|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 283, Issue 6, 3454-3464, February 8, 2008
Autophagy Is Involved in Nutritional Stress Response and Differentiation in Trypanosoma cruzi*
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The molecular basis of autophagy was elucidated through Saccharomyces cerevisiae genetic screens, where 16 essential genes (ATGs) were identified (4). Among these genes, two unique ubiquitin-like systems play an important role in the early stages of autophagosome biogenesis (5). The first one is the Atg12 system, where the ubiquitin-like Atg12 protein is conjugated to Atg5 protein in a process mediated by Atg7, an E16-like enzyme (ubiquitin-activating enzyme), and Atg10, an E2-like enzyme (ubiquitin-conjugating enzyme). The Atg12-Atg5 conjugate forms a complex with Atg16 protein (6) that is thought to form a transient coat that drives the deformation of the sequestering membrane during vesicle formation. The second ubiquitin-like protein that acts on vesicle expansion and completion is Atg8. This protein is proteolytically processed by the Atg4 protease (autophagin), thereby exposing a Gly residue which is then covalently attached to a phosphatidylethanolamine (PE) moiety by the concerted action of Atg7 and Atg3 proteins, the latter being a specific E2-like conjugating enzyme (7). This enables the previously cytosolic Atg8 protein to tightly associate with the membranes (8) making Atg8-PE a suitable autophagosomal membrane marker. Before fusion with the vacuole, Atg8 is deconjugated from PE in the outer membrane by Atg4 and released to the cytosol to be reused for new vesicle formation (9). In yeast, autophagy overlaps with a biosynthetic process termed the cytoplasm-to-vacuole targeting (Cvt) pathway. The Cvt pathway is an example of a specific type of autophagy where some proteins that are destined to become resident vacuolar hydrolases are synthesized in the cytosol followed by specific packaging into vesicles and delivery to the vacuole (10, 11). The molecular mechanism of autophagy was found to be strikingly similar in mammalian cells, with conservation of all the genes essential for the autophagosome formation (12).
Very little is known about autophagy in primitive unicellular organisms such as protozoan parasites, known to infect hosts of diverse origin. The recent completion of the genome sequencing projects of several trypanosomatids (13) now offers new opportunities to study autophagy on the molecular level also in these evolutionarily ancient eukaryotes. One of them is Trypanosoma cruzi, the causative agent of the American trypanosomiasis or Chagas disease, whose genome was completed in 2005 (14). T. cruzi has a complex life cycle, including two replicative forms, the epimastigote present in the gut of the insect vector and the amastigote, an intracellular form in the infected mammal, and two infective, non-replicative forms, the metacyclic trypomastigote in the insect vector and the bloodstream trypomastigote released from infected cells into the blood of the mammal (15). Transitions between the hosts as well as changes in the replicative environment are accompanied by extensive metabolic and morphological changes of the parasite. Proteasome and cruzipain were suggested to be involved in these differentiation processes (16, 17); however, the molecular mechanism has not been elucidated. Because differentiation in higher organisms is known to involve autophagy, it was reasonable to hypothesize that autophagy could be involved in T. cruzi differentiation.
In this work we report that the T. cruzi genome contains all the major genes of the Atg8 conjugation system (Atg3, Atg4, Atg7, Atg8), whereas the major components of the Atg12-Atg5 conjugation system (Atg12, Atg5, Atg10) are apparently lacking. The two recombinant T. cruzi autophagins (Atg4 proteases) were found to process the two recombinant Atg8 homologues at the Gly residue. Moreover, all the T. cruzi Atg4, and to a lesser extent Atg8 homologues were found to substitute the yeast homologues in functional assays. Apart from starvation, autophagy was also substantially enhanced during differentiation of the parasite, a process that is essential for survival of the parasite.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Bioinformatics Analysis of T. cruzi Genome—BLAST searches were performed against the predicted ATG-related proteins contained in version 3 of the T. cruzi genome sequences (14). Amino acid sequences corresponding to the C54 family peptidase domain (21) in ATG4-like genes were used for alignment with ClustalW program, and their score values were taken as percentage of identity between two sequences. A similar analysis was performed for the ATG8-like genes analysis on the basis of the deduced amino acid sequences from the N-terminal Met to the conserved Gly residue at the predicted autophagin cleavage site.
Expression and Purification of Recombinant Atg4 and Atg8 Proteins—The sequences corresponding to TcATG4.1, TcATG4.2, TcATG8.1, and TcATG8.2 were obtained by high fidelity PCR with genomic DNA from T. cruzi epimastigotes as template (GenBankTM accession numbers DQ768297, DQ768298, DQ768299, and DQ768300). DNA was prepared using the conventional proteinase K phenol-chloroform method (22). Primers were designed according to the sequence data obtained from the T. cruzi Genome Project data base search. For TcATG4.1 and TcATG4.2 the primers introduced an NdeI site 5' to the start codon and a BamHI site 3' to the stop codon. Similarly, cloning sites for NcoI and BamHI were added to TcATG8.1 and TcATG8.2. The sequences of the primers were as follows: TcATG4.1 sense primer 5'-AACATATGCAAGGTACAATGACG-3' and reverse primer 5'-AAGGATCCTCAAGAAGAAAAAGTGTCCTC-3'; TcATG4.2 sense primer 5'-AACATATGGAGTGGTTGAAAATTG-3' and reverse primer 5'-AAGGATCCTACTCCGCCACGTCC-3'; TcATG8.1 sense primer 5'-AACCATGGCGCAAAGAAATTG-3' and reverse primer 5'-AAGGATCCCACCAAGAACCAAAAGTTG-3'; TcATG8.2 sense primer 5'-AACCATGGCACGCAAATATCGCTACCA-3' and reverse primer 5'-AAGGATCCGAATTCCGCCGCACAGCCG-3'. Each resulting DNA fragment was gel-purified by Qiaquick columns (Qiagen), cloned into pGEM-T Easy vector (Promega), and completely sequenced (Macrogen, DNA sequencing service, Seoul, Korea). Inserts were liberated with the appropriate restriction enzymes (New England Biolabs) and cloned into the pET-28a(+) bacterial expression vector (Novagen). A His6 tag was added to the N termini of TcATG4.1 and TcATG4.2, whereas 21 amino acid residues including a His6 tag were added to the C termini of TcATG8.1 and TcATG8.2. These constructs were used to transform Escherichia coli BL21(DE3) pLysS cells followed by the induction of protein expression by 0.5 mM isopropyl-β-D-thiogalactopyranoside at 18 °C for 8 h for TcAtg4.1 and TcAtg4.2 and at 28 °C for 4.5 h for TcAtg8.1 and TcAtg8.2, respectively. Cells were then harvested by centrifugation at 3000 x g for 10 min and frozen. After thawing at 4 °C, cells were resuspended in buffer 50 mM Tris-HCl, pH 7.6, 500 mM NaCl, lysed, and sonicated, and cell debris was removed by centrifugation at 20,000 x g for 25 min at 4 °C. Supernatants were directly applied to fast flow Ni-NTA columns (Amersham Biosciences) followed by a washing step with 50 mM Tris-HCl, pH 7.6, 500 mM NaCl. Finally, proteins were eluted with the same buffer containing 150 mM imidazole. Eluates containing the recombinant proteins were pooled, and buffer was changed to TBS (Tris-HCl 50 mM, NaCl 150 mM, pH 7.6) using PD-10 columns (Amersham Biosciences). TcAtg8.1 and TcAtg8.2 were further purified using size exclusion chromatography (Superdex 75; Amersham Biosciences).
Production of Polyclonal Antisera—Anti-TcAtg8.1 and anti-TcAtg8.2 antibodies were raised in rabbits by standard protocols using the purified recombinant proteins.
In Vitro Cleavage Assay of Recombinant TcAtg8 by Recombinant TcAtg4 Proteins—Purified TcAtg8.1 or TcAtg8.2 (17.2 µg) recombinant proteins were mixed with different amounts of purified recombinant autophagins (750 ng-7.5 pg for autophagin-1 and 1.0-0.01 µg for autophagin-2) in 100 µl of TBS containing 1 mM EDTA and 1 mM 1,4-dithiothreitol. The reaction mixtures containing autophagin-1 were incubated at room temperature for 35 min and those containing autophagin-2 for 18 h. The reactions were stopped by the addition of Laemmli sample buffer and 5 min of boiling. 20 µl of each sample were separated on a 15% SDS-PAGE gel and stained with Coomassie Brilliant Blue. To determine the protease class, the experiments were carried out in the presence of different inhibitors (2 mM iodoacetamide, 2.5 mM N-ethylmaleimide, 100 µM E-64, 39 ng/µl cystatin C, 2.5 mM EDTA, 2 mM o-phenanthroline, or 10 µM pepstatin). To determine the exact cleavage site in TcAtg8 proteins, similar reaction solutions were applied to a C8 reverse phase Aquapore RP-300 BrownleeTM column (Applied Biosystems) equilibrated with 0.1% trifluoroacetic acid. Peptides were eluted with an acetonitrile gradient 0-90% (v/v) in 0.1% trifluoroacetic acid (v/v). The fraction corresponding to the peak that only appeared after treatment with autophagin was freeze-dried. N-terminal amino acid sequence was determined with Procise Protein Sequencing System 492 (Applied Biosystems) following the manufacturer's instructions.
