pEFTag. Vectors for the E. coli expression of GST-PR8/NS1 and GST-PR8/NS1-Y89F were as before (18). To create GST-PR8/NS1{Delta}72, cDNA encoding residues 73–230 of PR8/NS1 was amplified from an existing vector by PCR using specific primers. The forward primer also contained nucleotides (GAAAACCTGTATTTTCAGGGCGCC) coding for the cleavage sequence of tobacco etch virus (TEV) protease. The digested PCR product was ligated between the EcoRI and NotI sites of pGEX-4T3 (Amersham Biosciences). For His6-tagged {alpha}-iSH2 (amino acids 440–616), His6-tagged β-iSH2 (amino acids 433–610), and His6-tagged β-564 (amino acids 433–564), the relevant cDNAs were PCR amplified from pCDNA3.bov.p85{alpha} (provided by B. Vanhaesebroeck, Queen Mary University of London, UK) or pMT2.bov.p85β (as appropriate), and ligated between the NcoI and NotI sites of pEHISTEV (provided by H. Lui, University of St. Andrews, UK). His6-tagged β/{alpha}-iSH2 was generated by 4-primer overlap PCR from the above plasmids, where the overlapping nucleotide sequence used for both p85{alpha}-iSH2 and p85β-iSH2 was GACAAGCGCATGAACAGC. Subsequently digested products were also ligated between the NcoI and NotI sites of pEHISTEV. His6-tagged PR8/NS1 was generated by partially digesting pGEX`TEV'PR8/NS1 with NcoI/NotI and ligating the ~700-bp fragment into the corresponding sites of linearized pEHISTEV. The pGADT7.p110{alpha}-ABD plasmid (expressing HA-tagged p110{alpha}-ABD) was a kind gift from M. DeFrances (University of Pittsburgh) (27). The integrity of all newly generated constructs was confirmed by DNA sequencing.

Preparation of Cell Lysates and in Vitro PI3K Assays—Monolayers from 6-well plates were fixed and lysed by addition of ice-cold lysis buffer (1% v/v Triton X-100, 120 mM NaCl, 50 mM NaF, 1 mM MgCl2, 1 mM EGTA, 1 mM EDTA, 5 mM β-glycerophosphate, 25 mM HEPES, pH 7.6 at 4 °C, supplemented with 0.1 mM phenylmethylsulfonyl fluoride, 0.1 mM benzamidine, 10 µM leupeptin, 1 mM Na3VO4, and 1 mM dithiothreitol). Cell debris was centrifuged for 5 min at 20,000 x g (4 °C), and lysate supernatants were frozen in liquid nitrogen before storage at –80 °C. For analysis, cell lysates were mixed for ~2 h at 4°C with 10 µg of anti-V5 antibody pre-coupled to protein G-Sepharose beads. Immunoprecipitates were collected by brief centrifugation, washed, and analyzed for PI3K activity as described (28).

Protein Purification from E. coli and Insect Cells—Maintenance, infection, and harvesting of Sf9 cells infected with a recombinant baculovirus expressing bovine p85β has been described (18). Plasmids encoding the relevant GST fusion proteins were expressed and purified from E. coli strain BL-21 (DE3) and used to capture baculovirus-expressed proteins as before (18). His6-tagged proteins were similarly expressed in BL-21 (DE3), but purified using Ni-NTA resin (GE Healthcare). Elution of GST-tagged proteins from glutathione-agarose was done using 10 mM glutathione in 50 mM Tris-HCl, 200 mM NaCl (final pH adjusted to 7.6). Elution of His6-tagged proteins from Ni-NTA resin was done using 100 mM imidazole in 50 mM Tris-HCl, pH 7.6, 200 mM NaCl. As necessary, cleavage by recombinant TEV protease (Invitrogen) was carried out overnight at room temperature with accompanying dialysis in 50 mM Tris-HCl, pH 7.6, 200 mM NaCl, 1 mM dithiothreitol (ratio 50:1 protein:enzyme).

Immunoprecipitations and SDS-PAGE Analysis—Plasmid transfection into mammalian cells, subsequent immunoprecipitations, and SDS-PAGE/Western blot analysis were all performed as before (18). T7-dependent in vitro translations were carried out using the TNT® Quick-coupled Transcription/Translation system (Promega). As required, [35S]methionine (1 µCi per µl of reaction mixture) was used to generate radiolabeled proteins.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The RNA-binding Domain of NS1 Is Not Essential for the Interaction with p85β—The ability of influenza A virus NS1 protein to bind RNA has been mapped to a number of basic residues in the first 73 amino acids of the protein (29, 30). In particular, arginine 38 probably interacts directly with the RNA target, while lysine 41 contributes significantly toward binding affinity (30). As these residues have been implicated in the NS1-mediated regulation of numerous host-cell processes (Fig. 1B) (3135), we investigated their importance for the interaction of NS1 with p85β. 293T cells were transfected with plasmids expressing either WT V5-tagged PR8/NS1 (18), or a V5-tagged PR8/NS1 construct that lacks RNA binding activity (R38A and K41A amino acid substitutions). Immunoblot analysis of proteins co-precipitated with the anti-V5 antibody revealed that both WT PR8/NS1 and PR8/NS1-R38AK41A efficiently precipitated endogenous p85β (Fig. 2A). As described (18), a PR8/NS1 construct containing the single Y89F substitution is unable to precipitate p85β (Fig. 2A).


Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 1.
Schematic representations of p85β and NS1. A, p85β regulatory subunit of PI3K (724 amino acids long) consists of an N-terminal SH3 domain, a BH domain, and two SH2 domains (N-terminal: nSH2, and C-terminal: cSH2), which flank the inter-SH2 (iSH2) domain. The iSH2 domain binds the p110 catalytic subunit of PI3K. Asterisks denote two proline-rich regions within the p85β protein (2). B, influenza A virus NS1 protein is 230–237 amino acids long depending upon the strain. The N-terminal 73 amino acids form a functional RNA-binding domain (RBD), while the C-terminal effector domain mediates interactions with host-cell proteins. NS1 contains two nuclear localization sequences (black circles, Ref. 46), and a nuclear export sequence (white circle, Ref. 47). Residues involved in RNA-binding (arginine 38 and lysine 41, Refs. 30) are also implicated in the inhibition of cellular 2'-5'-oligo (A) synthetase/RNase L (32), the inhibition of Jun N-terminal kinase (48), and the interaction with/inhibition of RIG-I (33). Additionally, NS1 contains binding sites for: poly(A)-binding protein I (PABI, Ref. 49), p85β (18), protein kinase R (PKR, Ref. 50), 30-kDa subunit of cleavage and polyadenylation specificity factor (CPSF, Ref. 51), poly(A)-binding protein II (PABII, Ref. 52), and PDZ domain-containing proteins (53).

 
To confirm that the entire RNA-binding domain of NS1 is not essential for binding p85β, we tested the in vitro interaction of p85β with recombinant E. coli expressed GST-PR8/NS1 protein lacking the first 72 amino acids of NS1 (termed GST-PR8/NS1{Delta}72). GST-PR8/NS1 fusion proteins (WT, Y89F, or {Delta}72) were immobilized onto glutathione-agarose beads and used to affinity isolate an excess of baculovirus-expressed p85β. SDS-PAGE and Coomassie Blue staining revealed that a single 90-kDa protein (p85β) was specifically isolated by both WT GST-PR8/NS1 and GST-PR8/NS1{Delta}72, but not by the GST-PR8/NS1-Y89F mutant (Fig. 2B). These data indicate that the C-terminal effector domain of NS1 alone is sufficient to form a stable complex with p85β.

NS1 Binds the Inter-SH2 Domain of p85β—To determine the domain of p85β that NS1 targets, we generated N-terminal Myc-tagged constructs corresponding to four domains of p85β: SH3 (amino acids 1–100), nSH2 (amino acids 313–433), iSH2 (amino acids 433–610), and cSH2 (amino acids 611–724). Transient expression of these constructs in 293T cells was followed by affinity isolation using E. coli-expressed WT GST-PR8/NS1. Immunoblot analysis using an anti-Myc antibody revealed that only the inter-SH2 domain of p85β (herein referred to as β-iSH2) was pulled-down by GST-PR8/NS1 (Fig. 3A).


Figure 2
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 2.
The RNA-binding domain of NS1 is not required for the interaction with p85β. A, 293T cells were transfected for 48 h with empty vector (–), a plasmid expressing WT V5-tagged PR8/NS1, or plasmids expressing V5-tagged PR8/NS1 proteins with the amino acid substitutions Y89F or R38AK41A. Soluble antigen extracts were immunoprecipitated with anti-V5 antibody and precipitates separated by SDS-PAGE followed by transfer to polyvinylidene difluoride membrane. Endogenous p85β and V5-tagged NS1 proteins were detected using specific mAbs. B, equal amounts of soluble Sf9 cell lysate (expressing p85β) were mixed with recombinant GST-NS1/Y89F, GST-NS1/WT, or GST-NS1{Delta}72 protein immobilized onto glutathione-agarose beads. After washing, protein complexes were dissociated from the beads and separated by SDS-PAGE through 4–12% polyacrylamide gradient gels. Polypeptides were stained with Coomassie Blue, and protein identification was confirmed by mass spectrometry. Note that polypeptides marked with asterisks are truncated forms of the full-length fusion proteins. Molecular mass markers (kDa) are indicated to the right.

 
To verify the specific interaction between PR8/NS1 and β-iSH2 in a wholly mammalian expression system, [35S]methionine-labeled His6-tagged β-iSH2 and unlabeled His6-tagged PR8/NS1 were synthesized in reticulocyte lysates, mixed, and then immunoprecipitated with anti-NS1 antibody. (Note that: (i) unlabeled PR8/NS1 was used because of the similar molecular weights of PR8/NS1 and β-iSH2; and (ii) β-iSH2 synthesized using this system is expressed in two forms: full-length His6-tagged β-iSH2 and untagged β-iSH2.) SDS-PAGE followed by phosphorimager analysis showed that both forms of β-iSH2 were efficiently precipitated from lysate mixtures containing both β-iSH2 and PR8/NS1, but not from lysates containing β-iSH2 only (Fig. 3B). In addition, we also expressed and purified a recombinant His6-tagged form of β-iSH2 from E. coli (see construct in Fig. 4A), and assessed its ability to compete with full-length p85β for the binding of WT GST-PR8/NS1. As shown in Fig. 3C, the binding of increasing amounts of β-iSH2 to E. coli expressed GST-PR8/NS1 prevented the subsequent interaction of GST-PR8/NS1 with baculovirus-expressed p85β. Overall, these data reveal that β-iSH2 is the primary site of interaction between NS1 and p85β.


Figure 3
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 3.
NS1 binds the inter-SH2 domain of p85β. A, 293T cells were transfected for 48 h with plasmids expressing Myc-tagged domain constructs of p85β: SH3, nSH2, iSH2, or cSH2. Soluble antigen extracts were mixed with GST-NS1 glutathione-agarose beads and the resulting pull-downs were analyzed by SDS-PAGE followed by immunoblotting using an anti-Myc mAb. Input GST-NS1 amount was confirmed by detecting NS1 with a specific pAb. The original soluble antigen extracts were also probed with an anti-Myc mAb in order to assess relative expression of the Myc-tagged constructs. B, in vitro synthesized [35S]methionine-labeled β-iSH2 was mixed with unlabeled PR8/NS1 and immunoprecipitated using anti-NS1 pAb. Immunoprecipitation of β-iSH2 alone acted as a negative control. Protein complexes were separated by SDS-PAGE through 4–12% polyacrylamide gradient gels and subjected to phosphorimager analysis. Note that these in vitro translations produce both full-length His6-tagged β-iSH2 (upper band) and untagged β-iSH2 (lower band). C, inter-SH2 domain of p85β is the primary site of interaction for NS1. GST-NS1 immobilized onto glutathione-agarose beads was mixed with 2-fold increasing amounts of purified His6-tagged β-iSH2 (E. coli expressed). After washing, a fixed amount of soluble p85β-expressing Sf9 cell lysate was added. Subsequent protein complexes were separated by SDS-PAGE, and GST-NS1 and β-iSH2 were visualized by Coomassie Blue staining. Levels of precipitated full-length p85β were determined by immunoblot analysis. Molecular mass markers (kDa) are indicated to the right.

 


Figure 4
View larger version (14K):
[in this window]
[in a new window]

 
FIGURE 4.
Purification of an untagged NS1{Delta}72:β-iSH2 complex. A, schematic representation of the GST-NS1{Delta}72 and His6-tagged β-iSH2 constructs. Numbers refer to residues from full-length PR8/NS1 and p85β. Sites of TEV protease cleavage are indicated. B, SDS-PAGE analysis of the purification process. Co-expressed GST-NS1{Delta}72 and His6-β-iSH2 from E. coli were purified on glutathione-agarose beads and eluted using 10 mM glutathione (i). The eluate was further purified on Ni-NTA resin and eluted in 100 mM imidazole (ii). After TEV protease cleavage (iii), a second glutathione-agarose column was used to remove free GST (~25 kDa) and uncleaved GST-NS1{Delta}72 (iv). A second Ni-NTA column was used to remove His6-TEV (~25 kDa), uncleaved His6-β-iSH2 (~25 kDa), and the small ~2 kDa cleavage product from His6-β-iSH2 (band z). The flow-through (v) contained only two polypeptide species as determined by Coomassie Blue staining, untagged NS1{Delta}72 (band y) and untagged β-iSH2 (band x). Molecular mass markers (kDa) are indicated to the right. C, interaction is independent of NS1 tyrosine 89 phosphorylation. 293T cells were transfected for 48 h with empty vector (–), a plasmid expressing WT V5-tagged PR8/NS1, or plasmids expressing V5-tagged PR8/NS1 proteins with the amino acid substitutions Y89F or Y89E. Soluble antigen extracts were immunoprecipitated with anti-V5 antibody and precipitates separated by SDS-PAGE followed by transfer to polyvinylidene difluoride membrane. Endogenous p85β and V5-tagged NS1 proteins were detected using specific mAbs.

 
In Vitro Purification of a Complex Containing only the C-terminal Effector Domain of NS1 and β-iSH2—To further confirm direct binding between the C-terminal effector domain of NS1 and β-iSH2, we purified an untagged complex of these proteins. Constructs encoding GST-PR8/NS1{Delta}72 and His6-tagged β-iSH2 (see Fig. 4A) were co-expressed in E. coli, and glutathione-agarose beads were used to affinity isolate GST-PR8/NS1{Delta}72 together with any associated proteins. It should be noted that both constructs have a cleavage sequence for the tobacco etch virus (TEV) protease between the protein of interest and the affinity tag. Glutathione eluted the bound proteins (Fig. 4B, lane i), and this eluate was further purified on Ni-NTA resin. After imidazole elution (Fig. 4B, lane ii), the GST and His6 tags were cleaved from the recombinant proteins by TEV protease (Fig. 4B, lane iii). A second glutathione-agarose column removed free GST and uncleaved GST-PR8/NS1{Delta}72 (Fig. 4B, lane iv), while a second Ni-NTA column removed His6-tagged TEV, uncleaved His6-β-iSH2, and the small ~2-kDa cleavage product from His6-β-iSH2. The flow-through from this column contained only two polypeptide species (as revealed by SDS-PAGE and Coomassie Blue staining, Fig. 4B, lane v), which were confirmed as untagged PR8/NS1{Delta}72 and untagged β-iSH2 by mass spectrometry.

The observation that an NS1:β-iSH2 complex can be formed in vitro from E. coli expressed recombinant proteins argues against a phosphorylation-dependent interaction. However, our previous studies had identified that a Y89F mutation in NS1 completely abrogates its interaction with p85β, both in vitro and in vivo (18). As this was highly suggestive of a role for tyrosine 89 phosphorylation in the binding of NS1 to p85β, we investigated this requirement further. Constructs encoding V5-tagged PR8/NS1 with a Y89E amino acid substitution (a mimic for the negative charge of phosphotyrosine), V5-tagged PR8/NS1-Y89F, or V5-tagged WT PR8/NS1 were transiently expressed in human 293T cells and subsequently immunoprecipitated with anti-V5 antibody. Western blot analysis of the immunoprecipitates revealed that only WT PR8/NS1 (and not the Y89F or Y89E mutants) was able to precipitate endogenous p85β (Fig. 4C). Together with the direct in vitro binding results from Fig. 4B, the data imply that phosphorylation of tyrosine 89 is not a determinant of the NS1:p85β interaction, and might even suggest that phosphorylation of tyrosine 89 could potentially prevent binding.

Binding of NS1 to β-iSH2 does not displace the p110 catalytic subunit of PI3K. In our original identification of p85β as a direct binding partner for NS1, we did not detect a polypeptide band corresponding to any p110 isoform in NS1 immunoprecipitates from HEp2 cells (18). This was surprising given that class IA PI3Ks are obligate p85:p110 heterodimers (3, 4). One explanation for this result may be that HEp2 cells express relatively low levels of p110{alpha} protein as compared with other commonly used laboratory cell lines (36). However, given that NS1 was found to interact directly with the p110-binding (iSH2) domain of p85β, the possibility that NS1 might displace p110 subunits from p85β was investigated. To determine initially if NS1 could associate with a functional p110-containing complex, a sensitive kinase activity assay was used. V5-tagged WT PR8/NS1 or PR8/NS1-Y89F were immunoprecipitated from 1321N1 cells stably expressing the appropriate construct (18), and these immunoprecipitates were subjected to in vitro PI3K activity assays (immunoprecipitates from naïve 1321N1 cells acted as a negative control). As shown in Fig. 5A, significant PI3K activity was readily detectable in anti-V5 immunoprecipitates from lysates expressing WT PR8/NS1, but not from naïve lysates, or from lysates expressing PR8/NS1-Y89F (which is unable to bind p85β, Ref. 18).


Figure 5
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 5.
NS1 can form a heterotrimeric complex containing β-iSH2 and p110. A, V5-tagged WT PR8/NS1 or V5-tagged PR8/NS1-Y89F were immunoprecipitated from equal amounts of stably expressing 1321N1 cell lysates and assayed for associated PI3K activity. Naive 1321N1 cell lysate acted as a negative control. Results show the mean and standard deviation of triplicate values obtained in a single experiment, and are representative of two similar experiments. B, individually synthesized [35S]methionine-labeled β-iSH2 and p110{alpha}-ABD (or co-synthesized β-iSH2 and p110{alpha}-ABD) were immunoprecipitated using anti-HA mAb. Labeled complexes were separated by SDS-PAGE through 4–12% polyacrylamide gradient gels and subjected to phosphorimager analysis. C, [35S]methionine-labeledβ-iSH2 and p110{alpha}-ABD were mixed individually (or together) with unlabeled PR8/NS1, and immunoprecipitated using anti-NS1 pAb. Labeled proteins co-precipitating with PR8/NS1 were visualized as for B. Note that both full-length His6-tagged β-iSH2 (upper band) and untagged β-iSH2 (lower band) are synthesized during the in vitro translation procedure.

 
The ability of WT PR8/NS1 (but not PR8/NS1-Y89F) to precipitate PI3K activity is most likely caused by the indirect coprecipitation of a p110 catalytic subunit via p85β. To directly establish this, we next investigated the in vitro formation of a heterotrimeric complex comprising NS1, β-iSH2, and the p85-binding domain of p110{alpha} (also known as the p110{alpha} adaptor binding domain; p110{alpha}-ABD). Initially, [35S]methionine-labeled β-iSH2 and HA-tagged p110{alpha}-ABD were individually or co-synthesized in reticulocyte lysates and immunoprecipitated using anti-HA antibody. SDS-PAGE and phosphorimager analysis showed that β-iSH2 could be specifically co-precipitated together with p110{alpha}-ABD (Fig. 5B), indicating that the β-iSH2 construct was able to interact with p110{alpha}-ABD. We then individually synthesized [35S]methionine-labeled β-iSH2 or p110{alpha}-ABD, as well as unlabeled PR8/NS1. Reticulocyte lysates expressing these proteins were mixed in various combinations and immunoprecipitated with anti-NS1 antibody. Although some minor nonspecific absorption of both β-iSH2 and p110{alpha}-ABD was observed (Fig. 5C, lanes 4 and 5), as expected only β-iSH2 (and not p110{alpha}-ABD) was efficiently co-precipitated directly with PR8/NS1 (Fig. 5C, lanes 6 and 7). However, a significant amount of p110{alpha}-ABD was clearly evident in immunoprecipitates of PR8/NS1 that contained co-precipitating β-iSH2 (Fig. 5C, lane 8). This confirms that the binding of PR8/NS1 to β-iSH2 does not prevent interactions between β-iSH2 and p110{alpha}-ABD, and suggests that a heterotrimeric complex consisting of NS1, p85β, and p110{alpha} could potentially form.

Binding of NS1 to β-iSH2 requires residues at the C-terminal end of β-iSH2. As the interaction between NS1 and β-iSH2 is independent of the p110-binding site (Fig. 5C), we hypothesized that NS1 must bind elsewhere on the molecule. It has previously been shown that truncation of p85{alpha} at residue 571 can cause constitutive p110 catalytic activity (37), which also occurs in the context of an isolated p85{alpha} nSH2-iSH2 fragment (38). Thus, as residues downstream of 571 in the iSH2 domain of p85{alpha} contribute to p85-mediated inhibition of PI3K activation, we investigated if the same region in p85β was required for binding to NS1. Plasmids were generated to express {alpha}-iSH2, β-iSH2, a β-iSH2 construct lacking residues downstream of amino acid 564 (equivalent to truncation at residue 571 in p85{alpha}; termed β-564), and a β-iSH2 construct with residues downstream of amino acid 564 substituted for the equivalent residues in p85{alpha}-iSH2 (termed β/{alpha}-iSH2) (see constructs in Fig. 6A). [35S]Methionine-labeled polypeptides were synthesized in vitro and individually mixed with unlabeled PR8/NS1 before immunoprecipitation with anti-NS1 antibody. As expected from our previous observations (18), β-iSH2, but not {alpha}-iSH2, was specifically co-precipitated with PR8/NS1 (Fig. 6B, lanes 1–6). Interestingly, the truncated β-iSH2 construct (β-564) was not precipitated by PR8/NS1 (Fig. 6B, lanes 7–9), and binding of this construct to PR8/NS1 could not be rescued by addition of the corresponding C-terminal {alpha}-iSH2 residues (Fig. 6B, lanes 10–12). The inability of PR8/NS1 to bind {alpha}-iSH2, β-564, or β/{alpha}-iSH2 is unlikely to be caused by gross nonspecific disruption of their structures, as all these constructs could be co-precipitated with in vitro synthesized HA-tagged p110{alpha}-ABD (Fig. 6C). These data strongly indicate that the C-terminal end of β-iSH2 is specifically required for NS1 binding. However, this C-terminal fragment of β-iSH2 alone could not be co-precipitated with PR8/NS1 (data not shown). Thus, the C terminus of β-iSH2 is absolutely essential, but probably not sufficient, to mediate the interaction with NS1.


Figure 6
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 6.
Interaction between NS1 and β-iSH2 requires residues specific to the C terminus of β-iSH2. A, schematic representation of the various His6-tagged {alpha}-iSH2 and β-iSH2 constructs. Numbers refer to residues from full-length bovine p85{alpha} and p85β. Sites of TEV protease cleavage are indicated with an asterisk.[35S]Methionine-labeled {alpha}-iSH2, β-iSH2, β-564, and β/{alpha}-iSH2 were mixed individually with either unlabeled PR8/NS1 (B) or unlabeled HA-tagged p110{alpha}-ABD (C), and immunoprecipitated using anti-NS1 pAb or anti-HA pAb, as appropriate. Identical procedures in the absence of PR8/NS1 or HA-tagged p110{alpha}-ABD acted as negative controls. Precipitated labeled proteins were visualized as for Fig. 5B. Note that both full-length His6-tagged β-iSH2 (upper band) and untagged β-iSH2 (lower band) are synthesized during the in vitro translation procedure.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We have demonstrated that the direct binding of NS1 to p85β is mediated via the C-terminal effector domain of NS1 and the iSH2 domain of p85β. This concurs with our previous results which identified tyrosine 89 and methionine 93 (both in the C-terminal domain of NS1) as essential for binding p85β (18). We were initially interested in these two residues as they formed part of a putative motif with similarity to the well-documented PI3K SH2-binding motif, phospho-YXXM (39). However, results from this and other studies indicate that the activation of PI3K by NS1 probably does not involve tyrosine-phosphorylated NS1 occupying a p85β SH2 domain. First, an interaction could not be detected between NS1 and either of the two p85β SH2 domains. Secondly, NS1 with glutamic acid substituted as a mimic of phosphotyrosine at residue 89 was unable to bind full-length p85β, and the interaction domains of NS1 and p85β could be expressed and purified as a complex entirely from E. coli. Thirdly, previous YXXM phosphopeptide binding studies have shown relatively conserved pockets in both p85 SH2 domains, which are strongly selective for methionine only at the Tyr+3 position (39). In NS1, the relevant methionine is at the Tyr+4 position and is unlikely to be presented in the appropriate orientation. Finally, structural analysis of the PR8/NS1 effector domain indicates that while tyrosine 89 appears exposed, methionine-93 is mostly buried within the NS1 homodimer (40). It is therefore not possible for methionine 93 to be directly involved in the interaction with p85β without a major conformational change in NS1. The observation that mutation of methionine 93 abrogates p85β binding may therefore be due to destabilization of the NS1 homodimer, as this residue could be important for maintaining functional integrity of the NS1 structure. We are currently investigating this possibility.

Competition assays from this work clearly establish that the principal direct binding site for NS1 in p85β is the iSH2 domain. Previous biochemical studies (5, 41), together with a recently determined x-ray crystallographic structure (42), show that iSH2 is a rigid 100–110 Å coiled-coil consisting primarily of two anti-parallel {alpha}-helices. The helices are ~70 amino acids long (helix-1; residues 434–505, and helix-2; residues 511–581), and are connected by a loop of 5 residues (506–510) (5). At the C-terminal end of helix-2 is a ~30 residue "tail" (helix-3) that links the coiled-coil to the cSH2 domain (42). The acidic nature of this stretch of amino acids may be responsible for it folding back and packing against exposed basic residues at the C terminus of helix-2 (5). Studies to determine the p110-binding site on p85β have indicated essential residues in helix-1 as 445–485 (and in particular 475–477) (5, 42, 43). Important residues for p110 binding in helix-2 (adjacent to the binding site on helix-1) are 525–534 (42, 43) (Fig. 7A).

Truncation of p85{alpha} at residue 571 removes part of helix-2/helix-3 from the iSH2 domain and the whole of cSH2, but leaves the p110-binding site intact. Consequently, this mutant leads to constitutive activation of the resulting p85{alpha}:p110{alpha} heterodimer (37). It is not absolutely clear why this mutant (unlike full-length p85{alpha}) is unable to repress PI3K function. However, one possibility is that deletion of the autoinhibitory phosphorylation site at serine 608 (in the "tail" of iSH2) leads to the deregulated phenotype (13, 44). Alternatively, specific inter- or intrasubunit interactions that repress p110 activity might be lost (38, 45). For example, biophysical results achieved using isolated recombinant p85{alpha} nSH2-iSH2 constructs suggest that the nSH2 domain of p85{alpha} is normally in close contact with residues 581–593 of iSH2, a conformation which could present nSH2 in such a way as to inhibit p110 activity (38). Indeed, a model has recently been proposed whereby kinase activity is negatively regulated by a charge-charge interaction between the p85 nSH2 domain and the p110 helical domain (42) (Fig. 8A). Thus, normal PI3K activation may result from disruption of the nSH2:p110 interaction by competitive receptor-mediated phosphopeptide binding to nSH2 (42) (Fig. 8B). In the context of truncated p85{alpha} lacking residues downstream of 571, nSH2 is unlikely to be positioned in such a way as to suppress p110 lipid kinase function (38).


Figure 7
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 7.
A, sequence alignment of the p85{alpha} and p85β inter-iSH2 domains. Amino acid sequence alignment of the bovine p85{alpha} (SwissProt data bank accession number: P23727) and p85β (SwissProt data bank accession number: P23726) iSH2 domains used in this study. Numbers correspond to residues in the full-length proteins. Assignment of structural helices and residues involved in p110 binding is shown above the sequences. Amino acids that differ between human and bovine p85 homologues are highlighted in black. Sequence identity and homology is shown beneath the sequences. Only 10 amino acids differ between p85{alpha} and p85β in the region of iSH2 that is required for NS1 binding. B, putative NS1-binding site of iSH2. Crystal structure of p85{alpha}-iSH2 in complex with p110{alpha}-ABD, as recently solved by Miled et al. (42). The p85{alpha}-iSH2 helices are colored dark gray, while p110{alpha}-ABD is a lighter shade of gray. Residues of {alpha}-iSH2 equivalent to those required for NS1 to bind β-iSH2 are highlighted. The image was generated using MacPyMol (Protein Data Bank file: 2V1Y).

 


Figure 8
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 8.
A, model of p110 lipid kinase regulation by p85. p110 binds the iSH2 (coiled-coil) domain of p85. Charge-charge contacts between the p85-nSH2 domain and the p110 helical domain maintain p110 in an inactive cytoplasmic state. B, model of receptor-mediated activation of PI3K. Phospho-YXXM motifs in activated growth factor receptors recruit the p85:p110 heterodimer to membranes via p85 SH2 domains. This phosphopeptide binding to p85 relieves the SH2-mediated inhibition of PI3K activity and thereby increases lipid kinase activity. C, proposed hypothetical model of PI3K activation by NS1. NS1 interacts primarily with the C-terminal region of the p85β iSH2 domain, but does not displace p110. Weak secondary interactions with the p85β SH3 domain and cSH2 domain may also occur. The binding of NS1 to β-iSH2 may disrupt the regulatory charge-charge contacts between p85β-nSH2 and p110, thus resulting in receptor-independent PI3K function. Alternatively, NS1 may recruit other essential host-cell proteins into a PI3K-activating complex. It is likely that this must occur at the plasma membrane in order for PI3K lipid substrates to be available.

 
It is intriguing to find that the binding of influenza A virus NS1 protein to the p85β iSH2 domain requires residues equivalent to those lost in the constitutively active p85{alpha} mutant (i.e. part of helix-2 and the acidic "tail" of helix-3) (Fig. 7, A and B). Thus, our data are suggestive of a novel mode-of-action whereby NS1 may potentially bind to this region and mask its contribution to p110 inhibition. Currently the mechanistic details can only be speculated upon: NS1 may modify inter- and intramolecular contacts within the PI3K heterodimer, displace an unknown repressive element, or recruit additional cellular co-stimulatory factors to the complex. However, given the model recently proposed by Miled et al. (42), it is tempting to think that NS1 simply displaces nSH2 from the p110 helical domain (Fig. 8C). Such direct targeting of a mechanical aspect of PI3K regulation would be an efficient way to activate the kinase, as the multiple inputs that normally regulate p85:p110 function would be short-circuited (69, 1113). For example, stimulation of PI3K by NS1 during virus infection would be independent of phosphopeptide binding, thus ensuring that signaling was not linked to host activity, and could occur even if the infected cells were quiescent (when normal receptor signaling might be low). Additionally, NS1 might mask the inhibitory serine 608 autophosphorylation site, and in this way circumvent any automatic negative feedback by p110 (13).

From our data we cannot rule out the possibility that other regions of either full-length NS1 or full-length p85β may play some minor role in the functional interaction in vivo. For example, the RNA-binding domain of NS1 is not absolutely essential for complex formation, but residues within this domain could contribute to NS1:p85β stability and/or the activation of PI3K signaling. Indeed, Ehrhardt et al. (26) noted that transient expression of an NS1 construct containing amino acid substitutions at arginine 38 and lysine 41 induced less PI3K activity (as determined by phospho-Akt levels) than the wild-type construct (26). Additionally, Shin et al. (20) have previously reported the independent co-precipitation of NS1 with both the SH3 and cSH2 domains of p85 (isoform not specified), and have also identified a putative SH3-binding poly-proline motif in the C-terminal effector domain of NS1 (22). Although we did not identify such interactions under our experimental conditions, it is possible that the binding of NS1 to p85β is relatively complex, and dynamic interplay between NS1 and multiple domains of p85β occurs in vivo. Indeed, the hypothetical model proposed here (Fig. 8C), would position NS1 at the C terminus of β-iSH2, potentially bringing it into close proximity with both the SH3 and cSH2 domains of p85. Thus, the observations made by Shin et al. (20, 22) may yet be compatible with this model.

To our knowledge, analogous host-cell or viral proteins that regulate PI3K by interacting with the p85β (or even p85{alpha}) iSH2 domain have yet to be identified. In this regard, it is intriguing to speculate that NS1 may mimic the normal function of an unknown cellular protein. Our ongoing biochemical and structural work aims to establish the mechanism by which NS1-mediated PI3K activation occurs. We are also actively seeking to determine the molecular and biological basis for p85β isoform specificity displayed by NS1, which itself is remarkable given the high protein sequence identity between the p85{alpha} and p85β iSH2 domains (Fig. 7A). It is likely that such studies will provide yet another example of how viruses can help us understand the normal regulation of cellular signaling pathways.


    FOOTNOTES
 
* This work was supported by the Medical Research Council, UK. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Centre for Biomolecular Sciences, University of St. Andrews, St. Andrews, Fife KY16 9ST, UK. Tel.: 44-1334-463407; Fax: 44-1334-462595; E-mail: bgh1{at}st-andrews.ac.uk.

2 The abbreviations used are: PI3K, phosphoinositide 3-kinase; SH, Src homology; BH, B-cell receptor homology; PR8, influenza A virus strain A/Puerto Rico/8/34; {alpha}-iSH2, inter-SH2 domain of p85{alpha}; β-iSH2, inter-SH2 domain of p85β; TEV, tobacco etch virus; GST, glutathione S-transferase; ABD, adapter-binding domain (p85-binding domain); mAb, monoclonal antibody; pAb, polyclonal antibody; WT, wild-type; PIP2, phosphatidylinositol (4,5)-bisphosphate; PIP3, phosphatidylinositol (3,4,5)-trisphosphate. Back


    ACKNOWLEDGMENTS
 
We thank C. Botting (University of St. Andrews, UK) for mass spectrometry services, and B. Vanhaesebroeck (Queen Mary University of London, UK), M. DeFrances (University of Pittsburgh), and H. Lui (University of St. Andrews, UK) for reagents.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Cantley, L. C. (2002) Science 296, 1655–1657[Abstract/Free Full Text]
  2. Vanhaesebroeck, B., Ali, K., Bilancio, A., Geering, B., and Foukas, L. C. (2005) Trends Biochem. Sci. 30, 194–204[CrossRef][Medline] [Order article via Infotrieve]
  3. Yu, J., Zhang, Y., McIlroy, J., Rordorf-Nikolic, T., Orr, G. A., and Backer, J. M. (1998) Mol. Cell. Biol. 18, 1379–1387[Abstract/Free Full Text]
  4. Geering, B., Cutillas, P. R., Nock, G., Gharbi, S. I., and Vanhaesebroeck, B. (2007) Proc. Natl. Acad. Sci. U. S. A. 104, 7809–7814[Abstract/Free Full Text]
  5. Dhand, R., Hara, K., Hiles, I., Bax, B., Gout, I., Panayotou, G., Fry, M. J., Yonezawa, K., Kasuga, M., and Waterfield, M. D. (1994) EMBO J. 13, 511–521[Medline] [Order article via Infotrieve]
  6. Carpenter, C. L., Auger, K. R., Chanudhuri, M., Yoakim, M., Schaffhausen, B., Shoelson, S., and Cantley, L. C. (1993) J. Biol. Chem. 268, 9478–9483[Abstract/Free Full Text]
  7. Rordorf-Nikolic, T., Van Horn, D. J., Chen, D., White, M. F., and Backer, J. M. (1995) J. Biol. Chem. 270, 3662–3666[Abstract/Free Full Text]
  8. Tolias, K. F., Cantley, L. C., and Carpenter, C. L. (1995) J. Biol. Chem. 270, 17656–17659[Abstract/Free Full Text]
  9. Zheng, Y., Bagrodia, S., and Cerione, R. A. (1994) J. Biol. Chem. 269, 18727–18730[Abstract/Free Full Text]
  10. Pleiman, C. M., Hertz, W. M., and Cambier, J. C. (1994) Science 263, 1609–1612[Abstract/Free Full Text]
  11. Gout, I., Middleton, G., Adu, J., Ninkina, N. N., Drobot, L. B., Filonenko, V., Matsuka, G., Davies, A. M., Waterfield, M., and Buchman, V. L. (2000) EMBO J. 19, 4015–4025[CrossRef][Medline] [Order article via Infotrieve]
  12. Cuevas, B. D., Lu, Y., Mao, M., Zhang, J., LaPushin, R., Siminovitch, K., and Mills, G. B. (2001) J. Biol. Chem. 276, 27455–27461[Abstract/Free Full Text]
  13. Foukas, L. C., Beeton, C. A., Jensen, J., Phillips, W. A., and Shepherd, P. R. (2004) Mol. Cell. Biol. 24, 966–975[Abstract/Free Full Text]
  14. Cooray, S. (2004) J Gen Virol 85, 1065–1076[Abstract/Free Full Text]
  15. Ichaso, N., and Dilworth, S. M. (2001) Oncogene 20, 7908–7916[CrossRef][Medline] [Order article via Infotrieve]
  16. Street, A., Macdonald, A., Crowder, K., and Harris, M. (2004) J. Biol. Chem. 279, 12232–12241[Abstract/Free Full Text]
  17. Linnemann, T., Zheng, Y. H., Mandic, R., and Peterlin, B. M. (2002) Virology 294, 246–255[CrossRef][Medline] [Order article via Infotrieve]
  18. Hale, B. G., Jackson, D., Chen, Y. H., Lamb, R. A., and Randall, R. E. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 14194–14199[Abstract/Free Full Text]
  19. Ehrhardt, C., Marjuki, H., Wolff, T., Nurnberg, B., Planz, O., Pleschka, S., and Ludwig, S. (2006) Cell Microbiol. 8, 1336–1348[CrossRef][Medline] [Order article via Infotrieve]
  20. Shin, Y.-K., Liu, Q., Tikoo, S. K., Babiuk, L. A., and Zhou, Y. (2007) J. Gen. Virol. 88, 13–18[Abstract/Free Full Text]
  21. Zhirnov, O. P., and Klenk, H. D. (2007) Apoptosis 12, 1419–1432[CrossRef][Medline] [Order article via Infotrieve]
  22. Shin, Y. K., Li, Y., Liu, Q., Anderson, D. H., Babiuk, L. A., and Zhou, Y. (2007) J. Virol. 81, 12730–12739[Abstract/Free Full Text]
  23. Garcia-Sastre, A. (2005) in Modulation of Host Gene Expression and Innate Immunity by Viruses (Palese, P., ed), pp. 95–107, Springer, New York
  24. Krug, R. M., Yuan, W., Noah, D. L., and Latham, A. G. (2003) Virology 309, 181–189[CrossRef][Medline] [Order article via Infotrieve]
  25. Shin, Y. K., Liu, Q., Tikoo, S. K., Babiuk, L. A., and Zhou, Y. (2007) J. Gen. Virol. 88, 942–950[Abstract/Free Full Text]
  26. Ehrhardt, C., Wolff, T., Pleschka, S., Planz, O., Beermann, W., Bode, J. G., Schmolke, M., and Ludwig, S. (2007) J. Virol. 81, 3058–3067[Abstract/Free Full Text]
  27. Zhu, Z., He, X., Johnson, C., Stoops, J., Eaker, A. E., Stoffer, D. S., Bell, A., Zarnegar, R., and DeFrances, M. C. (2007) Biochem. Biophys. Res. Commun. 358, 66–72[CrossRef][Medline] [Order article via Infotrieve]
  28. Batty, I. H., Fleming, I. N., and Downes, C. P. (2004) Biochem. J. 379, 641–651[CrossRef][Medline] [Order article via Infotrieve]
  29. Qian, X. Y., Chien, C. Y., Lu, Y., Montelione, G. T., and Krug, R. M. (1995) Rna 1, 948–956[Abstract]
  30. Wang, W., Riedel, K., Lynch, P., Chien, C. Y., Montelione, G. T., and Krug, R. M. (1999) Rna 5, 195–205[Abstract]
  31. Donelan, N. R., Basler, C. F., and Garcia-Sastre, A. (2003) J. Virol. 77, 13257–13266[Abstract/Free Full Text]
  32. Min, J. Y., and Krug, R. M. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 7100–7105[Abstract/Free Full Text]
  33. Pichlmair, A., Schulz, O., Tan, C. P., Naslund, T. I., Liljestrom, P., Weber, F., and Reis e Sousa, C. (2006) Science 314, 997–1001[Abstract/Free Full Text]
  34. Talon, J., Horvath, C. M., Polley, R., Basler, C. F., Muster, T., Palese, P., and Garcia-Sastre, A. (2000) J. Virol. 74, 7989–7996[Abstract/Free Full Text]
  35. Wang, X., Li, M., Zheng, H., Muster, T., Palese, P., Beg, A. A., and GarciaSastre, A. (2000) J. Virol. 74, 11566–11573[Abstract/Free Full Text]
  36. Vanhaesebroeck, B., Welham, M. J., Kotani, K., Stein, R., Warne, P. H., Zvelebil, M. J., Higashi, K., Volinia, S., Downward, J., and Waterfield, M. D. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4330–4335[Abstract/Free Full Text]
  37. Jimenez, C., Jones, D. R., Rodriguez-Viciana, P., Gonzalez-Garcia, A., Leonardo, E., Wennstrom, S., von Kobbe, C., Toran, J. L. L. R. B., Calvo, V., Copin, S. G., Albar, J. P., Gaspar, M. L., Diez, E., Marcos, M. A., Downward, J., Martinez, A. C., Merida, I., and Carrera, A. C. (1998) EMBO J. 17, 743–753[CrossRef][Medline] [Order article via Infotrieve]
  38. Shekar, S. C., Wu, H., Fu, Z., Yip, S. C., Nagajyothi, Cahill, S. M., Girvin, M. E., and Backer, J. M. (2005) J. Biol. Chem. 280, 27850–27855[Abstract/Free Full Text]
  39. Songyang, Z., Shoelson, S. E., Chaudhuri, M., Gish, G., Pawson, T., Haser, W. G., King, F., Roberts, T., Ratnofsky, S., Lechleider, R. J., Neel, B. G., Birge, R. B., Fajardo, J. E., Chou, M. M., Hanafusa, H., Schaffhausen, B., and Cantley, L. C. (1993) Cell 72, 767–778[CrossRef][Medline] [Order article via Infotrieve]
  40. Bornholdt, Z. A., and Prasad, B. V. (2006) Nat. Struct. Mol. Biol. 13, 559–560[CrossRef][Medline] [Order article via Infotrieve]
  41. Fu, Z., Aronoff-Spencer, E., Backer, J. M., and Gerfen, G. J. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 3275–3280[Abstract/Free Full Text]
  42. Miled, N., Yan, Y., Hon, W. C., Perisic, O., Zvelebil, M., Inbar, Y., Schneidman-Duhovny, D., Wolfson, H. J., Backer, J. M., and Williams, R. L. (2007) Science 317, 239–242[Abstract/Free Full Text]
  43. Fu, Z., Aronoff-Spencer, E., Wu, H., Gerfen, G. J., and Backer, J. M. (2004) Arch Biochem. Biophys. 432, 244–251[CrossRef][Medline] [Order article via Infotrieve]
  44. Carpenter, C. L., Auger, K. R., Duckworth, B. C., Hou, W. M., Schaffhausen, B., and Cantley, L. C. (1993) Mol. Cell. Biol. 13, 1657–1665[Abstract/Free Full Text]
  45. Chan, T. O., Rodeck, U., Chan, A. M., Kimmelman, A. C., Rittenhouse, S. E., Panayotou, G., and Tsichlis, P. N. (2002) Cancer Cell 1, 181–191[CrossRef][Medline] [Order article via Infotrieve]
  46. Greenspan, D., Palese, P., and Krystal, M. (1988) J. Virol. 62, 3020–3026[Abstract/Free Full Text]
  47. Li, Y., Yamakita, Y., and Krug, R. M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 4864–4869[Abstract/Free Full Text]
  48. Ludwig, S., Wang, X., Ehrhardt, C., Zheng, H., Donelan, N., Planz, O., Pleschka, S., Garcia-Sastre, A., Heins, G., and Wolff, T. (2002) J. Virol. 76, 11166–11171[Abstract/Free Full Text]
  49. Burgui, I., Aragon, T., Ortin, J., and Nieto, A. (2003) J. Gen. Virol. 84, 3263–3274[Abstract/Free Full Text]
  50. Min, J. Y., Li, S., Sen, G. C., and Krug, R. M. (2007) Virology 363, 236–243[CrossRef][Medline] [Order article via Infotrieve]
  51. Twu, K. Y., Noah, D. L., Rao, P., Kuo, R. L., and Krug, R. M. (2006) J. Virol. 80, 3957–3965[Abstract/Free Full Text]
  52. Chen, Z., Li, Y., and Krug, R. M. (1999) EMBO J. 18, 2273–2283[CrossRef][Medline] [Order article via Infotrieve]
  53. Obenauer, J. C., Denson, J., Mehta, P. K., Su, X., Mukatira, S., Finkelstein, D. B., Xu, X., Wang, J., Ma, J., Fan, Y., Rakestraw, K. M., Webster, R. G., Hoffmann, E., Krauss, S., Zheng, J., Zhang, Z., and Naeve, C. W. (2006) Science 311, 1576–1580[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
Z. Xing, C. J. Cardona, S. Adams, Z. Yang, J. Li, D. Perez, and P. R. Woolcock
Differential regulation of antiviral and proinflammatory cytokines and suppression of Fas-mediated apoptosis by NS1 of H9N2 avian influenza virus in chicken macrophages
J. Gen. Virol., May 1, 2009; 90(5): 1109 - 1118.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
B. G. Hale, R. E. Randall, J. Ortin, and D. Jackson
The multifunctional NS1 protein of influenza A viruses
J. Gen. Virol., October 1, 2008; 89(10): 2359 - 2376.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Das, L.-C. Ma, R. Xiao, B. Radvansky, J. Aramini, L. Zhao, J. Marklund, R.-L. Kuo, K. Y. Twu, E. Arnold, et al.
Structural basis for suppression of a host antiviral response by influenza A virus
PNAS, September 2, 2008; 105(35): 13093 - 13098.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. Alminaite, V. Backstrom, A. Vaheri, and A. Plyusnin
Oligomerization of hantaviral nucleocapsid protein: charged residues in the N-terminal coiled-coil domain contribute to intermolecular interactions
J. Gen. Virol., September 1, 2008; 89(9): 2167 - 2174.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Li, D. H. Anderson, Q. Liu, and Y. Zhou
Mechanism of Influenza A Virus NS1 Protein Interaction with the p85{beta}, but Not the p85{alpha}, Subunit of Phosphatidylinositol 3-Kinase (PI3K) and Up-regulation of PI3K Activity
J. Biol. Chem., August 22, 2008; 283(34): 23397 - 23409.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/3/1372    most recent
M708862200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hale, B. G.
Right arrow Articles by Randall, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hale, B. G.
Right arrow Articles by Randall, R. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2008 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement