Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M709279200 on November 21, 2007

J. Biol. Chem., Vol. 283, Issue 4, 2255-2264, January 25, 2008
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/4/2255    most recent
M709279200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iijima, R.
Right arrow Articles by Homma, K. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iijima, R.
Right arrow Articles by Homma, K. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Extracellular Adenosine Deaminase Growth Factor, ADGF/CECR1, Plays a Role in Xenopus Embryogenesis via the Adenosine/P1 Receptor*

Ryoko Iijima{ddagger}§1, Takekazu Kunieda§1, Shinji Yamaguchi{ddagger}||1, Hiroko Kamigaki||, Ikuko Fujii-Taira{ddagger}, Kazuhisa Sekimizu{ddagger}, Takeo Kubo§, Shunji Natori, and Koichi J. Homma{ddagger}||2

From the {ddagger}Graduate School of Pharmaceutical Sciences, and §Graduate School of Sciences, The University of Tokyo, Bunkyo-ku, Tokyo 113-0033, the Natori Special Laboratory, The Institute of Physical and Chemical Research (RIKEN), Wako, Saitama 351-0198, and the ||Faculty of Pharmaceutical Sciences, Teikyo University, Sagamihara, Kanagawa 229-0195, Japan

Received for publication, November 12, 2007


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Adenosine deaminase-related growth factors (ADGF), also known as CECR1 in vertebrates, are a novel family of growth factors with sequence similarity to classical cellular adenosine deaminase. Although genes for ADGF/CECR1 have been identified in both invertebrates as well as vertebrates, their in vivo functions in vertebrates remain unknown. We isolated cDNA clones for two cerc 1s from Xenopus laevis. Both recombinant Xenopus CECR1s exhibited adenosine deaminase and growth factor activity, and the adenosine deaminase activity was found to be indispensable for growth factor activity. The Xenopus cerc 1s are expressed in the somites, pronephros, eyes, cement gland, neural tube, and neural floor plate of the embryos. Knock-down of these two genes using morpholino oligonucleotides caused a reduction in the body size and abnormalities of the body axis in the Xenopus embryos, accompanied by selective changes in the expression of developmental marker genes. Injection of adenosine, agonists for adenosine/P1 receptors, or adenosine deaminase inhibitor into late gastrula archenteron embryos resulted in developmental defects similar to those caused by morpholino oligonucleotide injection. These results show, for the first time, the involvement of CECR1s via the adenosine/P1 receptors in vertebrate embryogenesis via regulation of extracellular adenosine concentrations.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Growth factors play important roles in morphogenesis and organogenesis in various animal species. Of these, the adenosine deaminase-related growth factor (ADGF)3 family is a novel group of growth factors with sequence similarity to classical adenosine deaminase (ADA) in their carboxyl-terminal regions (1-3). Classical ADA is a cytoplasmic enzyme that catalyzes the deamination of adenosine and 2'-deoxyadenosine to inosine and 2'-deoxyinosine, respectively (4), and has a wide phylogenetic distribution (5). ADA is involved in purine metabolism and plays an indispensable role in the upkeep of a competent immune system in mammals (6). In contrast, ADGFs are comprised of secretory or transmembrane-type ADGFs (1, 2, 7, 8), with some having growth factor-like activities (3, 9-14).

Insect-derived growth factor (IDGF), the first ADGF to be cloned, is a secretory ADGF purified from the conditioned medium of NIH-Sape-4, an embryonic cell line of Sarcophaga peregrina (flesh fly) (1). IDGF stimulates the growth of NIH-Sape-4 cells with a specific activity comparable with mammalian growth factors. Site-directed mutagenesis has demonstrated that the ADA activity of IDGF is essential for its growth factor activity (3, 15). So far, ADGF families have been reported in various invertebrates. In Drosophila melanogaster (fruit fly), Male-specific IDGF was identified as a transmembrane-type ADGF and is suggested to participate in spermatogenesis (7). Recently, six ADGFs have been identified in Drosophila, one of which (Adgf-A2) encodes Male-specific IDGF (8, 16). In addition, ADGF families have been identified in other fruit flies, sand flies, sea slugs, tsetse flies, mosquitoes, fungi, and slime mold (2).

ADGF families have also been identified in vertebrates, with human CECR1 first identified as a member of the ADGF family (17). The human CECR1 is a candidate gene responsible for "cat eye syndrome" (17). Cat eye syndrome is a human developmental disorder characterized by a variety of congenital defects, including ocular coloboma (hence the name "cat eye"), heart and kidney defects, and mental retardation (18, 19). Cat eye syndrome is associated with duplication of the proximal long arm of human chromosome 22, which contains CECR1, suggesting that the syndrome might be due to the overexpression of CECR1 (20). CECR1 homologues have also been identified in the genomes of other vertebrate species, such as chimp, baboon, pig, chicken, frog, zebrafish, and pufferfish (2), indicating that the ADGF/CECR1 genes represent a family of evolutionally conserved genes. Interestingly, no obvious CECR1 homologue has yet been identified in rodents (20).

ADA activity has been reported for some ADGF/CECRs (9-14), including IDGF (3), where the Km, Vmax, and kcat values are comparable with those of mammalian cytoplasmic ADAs (21). As IDGF was originally identified as a growth factor in an embryonic cell line (1) and ADA activity was shown to be indispensable for growth factor activity (3), it is plausible that the ADGF/CECR1 family plays a role in cell proliferation during morphogenesis and organogenesis via its ADA activity. In Drosophila, the lack of Adgf-a leads to precocious metamorphic changes during metamorphosis, including the differentiation of macrophage-like cells, fat body disintegration and developmental delay (16, 22). Transgenic expression of human CECR1 in mice results in abnormal heart and kidney development, suggesting a possible role in mammalian development (23). The in vivo function of the CECR1 family in vertebrates, however, remains unclear, as there is no known CECR1 homologue in mice.

In the present study, we analyzed the molecular properties and in vivo functions of Xenopus CECR1s to increase our understanding of the roles of the ADGF/CECR1 family in vertebrates. The results demonstrate a key role of Xenopus CECR1s in embryonic development via their ADA activity.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Embryos and Their Culture—Xenopus laevis embryos were collected and cultured as described previously (24). The embryos were staged according to the method described by Nieuwkoop and Faber (25).

cDNA Cloning for Xenopus cecr1s—To isolate Xenopus cecr1 cDNA, PCR was performed using Xenopus cDNA library (embryo, stage 30, Stratagene). The nucleotide sequences of the degenerated primers used for the PCR were 5'-GT(G/T)GGI(C/A)(G/A)IGA(A/G)GA(C/T)ACIGG-3' and 5'-CCA(A/G)TCNAT(T/C)TCICCIGC (G/A)TG(G/A)AA-3', which correspond to 325VGHEDTG331 and 355FHAGETDW362, respectively. A 114-bp cDNA fragment was amplified and used as a probe for subsequent cDNA cloning. Two hybridization-positive clones were isolated from 1.3 x 105 clones of a Xenopus embryo (stage 30) cDNA library (Stratagene) by plaque hybridization, and their sequences determined.

Phylogenetic Analysis—Deduced amino acid sequences encoded by the vertebrate CECR1-like genes were aligned using CLUSTAL W (26). The molecular tree was constructed using the neighbor-joining method (27) and displayed using TreeviewPPC (28). Accession numbers for each gene are: Hs_CECR1 (AF190746), Ss_CECR1 (AF384216), Gg_CECR1 (AY902779), Dr_CECR1-1 (AF384217), Dr_CECR1-2 (Genomic BX323558), Tn_CECR1-1 (Genomic CAAE01014566), and Tn_CECR1-2 (Genomic CAAE01014691).

Preparation of Recombinant Xl_CECR1s—The recombinant Xl_CECR1-1 and Xl_CECR1-2 proteins were produced in Escherichia coli BL21 star (DE3) using a pET100 directional TOPO expression kit (Invitrogen) as well as in Xenopus A6 cells (American Type Culture Collection). In the first method, the coding regions of Xl_cecr1-1 and -2 were amplified by PCR and subcloned into a pET100/D-TOPO vector. His-tagged fusion proteins were then produced in E. coli. Purification was performed using a HiTrap Chelating HP column (GE Healthcare BioSciences). In the second method, the amplified coding regions of Xl_cecr1-1 and -2 were subcloned and transfected to Xenopus A6 cells with FuGENE 6 transfection reagent (Roche Diagnostics). The recombinant proteins were used for assaying ADA and growth factor activities.

Preparation of Antibodies against Xl_CECR1s—To prepare antibodies against Xl_CECR1-1 and Xl_CECR1-2, the synthetic peptides CEDLAMNPEASEREL and CKFIKDLAMN-WKKEL, which are specific to Xl_CECR1-1 and Xl_CECR1-2, respectively, were conjugated to keyhole limpet hemocyanin and injected separately into an albino rabbit with Complete Freund adjuvant. After three booster injections with Incomplete Freund adjuvant, each antiserum was affinity-purified using the recombinant Xl_CECR1-1 or -2, produced in E. coli.

Assay of the ADA Activity of Xl_CECR1s—The ADA activity of Xl_CECR1s was assayed as described by Iwaki-Egawa et al. (29). Enzymatic activity was determined by quantifying inosine liberated from adenosine. Inosine is converted by purine nucleoside phosphorylase into hypoxanthine; the latter is then converted into uric acid and diformazan by xanthine oxidase and nitro blue tetrazolium. Thus, the optical density at 540 nm of diformazan was measured. In brief, the recombinant Xl_CECR1s were preincubated for 5 min at 37 °C in a reaction mixture containing 20 mM sodium phosphate buffer (pH 6.8), 1 unit/ml xanthine oxidase, 0.24 unit/ml purine nucleoside phosphorylase, and 1 mM nitro blue tetrazolium. Following incubation, the ADA assay was initiated by adding adenosine, and the mixture was further incubated at 37 °C for 15 min. The reaction was stopped by adding 1/4 volume of 50% acetic acid. The absorption at 540 nM diformazan was then measured. One unit of ADA activity was defined as the amount of enzyme that produced 1 µmol of inosine/min.

Assay of Growth Factor Activity—The growth factor activity assay was performed as described previously by assessing cell proliferation (7). NIH-Sape-4 cells were cultured in M-M medium (30) at 25 °C, as described previously (31). Briefly, NIH-Sape-4 cells were suspended at a density of 2.5 x 105 cells/ml in M-M medium, and then 100 µl of the cell suspension was poured into each well of a 96-well microtiter plate. Cell proliferation was assessed by measuring the enhancement of cellular metabolism using the Alamar Blue assay, after the addition of 1 ng of recombinant Xl_CECR1-1 and 10 ng of Xl_CECR1-2 (32, 33). The cells were then incubated for 2 days at 25 °C in the presence or absence of the test sample. Following this, 15 µl of Alamar Blue (Alamar Biosciences, Inc.) was added, and changes in the color of the culture medium were determined by measuring A570 and A610. One unit of growth factor activity was defined as the amount giving half-maximal stimulation of cell proliferation.

Reverse Transcription-Polymerase Chain Reaction (RT-PCR)—Total RNA was extracted from Xenopus embryos using TRIzol reagent (Invitrogen). RT-PCR was performed using the ProStar First Strand RT-PCR kit (Stratagene). The oligonucleotide primers used to detect Xl_cecr1s mRNA were 5'-CATACTTCTTCCATGCAGGAG-3' (sense) and 5'-ACCGAAGATGGATGGGTCATC-3' (antisense). These primers are designed to detect both Xl_cecr1-1 and Xl_cecr1-2. As an internal control, ornithine decarboxylase mRNA was detected using the oligonucleotide primers (5'-GTCAATGATGGAGTGTATGGATC-3' (sense) and 5'-TCCATTCCGCTCTCCTGAGCAC-3' (antisense)).

Whole Mount in Situ Hybridization—Whole mount in situ hybridization of Xenopus embryos was performed as described previously (34). The Xl_cecr1 probe consisted of digoxigenin-labeled RNA corresponding to a 605-bp fragment (+904 to +1508) of Xl_cecr1-2 cDNA. The Xmyod probe consisted of digoxigenin-labeled RNA corresponding to a 350-bp fragment (+157 to +506) of Xmyod cDNA (35). The Xa2a probe consisted of digoxigenin-labeled RNA corresponding to a 457-bp fragment (+479 to +935) of Xa2a cDNA clone (MGC:85585) (36). The Xmyf-5 probe consisted of digoxigenin-labeled RNA corresponding to a 405-bp fragment (+29 to +433) of Xmyf-5 cDNA clone (GenBankTM accession number X56738) (35).

Microinjection of Adenosine, DCF, and Adenosine/P1 Receptor Agonists—Microinjection was carried out via the modified method of Skoglund and Keller (37). Solutions injected were 10 mM adenosine, 10 mM DCF (2'-deoxycoformycin), 20 µM 5'-N-ethylcarboxamido adenosine, 1 mM cyclopentyl adenosine, 1 mM CGS-21680 hydrochloride in MMR buffer (0.1 M NaCl, 2 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 5 mM Hepes (pH 7.5)). Approximately 100 nl of each solution was injected into late gastrula archenteron at stage 12. Injected embryos were incubated in 0.1 x Steinberg solution at 20 °C up to stage 35/36.

Microinjection of Morpholino Oligonucleotides (MO)—MO microinjections were performed on two-cell stage embryos immobilized in a plastic mold. The MO was diluted in MMR buffer and 5 nl of 1 mM solution was injected into each blastomere of two-cell stage embryos. After injection, the embryos were cultured in 0.1 x Steinberg solution at 20 °C up to stage 35/36. MOs designed to be antisense specific to Xl_cecr1-1 or Xl_cecr1-2 were purchased from GeneTools, LLC (Philomath, OR). To knock down both the Xl_CECR1-1 and Xl_CECR1-2 simultaneously, a mixture of both MOs was used in the experiments. The control MOs were four nucleotide-substituted versions of experimental MOs. The MO sequences containing the initiation codon were as follows (with substituted nucleotides underlined): Xl_cecr1-1 MO, ATGCACGTCATCTTAATTCTCTCAG; 4-mis-Xl_cecr1-1 MO, ATGGACGTGATCTTAATACTCACAG; Xl_cecr1-2 MO, GCAACCAATGGGAGACGCACGCCAT; 4-mis-Xl_cecr1-2 MO, GCTACCTATGGGAGACGGACGGCAT. To confirm that the phenotype caused by the injection of the first pair of MOs is due to a specific knock down of CECR1s, we designed a second pair of MOs from a 5'-untranslated region sequence of Xl_CECR1s. MOs were diluted in MMR and 5 nl of 0.1 mM solution was injected into each blastomere of two-cell stage embryos. MO sequences were as follows: Xcecr1-1-5'UTR MO, ATTCTCTCAGTCTCCTCTAATCCTG and Xcecr1-2-5'UTR MO, TAATTCTCTCTCTCCTCTAATCCTG.

Semiquantitative RT-PCR Using Primers for Various Developmental Marker Genes—Total cellular RNA was isolated from each embryo using TRIzol reagent (Invitrogen). Total RNA (1.4 µg) was treated with RNase-free DNase I (Invitrogen) and reverse-transcribed using SuperScript III (Invitrogen) with oligo(dT) primers. The ornithine decarboxylase transcript was amplified to normalize the cDNA content of the samples. Equal amounts of cDNA were subsequently used for the amplification of marker genes with gene-specific primers. The linear range of amplification was determined for each primer set. For semiquantitative determination of relative gene expression levels, 10-µl samples of the amplificates were collected during PCR after the completion of three different cycle numbers in the linear range. The amplicons were analyzed on a 1% agarose gel stained with ethidium bromide. The primers (5' to 3') and cycle numbers used were: Xmyf5 (35), 5'-AAGAGATTTCCTGAAACCTGATTG-3' (sense) and 5'-GTTTGTAGTGGTGCATCTTTTGAG-3' (antisense) 30 cycles; Xmyod (35), 5'-AGCTCCAACTGCTCCGACGGCATGAA-3' (sense) and 5'-AGGAGAGAATCCAGTTGATGGAAACA-3' (antisense) 30 cycles; cardiac actin (38), 5'-TCCCTGTACGCTTCTGGTCGTA-3' (sense) and 5'-TCTCAAAGTCCAAAGCCACATA-3' (antisense) 25 cycles; six1 (39), 5'-GATCACCTCCACAAGAATGAGAG-3' (sense) and 5'-CTGTTCTTGAACCAGTTGCTGAC-3' (antisense) 30 cycles; xsmp-30 (Xenopus senescence marker protein-30) (40), 5'-GAGTGTATCAGTAGAAGCCCCAAT-3' (sense) and 5'-TTTGTACAGAGTCCTTCGATTTGA-3' (antisense) 30 cycles; XNKCC2 (41), 5'-TGTTATGGCAGTCAGGATCTTTTA-3' (sense) and 5'-CTGAGATGCTTCCAGTATGTCTGT-3' (antisense) 30 cycles; xwt1 (42), 5'-CACACGCACGGGGTCT-3' (sense) and 5'-TGCATGTTGTGATGACG-3' (antisense) 30 cycles; Xlim1 (43), 5'-TCCTCTAAAATCCCAAATAACCAA-3' (sense) and 5'-GGGTCTTGAGATTCAGGAGATAAA-3' (antisense) 30 cycles; {gamma}-crystallin (44), 5'-CTACATCAAGTCCTGCCGATTTAT-3' (sense) and 5'-CTGAATCTCCTGTATTCTCCAGGT-3' (antisense) 35 cycles; xPitx3 (45), 5'-TAATGGACTTATGCAGCCTTATGA-3' (sense) and ACTGACATGGGCTTAGGTTAGAAG (antisense) 30 cycles; darmin-r (46), 5'-TGGTGGTAAAACTGAACTGGTAGA-3' (sense) and AAGTGATACAGGGCTTATTTTTGC-3' (antisense) 30 cycles; xa (47), 5'-TGTTTTTCTACGTTCTTCTGCTTG-3' (sense) and 5'-AATTTTTCTGTGTGATGAGGGACT-3' (antisense) 35 cycles; xag (48), 5'-CAGGAACAACTGATACCAAAACTG-3' (sense) and 5'-TTTTGGCTTTCTTCATGTTTGTAA-3' (antisense) 35 cycles; Xa2a (adenosine receptor A2A) (36), 5'-ATTGCAATTAGTACCGGATTTTGT-3' (sense) and 5'-TTCTCCACATGTCACTTTCATTTT-3' (antisense) 30 cycles.

Other Methods—SDS-PAGE was performed using the method of Laemmli (49). Immunoblotting was performed as described by Luttrell et al. (50).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Identification and Characterization of X. laevis cecr1 cDNAs—To investigate the role of the ADGF/CECR1 family in vertebrates, we attempted to isolate cDNA (s) for the X. laevis homologue of CECR1. For this, we first amplified a cDNA fragment of the Xenopus cecr1 homologue using degenerate primers designed according to the amino acid sequences conserved among human, pig, and zebrafish CECR1s; this was due to the lack of information regarding the nucleotide sequence of the Xenopus homologue of CECR1 on commencement of this study. We identified two cDNAs that encode relevant but distinct proteins, named Xl_CECR1-1 and Xl_CECR1-2. Comparison of the deduced amino acid sequence of Xl_CECR1-1 and -2 revealed that they shared ~40% sequence identities with Sarcophaga IDGF and human CECR1, respectively (Fig. 1A). Based on their high sequence identities (91%), Xl_CECR1-1 and -2 were considered as isoforms. The Xl_CECR1-2 nucleotide sequence was almost identical to that of a clone (accession number AY902778) deposited in the NCBI data base. Both Xl_CECR1-1 and -2 contained putative signal sequences in their N termini, suggesting that they are secretory ADGFs (51). Phylogenetic tree analysis revealed that Xl_CECR1-1 and -2 are members of the CECR1 family and that their closest relative is the chicken Gg_CECR1 (Fig. 1B). Consensus amino acids in the active site of cellular classical ADA were conserved in many CECR1s including Xl_CECR1-1 and -2 except for Val431 (Fig. 1C). We previously reported that Asp462 and His405 in Sarcophaga IDGF were essential for ADA and growth factor activity (3). These two residues are also conserved in Xl_CECR1-1 and -2 (Fig. 1A). We performed BLAST search using the Xenopus tropicalis genome data base and confirmed that the genome (scaffold 341) also encodes the orthologues for both Xl_cecr1-1 and -2, and that there is no other gene more closely related to the human CECR1 gene than the X. tropicalis gene. Thus, we concluded that the cloned cDNAs are X. laevis homologues of human CECR1.


Figure 1
View larger version (51K):
[in this window]
[in a new window]

  		FIGURE 1.
Cloning of cDNA for Xenopus CECR1 isoforms. A, alignment of Xl_CECR1-1 and -2 with Sarcophaga IDGF and human CECR1. Amino acid residues are numbered starting from the first Met residue. Gaps were introduced to obtain maximal sequence similarity. Residues conserved in more than three sequences are shown in boldface type. The putative active site of ADA is shown in the open box. Putative signal sequences are underlined. Asp462 and His405 in Sarcophaga IDGF are shown in asterisks. B, phylogenetic tree analysis of the vertebrate CECR1s. Protein sequences from 9 vertebrate CECR1 genes were aligned using CLUSTAL W. The scale bar represents 0.1 substitutions per site. Dr, Danio rerio; Tn, Tetraodon nigroviridis; Gg, Gallus gallus; Xl, X. laevis; Hs, Homo sapiens; Ss, Sus scrofa. C, comparison of the amino acid sequences of ADA active sites of vertebrate CECR1s. The amino acid sequences of ADA active sites of vertebrate CECR1s are compared. Consensus pattern of the amino acid sequences of the cellular classical ADA are shown in the top right of the figure.

 
Characterization of ADA and Growth Factor Activities of Xl_ CECR1-1 and -2—We next analyzed the enzymatic properties of Xl_CECR1s and the relationship between their ADA and growth factor activities. For this, recombinant Xl_CECR1-1 and -2 proteins were expressed in Xenopus A6 cells, respectively. The conditioned medium containing Xl_CECR1-1 or -2 as the major protein was used for the experiments. Both Xl_CECR1-1 and -2 showed ADA activities with Km values of 260 and 230 µM, respectively, for adenosine as a substrate. The Km values of the Xl_CECR1s were in the intermediate range between those of invertebrate (~50 µM) (3) and human CECR1/ADA2 (~2 mM) (14). The enzymatic activities of Xl_CECR1-1 and -2 were inhibited with DCF, a potent inhibitor for cellular and extracellular ADAs, but not with erythro-9-(2-hydroxy-3-nonyl)-adenine hydrochloride (EHNA), a selective cellular ADA inhibitor (Fig. 2). This suggests that Xl_CECR1 has the enzymatic profile of an extracellular ADA. 2'-Deoxyadenosine was a less effective substrate than adenosine, and 5'-AMP was not a substrate for either Xl_CECR1-1 and -2, unlike in classical ADAs (Table 1) (21). These results indicate that the enzymatic activities of Xl_CECR1s share similar substrate and inhibitor specificities with human CECR1/ADA2 (52), although the Km is lower than that for human CECR1/ADA2.


View this table:
[in this window]
[in a new window]

  		TABLE 1
Relative Vmax in the ADA activities of XI_CECR1-1 and -2 when adenosine, 2'-deoxyadenosine, and 5'-AMP are used as substrates

 


Figure 2
View larger version (19K):
[in this window]
[in a new window]

  		FIGURE 2.
Effects of DCF or EHNA on the ADA activities of the recombinant Xl_CECR1-1 and -2. The ADA activities of recombinant Xl_CECR1-1 and -2 secreted from A6 cells were examined in the presence or absence of DCF or EHNA at the indicated concentrations, respectively. The bars indicate S.D.

 


Figure 3
View larger version (31K):
[in this window]
[in a new window]

  		FIGURE 3.
Growth factor activities of the recombinant Xl_CECR1-1 and -2 and the effects of DCF or EHNA on their activities. Dose-response curves for stimulation of the growth of NIH-Sape-4 cells in the presence or absence of DCF or EHNA by recombinant Xl_CECR1-1 and -2. Each point represents the mean of duplicate measurements. The growth factor activity of Xl_CECR1-1 is indicated in the absence (bullet) or presence of DCF (grey circle) and in EHNA ({circ}). The growth factor activity of Xl_CECR1-2 is indicated in the absence ({blacksquare}) or presence of DCF (grey box) and in EHNA ({square}).

 
Next, we examined the growth factor activities of Xl_ CECR1-1 and Xl_CECR1-2 in NIH-Sape-4 cells, as these cells are sensitive to various invertebrate ADGFs (1, 3, 10, 11, 15). Although both Xl_CECR1-1 and Xl_CECR1-2 showed growth factor activity, Xl_CECR1-1 displayed activity at lower concentrations than Xl_CECR1-2 (Fig. 3), consistent with the 10 times higher specific ADA activity of Xl_CECR1-1 than Xl_CECR1-2 (data not shown). To determine the relationship between ADA and growth factor activity, we examined the effects of DCF and EHNA on this activity. The growth factor activities of both Xl_CECR1-1 and -2 were inhibited by DCF, but not by EHNA (Fig. 3). These results demonstrate that the ADA activity of Xenopus CECR1s is indispensable for growth factor activity.

Analysis of the Xl_cecr1s Gene Expression during Embryogenesis—To examine the expression of the Xl_cecr1s during embryogenesis, RT-PCR was performed using RNAs from various developmental stages with primers designed to detect both Xl_cecr1-1 and -2 mRNAs. Expression of Xl_cecr1 started at stage 20 (neurula stage), gradually increased during the neurula stage, and was sustained to stage 44 (Fig. 4). There were no differences in the expression patterns between Xl_cecr1-1 and Xl_cecr1-2 in RT-PCR using gene-specific primers (data not shown).

To determine the spatial expression pattern of the Xl_cecr1 genes, we performed whole mount in situ hybridization. The probe was a 605-bp fragment of Xl_cecr1-2 cDNA with 94% homology with the corresponding sequence of Xl_cecr1-1, which suggests cross-hybridization with the Xl_cecr1-1 transcript. The Xl_cecr1 were expressed in the somites at stage 20 (neurula stage, Fig. 5A). In addition, the cement gland was also stained at stage 22 (neurula stage, Fig. 5B). At stage 30 (tail-bud stage), the Xl_cecr1s were clearly expressed in the somites, pronephros, eye, cement gland, neural tube, and neural floor plate (Fig. 5C). At stage 36, the expression patterns were similar to those of the tail-bud stage (stage 30) (Fig. 5D). Expression in the pronephros was maintained at stage 39, but expression in the other tissues diminished (data not shown). As ADA activity is indispensable for the growth factor activity of IDGF (3, 15), we assumed that Xl_CECR1s played a role in embryogenesis through adenosine/P1 receptor(s) via regulation of extracellular adenosine levels. We therefore examined the expression profiles of Xenopus homologues of an isoform of the adenosine/P1 receptor (adenosine A2A receptor, XA2A) gene. We found that Xa2a was expressed in somitic stripes and eyes in the tail-bud stage, similar to the Xl_cecr1, suggesting that Xa2a is involved in the regulation of Xl_cecr1s (Fig. 5, F and G).


Figure 4
View larger version (16K):
[in this window]
[in a new window]

  		FIGURE 4.
Expression of the Xl_cecr1s during Xenopus embryogenesis as detected by RT-PCR. Total RNA was extracted from the embryos of the indicated stages and unfertilized eggs. The mRNA levels were determined using RT-PCR. The mRNA level of the ornithine decarboxylase gene was also determined as a control. The primers here were used to detect both Xl_cecr1-1 and -2 genes.

 


Figure 5
View larger version (103K):
[in this window]
[in a new window]

  		FIGURE 5.
Whole mount in situ hybridization of Xl_cecr1s mRNA and Xenopus a2a receptor mRNA during embryogenesis. Embryos at stage 20 (neurula, A), stage 22 (neurula, B), stage 30 (tail-bud, C), and stage 36 (D) were treated with the antisense probe of Xl_cecr1-2. E, the illustration represents an embryo at stage 30 of C. F, embryos at stage 30 (tail-bud) were treated with the antisense probe of Xenopus a2a receptor. G, magnified view of F. Bars indicate 1 mm.

 
Analysis of the in Vivo Functions of the Xl_CECR1s during Embryogenesis—To analyze the in vivo functions of Xl_cecr1 in embryogenesis, we used MOs to knock down Xl_cecr1. We designed two MOs specifically to target sequences surrounding the initiation codon of each of the Xl_cecr-1 and -2, and microinjected both of them at the two-cell stage to knock down both Xl_CECR1-1 and -2. Antisense MO injection significantly reduced the amounts of both Xl_CECR1-1 and -2 as shown by immunoblotting (Fig. 6A). In contrast, there was no significant change with control MOs containing four mismatched pairs, suggesting a specific effect of these MOs. Up to the neurula stage, there were no apparent morphological differences between antisense and control MO-injected embryos, supporting our data showing that the expression of Xl_cecr1 starts at the neurula stage (Fig. 4). Developmental abnormalities were observed in MO-injected embryos at tail-bud stages. There was an intermediate phenotype with vertical or lateral bending (25%, Fig. 6, B and C), and an abnormal severe phenotype accompanied by both reduction in size and body axis bending (13%, n = 24, Fig. 6D). Conversely, embryos injected with control MO displayed no significant abnormalities (95%, n = 22, Fig. 6E). In situ hybridization experiments revealed that the expression of a gene for a basic helix loop helix transcription factor, Xmyod, was missing in some somitic stripes in MO-injected tail-bud embryos (Fig. 6, F-I), which may have contributed to the reductions in size and the abnormal body axis bending. We tested a total of 24 MO-injected embryos. Among them, 8 embryos showed a marked reduction in Xmyod expression in somites at stage 20. The phenotypes ranged from a severe one showing marked reduction in Xmyod expression in most of the somites to a mild one showing moderate reduction in Xmyod expression in a few somites. There was no tendency for the abnormal phenotype to appear in a specific region of the somite. The abnormal phenotype showing reduction in Xmyod expression was not detected in MO-injected embryos of stage 15 (data not shown), in which cecr1 mRNA had not yet been expressed, and was consistent with our notion that the phenotype is due to the knocking down of CECR1. To further confirm that the bending and truncated phenotypes observed in embryos injected with the first pair of MOs are due to the knocking down of the CECR1. As a result, similar phenotypes were observed as in the case of the first pair of MOs, and all of the MO-injected embryos showed bending and/or truncated phenotypes (n = 14, data not shown).

Analysis of Developmental Marker Gene Expression in MO-injected Embryos—We next examined whether the expression of typical developmental marker genes were affected in the MO-injected embryos (Fig. 7). Of the somite marker genes (Xmyf-5, Xmyod, cardiac actin, and six1), the gene expression of Xmyf-5 (a marker of the most dorsal and ventral tips of the somites) was significantly increased (over 16-fold compared with controls), suggesting that Xl_cecr1s are involved in suppressing Xmyf-5 expression. Although Xmyod gene expression in somitic stripes was ablated partially by MOs (Fig. 6, F and H), total expression levels were not affected. We also examined markers for pronephron, eye, cement gland, and hatching gland; dramatic changes were observed in the gene expression of xsmp-30, which is a Xenopus homologue of SMP-30 (senescence marker protein-30) expressed in pronephric proximal tubules. Its expression decreased 32-fold in MO-injected embryos compared with controls, whereas there were no significant changes in the other pronephric marker genes (XNKCC2 (distal tubules), xwt1 (glomus), and Xlim1 (pronephros, central nervous system, and tail bud)). Of the eye marker genes, {gamma}-crystallin, Xpitx3, and darmin-r, the gene expression of {gamma}-crystallin decreased 16-fold in the MO-injected embryos. Expression of the marker genes for the cement gland and the hatching gland (xa and xag, respectively) was not affected significantly, consistent with the fact that the cement gland was visibly formed even in severely affected embryos (Fig. 6, B-D). We examined whether the expression of Xa2a was affected in MO-injected embryos. The amounts of Xa2a transcript increased more than 16-fold compared with controls, suggesting a role of the adenosine/P1 receptor in Xl_CECR1 functioning in Xenopus embryogenesis. We further examined the effect of MOs on the expression pattern of the somite marker Xmyf-5 gene at stage 35/36. In the wild-type tail-bud embryo, the Xmyf-5 was expressed in the most ventral and dorsal tips of posterior somites and in the tail portion (Fig. 8, B and D) (53). On the contrary, in MO-injected embryos, the Xmyf-5 expression diminished the most in the tips of the somites (Fig. 8C). Instead, the Xmyf-5 expression was markedly up-regulated in the tail part (Fig. 8C), which may have contributed to the enhancement of the overall amount of Xmyf-5 expression detected in RT-PCR analysis (Fig. 7).


Figure 6
View larger version (58K):
[in this window]
[in a new window]

  		FIGURE 6.
Effects of Xl_cecr1 morpholino oligonucleotides on embryogenesis of X. laevis. A, immunoblotting of Xl_cecr1-1 and -2 using MO-injected embryos (lane 1), 4 missed control MO (lane 2), and no treatment at stage 35/36 (lane 3). Arrows indicate the positions of Xl_cecr1s. B-E, effect of Xl_cecr1 MOs; MOs were injected at two-cell stage for Xl_cecr1-1 and -2 (B-D) or 4 missed control MO (E). Injected embryos were incubated up to stage 35/36. B and C, intermediate phenotype; bending vertically (B), or laterally (C). D, severe phenotype; both reduction and bending were observed. E, no significant phenotype obtained with 4 missed control MO. F-I, Xmyod expression at stage 20 embryos. Xl_cecr1 MO-injected embryos (F and H) and no injection control (G and I). F, Xmyod expression in somitic stripes was partially ablated. Arrowheads show the ablated Xmyod expression in somitic stripes. G, the Xmyod were expressed in each somitic stripe (no injection control). H, magnified view of F. I, magnified view of G. Bars indicate 0.2 mm.

 


Figure 7
View larger version (45K):
[in this window]
[in a new window]

  		FIGURE 7.
Effect of Xl_cecr1 morpholino oligonucleotides on the various gene expressions of X. laevis. Semi-quantitative RT-PCR was performed using primers of various developmental marker genes: MO-injected embryo (lane 1), 4 missed control MO (lane 2), and no treatment at stage 35/36 (lane 3). Relative gene expression levels were determined by RT-PCR. Amplification of ornithine decarboxylase was used to normalize the cDNA content of the samples. Xmyf-5, Xmyod, cardiac actin, and six1 are marker genes of somites. Xsmp-30, XNKCC2, xwt1, and Xlim-1 are marker genes of pronephros. {gamma}-Crystallin, Xpitx3, and darmin-r are marker genes for the eye. xa and xag are marker genes for the cement gland. Xa2a is a gene of the Xenopus homologue of the adenosine A2A receptor.

 


Figure 8
View larger version (75K):
[in this window]
[in a new window]

  		FIGURE 8.
Effects of Xl_cecr1 morpholino oligonucleotides on the Xmyf-5 expression pattern of X. laevis embryos at stage 35/36. A, mild phenotype of Xl_cecr1 MO-injected embryos; the gene expression of Xmyf-5 was markedly up-regulated in the tail part and diminished the most in the most ventral and dorsal tips of posterior somites. B, no injection controls; the Xmyf-5 was expressed in the tail part and in the most ventral and dorsal tips of posterior somites. C, magnified view of A. D, magnified view of B. Bars indicate 0.2 mm.

 


Figure 9
View larger version (61K):
[in this window]
[in a new window]

  		FIGURE 9.
Effects of adenosine, DCF, and various adenosine/P1 receptor agonists on embryogenesis of Xenopus laevis. DCF (A), CGS-21680 hydrochloride (selective for the adenosine A2A receptor) (B), CPA (cyclopentyl adenosine, selective for the adenosine A1 receptor) (C), adenosine (D), NECA (5'-N-ethylcarboxamido adenosine) (selective for the adenosine A1, A2A, A2B, and A3 receptor) (E), and MMR buffer (F) were injected into late gastrula archenteron at stage 12 and were incubated up to stage 35/36. A-E, abnormal phenotype; embryos showed significant reductions in size and body shape. F, no significant phenotype was observed. G and H, Xmyod expression at stage 20 embryos. CGS-21680 hydrochloride-injected embryos (G) and buffer-injected control (H). G, Xmyod expression in somitic stripes was ablated partially. Arrowheads show the ablated Xmyod expression in somitic stripes. H, Xmyod were expressed in each somitic stripe in buffer-injected control. Bars indicate 0.2 mm.