Enzymatic Assays—Enzymatic activity of recombinant autophagins was tested using Abz-TFGQ-EDDnp, where Abz is the ortho-aminobenzoic acid fluorescent group, and EDDnp is N-(ethylenediamine)-2,4-dinitrophenylamide, a quenching group (kindly provided by Dr. Luiz Juliano, Sao Paulo, Brazil) (23). This peptide was designed based on the TcAtg8.1 cleavage site (TFG
). Activity measurements were performed in 96-well plates in TBS buffer containing 2 mM 1,4-dithiothreitol, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, and 10 µg/ml substrate (final concentration) at 30 °C. The reactions were started by the addition of 2 µg of either autophagin to the reaction mixture. Fluorescence was measured in a Safire plate reader (Tecan) for 30 min at excitation and emission wavelengths of 320 and 420 nm, respectively.
Detection of Autophagin Activity in T. cruzi Cell-free Extracts—Extracts of the four T. cruzi developmental stages were prepared by resuspending the parasites in TBS containing 1 mM 1,4-dithiothreitol, 100 µM E-64, 2 mM phenylmethylsulfonyl fluoride, and 2.5 mM EDTA. Cells were broken by three cycles of freezing at -20 °C and thawing, and the cell-free extracts were obtained by centrifugation at 26,900 x g. Lysates (100 µg of protein) were then added to 17.2 µg of recombinant TcAtg8.1 or TcAtg8.2 in TBS containing 1 mM 1,4-dithiothreitol, 2 mM phenylmethylsulfonyl fluoride, 2 mM EDTA, 2 mM o-phenanthroline, and 10 µM E-64. Where indicated, equivalent reactions were inhibited by 3 mM iodoacetamide. The reactions were incubated for 18 h at room temperature and stopped with Laemmli sample buffer. One-third of each mixture was loaded on a 15% SDS-PAGE gel and transferred to a nitrocellulose membrane (Amersham Biosciences). To detect the cleavage fragments, antisera raised against recombinant TcAtg8.1 or TcAtg8.2 were used as primary antibodies, and alkaline phosphatase-conjugated goat anti-rabbit antibody was used as secondary antibody. The blots were developed using 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt and nitro blue tetrazolium chloride.
Yeast Complementation Studies—BamHI and NotI sites were introduced at the 5'- and the 3'-ends of TcATG4.1, TcATG4.2, TcATG8.1, and TcATG8.2 genes by PCR using the following primers: for TcATG4.1, sense primer 5'-TTAGGATCCATGCAAGGTACAATGACG-3' and reverse primer 5'-AATGCGGCCGCTCAAGAAAAAGTGTC-3'; for TcATG4.2, sense primer 5'-TTAGGATCCATGGAGTGGTTGAAAATTG-3' and reverse primer 5'-AATGCGGCCGCTACTCCGCCACGTCC-3'; for TcATG8.1, sense primer 5'-TTAGGATCCATGGCGCCAAAGAAA-3' and reverse primer 5'-AATGCGGCCGCTCACCAAGAACCAAAAGTTG-3'; for TcATG8.2, sense primer 5'-TTAGGATCCATGGCACGCAAATATC-3' and reverse primer 5'-AATGCGGCCGCTCAATTCCGCCGCACAGC-3'. Inserts were cloned into the pCM190 vector (24) and used to transform atg4
and atg8
WCG strains of S. cerevisiae (kindly provided by Dr. M. Thumm) by the lithium acetate method (25). Transformant cultures and wild type control WCG yeast strain were grown in yeast nitrogen base media containing 0.5% ammonium sulfate containing amino acids but lacking uracil until an optical density of 1 at 600 nm was reached. Cells were subsequently split into two aliquots. The first was centrifuged, and cells were resuspended in 1% potassium acetate and grown for additional 7 h to induce starvation response. Fresh growth medium was added to the second aliquot as a control. Cultures were centrifuged, Laemmli sample buffer and glass beads were added to the harvested cells, and the mixture was vortexed vigorously to break cell walls. Yeast proteins were separated on a 10% SDS-PAGE gel and transferred to a nitrocellulose membrane. Immunodetection was performed with anti-(pro)aminopeptidase I primary antibodies (gift from I. V. Sandoval and M. J. Mazón) and horseradish peroxidase-conjugated anti-rabbit secondary antibodies. The antigens were visualized with ECLTM detection system (Amersham Biosciences).
Generation of ATG8 Transfectant Epimastigotes—Hemagglutinin (HA) tags and restriction sites for BamHI and XhoI were introduced at the N termini of TcATG8.1 and TcATG8.2 using the following primers: TcATG8.1 sense primer 5'-TAGGATCCATGTACCCATACGATGTTCCAGATTACGCGCCAAAGAAATTGGAGAGC-3' and reverse primer 5'-ATCTCGAGTCACCAAGAACCAAAAGTTGCCTC-3'; TcATG8.2 sense primer 5'-TAGGATCCATGTACCCATACGATGTTCCAGATTACGCTCCACGCAAATATCGCTACCAGCG and reverse primer 5'-TTCTCGAGCTAATTCCGCCGCACAGCCGCAC-3'. The corresponding DNA fragments were cloned into the pRibotex plasmid (26) and completely sequenced. Plasmid constructs for TcATG8.1G121A and TcATG8.2G131A were generated by site-directed mutagenesis using the Quik-Change site-directed mutagenesis kit (Stratagene) The following primers were used: for pRibotex-HA-ATG8.1G121A, sense primer 5'-GGTGAGGCAACTTTTGCTTCTTGGTGACTCGAG-3' and its reverse complement as reverse primer; for p-Ribotex-HA-ATG8.2G131A, sense primer 5'-ATTGAGAGCGCCTTTGCCGGTGCGCTGTGCGG-3' and its reverse complement as reverse primer. Mutation was verified by automatic DNA sequencing. These four constructs were used to transfect T. cruzi epimastigotes as previously described (27).
Immunofluorescence Studies—The parasites were fixed in 4% paraformaldehyde in PBS for 15 min. Next, the cells were washed twice with PBS, incubated for 10 min with 25 mM ammonium chloride, and washed again twice with PBS. Coverslides were saturated in the blocking buffer (2% bovine serum albumin, 0.1% saponin in PBS) containing 3% goat serum for 30 min and incubated for 2 h with the primary antibody diluted in the blocking buffer. Parasites were then washed with PBS and incubated with the appropriate secondary antibody diluted in the blocking buffer for 1 h. After extensive washing with PBS, coverslides were mounted using Fluor-SaveTM reagent (Calbiochem) containing 5 µg/ml DAPI. The following primary antibodies were used: rat anti-HA high affinity monoclonal antibodies (Roche Applied Science) (1/500 dilution), rabbit anti-Atg8.1 polyclonal antibodies (1/700 dilution), and mouse anti-TcSCP (T. cruzi serine carboxypeptidase) polyclonal antibodies as a lysosomal/reservosomal marker (1/1000) (28). The secondary antibodies used were AlexaFluor 546-conjugated goat anti-rat, AlexaFluor 546-conjugated goat anti-rabbit, AlexaFluor 488-conjugated goat anti-rabbit, and AlexaFluor 546-conjugated goat anti-mouse immunoglobulins (Molecular Probes), all diluted 1/1000. Preparations were analyzed using a fluorescence microscope (Nikon Eclipse E600), and image capture was performed by a Spot RT Slider Model 2.3.1 digital camera (Diagnostic Instruments). The number of Atg8.1 positive vesicles within untransfected T. cruzi epimastigotes was quantified by observing at least 70 cells from three independent experiments.
Transmission Electron Microscopy—Parasites were fixed for 1 h at room temperature with 2.5% glutaraldehyde in 0.1 M phosphate buffer, pH 7.2, post-fixed for 30 min with 1% OsO4, 1.25% potassium ferrocyanide, and 5 mM CaCl2 in 0.1 M cacodylate buffer, pH 7.2, dehydrated in an ascending ethanol series, and embedded in Epon resin. Ultrathin sections were stained with uranyl acetate and lead citrate and then examined in a Zeiss 902 electron microscope operating at 80 kV.
| RESULTS |
|---|
|
|
|---|
Surprisingly, BLAST analysis failed to identify most of the genes specifically involved in Atg12 conjugation. These included the ATG12 gene encoding an ubiquitin-like protein, which is the most important, as well as the genes encoding two other components of this pathway, ATG5 and ATG10. The only two sequences identified were both homologous to ATG16, which is, however, a downstream gene in the pathway (supplemental Table 1). This further suggests that the Atg-12-Atg5 conjugation system is most likely lacking in T. cruzi or at least significantly diverse from the yeast system.
However, all the essential genes involved in the Atg8 conjugation system could be identified in the T. cruzi genome using the same approach (supplemental Table 1). The analysis, thus, revealed single genes homologous to the E1-enzyme Atg7 (34% identity with yeast Atg7) and the E2-enzyme Atg3 (28% identity with yeast Atg3). In contrast, two candidate genes were identified for each of the two early genes of the pathway, the ubiquitin-like modifier Atg8 and its processing protease Atg4. A detailed analysis of the two candidate genes for Atg4 protease (TcATG4.1 and TcATG4.2) revealed that they encode proteins with 30 and 20% identity to the yeast Atg4, respectively. The two genes are 21% identical with each other within the region corresponding to the catalytic domains characteristic for C54 (autophagin) family (supplemental Fig. 1). Both candidate proteases were found to contain all the key amino acid residues involved in substrate hydrolysis: the Cys-Asp-His catalytic triad, the Tyr residue, which participates in the formation of the oxyanion hole, and the conserved Trp residue critical for the binding of Atg8 (29). Interestingly, orthologs of both TcATG4.1 and TcATG4.2 could be found in the Trypanosoma brucei (Tb11.01.7970 and Tb927.6.1690) and in the Leishmania major (LmjF30.0270 and LmjF32.3890) genomes. A similar analysis of the two Atg8 homologues, TcATG8.1 and TcATG8.2, revealed that they are 43% identical to each other. Besides an overall similarity to the yeast Atg8, they also share the conserved Gly residue at the putative Atg4 cleavage site as well as the two crucial Phe residues suggested to be important for recognition by Atg4 (supplemental Fig. 2). TcAtg8.1 displays higher sequence identity (53%) to the yeast Atg8 protein and has two orthologs in T. brucei (Tb07.10C21.40 and Tb07.10C21.50) and one in L. major (LmjF19.1630). In contrast, TcAtg8.2 has only one ortholog in T. brucei (Tb07.28B13.800), whereas none could be found in L. major. However, the L. major genome contains several more distantly related ATG8-like sequences whose direct orthologs do not seem to be present in T. cruzi and T. brucei.
This immediately raised an important question, whether the apparently functional Atg8 conjugation system would be sufficient for the formation of autophagosomal vesicles in T. cruzi. To address this question, all the subsequent work was focused on the functional analysis of the two early genes, Atg4 and Atg8.
T. cruzi Atg4 Proteins (Autophagins) Process T. cruzi Atg8 Homologues in Vitro at the Conserved Gly Residue—The entire open reading frames of TcATG4.1, TcATG4.2, TcATG8.1, and TcATG8.2 genes were obtained from T. cruzi genomic DNA, cloned into the bacterial expression vector pET-28, and expressed in E. coli BL21(DE3) pLysS cells. Recombinant fusion proteins with the His6 peptide at the amino (TcATG4.1 and TcATG4.2) or carboxyl (TcATG8.1 and TcATG8.2) terminus were purified in one step using Ni-NTA affinity chromatography. Next, both recombinant TcAtg4 proteins (autophagins) were tested for their ability to process both potential recombinant TcAtg8 substrates in in vitro cleavage assays using fixed amounts of TcAtg8.1 or TcAtg8.2. Autophagin-1 (TcATG4.1) was shown to rapidly process both Atg8 proteins with a minor preference for TcAtg8.1 already at low protease concentration (Fig. 1, A and B). Processing was inhibited by iodoacetamide and N-ethylmaleimide but not by E-64, cystatin C, EDTA, o-phenanthroline, or pepstatin (not shown), consistent with the inhibition pattern of the yeast cysteine peptidase Atg4. In contrast, only minor amounts of Atg8 proteins were cleaved by autophagin-2 despite considerably higher concentration of the protease (>250-fold) and substantially increased incubation time (18 h) (Fig. 1, C and D). The possibility that autophagin-2 had been inhibited by metal cations during the Ni-NTA purification procedure was excluded since in a control experiment performed with crude extracts from E. coli cells overexpressing the recombinant peptidase the same results were obtained (not shown). Despite dramatically lower proteolysis efficiency of autophagin-2 (
10,000-fold), which suggests that autophagin-1 is the main enzyme responsible for Atg8 protein processing in T. cruzi, both autophagins cleaved the two Atg8 proteins after the same Gly residues (Fig. 1G, Gly-121 in Atg8.1 and Gly-131 in Atg8.2), as determined by N-terminal sequencing of the C-terminal proteolytic products (Fig. 1, E and F). This is also consistent with the predicted cleavage sites, as cleavage at these Gly residues is highly conserved throughout evolution among Atg8 proteins (supplemental Fig. 2).
|
and atg8
strains were shown to be deficient in both autophagy and the Cvt pathway and, therefore, failed to deliver proaminopeptidase I (pAPI) from the cytosol to the vacuole where pAPI is normally processed to the mature enzyme (mAPI) (30). Processing of pAPI to mAPI was, thus, used as an indicative marker of functional autophagy under normal growth conditions and under nitrogen starvation. As shown in Fig. 2, transforming the S. cerevisiae atg4
strain with either TcATG4.1 or TcATG4.2 complemented the yeast deletion almost completely, generating mAPI in both nutrient rich and starvation conditions. In contrast, neither of the TcAtg8 proteins restored the Cvt pathway in the atg8
strain in nutrient-rich conditions. However, under nitrogen starvation conditions a minor mAPI band was observed in TcATG8.1 transformant, suggesting that autophagy is at least partially reestablished. Western blot analysis of the transformant yeast extracts using anti-TcAtg8.1 and anti-TcAtg8.2 polyclonal antibodies demonstrated that both proteins were efficiently expressed (not shown), excluding the possibility that inefficient processing was a consequence of low protein expression. This is, however, in agreement with the results of an analogous experiment with Arabidopsis thaliana ATG8 homologues, where pAPI processing was partially restored under starvation conditions only (31). This difference between Atg4 and Atg8 can probably be explained by the fact that Atg8 protein has to interact with several host cell proteins to mediate autophagosome formation and not just with a single one as Atg4, giving a much higher chance that these Atg8 interactions are not optimal due to species divergence.
|
TcAtg8.1 Is a Functional Homologue of Yeast Atg8 Protein—To establish the role of TcAtg8.1 and TcAtg8.2 proteins in T. cruzi, N-terminal HA-tagged TcATG8.1 and TcATG8.2 genes were cloned into the pRibotex expression vector. T. cruzi epimastigotes were then transfected with these constructs, and the intracellular localization of the two proteins was investigated by indirect immunofluorescence microscopy using anti-HA antibodies (Fig. 4A). In nutrient-rich BHT growth medium, both proteins were located in the cytosol. However, when transfected epimastigotes were exposed to prolonged starvation in PBS, Atg8.1 localization changed considerably, revealing the presence of several large bright spots, probably resulting from Atg8.1 concentration in the membranes of autophagosomal vesicles. In a control experiment, when epimastigotes were transfected with the G121A mutant of HA-Atg8.1, no such change in localization could be observed. This further suggests that, analogous to the yeast system, the autophagosome localization of Atg8.1 is dependent on the conjugation of the C-terminal Gly residue probably to a PE moiety. Although after prolonged starvation Atg8.2 protein was also partially localized to several bright spots, the effect was less pronounced than in the case of Atg8.1. Furthermore, the TcAtg8.2 G131A mutant exhibited similar vesicle membrane-associated localization, suggesting that membrane binding can occur independently of conjugation to PE. This further implies that TcAtg8.2 might be partially bound to autophagy-related vesicles, although the possibility that it might have another localization and/or another function cannot be excluded. This is, however, more similar to the human Atg8 homologues GABARAP and GATE-16, whose physiological functions and roles in autophagy are also not clear (2, 32).
|
|
Because starvation-induced autophagy is often linked with increased protein degradation, we next tried to block the appearance of autophagosomes by the classical autophagy inhibitor 3-methyladenine, which similarly to wortmannin, blocks phosphatidyl inositol 3-kinase. However, both inhibitors seem to be toxic for the parasite, consistent with recent observations (33), which precluded us from performing the experiment.
T. cruzi Differentiation Is Accompanied by Autophagosome Formation—T. cruzi experiences profound morphological changes during development in the vertebrate and invertebrate hosts. The process of T. cruzi metacyclogenesis in volves the transformation of noninfective epimastigotes into metacyclic trypomastigotes, which are the naturally infective form of the parasite. During in vivo metacyclogenesis, differentiating epimastigotes adhere to the epithelium of the insect rectum before transforming into metacyclic trypomastigotes. It is not clear how adhesion triggers the differentiation process, but it has been demonstrated that both adhesion and metacyclogenesis are triggered by nutritional stress (34).
Because autophagy has been widely described to be involved in cellular remodeling during development and differentiation and is a common response to nutrient deprivation (35), as also demonstrated in T. cruzi (see above), the involvement of autophagy in the process of T. cruzi metacyclogenesis was studied. The next set of experiments was, therefore, performed using samples derived from cultures undergoing spontaneous differentiation from epimastigotes to metacyclic trypomastigotes in BHT medium. Based on bright field microscopy combined with fluorescence microscopy, three different cell-type populations could be defined: epimastigotes, differentiating epimastigotes, and fully differentiated metacyclic trypomastigotes (Fig. 5). The three populations have the following characteristics; epimastigotes (E) are spindle-shaped organisms (a) with a rounded nucleus and a slightly concave disk, the kinetoplast, located in the proximity of the nucleus and anterior to it, based on DAPI staining (b). Lysosome-like organelles called reservosomes, characteristic for this form, could also be seen at the posterior end of the parasite (c). Differentiating epimastigotes (D) are smaller than epimastigotes with a rounded posterior end (f and k). DAPI staining revealed that the nucleus is still spherical, but the kinetoplast has begun to migrate and is located beside or at the posterior side of the nucleus (g and l). The number of reservosomes is diminished in this stage based on carboxypeptidase staining (h and m). Finally, metacyclic trypomastigotes (T) are slender (p) with an elongated nucleus and a round-shaped kinetoplast occupying the posterior position in the cell as revealed by DAPI staining (q). Small lysosome-like vesicles located next to the kinetoplast at the posterior end of the parasite were identified based on carboxypeptidase staining (r). In addition to the differences described above, remarkable differences were observed based on Atg8.1 staining. Extremely intense staining was observed in differentiating epimastigotes (i and n), suggesting that these cells were undergoing massive autophagy. Because of this very intense signal, the exposition times used were much shorter as in Fig. 4, thereby precluding us from accurately detecting the levels of Atg8.1 in epimastigotes (d) and metacyclic trypomastigotes (s), where almost no signal was observed. However, based on these results, the results of the Western blot (Fig. 4B), and the findings in rich medium (Fig. 4C), it can be suggested that the basal level of Atg8.1 is not very high in epimastigotes and very low (below the detection limit) in metacyclic trypomastigotes. Merged images of serine carboxypeptidase and Atg8.1 staining of the same parasites revealed that both proteins partially colocalized in the reservosomes during differentiation, a fact that is likely due to the delivery of the autophagosome content to the reservosomes/lysosomes (j and o).
|
| DISCUSSION |
|---|
|
|
|---|
Lipidation of Atg8 in yeast or LC3 modification in mammals is an essential step in correct autophagosome formation (40). Indeed, Nakatogawa et al. (41) have recently shown that Atg8 conjugated to PE mediates tethering between adjacent membranes and stimulates membrane hemifusion, an event that may mimic expansion of the autophagosomal membrane during autophagy. A prerequisite for this is, however, proteolytic removal of the C terminus of Atg8/LC3 by the cysteine protease Atg4 (autophagin) to expose a Gly residue, which is then covalently modified (7). Atg4 and Atg8 homologues in T. cruzi and their possible implications in autophagy were, therefore, the focus of further work. In contrast to yeast, two homologues of both Atg4 (TcAtg4.1 and TcAtg4.2, supplemental Fig. 1) and Atg8 (TcAtg8.1 and TcAtg8.2, supplemental Fig. 2) were found in T. cruzi, resembling more the situation in mammals, where four homologues of each gene can be found (42, 43). Because in humans only one Atg4 homologue, HsAtg4B, and one Atg8 homologue, LC3, are principally involved in autophagy (44, 45), it was important to identify their functional TcAtg4 and TcAtg8 homologues.
Based on in vitro cleavage assays, TcAtg4.1 was found to be most likely responsible for processing the TcAtg8 proteins. Nevertheless, when expressed in the ATG4-deficient yeast strain, TcATG4.2 was as efficient as TcATG4.1 in reconstituting the Cvt pathway and autophagy. One possibility is that low levels of autophagin activity are sufficient to trigger substantial proaminopeptidase processing. This could also be linked with overexpression of both autophagins in yeast, which are probably much higher than the endogenous levels of Atg4. Alternatively, TcAtg4.1 and TcAtg4.2 may be similarly effective in processing yeast Atg8, as both autophagins were found to have the same specificity. Moreover, this result also suggests that both autophagins are capable not only of processing Atg8 but also deconjugating it from PE. TcAtg4.2 may, thus, be an orphan protease remaining in the genome and eventually serving as a backup system, although the possibility that TcAtg4.2 might be involved in the processing and/or deconjugation of other ubiquitin-like proteins remains open. A recent study performed in L. major suggested the LmATG4.2 gene to be important for autophagy and differentiation (46). The L. major atg4.2
mutants had an increased proportion of the lipidated form of Atg8 relative to the unlipidated one, which led to speculation for a role of Atg4.2 in Atg8 deconjugation. However, no further studies were performed with Leishmania Atg4.2 or Atg4.1 to provide insight into the roles of these proteases.
Autophagins were found to be constitutively expressed in all life-cycle stages of T. cruzi, which is in agreement with the earlier findings on human autophagins (43). Despite its constitutive expression and apparent lack of existing endogenous inhibitors, the very strict specificity of autophagins may be sufficient to prevent unspecific proteolysis in the cytosol. This can be explained by the recently determined crystal structure of HsAtg4B (29). The active site cleft of this family of enzymes was found to be masked by a loop of four amino acid residues and could be exposed only after Atg8 binding, which might also explain the apparent lack of activity of both T. cruzi autophagins on the short peptidic substrate Abz-TFGQ-EDDnp, designed on the basis of the cleavage sequence in TcAtg8.1.
Functional studies with TcATG8.1 and TcATG8.2 clearly revealed TcAtg8.1 to be the critical molecule. TcATG8.1 was the only one able to partially replace yeast Atg8 function when expressed in an Atg8-deficient yeast strain (Fig. 2). Moreover, only TcAtg8.1 was found to concentrate in several large vesicles in HA-tagged TcATG8.1-transfected epimastigotes exposed to starvation conditions (Fig. 4A). Mutating the conserved Gly residue to Ala (G121A mutant) abolished this effect, suggesting that the observed pattern is a consequence of Atg8.1-PE conjugates insertion into the lipid membranes and not of unspecific protein aggregation. Finally, this finding was confirmed with polyclonal anti-TcAtg8.1 antibodies in wild-type nontransfected epimastigotes exposed to starvation.
These findings strongly suggest that the Atg8 conjugation system in T. cruzi functions very similarly to the Atg8 conjugation systems in yeast and mammals. Moreover, these experiments clearly demonstrated induction of autophagy as a response to starvation and validated TcAtg8.1 as a suitable marker for autophagy in T. cruzi, in agreement with previous data on LC3 and Atg8 (8, 47). Autophagy could, thus, represent a crucial survival mechanism of T. cruzi epimastigotes as a response to starvation in the gut of the insect vector. The latter are known to suffer long periods of starvation, which can last for more than 12 months depending on species, instar, and climatic conditions (48). Furthermore, nutritionally poor growth media such as triatomine artificial urine and M16 induce metacyclogenesis, a process during which epimastigotes differentiate to metacyclic trypomastigotes and which occurs in nature in the insect rectum (49, 50). The process, therefore, requires fast and extensive protein degradation and recycling of building blocks for the synthesis of new macromolecules. Initial studies suggested that cruzipain, the most abundant lysosomal/reservosomal cysteine peptidase of T. cruzi belonging to the CA clan (21) of proteases, is critical for the differentiation as the cell-permeable cruzipain inhibitors effectively inhibited the process (19, 51), whereas overexpression of this enzyme is associated with enhanced metacyclogenesis (52). Our results clearly demonstrate that autophagy is also involved in cell remodeling most probably by delivering large parts of the cytoplasm and organelles to lysosomes/reservosomes. Blocking cruzipain is, thus, a downstream effect associated with defects in the terminal turnover of proteins. An analogous situation can be found in mammals where lysosomal cathepsins are responsible for the terminal protein degradation within autolysosomes after the autophagosome-lysosome fusion. Knocking out aspartic protease cathepsin D or, simultaneously, cathepsins B and L resulted in defects in autophagy and accumulation of autophagosomes (53). A similar effect was also observed in Leishmania, where inhibition of cysteine peptidases (CPA, CPB, CPC) homologous to cruzipain and cysteine cathepsins with broad spectrum reversible or irreversible inhibitors, which killed the parasite, was accompanied with defects in the lysosomal compartment resembling lysosomal storage disease (54). Moreover, CPA and CPB from Leishmania mexicana were recently found to be essential for both autophagosome degradation and differentiation of that parasite. In addition, LmAtg4.2 was suggested to be involved in autophagosome formation, thus being upstream of CPA and CPB (39, 46).
Because differentiation is critical for the pathogenicity of the parasite, these findings could also be important for the treatment of Chagas disease. This infection is endemic in Central and South America, where its prevalence is estimated at 16-18 million cases with 120 million people at risk. No vaccines have been developed so far, and the low effectiveness and serious adverse effects of the chemotherapeutic agents available makes treatment of Chagas disease very difficult. There is, therefore, a pressing need for the identification of novel drug targets and virulence factors to improve the prevention and treatment of this disease (55). Proteases are very attractive targets for infectious diseases (56), and cruzipain has already been validated as a target for Chagas disease (17). Our data suggest that autophagins, which act upstream of cruzipain in T. cruzi differentiation, should be considered as potential targets, as targeting an upstream protease in the signaling pathway is often beneficial (56).
In conclusion, we have found that conservation of the autophagy mechanism is even broader than believed so far, spanning all of eukaryotic evolution. However, autophagosome formation seems to be driven primarily by the functional Atg8 conjugation system, as Atg12 is apparently absent from the T. cruzi genome. Autophagy was shown to be important for the survival of the parasite during starvation and differentiation, which suggests that inhibition of autophagy might be considered a novel strategy for treatment of infections caused by T. cruzi.
| FOOTNOTES |
|---|
* This work was supported in part by a grant from Slovene Research Agency P0140 (to V. T.) and by a travel grant from the Secretaría de Ciencia, Tecnología e Innovación Productiva (Argentina) as part of a bilateral cooperation agreement with the Slovenian Research Agency. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ![]()
The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. 1 and 2 and Table 1. ![]()
1 Both authors contributed equally to this work. ![]()
2 Research Fellow of the Argentinian National Research Council (Consejo Nacional de Investigaciones Científicas y Técnicas). ![]()
3 Supported in part by a grant from the Ellison Medical Foundation to the Center for Tropical and Emerging Global Diseases. Electronmicroscopywasperformed in the laboratory of Roberto Docampo, University of Georgia, Athens, GA. ![]()
4 Member of the Research Career of the Argentinian of the National Research Council (Consejo Nacional de Investigaciones Científicas y Técnicas). ![]()
5 To whom correspondence should be addressed. Tel.: 386-1-477-37-72; Fax: 386-1-477-3894; E-mail: boris.turk{at}ijs.si.
6 The abbreviations used are: E1, ubiquitin-activating enzyme; E2, ubiquitin-conjugating enzyme; PE, phosphatidylethanolamine; Cvt pathway, cytoplasm-to-vacuole targeting pathway; BHT, brain-heart-tryptose; PBS, phosphate-buffered saline; Ni-NTA, nickel-nitrilotriacetic acid; TBS, Tris-buffered saline buffer; E-64, trans-epoxysuccinyl-L-leucilamido-(4-guanidino)butane; Abz, ortho-aminobenzoic acid; pAPI, proaminopeptidase I; mAPI, mature aminopeptidase I; HA, hemagglutinin; DAPI, 4',6-diamidino-2-phenylindole. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |