HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 283, Issue 30, 20733-20744, July 25, 2008

This Article Free via Author's Choice: AC AC Abstract Full Text (PDF) AC All Versions of this Article: 283/30/20733    most recent M802254200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Singh, A. Articles by Koschak, A. Search for Related Content PubMed PubMed Citation Articles by Singh, A. Articles by Koschak, A. Social Bookmarking                      What's this?

Modulation of Voltage- and Ca²⁺-dependent Gating of Ca_V1.3 L-type Calcium Channels by Alternative Splicing of a C-terminal Regulatory Domain^*

Anamika Singh, Mathias Gebhart, Reinhard Fritsch, Martina J. Sinnegger-Brauns, Chiara Poggiani, Jean-Charles Hoda, Jutta Engel^¶, Christoph Romanin, Jörg Striessnig, and Alexandra Koschak¹

From the Institute of Pharmacy, Pharmacology, and Toxicology, and Center for Molecular Biosciences, University of Innsbruck, Peter-Mayr-Strasse 1/I, A-6020 Innsbruck, Austria, Institute of Biophysics, University of Linz, Altenbergerstrasse 69, A-4040 Linz, Austria, and ^¶Institute of Physiology II and Tübingen Hearing Research Centre, University of Tübingen, D-72076 Tübingen, Germany

Received for publication, March 21, 2008 , and in revised form, May 13, 2008.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Low voltage activation of Ca_V1.3 L-type Ca²⁺ channels controls excitability in sensory cells and central neurons as well as sinoatrial node pacemaking. Ca_V1.3-mediated pacemaking determines neuronal vulnerability of dopaminergic striatal neurons affected in Parkinson disease. We have previously found that in Ca_V1.4 L-type Ca²⁺ channels, activation, voltage, and calcium-dependent inactivation are controlled by an intrinsic distal C-terminal modulator. Because alternative splicing in the Ca_V1.3 1 subunit C terminus gives rise to a long (Ca_V1.3₄₂) and a short form (Ca_V1.3_42A), we investigated if a C-terminal modulatory mechanism also controls Ca_V1.3 gating. The biophysical properties of both splice variants were compared after heterologous expression together with β3 and 21 subunits in HEK-293 cells. Activation of calcium current through Ca_V1.3_42A channels was more pronounced at negative voltages, and inactivation was faster because of enhanced calcium-dependent inactivation. By investigating several Ca_V1.3 channel truncations, we restricted the modulator activity to the last 116 amino acids of the C terminus. The resulting Ca_V1.3_C116 channels showed gating properties similar to Ca_V1.3_42A that were reverted by co-expression of the corresponding C-terminal peptide C₁₁₆. Fluorescence resonance energy transfer experiments confirmed an intramolecular protein interaction in the C terminus of Ca_V1.3 channels that also modulates calmodulin binding. These experiments revealed a novel mechanism of channel modulation enabling cells to tightly control Ca_V1.3 channel activity by alternative splicing. The absence of the C-terminal modulator in short splice forms facilitates Ca_V1.3 channel activation at lower voltages expected to favor Ca_V1.3 activity at threshold voltages as required for modulation of neuronal firing behavior and sinoatrial node pacemaking.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Ca²⁺ influx through voltage-gated L-type Ca²⁺ channels (LTCCs)² regulates numerous physiological functions, including muscle contraction, hormone release, neuronal firing and plasticity, sensory function, and cardiac pacemaking (1). Four pore-forming 1 subunit isoforms (Ca_V1.1–Ca_V1.4) with different biophysical properties and expression profiles evolved to adjust LTCC Ca²⁺ signals to cellular needs. Ca_V1.3 channels play a unique role for hearing (sensory signaling in cochlear inner hair cells (IHC)) and sinoatrial node (SAN, diastolic depolarization) function (2). Ca_V1.3 channels appear ideally suited for these functions because the operating range of both IHCs and SAN cells is within a voltage range of about –60 and –40 mV where these channels can conduct inward current because of their negative activation range (Refs. 3–5 and for review see Ref. 6). In neurons, Ca_V1.3 channels also serve pacemaker function and shape neuronal firing (7, 8). Ca²⁺ influx through LTCCs is limited by a Ca²⁺-dependent feedback mechanism, the so-called calcium-dependent inactivation (CDI) (9). CDI develops in response to local or global elevations of intracellular Ca²⁺ sensed by channel-bound calmodulin (10, 11). However, moderation of CDI is an important prerequisite in some cells, such as in IHCs (Ca_V1.3; 12–14) and in retinal photoreceptors (Ca_V1.4), where slow inactivation of I_Ca is required for sensory signaling. In Ca_V1.4 channels, CDI is completely prevented by an intrinsic gating modulator located in the Ca_V1.41 C terminus, and CDI is restored in C-terminal truncation mutants (15, 16). This C-terminal gating modulator (CTM) not only prevents CDI but also shifts the activation voltage range to more positive potentials (15). Gating modulation seems not to be limited to Ca_V1.4 because co-expression of C-terminal fragments of Ca_V1.2 channels also shifts their activation range to more positive voltages and inhibits pore opening (17). Because C termini of Ca_V1.2 (and also Ca_V1.1) 1 subunits are proteolytically cleaved (18–20) but remain noncovalently bound to proximal C-terminal domains, they may serve as autoinhibitory modules (17, 21).

We hypothesized that Ca_V1.3 function may also be fine-tuned by a CTM domain similar to Ca_V1.1, Ca_V1.2, and Ca_V1.4. Unlike for other LTCC 1 subunits, alternative splicing generates Ca_V1.3 1 subunits with long (usage of exon 42, Ca_V1.3₄₂) or short (usage of exon 42A, Ca_V1.3_42A) C termini. A CTM would therefore confer different biophysical properties on Ca_V1.3 only if present as in certain (i.e. long) variants.

Here we provide unequivocal evidence that an intramolecular protein-protein interaction gives rise to substantial gating differences between Ca_V1.3₄₂ and Ca_V1.3_42A. Our finding that the long and the short splice variants are expressed in several mouse and human tissues suggests that both contribute to fine-tuning of physiological Ca_V1.3 channel function.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Cloning of cDNA Constructs
To generate splice variant Ca_V1.3_42A, the alternatively spliced exon 42A was introduced into Ca_V1.3 cDNA (Ca_V1.3₄₂ = human Ca_V1.3_8A as in Ref. 4, GenBank^TM accession number EU363339 [GenBank] ) by co-ligating an EcoRI-BamHI-cut PCR product containing exon 42A from a rat brain 1 subunit (GenBank^TM accession number M57682 [GenBank] ) with HindIII-EcoRI-cut Ca_V1.3 cDNA into HindIII-BamHI (4622–7100)-cut Ca_V1.3-pBS vector. The rat exon 42A amino acid sequence is identical to its human homologue. Human Ca_V1.3 containing exon 42A was subsequently cloned into vector pGFP^– (wild type) short form of the Ca_V1.3 protein (4). For analyzing the effects of exon 44, amino acid residues RTRYYETYI were introduced into an untagged construct containing the long Ca_V1.3 C terminus after position 1787 using standard PCR techniques. Ca_V1.3_C473, Ca_V1.3_C158, Ca_V1.3_C116, and Ca_V1.3_C76 channels were constructed by introducing stop codons into untagged Ca_V1.3₄₂ at respective amino acid positions 1665, 1980, 2022, and 2062 followed by artificial restriction sites as follows: BamHI* for Ca_V1.3_C158 and Ca_V1.3_C76, HpaI* for Ca_V1.3_C116, and XhoI* for Ca_V1.3_C473. Peptides GFP-C₁₅₈, GFP-C₁₁₆, and GFP-C₇₆ were constructed by ligating HindIII*-SalI*-flanked PCR products corresponding to amino acids 1980–2137, 2022–2137, and 2062–2137 of Ca_V1.3₄₂ into the pGFP⁺ plasmid resulting in the corresponding GFP-tagged Ca_V1.3 C-terminal peptides (22). For FRET analysis, all C-terminal Ca_V1.3 fragments were cloned either into the mammalian expression vector pEYFP-C1 for N-terminal EYFP labeling or vector pECFP-N1 for C-terminal enhanced CFP labeling (Clontech). N-terminally EYFP-labeled constructs 5'-HindIII* and 3'-SalI* restriction sites flanking nucleotide sequences corresponding to the following Ca_V1.3 amino acid positions were introduced and cloned into HindIII-SalI-cut vector pEYFP-C1 as follows: peptide EF-preIQ-IQ-postIQ, amino acids 1453–2137; EF-preIQ-IQ, amino acids 1453–1623; and EF-preIQ-IQ-PCRD, amino acids 1453–1664. To construct peptide EF-preIQ-IQ-PCRD^RRQQ, arginines at positions 1640 and 1641 were mutated to glutamines by splicing by overlapping extension-PCR. For C₁₅₈-CFP and C₁₁₆-CFP, 5'-EcoRI* and 3'-BamHI* restriction sites were introduced to flanking nucleotide sequences corresponding to Ca_V1.3 amino acid positions 1980–2137 and 2022–2137 and cloned into EcoRI-BamHI-cut vector pECFP-N1. To generate enhanced CFP-C₁₁₆^DEQQ, aspartate and glutamate at positions 2073 and 2076 were mutated to glutamines by splicing by overlapping extension-PCR. Integrity of all constructs was confirmed by DNA sequencing (MWG Biotec, Martinsried, Germany). Construct Ca_V1.3₄₂ was subjected to full-length sequence analysis. Numbering of amino acids or nucleotide positions in all constructs refers to GenBank^TM accession number EU363339. Asterisks indicate artificial restriction sites introduced by PCR.

Qualitative RT-PCR
Mouse tissue was prepared from C57B/6N wild-type mice. Total RNA was isolated from whole-brain and brain sub-regions using the RNAqueos®-4PCR kit (Ambion, Foster City, CA). After DNase I treatment, RNA integrity was checked by the quality of the 28 S and 18 S rRNA bands on a denaturing agarose gel. Organ of Corti mRNA was prepared from P4 or P19 mice as described in Ref. 23. Human total RNAs from brain, heart, pancreas, and retina were purchased from Clontech. One µg of total RNA was used for first strand cDNA synthesis by reverse transcriptase (RevertAid^TM H Minus First Strand cDNA synthesis kit, MBI; Fermentas, Hanover, Germany) and random hexamer primers. For PCR analysis, the forward (fwd) primer was located in exon 39 (GenBank^TM accession number NM_028981 [GenBank] for mouse and EU363339 [GenBank] for human). To differentiate between Ca_V1.3₄₂ and Ca_V1.3_42A, specific reverse (rev) primers were designed, located either in exon 42 or 42A. The following primers were used for mouse: fwd primer, 5'-CAACCCTGTTTGCTTTGGTC-3', and rev primer for exon 42, 5'TATAGCCCGTCGGATTTCTG-3' (332-bp product); rev primer for exon 42A, 5'-CTTCCTTCCGGAGGAGTGC-3' (483-bp product). The following primers were used for human: fwd primer, 5'-AACCCTGTTTGCTTTGGTTC-3', rev primer for exon 42, 5'-TATAGCACGCCGGATTTCTG-3' (331-bp product); rev primer for exon 42A, 5'-CCACCTTCCGGAGGAGTG-3' (488-bp product). In mouse organ of Corti, splice variants were also detected with the following primer pairs: exon 42 fwd primer, 5'-CTGCTTGACCAAGTTGTCCCTCCA-3', rev primer, 5'-CTACAAGGTGGTAATGCAAATCAT-3'; exon 42A, fwd primer, 5'-CGCGGATCCTACTTGACCAAGTTGTCCC-3'; rev primer, 5'-CGCAAGCTTCTAGAGCATCCGTTCAAGC-3'. Mouse and human GAPDH was used as positive control as follows: for mouse (GenBank^TM accession number NM_008084 [GenBank] ), fwd primer, 5'-ACTCCACTCACGGCAAATTC-3', rev primer 5'-CACATTGGGGGTAGGAACAC-3' (572-bp product); for human (GenBank^TM accession number NM_002046 [GenBank] ), fwd primer, CAATGACCCCTTCATTGACC, rev primer, 5'-GAGGCAGGGATGATGTTCTG-3' (531-bp product). 500 ng (2.7 µg for organ of Corti) of reverse-transcribed cDNA was used as template for each PCR. Samples without template were used as contamination control. The following PCR program was used: 94 °C for 3 min, 40 cycles of 94 °C for 45 s, 55 °C for 45 s, and 68 °C for 1 min, followed by an elongation step of 68 °C for 10 min. PCRs were performed using BioTherm^TM TaqDNA polymerase (GeneCraft, Lüdinghausen, Germany) in the presence of 1.5 mM MgCl₂. The resulting PCR products were subcloned into pGEM-T Easy vectors (Promega, Mannheim, Germany) and sequenced.

Quantitative RT-PCR
RNA Isolation and cDNA Preparation—Tissue from three adult male c57BL/6N mice (3–6 months) was used for whole-brain and brain sub-region cDNA preparations. Total RNA and cDNA were prepared as described (24).

Quantitative RT-PCR—The relative abundance of different Ca_V1.3 mRNAs was assessed by TaqMan quantitative PCR (50 cycles) using a standard curve method as described (24). TaqMan gene expression assays, designed to span exon-exon boundaries, were purchased from Applied Biosystems (Foster City, CA). Assessment of mouse GAPDH transcripts was included as efficiency reference. Assay identification numbers are as follows: exon 42, Mm0551393_m1 (efficiency (E) = 103.6%); exon 42A (E = 98.7%), custom-designed (fwd primer, 5'-GGAAGTACCCTGCGAAGAACAC-3'; probe, 5'-TTGCCCTACAGATGCTTG-3'; rev primer, 5'-CTCAGGCAGAGAACTCTAAAGCAT-3'); GAPDH, Mm99999915_g1. To amplify specific cDNA templates from the analyzed tissues for the standard curves of each assay, primer pairs were as follows: exon 42 fwd primer, 5'-CAACCCTGTTTGCTTTGGTC-3', rev primer, 5'-TGATTGACATGGTTTCCAAGC-3'; exon 42A fwd primer, 5'-CAACCCTGTTTGCTTTGGTC-3', rev primer, 5'-CTTCCTTCCGGAGGAGTGC-3'. Analysis was carried out in triplicate.

Cell Culture and Transient Expression—HEK-293 (tsA-201) cells were cultured and transfected as described previously (4). Untagged Ca_V1.31 constructs were expressed together with β3 (or β2a) and ₂ 1 subunits (4). In co-expression studies, GFP-labeled C-terminal Ca_V1.3 fragments were used to ensure the presence of the corresponding C-terminal peptide in the cell recorded. Immunoblotting was performed as described previously (25) using a generic anti-1 sequence-directed antibody as described previously (4). All constructs were expressed with the expected molecular mass.

Electrophysiological Recordings—Whole-cell patch clamp recordings in transiently transfected HEK-293 (tsA-201) cells were performed 2–3 days after transfection using either 15 mM Ba²⁺ or Ca²⁺ as charge carrier as described in Ref. 4. Recording solutions were composed as follows (in mM): intracellular solution, 135 CsCl, 10 Cs-EGTA, 1 MgCl₂ adjusted to pH 7.4 with CsOH (311 mosM); bath solution, 15 BaCl₂, 10 HEPES, 150 choline-Cl, and 1 MgCl₂, adjusted to pH 7.4 with CsOH (358 mosM). Transfected cells were visualized by co-expression of GFP or GFP- or YFP-labeled constructs co-expressed with the channel complex as indicated. Current-voltage (I-V) relationships were obtained by holding cells at a potential of –90 mV before applying 50-ms or 300-ms pulses to various test potentials. I-V curves were fitted to the equation I = G_max(V – V_rev)/{1 + exp((V – V_0.5act)/k)}, where V_rev is the extrapolated reversal potential; V is the test potential; I is the peak current amplitude; G_max is the maximum slope conductance; V_0.5,act is the half-maximal activation voltage; and k is the slope factor. Percentage of inactivation was determined at specified time points during depolarizing pulses from a holding potential of –90 mV to the peak current potential (V_max) of the I–V relation of the individual cell. The voltage dependence of inactivation was assessed by application of a 20-ms test pulse to V_max before and after holding cells at various conditioning test potentials for 5 s. Steady-state inactivation curves were analyzed using the Boltzmann relationship I = I_SS + (1 – I_SS)/(1 + exp(V – V_0.5,inact/k_inact)), where I is the peak current amplitude; I_SS is the noninactivating fraction; V is the membrane potential; V_0.5,inact is the half-inactivation potential; and k_inact is the slope factor. To investigate Ca_V1.3₄₂ and Ca_V1.3_42A gating properties, head-to-head analysis was performed time-independently by two investigators. Experiments showing currents bigger than 3 nA were prospectively excluded from analysis of activation and inactivation parameters to guarantee high quality voltage clamp. CDI was quantified as the current remaining at the end of 250-ms depolarizations to different test potentials, expressed as fraction of peak current amplitude (r₂₅₀). Parameter f was defined as the difference between r₂₅₀ values of I_Ba and I_Ca at +10 mV. CDI experiments were performed on different cells, but effects were the same when the charge carrier was switched from Ba²⁺ to Ca²⁺ on the same cell in representative experiments. All voltages were corrected for the liquid junction potential.

Confocal FRET Microscopy
Confocal FRET microscopy was performed as described previously (15). As negative controls, peptide YFP-EF-PreIQ-IQ-PCRD was co-expressed with CFP alone (CFP control), and probes CFP-C₁₅₈ or CFP-C₁₁₆ with YFP alone (YFP controls 1 and 2). Image analysis was accomplished using a self-made program integrated in MatLab 7 based on the FRET analysis algorithm proposed (26). Interaction between fragments was considered when a significant difference to the CFP as well as the corresponding YFP control was observed. The local ratio between CFP and YFP might vary because of different local expression levels of the different protein constructs, which could affect calculation of FRET values. Therefore, analysis was limited to pixels with a CFP:YFP molar ratio between 1:10 and 10:1.

Statistical Analysis
Data were analyzed using Clampfit® 9.0 (Molecular Devices, Union City, CA) and Microcal Origin® 5.0 (Northampton, MA). Significant difference between the two splice variants was assessed a priori by pairwise comparison before other truncation constructs to characterize the modulatory mechanism were made. Student's t test or Mann-Whitney test were used for comparison between two groups for parametric and nonparametric data, respectively. Statistical significance was determined using one-way ANOVA followed by Bonferroni post-test, except if stated otherwise. Statistical significance was set at p < 0.05. All data are presented as mean ± S.E. for the indicated number of experiments.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Ca_V1.3 C-terminal Modulator Affects Voltage-dependent Channel Activity—To test for the presence of a C-terminal modulator (CTM), we employed two previously described naturally occurring Ca_V1.3 1 subunit splice variants, Ca_V1.3₄₂ and Ca_V1.3_42A (also termed Ca_V1.3a and Ca_V1.3b, respectively (5, 27, 28)), which differ with respect to the length of their C termini, as illustrated in Fig. 1a. Similar to the Ca_V1.4 truncation mutant K1591X (15), Ca_V1.3_42A terminates shortly after the IQ motif and lacks most of a homologous region (termed PCRD) previously found to participate in the binding of distal C-terminal sequences in Ca_V1.2 (17). Wild-type long and short Ca_V1.3 1 subunits were expressed in HEK-293 cells together with β3 (or β2a) and 2 1. β3 subunits were selected because we have previously shown that they form a large fraction of dihydropyridine-sensitive LTCCs in the brain (29). Both 1 subunits migrated with the expected molecular mass in Western blots of HEK-293 cell preparations (Fig. 1b).

View larger version (30K): [in this window] [in a new window]   FIGURE 1. C-terminal splice variants CaV1.342 and CaV1.342A. a, alternative usage of exon 42 results in either full-length (exon 42, black) or C-terminally truncated (exon 42A, gray) CaV1.3 channels. Arrows indicate the approximate position of forward (fwd) and reverse (rev) PCR primers used in Fig. 8. b, immunoblot of both splice variants expressed together with β3 and 21 subunits in HEK-293 cells, as described under "Experimental Procedures." Mock-transfected cells (mock) were used to show specificity of immunoreactivity. One representative experiment out of four is shown.

View larger version (27K): [in this window] [in a new window]   FIGURE 2. Activation and steady-state inactivation properties of CaV1.342 compared with CaV1.342A channels. a, normalized mean I-V curves of ICa for CaV1.342 (black) and CaV1.342A (gray) channels. Activation parameters and statistics are given in Table 1. The dotted line describes the fit to a normalized I-V curve of ICa for CaV1.2 in comparison: V0.5,act, 8.8 mV; kact, –11.0 mV. Cell, 111d_16. b, representative current traces for ICa (300-ms depolarization to indicated test potentials). Cells: CaV1.342, 196l_23; CaV1.342A, 196l_32. c, V0.5,act for CaV1.342A was independent from current density. d, exemplar ON-gating currents for CaV1.342 and CaV1.342A with similar IBa amplitudes measured by depolarizing cells to Vrev. One representative out of six experiments is shown. Cells: CaV1.342, 207l_34; CaV1.342A, 237k_26. e, steady-state inactivation curves for CaV1.342 and CaV1.342A. Activation curves were obtained from parameters in a. Solid lines are fits to the Boltzmann relationship (see "Experimental Procedures"). Statistics are given under "Results." Error bars reflect S.E.

Ca_V1.3 C Terminus Modulates Ca²⁺-dependent Inactivation Properties—As already obvious from the representative current traces in Fig. 2b, Ca_V1.3_42A channels inactivate faster during depolarization to different test potentials than Ca_V1.3₄₂ channels. This is also evident from a detailed comparison of I_Ca inactivation during 10-s pulses to the maximum of the I-V curve (V_max) (Fig. 3, a and b; Table 3). The difference was most pronounced during the first 30 ms (% inactivation: Ca_V1.3₄₂, 27.5 ± 1.9, n = 16; Ca_V1.3_42A, 73.6 ± 1.9, n = 19, p < 0.001; Fig. 3, a, inset, and b, and Table 3). Inactivation included an initial fast component followed by a slow component in both isoforms. Inactivation was not complete even during 10 s (Ca_V1.3₄₂, 96.9 ± 0.7%, n = 14; Ca_V1.3_42A, 98.1 ± 0.3%, n = 17; one sample t test, compared with 100%: p = 0.0006 for Ca_V1.3₄₂ and p = 0.0001 for Ca_V1.3_42A) suggesting that some Ca²⁺ influx through Ca_V1.3 channels may persist even during extended periods of strong depolarization. Faster I_Ca inactivation of Ca_V1.3_42A was also seen at physiologically more relevant potentials, as indicated by a significant decrease in integrated I_Ca during 300-ms test pulses (Fig. 3c). Note that voltage dependence of activation and inactivation is shifted by 15 mV to more positive voltages under our recording conditions (5). Therefore, –20 mV corresponds to about –35 mV at physiological Ca²⁺ concentrations.

View larger version (32K): [in this window] [in a new window]   FIGURE 3. Inactivation properties of CaV1.342 and CaV1.342A channel-mediated currents. a, representative current traces of CaV1.342 (black) and CaV1.342A (gray) ICa evoked by a 10-s depolarization to Vmax. The inset illustrates inactivation during initial 30 ms. Cells: CaV1.342, 316h_51; CaV1.342A, 187g_46. b, percent ICa inactivation during 0.03-, 0.25-, 1-, and 5-s test pulses to Vmax. ***, p 0.001, Student's t test. c, normalized representative ICa traces at physiologically relevant potentials (–20 mV; corresponding to –35 mV at physiological Ca2+ concentrations; see "Results"). Cells: CaV1.342, 196l_23; CaV1.342A, 187g_17. Integrated current corresponding to the area under normalized ICa during a 300-ms pulse is shown. Statistically significant difference: ***, p 0.001, Unpaired t test. d, percent IBa inactivation during 0.03-, 0.25-, 1-, and 5-s test pulses to Vmax. *, p < 0.05; **, p < 0.01, Student t test. e, voltage dependence of CDI for CaV1.342 (left) and CaV1.342A (right): r250 corresponds to the fraction of ICa or IBa remaining after 250 ms; f is the difference between r250 values at +10 mV (for statistics see "Results" and Table 3). Number of experiments is given in parentheses. Error bars reflect S.E.

From these data we conclude that the faster inactivation of I_Ca observed for Ca_V1.3_42A must be due to more pronounced CDI. As a quantitative measure of CDI, we analyzed the fraction of I_Ca through Ca_V1.3 channels remaining after a 250-ms depolarization (r₂₅₀) in a wide voltage range (Fig. 3e). A typical U-shaped dependence on test voltage was observed for both splice variants, but it was more pronounced for Ca_V1.3_42A channels (f = 0.60 ± 0.07 versus 0.25 ± 0.11 at 10 mV for Ca_V1.3₄₂ channels). In agreement with a previous report (13), Ca_V1.3 CDI was CaM-mediated. I_Ca inactivation of Ca_V1.3_42A channels was dramatically slowed by co-expression of YFP-labeled dominant-negative CaM (CaM₁₂₃₄) (r₂₅₀ at V_max:Ca_V1.3_42A + CaM₁₂₃₄, 0.76 ± 0.061%, n = 5, p < 0.0001, Student's t test versus Ca_V1.3_42A) thus approaching r₂₅₀ values for I_Ba (for comparison see Fig. 3e). CaM₁₂₃₄ did not affect the hyperpolarizing shift of the I_Ca activation (V_0.5,act:Ca_V1.3_42A + CaM₁₂₃₄: –16.3 ± 0.5 mV, n = 8) suggesting that the shift in activation voltage occurs independent of CaM as also shown previously for Ca_V1.4 (15). Taken together, these data provide unequivocal evidence that the CTM in Ca_V1.3 channels not only modulates its activity range but also moderates CDI.

Ca_V1.3 CTM Lies within the Most Distal C-terminal Domain Highly Conserved in LTCCs—To further strengthen this hypothesis and pinpoint important structural domains, we tested if different C-terminal truncations exhibit similar gating effects. In accordance to the C-terminal peptide C₁₂₂ important for Ca_V1.4 channel modulation (15), we deleted the corresponding distal 158 amino acids of Ca_V1.3₄₂. The resulting Ca_V1.3_C158 channels exhibited I_Ca and I_Ba activation properties comparable with Ca_V1.3_42A (Tables 1 and 2). For I_Ca, k_act significantly decreased (Ca_V1.3_C158: –7.4 ± 0.2, n = 9; p < 0.001; Table 1), and V_0.5,act (Ca_V1.3_C158: –14.3 ± 0.4 mV, n = 9, p < 0.001; Table 1) shifted to more hyperpolarized voltages. Like in Ca_V1.3_42A, I_Ca inactivation was faster, and CDI was more pronounced, and I_Ba was slowed (for all data and statistics see Tables 1, 2, 3).

To prove the modulatory role of the last 158 amino acid residues, we tested the capability of this C-terminal fragment to restore the gating changes induced by the truncation. Therefore, GFP-fused peptide (GFP-C₁₅₈) was expressed together with the respective truncated channel. GFP-C₁₅₈ reverted the gating changes observed in Ca_V1.3_C158 channels to values similar to Ca_V1.3₄₂; the hyperpolarizing shift of the I_Ca activation curve was reversed (V_{0.5, act}:Ca_V1.3_C158 + GFP-C₁₅₈, –0.8 ± 1.4 mV n = 8, p = 0.3 versus Ca_V1.3₄₂; see Table 1); I_Ca inactivation was slowed (during 30 ms: Ca_V1.3_C158 + GFP-C₁₅₈; 23.5 ± 1.9%, n = 8, p = 0.2 versus Ca_V1.3₄₂; see Table 3), and CDI was less pronounced as indicated by the decrease of the f value (at 10 mV, Ca_V1.3_C158 + GFP-C₁₅₈, 0.2 ± 0.08, n = 6–8; see Table 3). Peptide-induced reversal of activation and inactivation parameters was also observed in I_Ba (Table 2).

View larger version (25K): [in this window] [in a new window]   FIGURE 4. Gating properties of CaV1.3C116 channels and effect of the distal CTM peptide C116. Data for CaV1.342 were taken from Fig. 2. a, representative normalized I-V curves for ICa. Activation parameters were as follows (in mV): CaV1.342: V0.5,act, –4.2, and kact, –8.6; CaV1.3C116: V0.5,act: –12.8, and kact, –7.7; CaV1.3C116+GFP-C116: V0.5,act, –4.7, and kact, –8.8; Cells: 196l_23, 27g_57, and 27g_91, respectively. b, representative current traces of ICa evoked by a depolarization to Vmax. Cells: CaV1.3C116, 27g_27; CaV1.3C116+GFP-C116, 197f_26. c, percent ICa inactivation during test pulses to Vmax: **, p < 0.01; ***, p < 0.001, compared with CaV1.342 (black); +, p < 0.05; +++, p < 0.001, comparison of CaV1.3C116 + GFP-C116 (white) with CaV1.3C116 (gray) alone (one-way ANOVA followed by Bonferroni post-test). Number of experiments is given in parentheses. Error bars reflect S.E. d and e, representative ICa traces for CaV1.3C116 (d) and CaV1.3C116+GFP-C116 (e). Cells: 27g_67 and 27g_91, respectively. For comparison to CaV1.342 see Fig. 2.

C76

C158

C76

C116

C116

C76

Intramolecular Protein-Protein Interaction Regulates Ca_V1.3 Channel Gating—We (15) and others (16) showed that in Ca_V1.4 1 subunits the distal CTM interacts with a more proximal domain containing the EF-hand, pre-IQ-, and IQ-motif. If such a mechanism also holds true for Ca_V1.3 channels, CTM-containing peptides should also modulate Ca_V1.3_42A (containing EF-PreIQ-IQ). Interestingly, co-expression of GFP-C₁₅₈ neither reversed the Ca_V1.3_42A-induced hyperpolarizing shift of the activation range of I_Ca (Ca_V1.3_42A + GFP-C₁₅₈: V_0.5,act = –12.6 ± 1.5 mV, n = 7; p < 0.001; see Fig. 5a and Table 1) and I_Ba (Table 2) nor the voltage-dependent inactivation and CDI (Fig. 5, b and c; Table 3). This prompted us to extend the Ca_V1.3 1 subunit C terminus to residue 1664 thereby including a highly conserved domain downstream of the IQ-motif that is missing in Ca_V1.3_42A and also contains the so-called PCRD domain previously identified as binding partner for C-terminal peptides in Ca_V1.2 channels (Fig. 6) (17). As expected, the resulting Ca_V1.3_C473 channels showed Ca_V1.3_42A-like gating (Tables 1, 2, 3) but, in contrast to Ca_V1.3_42A, co-expression of GFP-C₁₁₆ restored CDI (Fig. 5, h and i; Table 3) and the activation and inactivation parameters for I_Ca (Fig. 5, d–f and h and i; and Tables 1 and 3) and I_Ba (Tables 2 and 3) close to Ca_V1.3₄₂ values. These data provide functional evidence for an important role of proximal residues 1626–1664 and the distal 116 amino acids for CTM function.

To provide further evidence for this mechanism, we measured FRET between different YFP-labeled C-terminal fragments and CFP-labeled C₁₅₈ (CFP-C₁₅₈) as well as CFP-labeled C₁₁₆ (CFP-C₁₁₆) (Fig. 7). The construct corresponding to the C-terminal fragment of Ca_V1.3_42A (YFP-EF-PreIQ-IQ) did not show significant FRET with the CFP-C₁₅₈ probe (legend to Fig. 7). By extending the Ca_V1.3 YFP-EF-preIQ-IQ bait to residue 1664 yielding YFP-EF-preIQ-IQ-PCRD, a strong and significant FRET signal was measured with CFP-C₁₅₈ as well CFP-C₁₁₆ (Fig. 7), which is in excellent agreement with our electrophysiological data. Accordingly, no FRET was observed when CFP-C₇₆ peptide was used as a probe (not shown). For Ca_V1.2 channels, interaction between a pair of arginine residues in the PCRD and a set of negatively charged residues in the distal C-terminal region (DCRD) was predicted (Fig. 6) (17). As shown in Fig. 7, mutating the two conserved arginines in the Ca_V1.3 PCRD to glutamine (EF-preIQ-IQ-PCRD^RRQQ containing R1640Q and R1641Q) still supported a significant FRET signal when co-expressed with CFP-C₁₁₆. Using probe CFP-C₁₁₆^DEQQ, where the two negative charges in DCRD conserved in Ca_V1.3 were neutralized (D2073Q and E2076Q), significant FRET was eliminated for both EF-preIQ-IQ-PCRD and EF-preIQ-IQ-PCRD^RRQQ. Therefore, neutralization of the two positive charges of the PCRD arginines is not sufficient to prevent the binding interaction suggesting that other binding determinants exist in the conserved domain between residues 1626 and 1664. Our data indicate an essential role of the two negative charges in the Ca_V1.3₄₂ DCRD region, similar to Ca_V1.2.

View larger version (40K): [in this window] [in a new window]   FIGURE 5. CaV1.3C473 channel properties in absence and presence of distal CTM peptide C116. Data for CaV1.342 (black) and CaV1.342A (gray) were taken from Figs. 2 and 4. a, representative normalized I-V curves for ICa. Activation parameters (in mV): CaV1.342A: V0.5,act, –14.3, and kact, –6.8; CaV1.342A + GFP-C158: V0.5,act, –13.5 and kact, –7.2; Cells: 196l_32 and 217c_3, respectively. b, representative current traces of ICa evoked a 10-s depolarization to Vmax. Cells: CaV1.342A + GFP-C158, 227k_19; CaV1.342, 316h_51; CaV1.342A, 187g_46. c, percent ICa inactivation during test pulses to Vmax:*, p < 0.05; ***, p < 0.001 compared with CaV1.342; ++, p < 0.01; +++, p < 0.001, comparison of CaV1.342A + GFP-C158 with CaV1.342A alone. d, representative normalized I-V curves for ICa. Activation parameters (in mV): CaV1.3C473: V0.5,act, –14.4, and kact, –7.1; CaV1.3C473 +GFP-C116: V0.5,act, –2.4, and kact, –9.4; Cells: 177i_1 and 167j_24, respectively. e, same conditions as in b. Cells: CaV1.3C473, 247h_25; CaV1.3C473 +GFP-C116, 167j_14. f, percent ICa inactivation during test pulses to Vmax:*, p < 0.05; **, p < 0.01; ***, p < 0.001 compared with CaV1.342; +, p < 0.05; ++, p < 0.01; +++, p < 0.001, comparison of CaV1.3C473 + GFP-C116 with CaV1.3C473 alone. g–i, representative ICa traces for CaV1.342A + GFP-C158 (g), CaV1.3C473 (h), and CaV1.3C473 + GFP-C116 (i) correspond to I-V curves in a and d. For comparison to CaV1.342 and CaV1.342A see Fig. 2. For statistics: in a and d, Student's t test; c and f, one-way ANOVA followed by Bonferroni post-test. Number of experiments is given in parentheses. Error bars reflect S.E.

We also investigated whether the function of the CTM was prevented by alternative splicing of exon 44 in the post-IQ region of the C terminus (Fig. 6). Introduction of 9 amino acid corresponding to exon 44 into a full-length Ca_V1.3 construct (Ca_V1.3₄₂₊₄₄) exhibited activation parameters similar to Ca_V1.3₄₂ (I_Ba: V_{0.5, act} = –14.8 ± 1.2 mV, k_act = –9.3 ± 0.3 mV, n = 14; I_Ca, V_{0.5, act} = –3.7 ± 1.02 mV, k_act = –10.6 ± 0.3 mV, n = 8) suggesting that CTM function was not prevented by alternative splicing of this exon.

Ca_V1.3₄₂ and Ca_V1.3_42A Are Both Expressed in Mouse and Human Tissues—We employed PCR to determine whether both long (CTM-containing) and short (CTM-deficient) splice variants are expressed in mouse and human tissue. RT-PCR experiments identified both exon 42 and 42A mRNA in different mouse brain regions and the organ of Corti (Fig. 8a) as well as in human brain, heart, retina, and pancreas (Fig. 8b). Using quantitative real time PCR, we determined the relative abundance of these transcripts in mouse whole-brain as well as several brain sub-regions (Fig. 8c). Because exons 42 and 42A are used in a mutually exclusive manner, we calculated the relative amount of exon 42A as percentage of the sum of exon 42 and 42A containing mRNA molecules in samples from two to three independent RNA preparations. Although exon 42 was the predominant form in whole-brain and all sub-regions investigated, significant expression of exon 42A was also found. In whole-brain preparations, exon 42A was 11.0 ± 0.6% (n = 8) of the two mRNAs. Variable expression was found in brain sub-regions with the highest expression in cerebellum (17.1 ± 2.5%, n = 4) and the nucleus accumbens (13.3 ± 1.5%, n = 3) and the lowest in olfactory bulb (2.1 ± 0.2%, n = 3). These data suggest that the short Ca_V1.3 splice variant can contribute significantly to overall Ca_V1.3 activity. Notably, our experiments do not rule out the possibility of other short isoforms with gating properties similar to Ca_V1.3_42A. Therefore the contribution of short forms to overall Ca_V1.3 expression is likely to be underestimated by our experiments.

View larger version (78K): [in this window] [in a new window]   FIGURE 6. Sequence alignment of LTCC C termini. A sequence alignment of neuronal human CaV1.3 (GenBankTM accession number NM_000720 [GenBank] ), CaV1.4 (GenBankTM accession number AJ224874 [GenBank] ), and CaV1.2 (uniprot accession number Q13936 [GenBank] ) 1 subunits is shown. Sequence identity (dark gray), similarity (light gray) and gaps (–) are indicated. PCRD, proximal C-terminal regulatory domain; DCRD, distal C-terminal regulatory domain; CTM, dotted line. Position of CaV1.342A and truncation mutants CaV1.3C473, CaV1.3C158, CaV1.3C116, and CaV1.3C76 are indicated by black arrows. Position of exon 44 is given.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

C116

C158

C473

View larger version (15K): [in this window] [in a new window]   FIGURE 7. FRET analysis of the binding of peptide C158 or C116 to various fragments of the CaV1.3 C terminus. NFRET values obtained from co-expression of CFP-C158 or CFP-C116 (probe) with the indicated YFP-tagged CaV1.3 C-terminal fragments in HEK-293 cells. All constructs showed a homogeneous intracellular distribution. As controls, NFRET values are given for CFP co-expressed with YFP-EF-PreIQ-IQ-PCRD (CFP control) and YFP with probes CFP-C158 (YFP control 1) and CFP-C116 (YFP control 2). Controls are not significantly different from zero (one-sample t test against 0). Interaction between fragments was considered when significant difference to both the CFP- and the corresponding YFP control was observed (***, p < 0.001, one-way ANOVA followed by Bonferroni post-test).

View larger version (56K): [in this window] [in a new window]   FIGURE 8. Tissue expression of CaV1.3 C-terminal splice variants. Qualitative RT-PCR experiments showing expression of both long (containing exon (Ex) 42) and short (containing exon 42A) CaV1.3 isoforms in different mouse (a) and human (b) tissues. GAPDH was used as a housekeeping gene. One representative out of at least three independent experiments is shown. Quantitative Taqman RT-PCR experiments in a (right), show the relative expression of exons 42 and 42A in percent of total signal in mouse whole-brain and several brain subregions (***, p < 0.001, unpaired Students t test, all significantly different from 0, one sample t test). Data are given as means ± S.E.

Our observation of a modulatory C-terminal domain in Ca_V1.3 adds to recent discoveries of a similar regulatory principle in other LTCC isoforms (see Refs. 15, 17, and references therein). Autoinhibitory control of Ca_V1.2 channel function was proposed to be based on a binding interaction between a pair of exposed arginine residues and negatively charged residues in -helical motifs in a proximal (PCRD) and a distal (DCRD) conserved region of the C terminus, respectively (17). In our human Ca_V1.3 channels, 39 residues (1626–1664) comprising the proximal conserved domain containing the PCRD were necessary to confer modulation, as well as FRET to co-expressed CTM-containing peptides. Neutralization of the two conserved positive charges in PCRD did not prevent FRET implying other essential motifs within this 39-residue PCRD domain. Evidence for a role of DCRD comes from the finding that two conserved negative charges are required to support binding of CFP-C₁₁₆ to the upstream domain.

The functional consequences of LTCC C-terminal modulation appear different in Ca_V1.2 and Ca_V1.3 channels. In Ca_V1.2, C-terminal truncation does not induce a more negative V_0.5,act, but overexpression of the distal C terminus shifts the activation range to more positive voltages and reduces the coupling efficiency of voltage-sensing to channel opening (17). This is in contrast to Ca_V1.4 and Ca_V1.3 channels in which removal of the CTM facilitates activation within a more negative voltage range and CTM co-expression restores gating (15 and this paper). Differences between LTCCs also exist with respect to the moderation of CDI. Although in both channels the CTM is able to interfere with CaM association, the CTM completely prevents CDI in Ca_V1.4 (15) but only moderates CDI in Ca_V1.3. To our knowledge the effects of the C-terminal autoinhibitory domain on CDI of Ca_V1.2 channels has not been systematically analyzed so far.

Our finding of C-terminal modulation of Ca_V1.3 also raises the important question about potential post-translational proteolytic cleavage in the long C terminus. Such has been reported for Ca_V1.1 and Ca_V1.2 channels (18, 34). The Ca_V1.2 cleavage product not only serves as a potent autoinhibitor when it remains noncovalently bound to the channel (17) but may also dissociate from the 1 subunit thereby serving as a transcriptional regulator after translocation to the nucleus (19). So far biochemical evidence for Ca_V1.3 C-terminal cleavage is lacking, and it does not appear to function as a transcriptional regulator (19). Instead, as demonstrated here, alternative splicing can generate short and functionally distinct Ca_V1.3 variants. Such splicing has not yet been reported for Ca_V1.1, Ca_V1.2, or Ca_V1.4 channels.

Our data predict that the expression of Ca_V1.3_42A would allow a cell to promote Ca²⁺ entry through Ca_V1.3 channels at sub-threshold voltages as predicted from the negative shift of the window current (Fig. 2e). Stronger activation at more negative voltages may also facilitate the onset of upstate potentials in neurons. However, during maintained depolarization, the faster CDI would limit Ca²⁺ entry through these channels as relevant in neurons with Ca_V1.3-dependent pacemaking, e.g. dopamine-containing neurons in the substantia nigra (36). Whereas negative activation of an even small Ca_V1.3 current could trigger pacemaking, faster CDI would limit Ca²⁺ entry during ensuing action potentials. This may be important in these neurons that are susceptible to Ca²⁺ toxicity and neuro-degeneration in Parkinson disease (36). In contrast, the CTM in Ca_V1.3₄₂ channels may be required for longer lasting Ca²⁺ signals triggered by stronger depolarization inducing cAMP-response element-binding protein phosphorylation and synaptic plasticity (37).

Our study raises several important questions that need to be addressed in future studies. The fact that the increase in current density observed in Ca_V1.3_42A channels seems not to be due to increased expression density (and increased gating currents, see Fig. 2) suggests differences in the unitary current (e.g. increase in single-channel conductance or open probability or prolonged open times). Single-channel analysis will also be required to provide a mechanistic explanation for the shift in activation gating parameters in the short Ca_V1.3 channels. Changes in the unitary conductance of Ca_V1.2 channels induced by structural alterations within the CaM interaction domains in the C terminus well outside the known pore-forming regions have been described (38) providing evidence for a conformational link of the CaM binding domain not only with the gating machinery but also with the channel pore.

Several proteins binding to interaction domains of the C terminus have been described. For example, in neurons the multifunctional PDZ protein Erbin binds to a PDZ-binding domain formed by the last four amino acid residues of Ca_V1.3₄₂ and thereby relieves the autoinhibitory effect of the C terminus on VDF (see Ref. 39 and see above). Also Shank protein (40) and RIM-binding protein (41) are predicted to bind selectively to the C terminus of Ca_V1.3 channels and may therefore affect CTM function. The fact that the distal C terminus comprising the CTM also contains regulatory sites, including sites for cAMP-dependent protein kinase phosphorylation (42) and AKAP-15 (43), raises the interesting possibility that their interference with the activity of the CTM itself could also serve as mechanism to fine-tune Ca_V1.3 function. Such a mechanism has recently been proposed to explain the still enigmatic mechanism of cAMP-dependent protein kinase-dependent activation of Ca_V1.2 LTCCs (35).

Taken together, we have identified a modulatory domain in Ca_V1.3 LTCCs responsible for profound differences in the Ca²⁺- and voltage-dependent gating of the different C-terminal splice variants. Given that many unique physiological functions of Ca_V1.3 depend on the negative activation range of the channel and the amount of Ca²⁺ ions entering during plateau (7) or single action potentials (8), our findings identify the CTM and factors that modify its activity (such as alternative splicing) as elements suitable to determine electrical excitability. Future experiments must also address the interesting possibility that interference with this C-terminal regulatory mechanism can also be exploited for pharmacological intervention, as an alternative to classical Ca²⁺ channel modulators.

	FOOTNOTES

 
Author's Choice—Final version full access.

^* This work was supported by the Austrian Science Funds P17159 [GenBank] (to J. S.) and P18169 [GenBank] (to C. R.), the Tyrolean Science Fund UNI-0404/353 (to A. K.), European Community Grant Cavnet, MRTN-CT-2006-35367, and the University of Innsbruck. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Author's Choice

Creative Commons Attribution Non-Commercial License applies to Author Choice Articles

¹ To whom correspondence should be addressed. Tel.: 43-512-507-5602; Fax: 42-512-507-2931; E-mail: alexandra.koschak{at}uibk.ac.at.

² The abbreviations used are: LTCC, L-type Ca²⁺ channel; ANOVA, analysis of variance; GFP, green fluorescent protein; YFP, yellow fluorescent protein; EYFP, enhanced YFP; CFP, cyan fluorescent protein; RT, reverse transcription; FRET, fluorescence resonance energy transfer; CTM, C-terminal gating modulator; CDI, calcium-dependent inactivation; DCRD, distal C-terminal regulatory domain; VDF, voltage-dependent facilitation; fwd, forward; rev, reverse; IHC, inner hair cells; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SAN, sinoatrial node; CaM, calmodulin; PCRD, primal C-terminal regulatory domain.

	ACKNOWLEDGMENTS

 
We thank Dr. Simone Sartori for the preparation of mouse brain subregions. We thank Ursula Einzinger, Perrine Busquet, and Gilda Pelster for help with quantitative RT-PCRs. We also thank Sylvia Kaperek for preparation of cDNA from the mouse organ of Corti, Gilda Pelster and Irene Frischauf, Heike Kahr, and Sabine Buchegger for excellent technical assistance.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Catterall, W. A., Perez-Reyes, E., Snutch, T. P., and Striessnig, J. (2005) Pharmacol. Rev. 57, 411–425[Abstract/Free Full Text]
2. Striessnig, J. (2007) J. Physiol. (Lond.) 585, 643–644[Free Full Text]
3. Platzer, J., Engel, J., Schrott-Fischer, A., Stephan, K., Bova, S., Chen, H., Zheng, H., and Striessnig, J. (2000) Cell 102, 89–97[CrossRef][Medline] [Order article via Infotrieve]
4. Koschak, A., Reimer, D., Huber, I., Grabner, M., Glossmann, H., Engel, J., and Striessnig, J. (2001) J. Biol. Chem. 276, 22100–22106[Abstract/Free Full Text]
5. Xu, W., and Lipscombe, D. (2001) J. Neurosci. 21, 5944–5951[Abstract/Free Full Text]
6. Lipscombe, D., Helton, T. D., and Xu, W. (2004) J. Neurophysiol. 92, 2633–2641[Abstract/Free Full Text]
7. Olson, P. A., Tkatch, T., Hernandez-Lopez, S., Ulrich, S., Ilijic, E., Mugnaini, E., Zhang, H., Bezprozvanny, I., and Surmeier, D. J. (2005) J. Neurosci. 25, 1050–1062[Abstract/Free Full Text]
8. Helton, T. D., Xu, W., and Lipscombe, D. (2005) J. Neurosci. 25, 10247–10251[Abstract/Free Full Text]
9. Halling, D. B., Aracena-Parks, P., and Hamilton, S. L. (2006) Sci. STKE 2006, er1
10. Liang, H., DeMaria, C. D., Erickson, M. G., Mori, M. X., Alseikhan, B. A., and Yue, D. T. (2003) Neuron 39, 951–960[CrossRef][Medline] [Order article via Infotrieve]
11. Soldatov, N. M., Zuhlke, R. D., Bouron, A., and Reuter, H. (1997) J. Biol. Chem. 272, 3560–3566[Abstract/Free Full Text]
12. Shen, Y., Yu, D., Hiel, H., Liao, P., Yue, D. T., Fuchs, P. A., and Soong, T. W. (2006) J. Neurosci. 26, 10690–10699[Abstract/Free Full Text]
13. Yang, P. S., Alseikhan, B. A., Hiel, H., Grant, L., Mori, M. X., Yang, W., Fuchs, P. A., and Yue, D. T. (2006) J. Neurosci. 26, 10677–10689[Abstract/Free Full Text]
14. Cui, G., Meyer, A. C., Calin-Jageman, I., Neef, J., Haeseleer, F., Moser, T., and Lee, A. (2007) J. Physiol. (Lond.) 585, 791–803[Abstract/Free Full Text]
15. Singh, A., Hamedinger, D., Hoda, J. C., Gebhart, M., Koschak, A., Romanin, C., and Striessnig, J. (2006) Nat. Neurosci. 9, 1108–1116[CrossRef][Medline] [Order article via Infotrieve]
16. Wahl-Schott, C., Baumann, L., Cuny, H., Eckert, C., Griessmeier, K., and Biel, M. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 15657–15662[Abstract/Free Full Text]
17. Hulme, J. T., Yarov-Yarovoy, V., Lin, T. W., Scheuer, T., and Catterall, W. A. (2006) J. Physiol. (Lond.) 576, 87–102[Abstract/Free Full Text]
18. Hulme, J. T., Konoki, K., Lin, T. W., Gritsenko, M. A., Camp, D. G., II, Bigelow, D. J., and Catterall, W. A. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 5274–5279[Abstract/Free Full Text]
19. Gomez-Ospina, N., Tsuruta, F., Barreto-Chang, O., Hu, L., and Dolmetsch, R. (2006) Cell 127, 591–606[CrossRef][Medline] [Order article via Infotrieve]
20. Ganesan, A. N., Maack, C., Johns, D. C., Sidor, A., and O'Rourke, B. (2006) Circ. Res. 98, e11-8[Abstract/Free Full Text]
21. Gao, T., Cuadra, A. E., Ma, H., Bunemann, M., Gerhardstein, B. L., Cheng, T., Eick, R. T., and Hosey, M. M. (2001) J. Biol. Chem. 276, 21089–21097[Abstract/Free Full Text]
22. Grabner, M., Dirksen, R. T., and Beam, K. G. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 1903–1908[Abstract/Free Full Text]
23. Michna, M., Knirsch, M., Hoda, J. C., Muenkner, S., Langer, P., Platzer, J., Striessnig, J., and Engel, J. (2003) J. Physiol. (Lond.) 553, 747–758[Abstract/Free Full Text]
24. Koschak, A., Obermair, G. J., Pivotto, F., Sinnegger-Brauns, M. J., Striessnig, J., and Pietrobon, D. (2007) J. Neurosci. 27, 3855–3863[Abstract/Free Full Text]
25. Huber, I., Wappl, E., Herzog, A., Mitterdorfer, J., Glossmann, H., Langer, T., and Striessnig, J. (2000) Biochem. J. 347, 829–836[CrossRef][Medline] [Order article via Infotrieve]
26. Xia, Z., and Liu, Y. (2001) Biophys. J. 81, 2395–2402[Medline] [Order article via Infotrieve]
27. Hui, A., Ellinor, P. T., Krizanova, O., Wang, J.-J., Diebold, R. J., and Schwartz, A. (1991) Neuron 7, 35–44[CrossRef][Medline] [Order article via Infotrieve]
28. Williams, M. E., Feldman, D. H., McCue, A. F., Brenner, R., Velicelebi, G., Ellis, S. B., and Harpold, M. M. (1992) Neuron 8, 71–84[CrossRef][Medline] [Order article via Infotrieve]
29. Pichler, M., Cassidy, T. N., Reimer, D., Haase, H., Kraus, R., Ostler, D., and Striessnig, J. (1997) J. Biol. Chem. 272, 13877–13882[Abstract/Free Full Text]
30. Mangoni, M. E., Couette, B., Bourinet, E., Platzer, J., Reimer, D., Striessnig, J., and Nargeot, J. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 5543–5548[Abstract/Free Full Text]
31. Matthes, J., Yildirim, L., Wietzorrek, G., Reimer, D., Striessnig, J., and Herzig, S. (2004) Naunyn-Schmiedeberg's Arch. Pharmacol. 369, 554–562[CrossRef][Medline] [Order article via Infotrieve]
32. Bean, B. P. (2007) Nature 447, 1059–1060[CrossRef][Medline] [Order article via Infotrieve]
33. Safa, P., Boulter, J., and Hales, T. G. (2001) J. Biol. Chem. 276, 38727–38737[Abstract/Free Full Text]
34. Hell, J. W., Westenbroek, R. E., Breeze, L. J., Wang, K. K., Chavkin, C., and Catterall, W. A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 3362–3367[Abstract/Free Full Text]
35. Hulme, J. T., Westenbroek, R. E., Scheuer, T., and Catterall, W. A. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 16574–16579[Abstract/Free Full Text]
36. Chan, C. S., Guzman, J. N., Ilijic, E., Mercer, J. N., Rick, C., Tkatch, T., Meredith, G. E., and Surmeier, D. J. (2007) Nature 447, 1081–1086[CrossRef][Medline] [Order article via Infotrieve]
37. Zhang, H., Fu, Y., Altier, C., Platzer, J., Surmeier, D. J., and Bezprozvanny, I. (2006) Eur. J. Neurosci. 23, 2297–2310[CrossRef][Medline] [Order article via Infotrieve]
38. Kepplinger, K. J., Kahr, H., Forstner, G., Sonnleitner, M., Schindler, H., Schmidt, T., Groschner, K., Soldatov, N. M., and Romanin, C. (2000) FEBS Lett. 477, 161–169[CrossRef][Medline] [Order article via Infotrieve]
39. Calin-Jageman, I., Yu, K., Hall, R. A., Mei, L., and Lee, A. (2007) J. Neurosci. 27, 1374–1385[Abstract/Free Full Text]
40. Zhang, H., Maximov, A., Fu, Y., Xu, F., Tang, T. S., Tkatch, T., Surmeier, D. J., and Bezprozvanny, I. (2005) J. Neurosci. 25, 1037–1049[Abstract/Free Full Text]
41. Hibino, H., Pironkova, R., Onwumere, O., Vologodskaia, M., Hudspeth, A. J., and Lesage, F. (2002) Neuron 34, 411–423[CrossRef][Medline] [Order article via Infotrieve]
42. Qu, Y., Baroudi, G., Yue, Y., El-Sherif, N., and Boutjdir, M. (2005) Am. J. Physiol. 288, H2123–H2130
43. Hulme, J. T., Ahn, M., Hauschka, S. D., Scheuer, T., and Catterall, W. A. (2002) J. Biol. Chem. 277, 4079–4087[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				L. Shi, K. Jian, M. L. Ko, D. Trump, and G. Y.-P. Ko Retinoschisin, a New Binding Partner for L-type Voltage-gated Calcium Channels in the Retina J. Biol. Chem., February 6, 2009; 284(6): 3966 - 3975. [Abstract] [Full Text] [PDF]

This Article Free via Author's Choice: AC AC Abstract Full Text (PDF) AC All Versions of this Article: 283/30/20733    most recent M802254200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Singh, A. Articles by Koschak, A. Search for Related Content PubMed PubMed Citation Articles by Singh, A. Articles by Koschak, A. Social Bookmarking                      What's this?