 
Analysis of the Mechanism of Action of Xl_CECR1s and XA2A in Xenopus Embryogenesis—Next, to determine whether the adenosine/P1 receptor influences Xl_CECR1 activity, we examined the effects of adenosine, an ADA inhibitor (DCF) and adenosine/P1 receptor agonists (CGS21680, 5'-N-ethylcarboxamido adenosine, or cyclopentyl adenosine) on embryogenesis by injecting them into late gastrula stage 12 embryo archenteron. Injected embryos were incubated up to stage 35/36 and their morphologies were examined. DCF caused an abnormal phenotype accompanied by reductions in both size and body axis bending, suggesting that the ADA activity of Xl_CECR1s modulates their activity (Fig. 9A). Injection of adenosine, or adenosine agonists also caused abnormal phenotypes, similar to DCF, characterized by reduction in size and abnormal body axis bending (Fig. 9, B-E). We also examined the effect of the adenosine/P1 receptor agonists on the expression of the somite marker gene, Xmyod, at stage 20. In situ hybridization revealed that the Xmyod expression in somitic stripes decreased in embryos injected with either the adenosine receptor agonist, CGS-21680 hydrochloride (Fig. 9G) or cyclopentyl adenosine (data not shown). These phenotypes were similar to those obtained with the injection of cecr1 MOs, which is characterized by the ablated Xmyod expression in somitic stripes (Fig. 6, F and H). These results are consistent with our notion that Xl_cecr1s function in Xenopus embryogenesis via the adenosine/P1 receptor by regulating extracellular adenosine levels.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
In the current study, we first identified two Xenopus CECR1 homologues and showed that they catalyze adenosine deamination with Km values (260 µM and 230 µM) 10 times lower than those of human CECR1/ADA2 (Km = 2.53 mM). Thus there might be altered levels of enzymatic activity, possibly associated with the molecular evolution from amphibian to mammal. It is noteworthy that the ADA activity of Xl_CECR1s was also linked to growth factor activity, as shown for invertebrate ADGFs (3, 9-13). The differences in the specific growth factor activities between Xl_CECR1-1 and -2 may reflect differences in their specific ADA activities. Thus, it is plausible that Xl_CECR1s play some role in growth regulation during development via extracellular adenosine deamination.

The two Xenopus cecr1 isoforms showed similar expression profiles during embryogenesis, suggesting that they have cooperative roles. The most frequent phenotypes in the knockdown experiments were a reduction in size and abnormal bending of the body axis, which might be explained by selective changes of cell populations caused by the lack of growth factors. Given the early expression in somites of these growth factors, these results suggest that Xenopus cecr1s are involved in somite formation and differentiation during embryogenesis. This was supported by the significant increase in the amount of Xmyf-5 mRNA and the ablated expression of Xmyod mRNA in the MO-injected embryos.

The initial activation of muscle-specific genes is observed during gastrulation and concerns the two myogenetic regulatory factors, XMyf-5 and XMyoD, whose transcripts are detected at stages 9.5 and 10.5, respectively. This is quickly followed by the accumulation of transcripts of cardiac actin, the first muscle structural gene expressed in vertebrates (54). Expression of the Xl_cecr1 started at stage 20 (Fig. 4), and local elevation of adenosine in MO-injected embryos might have disturbed the function of Xmyf-5 and Xmyod present in somites thorough adenosine/P1 receptor signaling, resulting in developmental defects in the somites. As the gene expression of the Xl_cecr1s and the adenosine/P1 receptor (Xa2a) overlaps in some cell populations in somitic strips, it might be possible that the CECR1 signaling and the adenosine/P1 receptor compose an autocrine feedback loop in these cell populations to respond to a local change in the concentration of the ligand (adenosine) metabolized by the extracellular enzyme (CECR1).


Figure 10
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 10.
Possible mode of action of Xenopus CECR1 during development through the adenosine/P1 receptor-mediated signaling. The extracellular adenosine concentration regulated by CECR1 might be a crucial determinant of the differential activation of coexisting the adenosine/P1 receptors under varying physical conditions. A local decrease in extracellular adenosine concentrations may modulate the selectivity of the receptor subtypes.

 
We showed somitic expression of Xa2a (a Xenopus homologue of adenosine A2A receptor) and the augmentation of gene expression in MO-injected embryos (Figs. 5, F and G, and 7). The mode of action of Xl_CECR1s during development might be explained by adenosine/P1 receptor-mediated signaling. The results of the experiments using adenosine/P1 receptor agonists suggest that adenosine/P1 receptors mediate the signal from CECR1, probably by changing the sensitivity to the ligand, adenosine, in response to a local decrease in adenosine concentration catalyzed by CECR1 (summarized in Fig. 10). This notion is consistent with the fact that human CECR1 has a binding site on the cell surface near the adenosine/P1 receptor. Human CECR1/ADA2 interacts with heparan sulfate proteoglycans and/or receptors on the cell surface to stimulate the proliferation of immune cells and tumor cells (14). The local decrease of extracellular adenosine concentration may modulate the selectivity of the receptor subtypes.

The adenosine/P1 receptor family comprises the A1, A2A, A2B, and A3 adenosine receptors, which have been cloned from various species (55). A1, A2A, A2B, and A3 adenosine receptors have distinct but frequently overlapping tissue distributions. The concentration of extracellular adenosine regulated by CECR1 might be a crucial determinant of the differential activation of coexisting adenosine/P1 receptors under different physical conditions. For example, it has been shown that low concentrations of adenosine activate the A1 adenosine receptor expressed on neutrophils, whereas high concentrations of adenosine, acting on A2 adenosine receptors, inhibit the effects produced by A1 occupancy (55). The increased expression of the Xa2a in the MO-injected embryos may reflect such a switch caused by excess amounts of extracellular adenosine. Interestingly, microinjection of adenosine receptor agonists for A1, A2B, and A3 resulted in developmental defects similar to those of A2A, suggesting the involvement in embryogenesis of other subtypes apart from the adenosine A2A receptor. The phenotypes resulting from Adgf-a (a CECR1 family in invertebrates) deficiency in Drosophila are partially explained by adenosine/P1 receptor signaling and elevations of extracellular adenosine levels (22). Similarly, adenosine concentrations could also be up-regulated in MO-injected embryos as in the Drosophila mutants (22).

We found a dramatic decrease in the number of xsmp-30 transcripts in the MO-injected embryos. Other marker genes, including that for pronephric distal tubules, XNKCC2, were unaffected in the same embryo, indicating that pronephric proximal tubules specifically failed to fully develop in the Xenopus CECR1s-deprived embryos. It was recently reported that SMP-30 acts as a survival factor in hepatocytes by regulating Akt activity (56). It might also be possible for SMP-30 to function as a survival factor during pronephros development via Akt, with expression regulated by X1_CECR1s.

Overexpression of human CECR1 is suggested to be responsible for some of the features of cat eye syndrome, such as congenital ocular coloboma and kidney defects (17, 20). In contrast, as shown in our experiments, knockdown of Xenopus CECR1s resulted in a reduction in size and abnormal bending of the body axis, suggesting an important role of Xenopus CECR1 in normal development. Thus, expression of the CECR1 should be tightly regulated, possibly to maintain the appropriate adenosine levels required for normal development.

What is the physiological function of extracellular adenosine in Xenopus embryogenesis? Our results suggest that an optimum level of extracellular adenosine is needed for normal development. ATP and the reaction products (ADP/AMP) are known to be enzymatically hydrolyzed by ectonucleotidases in the extracellular space, and the physiological significance of this has been previously discussed (55, 57). Interestingly, circadian-regulated 5'-AMP seems to be the key signal that mediates murine procolipase expression in peripheral organs and induces torpor, a hibernation-like state (58). In addition, a certain level of extracellular adenosine functions as a synaptic, angiogenic, and vasculogenic modulator (55, 59-61). Thus, extracellular levels of adenosine or purine nucleotides are regulated both seasonally and developmentally. Our findings stress the important role of a novel group of extracellular ADAs linked with growth factor activity in the local metabolism of extracellular adenosine, which act via adenosine/P1 receptor-mediated intracellular signaling during embryogenesis.


   FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the Gen-BankTM/EBI Data Bank with accession number(s) AY986978 and AY986979.

* This work was supported by Grants-in-aid for Scientific Research from the Japan Society for the Promotion of Science (to K. J. H.), the Ministry of Education, Science, Sports and Culture of Japan (to S. Y.), the Naito Foundation (to K. J. H.), the Japan Foundation of Applied Enzymology (to K. J. H.), the Uehara Memorial Foundation (to S. Y.), the Sagawa Foundation for Promotion of Cancer Research (to S. Y.), and the Core Research for Evolutional Science and Technology of the Japan Science and Technology Corporation (to S. N.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 These authors contributed equally to this work. Back

2 To whom correspondence should be addressed: Faculty of Pharmaceutical Sciences, Teikyo University, Sagamihara, Kanagawa 229-0195, Japan. Tel.: 81-42-685-3739; Fax: 81-42-685-3738; E-mail: homma-kj{at}umin.ac.jp.

3 The abbreviations used are: ADGF, adenosine deaminase-related growth factor; ADA, adenosine deaminase; CECR1, cat eye syndrome critical region candidate 1; DCF, 2'-deoxycoformycin; EHNA, erythro-9-(2-hydroxy-3-nonyl)-adenine hydrochloride; IDGF, insect-derived growth factor; RT, reverse transcriptase; MO, morpholino oligonucleotide. Back


   ACKNOWLEDGMENTS
 
We thank H. Thoenen, K. Shiokawa, and M. Hayashi for critical reading of this manuscript. We also thank S. Katagiri, A. Murakami, N. Hirose, and M. Matsui for technical assistance.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Homma, K., Matsushita, T., and Natori, S. (1996) J. Biol. Chem. 271, 13770-13775[Abstract/Free Full Text]
  2. Maier, S. A., Galellis, J. R., and McDermid, H. E. (2005) J. Mol. Evol. 61, 776-794[CrossRef][Medline] [Order article via Infotrieve]
  3. Homma, K. J., Tanaka, Y., Matsushita, T., Yokoyama, K., Matsui, H., and Natori, S. (2001) J. Biol. Chem. 276, 43761-43766[Abstract/Free Full Text]
  4. Simon, L. N., Bauer, R. J., Tolman, R. L., and Robins, R. K. (1970) Biochemistry 9, 573-577[CrossRef][Medline] [Order article via Infotrieve]
  5. Chang, Z., Nygaard, P., Chinault, A. C., and Kellems, R. E. (1991) Biochemistry 30, 2273-2280[CrossRef][Medline] [Order article via Infotrieve]
  6. Blackburn, M. R., and Kellems, R. E. (2005) Adv. Immunol. 86, 1-41[CrossRef][Medline] [Order article via Infotrieve]
  7. Matsushita, T., Fujii-Taira, I., Tanaka, Y., Homma, K. J., and Natori, S. (2000) J. Biol. Chem. 275, 36934-36941[Abstract/Free Full Text]
  8. Maier, S. A., Podemski, L., Graham, S. W., McDermid, H. E., and Locke J. (2001) Gene (Amst.) 280, 27-36[CrossRef][Medline] [Order article via Infotrieve]
  9. Charlab, R., Valenzuela, J. G., Andersen, J., and Ribeiro J. M. (2001) Gene (Amst.) 267, 13-22[CrossRef][Medline] [Order article via Infotrieve]
  10. Zurovec, M., Dolezal, T., Gazi, M., Pavlova, E., and Bryant, P. J. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 4403-4408[Abstract/Free Full Text]
  11. Akalal, D. B., Bottenstein, J. E., Lee, S. H., Han, J. H., Chang, D. J., Kaang, B. K., and Nagle, G. T. (2003) Brain Res. Mol. Brain Res. 117, 228-236[Medline] [Order article via Infotrieve]
  12. Li, S., and Aksoy, S. (2000) Gene (Amst.) 252, 83-93[CrossRef][Medline] [Order article via Infotrieve]
  13. Ribeiro, J. M., Charlab, R., and Valenzuela, J. G. (2001) J. Exp. Biol. 204, 2001-2010[Abstract/Free Full Text]
  14. Zavialov, A. V., and Engstrom, A. (2005) Biochem. J. 391, 51-57[CrossRef][Medline] [Order article via Infotrieve]
  15. Tanaka, Y., Yamaguchi, S., Fujii-Taira, I., Iijima, R., Natori, S., and Homma, K. J. (2006) Biochem. Biophys. Res. Commun. 350, 334-338[CrossRef][Medline] [Order article via Infotrieve]
  16. Dolezal, T., Gazi, M., Zurovec, M., and Bryant, P. J. (2003) Genetics 165, 653-666[Abstract/Free Full Text]
  17. Riazi, M. A., Brinkman-Mills, P., Nguyen, T., Pan, H., Phan, S., Ying, F., Roe, B. A., Tochigi, J., Shimizu, Y., Minoshima, S., Shimizu, N., Buchwald, M., and McDermid, H. E. (2000) Genomics 64, 277-285[CrossRef][Medline] [Order article via Infotrieve]
  18. Freedom, R. M., and Gerald, P. S. (1973) Am. J. Dis. Child. 126, 16-18[Abstract/Free Full Text]
  19. Schinzel, A., Schmid, W., Fraccaro, M., Tiepolo, L., Zuffardi, O., Opitz, J. M., Lindsten, J., Zetterqvist, P., Enell, H., Baccichetti, C., Tenconi, R., and Pagon, R. A. (1981) Hum. Genet. 57, 148-158[CrossRef][Medline] [Order article via Infotrieve]
  20. Footz, T. K., Brinkman-Mills, P., Banting, G. S., Maier, S. A., Riazi, M. A., Bridgland, L., Hu, S., Birren, B., Minoshima, S., Shimizu, N., Pan, H., Nguyen, T., Fang, F., Fu, Y., Ray, L., Wu, H., Shaull, S., Phan, S., Yao, Z., Chen, F., Huan, A., Hu, P., Wang, Q., Loh, P., Qi, S., Roe, B. A., and McDermid, H. E. (2001) Genome Res. 11, 1053-1070[Abstract/Free Full Text]
  21. Wiginton, D. A., Coleman, M. S., and Hutton, J. J. (1981) Biochem. J. 195, 389-397[Medline] [Order article via Infotrieve]
  22. Dolezal, T., Dolezelova, E., Zurovec, M., and Bryant, P. J. (2005) PLoS Biol. 3, 1213-1224
  23. Riazi, A. M., Arsdell, G. V., and Buchwald, M. (2005) Transgenic Res. 14, 333-336[CrossRef][Medline] [Order article via Infotrieve]
  24. Shiokawa, K., Koga, C., Ito, Y., and Shibata, M. (1997) Methods Mol. Biol. 62, 247-270[Medline] [Order article via Infotrieve]
  25. Nieuwkoop, P. D., and Faber, J. (1956) Normal Table of Xenopus laevis (Daudin), North-Holland Publishing Co., Amsterdam
  26. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-4680[Abstract/Free Full Text]
  27. Saitou, N., and Nei, M. (1987) Mol. Biol. Evol. 4, 406-425[Abstract]
  28. Page, R. D. (1996) Comput. Appl. Biosci. 12, 357-358[Free Full Text]
  29. Iwaki-Egawa, S., Watanabe, Y., and Matsuno, H. (2001) J. Rheumatol. 28, 485-489[Abstract/Free Full Text]
  30. Mitsuhashi, J., and Maramorosch, K. (1964) Contrib. Boyce Thompson Inst. 22, 435-460
  31. Komano, H., Kasama, E., Nagasawa, Y., Nakanishi, Y., Matsuyama, K., Ando, K., and Natori, S. (1987) Biochem. J. 248, 217-222[Medline] [Order article via Infotrieve]
  32. Ahmed, S. A., Gogal, R. M., Jr., and Walsh, J. E. (1994) J. Immunol. Methods 170, 211-224[CrossRef][Medline] [Order article via Infotrieve]
  33. Page, B., Page, M., and Noel, C. (1993) Int. J. Oncol. 3, 473-476
  34. Fukui, A., Noda, M., and Asashima, M. (1997) Gene (Amst.) 203, 183-188[CrossRef][Medline] [Order article via Infotrieve]
  35. Dosch, R., Gawantka, V., Delius, H., Blumenstock, C., and Niehrs, C. (1997) Development 124, 2325-2334[Abstract]
  36. Klein, S. L., Strausberg, R. L., Wagner, L., Pontius, J., Clifton, S. W., and Richardson, P. (2002) Dev. Dyn. 225, 384-391[CrossRef][Medline] [Order article via Infotrieve]
  37. Skoglund, P., and Keller, R. (2007) Dev. Biol. 301, 404-416[CrossRef][Medline] [Order article via Infotrieve]
  38. Mohun, T. J., Brennan, S., Dathan, N., Fairman, S., and Gurdon, J. B. (1984) Nature 311, 716-721[CrossRef][Medline] [Order article via Infotrieve]
  39. Ghanbari, H., Seo, H., Fjose, A., and Brandli, A. W. (2001) Mech. Dev. 101, 271-277[CrossRef][Medline] [Order article via Infotrieve]
  40. Sato, A., Asashima, M., Yokota, T., and Nishinakamura, R. (2000) Mech. Dev. 92, 273-275[CrossRef][Medline] [Order article via Infotrieve]
  41. Zhou, X., and Vize, P. D. (2004) Dev. Biol. 271, 322-338[CrossRef][Medline] [Order article via Infotrieve]
  42. Carroll, T. J., and Vize, P. D. (1996) Dev. Dyn. 206, 131-138[CrossRef][Medline] [Order article via Infotrieve]
  43. Taira, M., Jamrich, M., Good, P., and Dawid, I. B. (1993) Genes Dev. 6, 356-366[CrossRef]
  44. Mizuno, N., Mochii, M., Takahashi, T. C., Eguchi, G., and Okada, T. S. (1999) Differentiation 64, 143-149[CrossRef][Medline] [Order article via Infotrieve]
  45. Pommereit, D., Pieler, T., and Hollemann, T. (2001) Mech. Dev. 102, 255-257[CrossRef][Medline] [Order article via Infotrieve]
  46. Pera, E. M., Martinez, S. L., Flanagan, J. J., Brechner, M., Wessely, O., and De Robertis, E. M. (2003) Gene Expr. Patterns 3, 147-152[CrossRef][Medline] [Order article via Infotrieve]
  47. Hemmati-Brivanlou, A., Frank, D., Bolce, M. E., Brown, B. D., Sive, H. L., and Harland, R. M. (1990) Development 110, 325-330[Abstract/Free Full Text]
  48. Sive, H. L., Hattori, K., and Weintraub, H. (1989) Cell 58, 171-180[CrossRef][Medline] [Order article via Infotrieve]
  49. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
  50. Luttrell, D. K., Lee, A., Lansing, T. J., Crosby, R. M., Jung, K. D., Willard, D., Luther, M., Rodriguez, M., Berman, J., and Gilmer, T. M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 83-87[Abstract/Free Full Text]
  51. Neilsen, H., Engelbrecht, J., Brunak, S., and Heijne, G. (1997) Protein Eng. 10, 1-6[Abstract/Free Full Text]
  52. Ratech, H., Thorbecke, G. J., Meredith, G., and Hirschhorn, R. (1981) Enzyme 26, 74-84[Medline] [Order article via Infotrieve]
  53. Chen, Y., Lin, G. F., Hu, R., Chen, Y., and Ding, X. (2003) Biochem. Biophys. Res. Commun. 310, 121-127[CrossRef][Medline] [Order article via Infotrieve]
  54. Chanoine C., and Hardy, S. (2003) Dev. Dyn. 226, 12-23[CrossRef][Medline] [Order article via Infotrieve]
  55. Fields, R. D., and Burnstock, G. (2006) Nat. Rev. Neurosci. 7, 423-436[CrossRef][Medline] [Order article via Infotrieve]
  56. Matsuyama, S., Kitamura, T., Enomoto, N., Fujita, T., Ishigami, A., Handa, S., Maruyama, N., Zheng, D., Ikejima, K., Takei, Y., and Sato, N. (2004) Biochem. Biophys. Res. Commun. 321, 386-390[CrossRef][Medline] [Order article via Infotrieve]
  57. Jackson, E. K., and Raghvendra, D. K. (2004) Annu. Rev. Physiol. 66, 571-599[CrossRef][Medline] [Order article via Infotrieve]
  58. Zhang, J., Kaasik, K., Blackburn, M. R., and Lee, C. C. (2006) Nature 439, 340-343[CrossRef][Medline] [Order article via Infotrieve]
  59. Nicoll, R. A., and Schimitz, D. (2005) Nat. Rev. Neurosci. 6, 863-876[CrossRef][Medline] [Order article via Infotrieve]
  60. Montesinos, M. C., Shaw, J. P., Yee, H., Shamamian, P., and Cronstein, B. N. (2004) Am. J. Pathol. 164, 1887-1982[Abstract/Free Full Text]
  61. Dunwiddie, T. V., and Masino, S. A. (2001) Annu. Rev. Neurosci. 24, 31-55[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 DevelopmentHome page
T. Fukazawa, Y. Naora, T. Kunieda, and T. Kubo
Suppression of the immune response potentiates tadpole tail regeneration during the refractory period
Development, July 15, 2009; 136(14): 2323 - 2327.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/4/2255    most recent
M709279200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iijima, R.
Right arrow Articles by Homma, K. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iijima, R.
Right arrow Articles by Homma, K. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2008 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement