Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M702454200 on October 31, 2007

J. Biol. Chem., Vol. 283, Issue 5, 2564-2574, February 1, 2008
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/5/2564    most recent
M702454200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, H.
Right arrow Articles by Zhu, W.-G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, H.
Right arrow Articles by Zhu, W.-G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

An ATM- and Rad3-related (ATR) Signaling Pathway and a Phosphorylation-Acetylation Cascade Are Involved in Activation of p53/p21Waf1/Cip1 in Response to 5-Aza-2'-deoxycytidine Treatment*

Haiying Wang{ddagger}, Ying Zhao{ddagger}, Lian Li{ddagger}, Michael A. McNutt§, Lipeng Wu{ddagger}, Shaoli Lu{ddagger}, Yu Yu{ddagger}, Wen Zhou{ddagger}, Jingnan Feng{ddagger}, Guolin Chai{ddagger}, Yang Yang{ddagger}, and Wei-Guo Zhu{ddagger}1

From the Departments of {ddagger}Biochemistry and Molecular Biology and §Pathology and the Cancer Research Center, Peking University Health Science Center, Beijing 100083, China

Received for publication, March 22, 2007 , and in revised form, October 30, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Most agents that damage DNA act through posttranslational modifications of p53 and activate its downstream targets. However, whether cellular responses to nucleoside analogue-induced DNA damage also operate through p53 posttranslational modification has not been reported. In this study, the relationship between p53 activation and its posttranslational modifications was investigated in the human cancer cell lines A549 and HCT116 in response to 5-aza-2'-deoxycytidine (5-aza-CdR) or cytarabine treatment. 5-Aza-CdR induces p53 posttranslational modifications through activation of an ATM- and Rad3-related (ATR) signaling pathway, and 5-aza-CdR-induced association of replication protein A with chromatin is required for the binding of ATR to chromatin. Upon treatment with 5-aza-CdR, ATR activation is clearly associated with p53 phosphorylation at Ser15, but not at Thr18, Ser20, or Ser37. This specific p53 phosphorylation at Ser15 in turn results in acetylation of p53 at Lys320 and Lys373/Lys382 through transcriptional cofactors p300/CBP-associated factor and p300, respectively. These p53 posttranslational modifications are directly responsible for 5-aza-CdR induced p21Waf1/Cip1 expression because the binding activity of acetylated p53 at Lys320/Lys373/Lys382 to the p21Waf1/Cip1 promoter, as well as p21Waf1/Cip1 expression itself are significantly increased after 5-aza-CdR treatment. It is of interest that p53 phosphorylation at Ser15 and acetylations at Lys320/Lys373/Lys382 mutually interact in the 5-aza-CdR induced p21Waf1/Cip1 expression shown by transfection of artificially mutated p53 expression vectors including S15A, K320R, and K373R/K382R into p53-null H1299 cells. These data taken together show for the first time that 5-aza-CdR activates the ATR signaling pathway, which elicits a specific p53 phosphorylation-acetylation cascade to induce p21Waf1/Cip1 expression.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The p53 tumor suppressor stands at the cross-roads of cellular responses to various stresses (1, 2). Under normal conditions, p53 is maintained at a low level through its interaction with MDM2 (3, 4), Pirh2 (5), COP1 (6), and ARF-BP1 (7), which mediate both ubiquitination and proteasome-dependent degradation of p53. However, in response to DNA damage, both the quantity and activity of p53 are greatly increased. As a transcription factor, depending on the nature of the stress, p53 can induce expression of many different downstream genes including p21Waf1/Cip1, GADD45, and Bax to elicit various responses, such as cell cycle arrest, apoptosis, and DNA repair (8–10).

p53 accumulation and activation are thought to be regulated through posttranslational modifications such as phosphorylation, acetylation, and ubiquitination under conditions of stress. Up to date, at least 20 phosphorylation sites have been detected in the p53 molecule in human cells following DNA damage (2, 11–13). Phosphorylation of p53 usually modulates its stability and sequence-specific DNA binding activity (2). For instance, phosphorylation of Ser15, Thr18, Ser20, and Ser37 stabilizes p53 by disrupting interaction between p53 and MDM2 (14–16), whereas phosphorylations at the p53 C terminus such as at Ser315 and Ser392 are reported to regulate the oligomerization state and sequence-specific DNA binding ability of p53 (11, 17).

These phosphorylation modifications of p53 are catalyzed by different kinases (1). The PI3K2 family including ATM (ataxia telangiectasia mutated) and ATR (ATM- and Rad3-related) is at the top of the DNA damage signaling network and plays a key role in the response of p53 to DNA damage (18–21). ATM mainly phosphorylates the Ser15 residue in response to irradiation and chemotherapeutic drugs (20, 21), whereas ATR especially phosphorylates both Ser15 and Ser37 residues when cells are treated with UV and inhibitors of replication (1, 19).

In addition, p53 acetylation may also play important roles in response to various types of DNA damage (1, 2, 22–25). Two transcription factors with histone acetyltransferase activity, p300/CBP, and p300/CBP-associated factor (PCAF), are reported to be mainly responsible for the p53 acetylation. p300/CBP acetylates p53 at Lys305, Lys372, Lys373, Lys381, and Lys382, whereas PCAF acetylates p53 at Lys320 (1, 2, 22, 24). Recently, another transcription factor, Tip60, was reported to specifically acetylate p53 at Lys120 in response to DNA damage, which is crucial for p53-dependent apoptosis, by selectively affecting the transcription of proapoptotic target genes such as BAX and PUMA (26, 27).

p53 acetylation can increase p53 sequence-specific DNA binding capacity (22, 28–31) or enhance its stabilization by inhibiting ubiquitination of p53 mediated by MDM2 (31–33). Several reports have demonstrated that Lys320 acetylation is correlated with increased sequence-specific DNA binding and transcriptional activation, which positively regulates p53 activity (1, 2, 29). p53 acetylation at Lys320 and Lys382 increases p53 transactivation function, possibly because of acetylation-induced conformational changes (30). In addition to agents that damage DNA, histone deacetylase inhibitors and other chemical agents are also reported to induce p53 acetylation. Both our recent study and work by another group have shown that the histone deacetylase inhibitors depsipeptide and CG1521 can induce p21Waf1/Cip1 expression through acetylation of p53 at Lys373/Lys382 (31, 34).

It is of particular interest that these two posttranslational modifications of p53, phosphorylation and acetylation, interact (2, 29, 35). Phosphorylation of p53 seems to be a signal for subsequent acetylation. For example, phosphorylation at N-terminal serines, such as Ser15, Ser33, and Ser37 have been reported to recruit p300/CBP and PCAF to induce p53 acetylation in response to DNA damage (29, 36). UV-activated HIPK2 was reported to phosphorylate p53 at Ser46, thus facilitating the CBP-mediated acetylation of p53 at Lys382, and promoting p53-dependent gene expression (35). In addition, phosphorylation of p53 at Ser20 or Thr18 can stabilize the p300-p53 complex and thus induce p53 acetylation (37). Recently, it was reported that p53 C-terminal phosphorylation also modulates C-terminal acetylation in response to DNA damage (38). However, the latter study offered little information as to whether acetylation site mutation of p53 influences the phosphorylation status of p53 after DNA damage (39). These reports imply that different stimuli leading to DNA damage may induce different p53 posttranslational modifications, and there may be an obligatory parallel increase in p53 phosphorylation and acetylation for p53 to exert its function. Thus, understanding the sequence of events of p53 phosphorylation and acetylation may give greater insight into p53 function and help guide applications of p53 in clinical therapy.

Although the nucleoside analogue 5-aza-2'-deoxycytidine (5-aza-CdR) is currently used in epigenetic research, its original role was as an antineoplastic agent because it is readily incorporated into DNA (40). It is distinct from other inducers of DNA damage, such as radiation and UV light; nucleoside analogue-induced DNA damage usually results in a single-stranded break in DNA (40, 41). Although our previous data and that of others have demonstrated that 5-aza-CdR activates the p53/p21Waf1/Cip1 pathway through DNA damage (42, 43), the mechanism by which nucleoside analogues induce activation of p53/p21Waf1/Cip1 has not been worked out yet. Hence, it is of particular interest to determine whether nucleoside analogue 5-aza-CdR or Ara-C induces p53 activation through a specific pathway and evokes specific p53 posttranslational modifications.

In this study, our data indicate that 5-aza-CdR activates p53 through the PI3K pathway, which in turn induces p53 posttranslational modifications including phosphorylation at Ser15 and acetylation at Lys320 and Lys373/Lys382. These posttranslational modifications are required for p53 to activate its downstream target gene p21Waf1/Cip1. More importantly, a mutual causal relationship between phosphorylation and acetylation of p53 at specific sites was confirmed in p53 activation as well as by p21Waf1/Cip1 expression in response to 5-aza-CdR treatment.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture and Nucleoside Analogue Treatment—Human lung cancer cell lines A549 and H1299 were grown in RPMI 1640 supplemented with 10% fetal bovine serum (heat-inactivated at 56 °C for 45 min) and penicillin/streptomycin, in a humidified incubator with 5% CO2 atmosphere at 37 °C. The cells were treated with 5-aza-CdR (0.01–5 µM, Sigma) for up to 72 h or with Ara-C (0.1–5 µM, Sigma) for up to 48 h. Fresh medium containing chemicals was added every 24 h.

Subcellular Fraction—The cellular protein fractionation was performed as described previously (44) with modifications. In brief, the cells were lysed in solution A (50 mM Tris-HCl, pH 7.8, 420 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40, 0.34 M sucrose, 10% glycerol, 1 mM Na3VO4, and protease inhibitor mixture). To obtain nuclear extracts, the cells were lysed in buffer B (10 mM HEPES, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 0.1% Triton X-100, protease inhibitor mixture). Isolated nuclei were washed once with buffer B and further lysed in buffer A as above. To obtain chromatin-bound proteins, the isolated nuclei were lysed in buffer C (3 mM EDTA, 0.2 mM EGTA, 1 mM dithiothreitol) and further lysed in buffer A as above.

Western Blot—Protein expression was evaluated by Western blotting as previously described, with minor modifications (43). Briefly, the cells were harvested with a scraper and then washed once with cold phosphate-buffered saline. The cells were then lysed in lysis buffer (50 mM Tris-HCl, 250 mM NaCl, 5 mM EDTA, 50 mM NaF, 0.15% Igepal CA-630, and 1.5 mM phenylmethylsulfonyl fluoride). Equal amounts of proteins (100–150 µg) were size-fractionated by 6–12.5% SDS-PAGE. The antibodies used were anti-p21Waf1/Cip1 (F-5; Santa Cruz), anti-p53 (DO-1; Santa Cruz), anti-p53 (P240; Santa Cruz), anti-PCAF (C-16; Santa Cruz), anti-p300 (H-272; Santa Cruz), anti-CBP (A-22; Santa Cruz), anti-ubiquitin (P4D1; Santa Cruz), anti-RPA32 (Santa Cruz), anti-RPA70 (Santa Cruz), anti-β-actin (Huatesheng Biotechnology, Fushun, China), anti-Lys373/382-p53 and anti-Lys320-p53 (Upstate%20Biotechnology">Upstate Biotechnology, Inc.), anti-Ser15, anti-Thr18, anti-Ser20, and anti-Ser37 (Cell Signaling).

RNA Interference—RNAi mediated knockdown of ATM and ATR was performed as described previously (45), with synthetic siRNA duplexes as follows: ATM, AAGCGCCUGAUUCGAGAUCCU; ATR, AAGACGGUGUGCUCAUGCGGC; and silencing control, AAUUCUCCGAACGUGUCACGU. The sequence of RPA70 siRNA is AACACUCUAUCCUCUUUCAUG. A549 cells were transfected with 100 nmol/liter siRNA and analyzed at 72 h after transfection.

Site-directed Mutagenesis—p53 mutant constructs (S15A, K320R, and K373R/K382R) were generated using a site-directed mutagenesis kit (QuikChange; Stratagene, La Jolla, CA). A wild-type p53 expression vector (pCIneo with full-length p53 cDNA) (43) was used as the mutagenesis template. Wild-type p53 was mutated at specific sites, following the manufacturer's directions. Primers used for mutagenesis had the following sequences: p53-15A-up, 5-CGT CGA GCC CCC TCT GAG(GC) TCA GGA AAC ATT TTC AG-3; p53-15A-down, 5-CTG AAA ATG TTT CCT GACT(GC)CA GAG GGG GCT CGA CG-3; p53–320R-up, 5-CTC TCC CCA GCC AAA GAA(CG) GAA ACC ACT GGA TGG AG-3; p53–320R-down, 5-CTC CAT CCA GTG GT T TCTT(CG)CT TTG GCT GGG GAG AG-3; p53–373R-up, 5-CAC CTG AAG TCC AAA AG(A) G GGT CAG TCT ACC TC-3; p53–373R-down, 5-GA GGT AGA CTG ACC CC(T) TTTT GGA CTT CAG GTG-3; p53–382R-up, 5-CTA CCT CCC GCC ATA AAA G(A)AC TCA TGT TCA AGA-3; and p53–382R-down, 5-TCT TGA ACA TGA GTC(T) TTT TAT GGC GGG AGG TAG-3. In these primers, underlined italicized nucleotides indicate the replaced nucleotides, and the nucleotides in parentheses indicate the original nucleotides.

Assay for Detecting Ubiquitination of p53—A549 cells were treated with 5-aza-CdR at 1 µM for 48 h (or 5-aza-CdR was omitted as a control) and treated for 6 h with 25 µM proteasome inhibitors N-acetyl-L-leucyl-L-leucyl-L-norleucine and MG132 before being harvested. The treated cells were then lysed and immunoprecipitated with anti-p53 (P240). The immunoprecipitated proteins were size-fractionated by SDS-polyacrylamide gel electrophoresis, and Western blot was then performed with anti-ubiquitin.

Transient Transfection—Vectors used for transfections in this study include wild-type p53, mutant Lys320 p53, mutant Lys373/Lys382 p53 (lysines were replaced in these sites with arginines), and mutant Ser15 p53 (Ser15 was replaced with alanine). Twenty-four hours prior to transfection, H1299 cells were seeded into 6-well tissue culture plates. On the following day, these cells were transfected with the expression vectors for wild-type p53 or p53 mutants using Qiagen EffecteneR transfection reagent, as recommended by the manufacturer. The cells were then treated with 1 µM 5-aza-CdR for 24 h after transfection and harvested for Western blotting.

Chromatin Immunoprecipitation (ChIP) Assay—A549 cells were cross-linked with 1% formaldehyde for 10 min at 37 °C and then washed with cold phosphate-buffered saline. The cell pellet was resuspended in lysis buffer (1% SDS, 100 mM NaCl, 50 mM Tris·HCl, pH 8.1, 5 mM EDTA), followed by sonication to an average DNA length of 500–1000 bp. Antibodies were added to each of the samples, which were then rotated at 4 °C overnight. After exposure to protein A beads and incubation overnight at 65 °C to reverse cross-links, the DNA was dissolved in TE buffer and analyzed by PCR. The antibodies anti-p53 (DO-1) and anti-acetylated p53 (Lys373/382 and Lys320) were added into the reaction solution. Primers used for PCR were derived from p21Waf1/Cip1 promoter sequences: 5'-CTCACATCCTCCTTCTTCAG-3' (sense) and 5'-CACACACAGAATCTGACTCCC-3' (antisense).

Co-immunoprecipitation (Co-IP)—The cells were harvested and then lysed in lysis buffer (1% Nonidet P-40, 150 mM NaCl, 50 mM Tris, 0.05% SDS, 1 mM phenylmethylsulfonyl fluoride, and a 1% mixture of protease inhibitors) on ice for 20 min. After centrifugation at 13,000 rpm for 10 min at 4 °C, antibodies were added to the supernatant for 1 h on ice. Agarose G was added to the samples and mixed by rolling for 1 h at 4 °C. After washing the beads three times with lysis buffer, the pellets were dissolved into 2x SDS loading buffer after centrifugation. The protein was analyzed by Western blotting with various antibodies.

Cell Cycle Analysis—H1299 cells were transfected with plasmids (wild-type p53 or different p53 mutants, respectively), and the cells were then treated with 5-aza-CdR at 1 µM for 48 h. The cells were harvested and stained with propidium iodide. The samples were analyzed with flow cytometry (BD FACS Calibur) using BD CellQuest software.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
5-Aza-CdR Induces an Increase in p53 through Decreased p53 Ubiquitination—In this study, human lung cancer cell line A549 was treated with 5-aza-CdR at different concentrations for 48 h or at different time intervals at 1 µM, and the expression of p53 was then determined by Western blotting. Both duration- and dose-dependent p53 accumulations were observed in A549 cells (Fig. 1, A and B). Because 5-aza-CdR at 1 µM was found to induce a maximum increase in p53 expression, a dose of 1 µM of 5-aza-CdR was thereafter used in this study. To determine whether 5-aza-CdR induced increase in p53 levels resulted from gene activation, RT-PCR was performed to evaluate transcription of p53 mRNA in 5-aza-CdR-treated cells. However, changes in the amount of p53 mRNA were not detected (Fig. 1C), indicating that 5-aza-CdR-induced p53 accumulation does not result from transcriptional activation.

Because the amount of p53 mRNA was unchanged, it seemed likely that accumulation of p53 was the result of decreased proteolytic degradation of the protein. Therefore, to evaluate whether 5-aza-CdR induces changes in the ubiquitination of p53, A549 cells were treated with 5-aza-CdR at 1 µM for 48 h, and proteins were then immunoprecipitated with anti-p53 (P240). Subsequently, anti-ubiquitin was used for performing Western blotting. As shown in Fig. 1D, p53-conjugated ubiquitin in 5-aza-CdR-treated cells is greatly decreased compared with those in cells without 5-aza-CdR treatment. These data demonstrate that 5-aza-CdR-induced p53 accumulation is due to a decrease in p53 ubiquitination.

ATR, but Not ATM, Is Responsible for 5-Aza-CdR-induced p53 Activation—Members of PI3K such as ATM, ATR and DNA-PK are the main sensors of DNA damage (18). To obtain information on the kinases responsible for the 5-aza-CdR-induced DNA damage response, the PI3K inhibitors, caffeine and wortmannin, were used in this study. A549 cells were treated with 2 mM of caffeine or 10 µM of wortmannin 30 min prior to 5-aza-CdR treatment and remained in the cell medium until the cells were harvested. As shown in Fig. 2A, caffeine, which has been reported to inhibit ATM and ATR but not DNA-PK, sharply reduced 5-aza-CdR-induced accumulation of p53. However, wortmannin, an inhibitor of ATM and DNA-PK, did not cause attenuation of 5-aza-CdR-induced p53 accumulation (Fig. 2B). These results imply that 5-aza-CdR may activate p53 through the ATR pathway.


Figure 1
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 1.
5-Aza-CdR induces p53 augment through a decrease in p53 ubiquitination. A and B, representative Western blots indicate p53 changes when A549 cells were treated with 5-aza-CdR at 1 µM for different times or at different concentrations for 48 h. β-Actin is shown under every panel as a loading control (CTR). C, A549 cells were treated with 5-aza-CdR at different concentrations, and RNA was then extracted for RT-PCR to detect changes of p53 mRNA. β-Actin is a loading control for the RT-PCR. The bands were scanned by phosphorimaging, and the relative band intensities were normalized to each β-actin band. The numerical value of each sample represents the band intensity relative to that of untreated sample. The band intensity of untreated sample was set as 1. D, A549 cells were treated with or without 5-aza-CdR at 1 µM for 48 h in the presence of proteasome inhibitors, 25 µM N-acetyl-L-leucyl-L-lucyl-L-norleucine and 25 µM MG132. The treated cells were then lysed and immunoprecipitated with anti-p53 (P240). The immunoprecipitated proteins were then size-fractionated on SDS-PAGE, and Western blot was performed with anti-ubiquitin.

 


Figure 2
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 2.
p53 stabilization induced by 5-aza-CdR is via the ATR pathway. A and B, A549 cells were treated with 5-aza-CdR at 1 µM for 48 h in the presence or absence of 2 mM caffeine or 10 µM wortmannin. Total p53 was examined by Western blotting with anti-p53 (DO-1). C, A549 cells were transfected with siRNAs for control (CTR), ATM, and ATR as described under "Experimental Procedures," and total ATM and ATR were detected at 72 h after transfection. D, A549 cells were transfected with siRNA controls, or ATM or ATR siRNAs, and the cells were incubated with or without 5-aza-CdR. After 48 h treatment, the cells were harvested, and Western blotting was performed to evaluate p53 expression. Etoposide (VP-16), a DNA damage agent, was used as a positive control to evaluate the efficacy of ATM RNAi. UV was used a positive control to evaluate the efficacy of ATR RNAi. The blots were reprobed with β-actin antibody as a loading control. Protein bands were scanned by phosphorimaging, and the relative band intensities were normalized to each β-actin band. The band intensity of untreated sample was set as 1. The numerical value of each sample represents the percentage of band intensity relative to that of untreated sample.

 
To further determine whether ATR is in fact directly responsible for 5-aza-CdR-induced p53 accumulation, the RNAi technique was used to knock down the expression of endogenous ATM and ATR. Duplexes specifically targeting ATM or ATR expression were synthesized as described previously (45), and an oligonucleotide duplex containing a nonspecific sequence was used as control. Protein was extracted 72 h after transfection, and Western blot analysis was performed to detect the efficiencies of RNAi against ATM and ATR. RNAi of both ATR and ATM was effective, resulting in 91% down-regulation of ATR and 97% down-regulation of ATM as assayed by scanning band intensity by phosphorimaging (Fig. 2C). Under these assay conditions, p53 accumulation was not obviously affected by RNAi targeting of ATM, but more importantly, p53 expression was markedly suppressed in the ATR knockdown cells (Fig. 2D). Etoposide (VP16) and UV, which were reported to activate p53 through ATM (46) and ATR (47), respectively, were chosen as positive control to test the efficacy of the RNAi against ATM and ATR. These results confirmed that the activation of ATR, but not ATM, is necessary for 5-aza-CdR-induced activation of the signaling pathway leading to p53 accumulation.

RPA and ATR Link 5-Aza-CdR-induced Stress to p53 Phosphorylation at Ser15 and p21Waf1/Cip1 Expression—Many DNA-damaging agents can elicit DNA damage responses through activation of ATR. All of these agents can activate ATR by a common intermediate, namely single-stranded DNA (48, 49). The RPA family including 70-, 32-, and 14-kDa subunits is the major group of cellular single-stranded DNA-binding proteins in eukaryotic cells, and it is involved in the regulation of DNA damage-induced cell cycle check points (44, 49). Because 5-aza-CdR has been reported to induce a single-stranded DNA break (40, 41), an interesting question to be answered is whether the activation of ATR by 5-aza-CdR is also triggered by single-stranded DNA. We isolated chromatin from the 5-aza-CdR-treated cells or untreated cells and analyzed the association of RPA with chromatin. As shown in Fig. 3A, a dose-dependent increase in chromatin-bound RPA70 and RPA32 was observed after 5-aza-CdR treatment. At the same time, soluble RPA32 and RPA70 were decreased in response to 5-aza-CdR treatment (Fig. 3B). These data suggest that damaged DNA resulting from 5-aza-CdR treatment was coated by RPA. Of significance, ATR was also bound to chromatin in a dose-dependent manner in treatment with 5-aza-CdR (Fig. 3C). Therefore, to determine whether RPA is required for the induction of chromatin-bound ATR in response to 5-aza-CdR treatment, an RNAi against RPA70 was performed. The result of this RNAi was clearly as expected as shown in Fig. 3D. The amount of chromatin-bound ATR was significantly decreased in 5-aza-CdR-treated cells when RPA70 knockdown was affected by RNAi treatment (Fig. 3E). These data indicate that ATR is a chromatin-bound protein and is recruited to chromatin by RPA in response to 5-aza-CdR treatment.


Figure 3
View larger version (39K):
[in this window]
[in a new window]

  		FIGURE 3.
Replication protein A is required for induction of chromatin-bound ATR. A and B, A549 cells were treated with 5-aza-CdR (0.1–5 µM) for 48 h, and cellular extracts including the chromatin fraction (A, Chr) and soluble fraction (B, Sol) were isolated for Western blotting to detect changes in RPA70 and RPA32. C, changes in chromatin-bound ATR were detected by Western blotting in the cells treated with 5-aza-CdR at 0.1–5 µM. D, RNAi against RPA70 was performed in A549 cells, and the efficacy of the RNAi was tested. E, 5-aza-CdR was added to the RNAi-treated cells, and chromatin was then isolated for Western blotting to detect changes in RPA70 and ATR. H3 served as a loading control (CTR) for the chromatin fraction. The band intensity of untreated sample was set as 1. The numerical value of each sample represents the percentage of band intensity relative to that of untreated sample.

 
It is reported that ATR mainly phosphorylates p53 at Ser15 and Ser37 in cells exposed to DNA-damaging agents (19). In the current study, A549 cells were treated with 5-aza-CdR at various doses for 48 h or x-ray at 8 grays and then harvested immediately for Western blotting to detect changes in p53 phosphorylation status. Using specific antibodies for the postulated phosphorylation sites, only Ser15 showed obvious phosphorylation following 5-aza-CdR treatment (Fig. 4A). In contrast, no significant changes in phosphorylation were observed at Ser37, Thr18, or Ser20 (Fig. 4A), although x-ray treatment-induced increases were observed in all of the phosphorylation sites tested (Fig. 4A). These data indicate that 5-aza-CdR particularly induces p53 phosphorylation at Ser15 by ATR kinase in A549 cells. p21Waf1/Cip1 was selected to investigate whether p53 phosphorylation at Ser15 contributes to expression of its downstream genes. As shown in Fig. 4 (B–D), p21Waf1/Cip1 expression (both protein and mRNA) is also dependent on both the concentration of 5-aza-CdR and the intervals of treatment that parallel 5-aza-CdR-induced p53 accumulation (compare with Fig. 1, A and B). To confirm the role of p53 phosphorylation at Ser15 in 5-aza-CdR induced p21Waf1/Cip1 expression, a p53 mutant was constructed by site-directed mutagenesis PCR, in which Ser15 was mutated to Ala (S15A). This p53 mutant S15A and a wild-type p53 plasmid were transfected into p53-null H1299 cells, and 5-aza-CdR-induced p53 phosphorylation at Ser15 and p21Waf1/Cip1 expression were evaluated. 5-Aza-CdR induced a 5.3-fold increase in p21Waf1/Cip1 expression in transfected cells with wild-type p53 but induced no increase in cells with a p53 mutation at Ser15 (Fig. 4E). In contrast, 5-aza-CdR was not able to induce p53 phosphorylation at Thr18 (Fig. 4E). These data indicate that phosphorylation of p53 at Ser15 alone is sufficient for inducing p21Waf1/Cip1 expression by 5-aza-CdR. Moreover, p53 Ser15 phosphorylation and p21Waf1/Cip1 expression were also suppressed by caffeine and the RNAi against ATR in A549 cells (Fig. 4, F and G), which adds further evidence that the ATR pathway is required for the 5-aza-CdR-induced p53/p21Waf1/Cip1 activation.

To show the generality of these findings, another cytidine analogue, cytarabine (Ara-C), was also used in this study. As shown in Fig. 5A, Ara-C induced a series of dose-dependent biochemical changes in A549 cells, including a significant increase in expression of p53 and p53 phosphorylation at Ser15 and p21Waf1/Cip1. These Ara-C-induced biochemical changes were also blocked by caffeine treatment (Fig. 5B). Moreover, these cytidine analogue-induced cellular signaling changes are not only observed in the human lung cancer cell line A549. For example, 5-aza-CdR also induced an obvious change in expression of p53, with p53 phosphorylation at Ser15 and p21Waf1/Cip1 in the human colon cancer cell line HCT116, which harbors a wild-type p53 (Fig. 5C). This change was also significantly reduced by caffeine (Fig. 5D).

5-Aza-CdR Enhances Acetylation of Lys320 and Lys373/Lys382 Residues of p53 in A549 Cells—In addition to phosphorylation, p53 is also modified by acetylation in response to DNA damage inducers, such as ionizing radiation and UV (24, 28). To determine whether 5-aza-CdR induces p53 acetylation at specific sites, antibodies specific for p53 acetylation at Lys320 and Lys373/Lys382 were used in this study. A significant dose-dependent increase in p53 acetylation at Lys373/Lys382 and Lys320 was observed in 5-aza-CdR-treated A549 cells (Fig. 6A). To further investigate which enzymes are responsible for the 5-aza-CdR-induced lysine acetylations at these residues, a Co-IP assay was performed to test the interaction of co-activators p300/CBP and PCAF with p53 in treated cells. Fig. 6B shows that 5-aza-CdR induces recruitment of p300 and PCAF to p53 (DO-1). However, 5-aza-CdR did not enhance interaction of CBP with p53 (Fig. 6B). To exclude the possibility that the increase in p300 or PCAF-binding p53 in response to 5-aza-CdR is simply due to the increase in the p53 expression level, we tested the effect of proteasome inhibitor, MG132 on the interaction between p53 and these histone acetyltransferases. Fig. 6C shows that MG132 did not enhance the interaction of histone acetyltransferases with p53, even though the p53 level is significantly increased in response to MG132 treatment. These data suggest that 5-aza-CdR may promote recruitment of p300 and PCAF to p53 and thus induce p53 acetylation at Lys373/Lys382 and Lys320.


Figure 4
View larger version (45K):
[in this window]
[in a new window]

  		FIGURE 4.
5-Aza-CdR specifically induces p53 phosphorylation at Ser15, which is critical for p21Waf1/Cip1 expression. A, A549 cells were treated with 5-aza-CdR (0.01–1 µM) for 48 h, and protein was then extracted for Western blotting with anti-Ser15-p53, anti-Thr18-p53, anti-Ser20-p53, anti-Ser37-p53, and anti-p53 (DO-1). The cells were also irradiated with {gamma}-ray at 8 grays (IR), and proteins were extracted to perform Western blotting as a positive control (CTR) for the p53 phosphorylations at these sites. B and C, A549 cells were also treated with 5-aza-CdR at 1 µM for different times or at different concentrations for 48 h, and protein was extracted for Western blotting using anti-p21 (F-5). D, A549 cells were treated with various doses of 5-aza-CdR for 48 h or at 1µM for different times, RNA was then extracted for RT-PCR to detect p21Waf1/Cip1 mRNA changes. β-Actin is shown under every panel as a loading control. E, H1299 cells were transfected with plasmids containing wild-type p53 or mutant p53 S15A and treated with 5-aza-CdR at 1 µM for 48 h. Western blot analysis was performed with anti-p53 (DO-1), anti-Ser15-p53, anti-Thr18-p53, or anti-p21 (F-5), respectively. F, A549 cells were treated with 5-aza-CdR at 1 µM for 48 h in the presence or absence of 2 mM caffeine and Ser15 phosphorylation of p53, total p53 as well as p21Waf1/Cip1 expression were examined by Western blotting with specific antibodies. G, A549 cells were transfected with ATR siRNAs at 24 h before treating with 5-aza-CdR and then incubated with 5-aza-CdR at 1 µM together for another 48 h. Western blot analysis was performed with specific antibodies. β-Actin is shown under every panel as a loading control. Protein bands were scanned by phosphorimaging, and the relative band intensities were normalized to each β-actin band.

 


Figure 5
View larger version (57K):
[in this window]
[in a new window]

  		FIGURE 5.
5-Aza-CdR and Ara-C show similar effects on activation of p53/p21Waf1/Cip1 in human cancer cells. A, A549 cells were treated with Ara-C (0.1–5 µM) for 48 h and protein was then extracted for Western blotting to detect changes in expression of p53, phosphorylation at Ser15, and p21Waf1/Cip1. B, A549 cells were also treated with Ara-C (1 µM for 48 h) in the presence or absence of caffeine (2 mM). Protein was extracted, and Western blotting was performed to detect changes in expression of p53, p53 phosphorylation at Ser15, and p21Waf1/Cip1. C, HCT116 cells were treated with 5-aza-CdR (0.1–5 µM for 48 h), and protein was then extracted for Western blotting to detect changes in expression of p53, p53 phosphorylation at Ser15, and p21Waf1/Cip1. D, HCT116 cells were also treated with 5-aza-CdR (1 µM for 48 h) in the presence or absence of caffeine (2 mM). β-Actin is shown under every panel as a loading control (CTR).

 
Acetylation of Lys320 and Lys373/Lys382 Induced by 5-Aza-CdR Is Required for p53 Binding to the p21Waf1/Cip1 Promoter—The acetylation of p53 has been shown to increase its DNA binding activity and to facilitate transcription of its downstream target genes (22). To validate the role of p53 acetylation at Lys373/Lys382 and Lys320 in the activation of the p21Waf1/Cip1 promoter, a ChIP assay was performed. Fig. 7A shows that 5-aza-CdR significantly increases binding of acetylated p53 at Lys373/Lys382 (4.8-fold increase) and Lys320 (3.1-fold increase) to the p21Waf1/Cip1 promoter in A549 cells. To gain more insight into the function of p53 acetylation at Lys373/Lys382 and Lys320 in 5-aza-CdR-induced p21Waf1/Cip1 expression, plasmids encoding p53 with K373R/K382R or K320R mutations were generated by site-directed mutagenesis PCR. The wild-type p53 plasmid or K373R/K382R or K320R mutated p53 plasmid was transfected into H1299 cells, and a ChIP assay was then performed after 5-aza-CdR treatment. Fig. 7B shows that 5-aza-CdR did not induce an increase in binding of p53 to the p21Waf1/Cip1 promoter when p53 was mutated either at Lys373/Lys382 or Lys320. These results clearly indicate that the specific p53 acetylation sites at Lys373/Lys382 and Lys320 are indispensable for 5-aza-CdR-induced p21Waf1/Cip1 expression. Subsequently, to further investigate functionally whether 5-aza-CdR-induced p21Waf1/Cip1 activation is due to p53 acetylation at Lys373/Lys382 or Lys320, two p53 plasmids encoding mutations at specific sites (p53 mutation at K320R and p53 mutations at K373R/K382R) were transfected into H1299 cells, and 5-aza-CdR-induced p21Waf1/Cip1 expression was evaluated by Western blotting. 5-Aza-CdR induced a significant increase in p21Waf1/Cip1 expression in transfected cells with wild-type p53 (Fig. 7C) but not in the cells with p53 mutations at K373R/K382R or at K320R (Fig. 7C). Collectively, these data imply that 5-aza-CdR-induced p21Waf1/Cip1 expression may be dependent on both acetylations of p53 at Lys320 and Lys373/Lys382 lysine sites.


Figure 6
View larger version (32K):
[in this window]
[in a new window]

  		FIGURE 6.
5-Aza-CdR induces recruitment of p300 and PCAF to the C terminus of p53 and in turn acetylates p53 at Lys373/Lys382 and Lys320. A, representative Western blots indicate the changes in p53 acetylation at Lys373/Lys382 and Lys320 in A549 cells treated with 5-aza-CdR at 0.01–1 µM. B, A549 cells were treated with 5-aza-CdR for 48 h, and protein was extracted for Co-IP with anti-p53 (as an input), anti-p300, anti-CBP, anti-PCAF, and IgG (as negative control), followed by Western blotting with anti-p53 (DO-1). The lower panels show Co-IP efficiency by reprobing with anti-p300, anti-CBP and anti-PCAF. C, A549 cells were treated with 25 µM MG132 for 24 h, and protein was extracted for Co-IP with anti-p53 (as an input), anti-p300, anti-CBP, and anti-PCAF, followed by Western blotting with anti-p53 (DO-1). The lower panels show Co-IP efficiency by reprobing with anti-p300, anti-CBP, and anti-PCAF. The protein bands were scanned by phosphorimaging, and the relative band intensities were normalized to each β-actin band. The numerical value of each sample represents the band intensity relative to that of untreated sample.

 


Figure 7
View larger version (42K):
[in this window]
[in a new window]

  		FIGURE 7.
p53 acetylation at Lys320 and Lys373/382 binds to the p21Waf1/Cip1 promoter and activates p21Waf1/Cip1 expression in response to 5-aza-CdR treatment. A, a ChIP assay was performed with anti-acetyl-p53 at Lys320 or anti-acetyl-p53 at Lys373/Lys382 to a specific sequence of the p21Waf1/Cip1 promoter in A549 cells when treated with or without 5-aza-CdR at 1 µM for 48 h. The bands with anti-IgG show negative controls. B, H1299 cells were transfected with plasmids containing wild-type p53, K320R mutant, and K373R/K382R mutant and then treated with 5-aza-CdR at 1 µM for 48 h. ChIP assay was performed with anti-p53 (DO-1) to the p21Waf1/Cip1 promoter. DNA bands were scanned by phosphorimaging, and the relative band intensities were normalized for each input band. The input PCR signal was set at 1, and the numerical value of ChIP signal represents the percentage of input. C, representative Western blots indicate that plasmids with wild-type p53, p53 mutated at K320R, or K373R/K382R were transfected into H1299 cells, respectively, and then 5-aza-CdR at 1 µM was added into the cells for 48 h to test the changes in p53 or p21Waf1/Cip1. β-Actin is shown under this panel as a loading control. Protein bands were scanned by phosphorimaging, and the relative band intensities were normalized to each β-actin band.

 
A Mutual Causal Relationship between p53 Phosphorylation at Ser15 and Acetylation at Lys320/Lys373/Lys382 Exists in Cells Treated with 5-Aza-CdR—Certain types of stress-induced increase in p53 activity may result from a phosphorylation-acetylation cascade (29, 36, 38, 50). In this study, 5-aza-CdR was found to induce both phosphorylation and acetylation, pointing to the possibility that there is a phosphorylation-acetylation cascade that operates in 5-aza-CdR-induced p53 activation. To address this question of operation of a cascade, H1299 cells were first transfected with p53 expression vectors including wild-type p53 and S15A mutant constructs, and 5-aza-CdR-induced acetylations were then identified with specific anti-Lys320 and anti-Lys373/Lys382. As shown in Fig. 8A, wild-type p53 and Ser15-mutated p53 were expressed at comparable levels in transfected H1299 cells. However, p53 acetylated at Lys373/Lys382 or at Lys320 did not show an increase following 5-aza-CdR treatment when p53 Ser15 was mutated to Ala. This result suggested that 5-aza-CdR-induced p53 acetylation is dependent on p53 phosphorylation at Ser15. To further evaluate whether p53 acetylation also influences p53 phosphorylation, H1299 cells were transfected with wild-type p53, K320R, and K373R/K382R mutant constructs and then evaluated for p53 phosphorylation at Ser15 after treatment with 5-aza-CdR. It is of note that 5-aza-CdR significantly increases p53 phosphorylation at Ser15 in wild-type p53 transfectants, whereas only minimal increases in p53 phosphorylation at Ser15 were observed in K320R and K373R/K382R mutant transfectants (Fig. 8B), suggesting that there may be a mutual causal relationship between p53 phosphorylation at Ser15 and acetylation at specific sites in response to 5-aza-CdR treatment.


Figure 8
View larger version (67K):
[in this window]
[in a new window]

  		FIGURE 8.
Phosphorylation at Ser15 and acetylation at Lys320/Lys373/Lys382 interact mutually in response to 5-aza-CdR induced p21Waf1/Cip1 expression. A, H1299 cells were transfected with wild-type p53 or p53 mutated at S15A with or without 5-aza-CdR treatment at 1 µM for 48 h. Western blot was performed with anti-p53 (DO-1), anti-acetyl-p53 at Lys373/Lys382, or anti-acetyl-p53 at Lys320. B, H1299 cells were transfected with wild-type p53 or mutant p53 K320R or mutant p53 K373R/K382R and treated with 5-aza-CdR at 1 µM for 48 h. Western blotting was then performed with anti-p53 (DO-1) and anti-Ser15-p53. β-Actin is shown under every panel as a loading control. The Protein bands were scanned by phosphorimaging, and the relative band intensities were normalized to each β-actin band.

 
p21Waf1/Cip1 plays a critical role in inhibiting cell proliferation. Therefore, we tested the effects of S15A, K320R, and K373R/K382R mutants on cell proliferation in response to 5-aza-CdR. H1299 cells were transfected with plasmids containing wild-type p53, S15A mutant, K320R mutant, and K373R/K382R mutant and were then seeded to 96-well plates and treated with 5-aza-CdR at 0–10 µM for 48 h. Cell proliferation was measured with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Dose-dependent inhibition of cell proliferation was observed only in wild-type p53 transfected cells, but not in S15A, K320R, or K373R/K382R transfected cells (Fig. 9B). The 5-aza-CdR induced inhibition of cell proliferation is reported to be dependent on p21Waf1/Cip1 expression (42). Therefore we further analyzed the changes in cell cycle in H1299 cells (with intact p21Waf1/Cip1) by transfecting with wild-type p53 or different mutated p53 and treating with 5-aza-CdR. By flow cytometry analysis, an obvious G1 arrest was observed in the H1299 cells transfected with wild-type p53 plasmid, but such an arrest was not observed in the H1299 cells transfected with mutated plasmids including S15A, K320R, or K373R/K382R in response to 5-aza-CdR treatment (Fig. 9, C–G). However, 5-aza-CdR induced a G2/M arrest in A549 cells (data not show); whether p21Waf1/Cip1 also plays a role in the G2/M arrest in response to 5-aza-CdR should be studied in the future. These data indicate that 5-aza-CdR-induced cell proliferation inhibition may result from the p21Waf1/Cip1-associated G1 arrest that is dependent on p53 posttranslational modifications including phosphorylation and acetylation.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Many different kinds of agents that damage DNA have been determined to act as anticancer agents through activation of the p21Waf1/Cip1 pathway by posttranslational modifications of p53 (1, 12, 14). However, whether nucleoside analogue 5-aza-CdR also elicits expression of p21Waf1/Cip1 through the specific phosphorylation or acetylation of p53 has been the subject of only a few reports. As a demethylating agent, 5-aza-CdR has been extensively used for both epigenetic research and anticancer therapy (51, 52). When 5-aza-CdR is incorporated into DNA, it influences further DNA synthesis and results in the initiation of a cellular response to DNA damage (40, 41). In the present study, we further explored the molecular mechanism by which p53 is accumulated and activated through initiation of ATR activation in response to 5-aza-CdR treatment. More importantly, our study demonstrates that RPA may be a key mediator for linking DNA damage and ATR in response to 5-aza-CdR treatment. In addition, it became clear that p53 activates its downstream p21af1/Cip1 via a series of posttranslational modifications including phosphorylation at Ser15 and acetylation at Lys320/Lys373/Lys382 (Figs. 4E and 7).

As a guardian of the genome, p53 is activated through different signaling pathways upon exposure to various types of DNA-damaging agents (1, 2). PI3K family members, ATM and ATR, are the central components of the DNA damage response mechanism. Despite functional overlap between these two pathways, ATM responds primarily to DNA double-stranded breaks induced by ionizing radiation or chemotherapeutic agents (46, 53, 54). In response to irradiation, ATM is activated by autophosphorylation (55) and recruited to double-stranded breaks through interaction with the Mre11-Rad50-Nbs1 complex (56), resulting in the phosphorylation of a diverse array of downstream targets, such as p53 and Chk2 (9, 57). In addition to irradiation, arsenite, a potent human carcinogen that induces double-stranded breaks, was reported to induce p53 accumulation in an ATM-dependent manner (58). However, ATR responds to a broader spectrum of genotoxic stimuli including DNA replication inhibitors (such as hydroxyurea), UV radiation, ionizing radiation, and agents that induce DNA interstrand cross-links and generate single-stranded DNA (47, 53, 59–61). For instance, overexpression of a kinase-inactivated ATR in human fibroblasts causes increased sensitivity to ionizing radiation, UV, and hydroxyurea and inhibits cell cycle arrest after DNA damage (47, 62). Moreover, activation of ATR signaling appears to be dependent on localization of ATR to regions of single-stranded DNA, which is accomplished through the function of ATR-interacting protein and RPA (48, 63). Consistent with these reports, 5-aza-CdR treatment induced damaged DNA, and the generated DNA damage was coated by RPA (Fig. 3A), and the chromatin-bound RPA played a critical role in recruitment of ATR to the chromatin (Fig. 3, C–E). In this study, two lines of evidence demonstrated that 5-aza-CdR-activated p53 and p21Waf1/Cip1 expression are modulated by ATR. First, caffeine, which is an inhibitor of both ATM and ATR, completely inhibited 5-aza-CdR-induced p53 and p21Waf1/Cip1 expression (Figs. 2A and 4F) and inhibited p53 phosphorylation at Ser15 (Fig. 4F). However, wortmannin, an inhibitor of ATM/DNA-PK, inhibited p53 accumulation and activity only slightly (Fig. 2B). These data indicate that ATR may be the real modulator of p53 accumulation and activation in cells treated with 5-aza-CdR. Second, 5-aza-CdR-induced p53 activation was abolished when cells were treated with the RNAi technique against ATR (Figs. 2D and 4G). This unique ATR-dependent p53 activation pathway, which operates in response to 5-aza-CdR treatment, is consistent with the evidence that 5-aza-CdR only results in single-stranded break DNA damage (40, 41).


Figure 9
View larger version (36K):
[in this window]
[in a new window]

  		FIGURE 9.
5-Aza-CdR-induced inhibition of cell proliferation is associated with p53 phosphorylation and acetylation. A, H1299 cells were transfected with plasmids containing wild-type p53, S15A mutant, K320R mutant, or K373R/K382R mutant, respectively, and were then seeded to 96-well plates for treatment with 5-aza-CdR at 0–10 µM for 48 h. The transfection efficacies of these plasmids were judged by Western blotting. β-Actin is presented as a loading control. B, inhibition effect of cell proliferation by 5-aza-CdR in the cells transfected with different plasmids was measured with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide. C–G, representative histograms measured by flow cytometry at 48 h after treatment with 5-aza-CdR in H1299 cells transfected with wild-type p53 or different mutated p53, respectively. The y axis represents the cell count numbers, and the x axis represents the DNA content. The experiments were conducted four times. The differences between groups were examined for statistic analysis using the unpaired t test. p value: G1 arrest for wild-type p53, p = 0.022; S15A mutant, p = 0.419; K320R: p = 0.476, and K373/382R: p = 0.861.

 
In response to DNA damage, it is recognized that p53 may be phosphorylated at multiple sites by a variety of protein kinases (1, 2, 13, 17). ATM/ATR kinases can phosphorylate p53 directly or indirectly and act to stabilize and activate p53 (18–21). ATR kinase mainly phosphorylate p53 at Ser15 and Ser37 in response to UV-induced DNA damage (19), and it is also reported that ATR activates Chk1 to indirectly phosphorylate p53 at Ser20 (64). It is of particular note that in this study we show that ATR phosphorylates p53 at Ser15 only but phosphorylates neither Ser20 nor Ser37 in response to 5-aza-CdR treatment (Fig. 4A). These differences in ATR-catalyzed specific p53 phosphorylation among cells treated with UV, {gamma}-irradiation, or nucleoside analogue reflect distinct reactions in response to different specific noxious stimuli. However, the 5-aza-CdR-induced ATR-catalyzed p53 phosphorylation at Ser15 may provide a more specific research tool for determining the relationship between p53 function and its specific phosphorylation at Ser15.

Phosphorylation at Ser15 is a critical event for accumulation and functional activation of p53 following cellular exposure to DNA-damaging agents (12, 14, 15). The phosphorylation of p53 at Ser15 blocks its capacity for association with MDM2 (14) or blocks nuclear export of p53 (65), thereby stabilizing p53 and leading to p53 accumulation. In addition, Ser15 phosphorylation is reported to be required for p53 activation in response to certain stimuli (36, 50, 66). For example, in response to ionizing radiation, p53 is phosphorylated at Ser15, which increases its ability to interact with p300/CBP (36). In addition, Ser15 phosphorylation of p53 was required for irradiation-induced C-terminal acetylation at Lys320 and Lys382, which stabilizes p53 and activates sequence-specific DNA binding (66). Another study showed that phosphorylation of Ser15 stimulates p53-dependent transactivation but does not modulate MDM2 binding (50). Consistent with the data reported in the latter study, we also show that p53 phosphorylation at Ser15 is crucial for p53-dependent p21Waf1/Cip1 expression (Fig. 4G).

In addition to p53 phosphorylation, p53 acetylation also plays a pivotal role in activating its downstream genes, especially p21Waf1/Cip1 (1, 2, 31). It has previously been shown that p53 acetylation enhances its ability to bind to its target genes and thus promotes the transcriptional activities of its downstream targets after DNA damage (22, 28, 29, 31). By analyzing p53 acetylation status in A549 cells treated with 5-aza-CdR, it is notable that 5-aza-CdR can induce multiple p53 acetylations at Lys320 and Lys373/Lys382 in A549 cells (Fig. 6A). Although this point has been a matter of controversy in some previous reports (67, 68), it is clear in this study that acetylated p53 plays an important role in p21Waf1/Cip1 transactivation (Fig. 7, B and C), because abundant acetylated p53 at Lys373/Lys382 and Lys320 was bound to the p21Waf1/Cip1 promoter after 5-aza-CdR treatment (Fig. 7A). Most notably, Lys320 is involved in the activation of p53 in 5-aza-CdR treatment, which is consistent with recent studies showing that Lys320 significantly enhances p53 function in cells treated with radiomimetic DNA alkylating agents such as adozelesin and bizelesin or the topoisomerase inhibitor etoposide or neurotrophin stimulation (39, 69).

Several studies have shown that in responses to stress, the activity of p53 is regulated by multiple covalent modifications, which may simply be coordinated or may be frankly interdependent on each other (29, 36–38, 50, 66). Consistent with these previous studies, our data also show that 5-aza-CdR activates p53 through a phosphorylation-acetylation cascade. For example, when p53 is intact (in A549 cells or H1299 cells transfected with wild-type p53), we observed both p53 phosphorylation at Ser15 and acetylation at Lys320/Lys373/Lys382 in response to 5-aza-CdR treatment (Fig. 8), whereas 5-aza-CdR could not induce p53 acetylation at Lys320/Lys373/Lys382 if H1299 cells were transfected with a mutant p53 plasmid (S15A) (Fig. 8A). These data suggest that p53 phosphorylation at Ser15 may be a precondition for p53 acetylation. This activation of p53 by a phosphorylation-acetylation cascade can be understood in light of previous reports concerning the relationship of acetylation and phosphorylation. For example, DNA damage-mediated phosphorylation of p53 at Ser15 promotes interaction between p53 and CBP/p300 or PCAF (36, 50), through which p53 is acetylated at specific sites. In further support of this point, our experiments demonstrated that 5-aza-CdR enhances interaction of p53 with both PCAF and p300 (but not CBP), through which p53 is acetylated at Lys320 and Lys373/Lys382 (Fig. 6B).

Although some previous evidence argues for a model of p53 phosphorylation-dependent acetylation, the influence of p53 acetylation on p53 phosphorylation has been only infrequently reported. We evaluated p53 phosphorylation at Ser15 following substitutions of Lys320 and Lys373/Lys382 with arginine. It was of interest that these Lys320 and Lys373/Lys382 substitutions prevented p53 phosphorylation at Ser15 in response to 5-aza-CdR treatment (Fig. 8B), which suggested that p53 acetylation does in fact also influence p53 phosphorylation. It is as yet unclear how acetylation influences phosphorylation of p53. However, it is possible that p53 acetylation induces changes of p53 conformation, which in turn interfere with the interaction of specific protein kinases and p53. In addition, a recent study has revealed that acetylation at different sites induced by alkylating agents influences the status of p53 phosphorylation (39). The cross-talk induced by these alkylating agents between p53 acetylation and phosphorylation may come from a change in the translocation of p53 from nucleus to cytoplasm (39, 65). However, studies to demonstrate in detail the mechanism of different DNA-damaging agents that induce specific interaction between p53 acetylation and phosphorylation will be critical for further investigation of this phenomenon.

In our study, we have evaluated several complex phenomena that are deserving of attention. First, p53 level was increased without 5-aza-CdR treatment when RNAi against ATM was performed (Fig. 2D), and we do not know how to explain this finding. However, transfection itself activates the DNA damage response to various degrees, probably depending in part on the quality of the DNA preparation. Thus, activation may be different for any two different DNA preparations. As reported by Scacheri et al. (70), the specificity of ten different siRNAs corresponding to the MEN1 gene significantly increased the level of p53 and p21Waf1/Cip1, which are considered functionally unrelated to MEN1. In addition, the p53-Lys320 mutant induces p21Waf1/Cip1 expression and phosphorylation at Ser15 without 5-aza-CdR treatment (Figs. 7C and 8B). This may be related to neddylation of p53. As a transcription factor, except for phosphorylation and acetylation, it has been reported that MDM2 promotes the neddylation of p53 on three lysine residues in the C-terminal regulatory domain, which inhibits its transcriptional activity (71–73). Recently, Abida et al. (74) showed that FBXO11 also neddylates p53 on lysine 320 and 321, and neddylation of p53 leads to suppression of its function. These data are consistent with our study showing that a lysine to arginine mutation at Lys320 enhances p53 function. However, although the S15A mutant induced more acetylation of p53 than that of wild-type p53 in H1299 cells without 5-aza-CdR treatment (Fig. 8A), it is consistent with previous reports (36, 66). Whether the S15A mutant induces an unidentified modification on the Ser15 of p53 is an interesting question deserving of investigation in the future.

In summary, our data demonstrate that 5-aza-CdR stabilized and activated p53 through the ATR pathway, which in turn evoked posttranslational modification of p53 including phosphorylation and acetylation at specific sites that are necessary for activation of its downstream target p21Waf1/Cip1. Understanding the signaling pathways involved in p53 activation via posttranslational modifications in response to DNA damage may have valuable implications for clinical applications. The mechanism of nucleoside analogue treatment may provide useful data for devising appropriate therapeutic strategies for cancer treatment.


   FOOTNOTES
 
* This work was supported by National Natural Science Foundation of China Grants 30425017, 30670417, 30700391, and 30621002 and Grants 2005CB522403, 2006AA02Z101, 2006CB910300, and B07001 from the Ministry of Science and Technology of China. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, Peking University Health Science Center, #38 Xueyuan Rd., Beijing 100083, China. Tel./Fax: 86-1082802235; E-mail: zhuweiguo{at}bjmu.edu.cn.

2 The abbreviations used are: PI3K, phosphatidylinositol 3-kinase; ATM, ataxia telangiectasia-mutated; ATR, ATM- and Rad3-related; 5-aza-CdR, 5-aza-2'-deoxycytidine; Ara-C, cytarabine; RPA, replication protein A; PCAF, p300/CBP-associated factor; CBP, cAMP-responsive element-binding protein-binding protein; RNAi, RNA interference; ChIP, chromatin immunoprecipitation; Co-IP, co-immunoprecipitation; RT, reverse transcription. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Wei Gu for kindly providing the HCT116 cells.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Appella, E., and Anderson, C. W. (2001) Eur. J. Biochem. 268, 2764–2772[Medline] [Order article via Infotrieve]
  2. Bode, A. M., and Dong, Z. (2004) Nat. Rev. Cancer 4, 793–805[CrossRef][Medline] [Order article via Infotrieve]
  3. Haupt, Y., May, R., Kazaz, A., and Oren, M. (1997) Nature 387, 296–299[CrossRef][Medline] [Order article via Infotrieve]
  4. Kubbutat, M. H., Jones S. N., and Vousden, K. H. (1997) Nature 387, 299–303[CrossRef][Medline] [Order article via Infotrieve]
  5. Leng, R. P., Lin, Y., Ma, W., Wu, H., Lemmers, B., Chung, S., Parant, J. M., Lozano, G., Hakem, R., and Benchimol, S. (2003) Cell 112, 779–791[CrossRef][Medline] [Order article via Infotrieve]
  6. Dornan, D., W. I., Shimizu, H., Arnott, D., Frantz, G. D., Dowd, P., O'Rourke, K., Koeppen, H., and Dixit, V. M. (2004) Nature 429, 86–92[CrossRef][Medline] [Order article via Infotrieve]
  7. Chen, D., Kon, D., Li, M., Zhang, W., Qin, J., and Gu, W. (2005) Cell 121, 1071–1083[CrossRef][Medline] [Order article via Infotrieve]
  8. El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B. (1993) Cell 75, 817–825[CrossRef][Medline] [Order article via Infotrieve]
  9. Kastan, M. B., Zhan, Q., el-Deiry, W. S., Carrier, F., Jacks, T., Walsh, W. V., Plunkett, B. S., Vogelstein, B., and Fornace, A. J., Jr. (1992) Cell 71, 587–597[CrossRef][Medline] [Order article via Infotrieve]
  10. Vousden, K. H., and Lu, X. (2002) Nat. Rev. Cancer 2, 594–604[CrossRef][Medline] [Order article via Infotrieve]
  11. Sakaguchi, K., Sakamoto, H., Lewis, M. S., Anderson, C. W., Erickson, J. W., Appella, E., and Xie, D. (1997) Biochemistry 36, 10117–10124[CrossRef][Medline] [Order article via Infotrieve]
  12. Siliciano, J. D., Canman, C. E., Taya, Y., Sakaguchi, K., Appella, E., and Kastan, M. B. (1997) Genes Dev. 11, 3471–3481[Abstract/Free Full Text]
  13. Mayr, G. A., Reed, M., Wang, P., Wang, Y., Schweds, J. F., and Tegtmeyer, P. (1995) Cancer Res. 55, 2410–2417[Abstract/Free Full Text]
  14. Shieh, S. Y., Ikeda, M., Taya, Y., and Prives, C. (1997) Cell 91, 325–334[CrossRef][Medline] [Order article via Infotrieve]
  15. Sakaguchi, K., Saito, S., Higashimoto, Y., Roy, S., Anderson, C. W., and Appella, E. (2000) J. Biol. Chem. 275, 9278–9283[Abstract/Free Full Text]
  16. Unger, T., Juven-Gershon, T., Moallem, E., Berger, M., Vogt Sionov, R., Lozano, G., Oren, M., and Haupt, Y. (1999) EMBO J. 18, 1805–1814[CrossRef][Medline] [Order article via Infotrieve]
  17. Wang, Y., and Prives, C. (1995) Nature 376, 88–91[CrossRef][Medline] [Order article via Infotrieve]
  18. Abraham, R. T. (2001) Genes Dev. 15, 2177–2196[Free Full Text]
  19. Tibbetts, R. S., Brumbaugh, K. M., Williams, J. M., Sarkaria, J. N., Cliby, W. A., Shieh, S. Y., Taya, Y., Prives, C., and Abraham, R. T. (1999) Genes Dev. 13, 152–157[Abstract/Free Full Text]
  20. Banin, S., Moyal, L., Shieh, S., Taya, Y., Anderson, C. W., Chessa, L., Smorodinsky, N. I., Prives, C., Reiss, Y., Shiloh, Y., and Ziv, Y. (1998) Science 281, 1674–1677[Abstract/Free Full Text]
  21. Canman, C. E., Lim, D. S., Cimprich, K. A., Taya, Y., Tamai, K., Sakaguchi, K., Appella, E., Kastan, M. B., and Siliciano, J. D. (1998) Science 281, 1677–1679[Abstract/Free Full Text]
  22. Gu, W., and Roeder, R. G. (1997) Cell 90, 595–606[CrossRef][Medline] [Order article via Infotrieve]
  23. Ito, A., Lai, C. H., Zhao, X., Saito, S., Hamilton, M. H., Appella, E., and Yao, T. P. (2001) EMBO J. 20, 1331–1340[CrossRef][Medline] [Order article via Infotrieve]
  24. Lill, N. L., Grossman, S. R., Ginsberg, D., DeCaprio, J., and Livingston, D. M. (1997) Nature 387, 823–827[CrossRef][Medline] [Order article via Infotrieve]
  25. Nag, A., Germaniuk-Kurowska, A., Dimri, M., Sassack, M., Gurumurthy, C. B., Gao, Q., Dimri, G., Band, H., and Band, V. (2007) J. Biol. Chem. 282, 8812–8820[Abstract/Free Full Text]
  26. Sykes, S. M., Mellert, H. S., Holbert, M. A., Li, K., Marmorstein, R., Lane, W. S., and McMahon, S. B. (2006) Mol. Cell 24, 841–851[CrossRef][Medline] [Order article via Infotrieve]
  27. Tang, Y., Luo, J., Zhang, W., and Gu, W. (2006) Mol. Cell 24, 827–839[CrossRef][Medline] [Order article via Infotrieve]
  28. Liu, L., Scolnick, D. M., Trievel, R. C., Zhang, H. B., Marmorstein, R., Halazonetis, T. D., and Berger, S. L. (1999) Mol. Cell Biol. 19, 1202–1209[Abstract/Free Full Text]
  29. Sakaguchi, K., Herrera, J. E., Saito, S., Miki, T., Bustin, M., Vassilev, A., Anderson, C. W., and Appella, E. (1998) Genes Dev. 12, 2831–2841[Abstract/Free Full Text]
  30. Luo, J., Li, M., Tang, Y., Laszkowska, M., Roeder, R. G., and Gu, W. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 2259–2264[Abstract/Free Full Text]
  31. Zhao, Y., Lu, S., Wu, L., Chai, G., Wang, H., Chen, Y., Sun, J., Yu, Y., Zhou, W., Zheng, Q., Wu, M., Otterson, G. A., and Zhu, W. G. (2006) Mol. Cell Biol. 26, 2782–2790[Abstract/Free Full Text]
  32. Li, M., Luo, J., Brooks, C. L., and Gu, W. (2002) J. Biol. Chem. 277, 50607–50611[Abstract/Free Full Text]
  33. Ito, A., Kawaguchi, Y., Lai, C. H., Kovacs, J. J., Higashimoto, Y., Appella, E., and Yao, T. P. (2002) EMBO J. 21, 6236–6245[CrossRef][Medline] [Order article via Infotrieve]
  34. Roy, S., Packman, K., Jeffrey, R., and Tenniswood, M. (2005) Cell Death Differ. 12, 482–491[CrossRef][Medline] [Order article via Infotrieve]
  35. Hofmann, T. G., Moller, A., Sirma, H., Zentgraf, H., Taya, Y., Droge, W., Will, H., and Schmitz, M. L. (2002) Nat. Cell. Biol. 4, 1–10[CrossRef][Medline] [Order article via Infotrieve]
  36. Lambert, P. F., Kashanchi, F., Radonovich, M. F., Shiekhattar, R., and Brady, J. N. (1998) J. Biol. Chem. 273, 33048–33053[Abstract/Free Full Text]
  37. Dornan, D., and Hupp, T. R. (2001) EMBO Rep. 2, 139–144[CrossRef][Medline] [Order article via Infotrieve]
  38. Ou, Y. H., Chung, P. H., Sun, T. P., and Shieh, S. Y. (2005) Mol. Biol. Cell 16, 1684–1695[Abstract/Free Full Text]
  39. Knights, C. D., Catania, J., Giovanni, S. D., Muratoglu, S., Perez, R., Swartzbeck, A., Quong, A. A., Zhang, X., Beerman, T., Pestell, R. G., and Avantaggiati, M. L. (2006) J. Cell Biol. 173, 533–544[Abstract/Free Full Text]
  40. Covey, J. M., D'Incalci, M., Tilchen, E. J., Zaharko, D. S., and Kohn, K. W. (1986) Cancer Res. 46, 5511–5517[Abstract/Free Full Text]
  41. D'Incalci, M., Covey, J. M., Zaharko, D. S., and Kohn, K. W. (1985) Cancer Res. 45, 3197–3202[Abstract/Free Full Text]
  42. Karpf, A. R., Moore, B. C., Ririe, T. O., and Jones, D. A. (2001) Mol. Pharmacol. 59, 751–757[Abstract/Free Full Text]
  43. Zhu, W. G., Hileman, T., Ke, Y., Wang, P., Lu, S., Duan, W., Dai, Z., Tong, T., Villalona-Calero, M. A., Plass, C., and Otterson, G. A. (2004) J. Biol. Chem. 279, 15161–15166[Abstract/Free Full Text]
  44. Zou, L., Cortez, D., and Elledge, S. J. (2002) Genes Dev. 16, 198–208[Abstract/Free Full Text]
  45. Shiotani, B., Kobayashi, M., Watanabe, M., Yamamoto, K., Sugimura, T., and Wakabayashi, K. (2006) Mol. Cancer Res. 4, 125–133[Abstract/Free Full Text]
  46. Andegeko, Y., Moyal, L., Mittelman, L., Tsarfaty, I., Shiloh, Y., and Rotman, G. (2001) J. Biol. Chem. 276, 38224–38230[Abstract/Free Full Text]
  47. Wright, J. A., Keegan, K. S., Herendeen, D. R., Bentley, N. J., Carr, A. M., Hoekstra, M. F., and Concannon, P. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 7445–7450[Abstract/Free Full Text]
  48. Zou, L., and Elledge, S. J. (2003) Science 300, 1542–1548[Abstract/Free Full Text]
  49. Paulsen, R. D., and Cimprich, K. A. (2007) DNA Repair (Amst.) 6, 953–966[CrossRef][Medline] [Order article via Infotrieve]
  50. Dumaz, N., and Meek, D. W. (1999) EMBO J. 18, 7002–7010[CrossRef][Medline] [Order article via Infotrieve]
  51. Santi, D. V., Garrett, C. E., and Barr, P. J. (1983) Cell 33, 9–10[CrossRef][Medline] [Order article via Infotrieve]
  52. Haaf, T. (1995) Pharmacol. Ther. 65, 19–46[CrossRef][Medline] [Order article via Infotrieve]
  53. Yang, J., Yu, Y., Hamrick, H. E., and Duerksen-Hughes, P. J. (2003) Carcinogenesis 24, 1571–1580[Abstract/Free Full Text]
  54. Pandita, T. K., Lieberman, H. B., Lim, D. S., Dhar, S., Zheng, W., Taya, Y., and Kastan, M. B. (2000) Oncogene 19, 1386–1391[CrossRef][Medline] [Order article via Infotrieve]
  55. Bakkenist, C. J., and Kastan, M. B. (2003) Nature 421, 499–506[CrossRef][Medline] [Order article via Infotrieve]
  56. Lee, J. H., and Paull, T. T. (2005) Science 308, 551–554[Abstract/Free Full Text]
  57. Khanna, K. K., and Lavin, M. F. (1993) Oncogene 8, 3307–3312[Medline] [Order article via Infotrieve]
  58. Yih, L. H., and Lee, T. C. (2000) Cancer Res. 60, 6346–6352[Abstract/Free Full Text]
  59. Guo, Z., Kumagai, A., Wang, S. X., and Dunphy, W. G. (2000) Genes Dev. 14, 2745–2756[Abstract/Free Full Text]
  60. Hekmat-Nejad, M., You, Z., Yee, M. C., Newport, J. W., and Cimprich, K. A. (2000) Curr. Biol. 10, 1565–1573[CrossRef][Medline] [Order article via Infotrieve]
  61. Costanzo, V., Shechter, D., Lupardus, P. J., Cimprich, K. A., Gottesman, M., and Gautier, J. (2003) Mol. Cell 11, 203–213[CrossRef][Medline] [Order article via Infotrieve]
  62. Cliby, W. A., Roberts, C. J., Cimprich, K. A., Stringer, C. M., Lamb, J. R., Schreiber, S. L., and Friend, S. H. (1998) EMBO J. 17, 159–169[CrossRef][Medline] [Order article via Infotrieve]
  63. Cortez, D., Guntuku, S., Qin, J., and Elledge, S. J. (2001) Science 294, 1713–1716[Abstract/Free Full Text]
  64. Zhao, H., and Piwnica-Worms, H. (2001) Mol. Cell Biol. 21, 4129–4139[Abstract/Free Full Text]
  65. Zhang, Y., and Xiong, Y. (2001) Science 292, 1910–1915[Abstract/Free Full Text]
  66. Saito, S., Goodarzi, A. A., Higashimoto, Y., Noda, Y., Lees-Miller, S. P., Appella, E., and Anderson, C. W. (2002) J. Biol. Chem. 277, 12491–12494[Abstract/Free Full Text]
  67. Hupp, T. R., Sparks, A., and Lane, D. P. (1995) Cell 83, 237–245[CrossRef][Medline] [Order article via Infotrieve]
  68. McKinney, K., Mattia, M., Gottifredi, V., and Prives, C. (2004) Mol. Cell 16, 413–424[CrossRef][Medline] [Order article via Infotrieve]
  69. Wong, K., Zhang, J., Awasthi, S., Sharma, A., Rogers, L., Matlock, E. F., Van Lint, C., Karpova, T., McNally, J., and Harrod, R. (2004) J. Biol. Chem. 279, 55667–55674[Abstract/Free Full Text]
  70. Scacheri, P. C., Rozenblatt-Rosen, O., Caplen, N. J., Wolfsberg, T. G., Umayam, L., Lee, J. C., Hughes, C. M., Shanmugam, K. S., Bhattacharjee, A., Meyerson, M., and Collins, F. S. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 1892–1897[Abstract/Free Full Text]
  71. Xirodimas, D. P., Saville, M. K., Bourdon, J. C., Hay, R. T., and Lane, D. P. (2004) Cell 118, 83–97[CrossRef][Medline] [Order article via Infotrieve]
  72. Chao, C., Wu, Z., Mazur, S. J., Borges, H., Rossi, M., Lin, T., Wang, J. Y., Anderson, C. W., Appella, E., and Xu, Y. (2006) Mol. Cell Biol. 26, 6859–6869[Abstract/Free Full Text]
  73. Harper, J. W. (2004) Cell 118, 2–4[CrossRef][Medline] [Order article via Infotrieve]
  74. Abida, W. M., Nikolaev, A., Zhao, W., Zhang, W., and Gu, W. (2007) J. Biol. Chem. 282, 1797–1804[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
Y. Yu, J.-P. Cai, B. Tu, L. Wu, Y. Zhao, X. Liu, L. Li, M. A. McNutt, J. Feng, Q. He, et al.
Proliferating Cell Nuclear Antigen Is Protected from Degradation by Forming a Complex with MutT Homolog2
J. Biol. Chem., July 17, 2009; 284(29): 19310 - 19320.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
J. Xiong and R. J. Epstein
Growth inhibition of human cancer cells by 5-aza-2'-deoxycytidine does not correlate with its effects on INK4a/ARF expression or initial promoter methylation status
Mol. Cancer Ther., April 1, 2009; 8(4): 779 - 785.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
P. A. Link, M. R. Baer, S. R. James, D. A. Jones, and A. R. Karpf
p53-Inducible Ribonucleotide Reductase (p53R2/RRM2B) Is a DNA Hypomethylation-Independent Decitabine Gene Target That Correlates with Clinical Response in Myelodysplastic Syndrome/Acute Myelogenous Leukemia
Cancer Res., November 15, 2008; 68(22): 9358 - 9366.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/5/2564    most recent
M702454200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, H.
Right arrow Articles by Zhu, W.-G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, H.
Right arrow Articles by Zhu, W.-G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2008 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement