Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M707576200 on December 26, 2007

J. Biol. Chem., Vol. 283, Issue 9, 5466-5476, February 29, 2008
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
283/9/5466    most recent
M707576200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oliva, J. L.
Right arrow Articles by Kazanietz, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oliva, J. L.
Right arrow Articles by Kazanietz, M. G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

S-Phase-specific Activation of PKC{alpha} Induces Senescence in Non-small Cell Lung Cancer Cells*Formula

Jose L. Oliva{ddagger}§12, M. Cecilia Caino{ddagger}1, Adrian M. Senderowicz§, and Marcelo G. Kazanietz{ddagger}3

From the {ddagger}Department of Pharmacology and Institute for Translational Medicine and Therapeutics, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104-6160 and the §CDER, Food and Drug Administration, Silver Spring, Maryland 20993

Received for publication, September 10, 2007 , and in revised form, December 18, 2007.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Protein kinase C (PKC) has been widely implicated in positive and negative control of cell proliferation. We have recently shown that treatment of non-small cell lung cancer (NSCLC) cells with phorbol 12-myristate 13-acetate (PMA) during G1 phase inhibits the progression into S phase, an effect mediated by PKC{delta}-induced up-regulation of the cell cycle inhibitor p21Cip1. However, PMA treatment in asynchronously growing NSCLC cells leads to accumulation of cells in G2/M. Studies in post-G1 phases revealed that PMA induced an irreversible G2/M cell cycle arrest in NSCLC cells and conferred morphological and biochemical features of senescence, including elevated SA-β-Gal activity and reduced telomerase activity. Remarkably, this effect was phase-specific, as it occurred only when PKC was activated in S, but not in G1, phase. Mechanistic analysis revealed a crucial role for the classical PKC{alpha} isozyme as mediator of the G2/M arrest and senescence, as well as for inducing p21Cip1 an obligatory event for conferring the senescence phenotype. In addition to the unappreciated role of PKC isozymes, and specifically PKC{alpha}, in senescence, our data introduce the paradigm that discrete PKCs trigger distinctive responses when activated in different phases of the cell cycle via a common mechanism that involves p21Cip1 up-regulation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Activation of protein kinase C (PKC)4 with phorbol esters and related natural compounds causes an array of effects on differentiation, mitogenesis, survival, apoptosis, and transformation. The diverse effects of phorbol esters both in normal and cancerous cells is due to the existence of numerous intracellular effectors, of which PKC isozymes have been the most widely characterized. The PKC family comprises 3 subfamilies that include 10 structurally related phospholipid-dependent serine/threonine kinases (1, 2). Members of the classical cPKC ({alpha}, βI, βII, and {gamma}) and the novel nPKC ({delta}, {epsilon}, {eta}, and {theta}) subfamilies are activated by phorbol esters and their cellular analogue, the second messenger diacylglycerol, which leads to redistribution (translocation) of the enzymes from cytosol to intracellular membrane compartments, where they phosphorylate specific substrates. The marked heterogeneity in the signaling events and cell type-specific responses triggered by phorbol esters could be explained by the distinctive pattern of expression and intracellular localization of PKC isozymes and their substrates, which ultimately results in selective pathway activation.

One of the paradigms that best exemplifies the functional versatility of PKC isozymes is the regulation of the cell cycle machinery. It became evident in the last years that PKCs can impact on the cell cycle both in positive and negative manners with a strict degree of cell type and isozyme specificity. PKC isozymes have been shown to regulate the progression of cells from G1 to S phase as well as with the transition from G2 to M phase (3) via transcriptional, translational, and post-translational mechanisms. PKCs control the activity of cyclin-Cdk complexes in G1 by modulating the expression of cyclins and Cdk inhibitors (4, 5). For example, early studies in vascular endothelial cells showed dual growth stimulatory or inhibitory roles for PKCs depending on which phase in the cell cycle PKC becomes activated. In HUVEC cells phorbol esters potentiate growth factor mitogenic activity when added in early G1 phase, but they inhibit DNA synthesis when added in late G1 phase (6). In NIH 3T3 cells, PKC{alpha} and PKC{epsilon} enhance cell cycle progression and proliferation by stimulating cyclin D1 transcription (7). On the other hand, PKC{eta} inhibits cdk2 activity in human keratinocytes, and overexpression of either PKC{eta} or PKC{delta}, but not PKC{alpha}, leads to G1 arrest and differentiation (8, 9). In several cell types, the PKC activator phorbol 12-myristate 13-acetate (PMA) up-regulates Cdk inhibitors p21Cip1 and/or p27 (10, 11). These contrasting effects ultimately impact on the status of Rb phosphorylation, the expression of E2F-regulated genes, and the biological outcome. Several studies have also established key roles for PKC isozymes in G2. For example, PKCβII activation was required for entry into mitosis in HL60 promyelocytic leukemia cells (12), whereas PMA was shown to induce G2 arrest by suppression of cdc2 kinase activity in vascular endothelial cells (13). Based on this complexity, it is not surprising that both PKC activators (such as bryostatins or phorbol esters) and PKC inhibitors (such as the PKCβ inhibitor enzastaurin) are in clinical trials for a number of neoplasias (14-17). Because of the contrasting effects of PKC isozymes on cell cycle regulation, a thorough understanding of these mechanisms is essential for the rational design of PKC modulators with anti-cancer activity.

Lung cancer is one of the most common forms of cancers worldwide and the major cause of cancer-related mortality. Non-small cell lung carcinoma (NSCLC), the most frequent type of lung cancer, is treated in early stages mainly with surgery and radiotherapy, whereas advanced stages receive combination chemotherapy or radiation therapy (18). Unfortunately, the marked resistance to the various therapies accounts for the high lethality (19). Studies in the last years have proposed PKC isozymes, such as PKC{alpha}, as targets for NSCLC therapy. However, a PKC{alpha}-specific antisense oligonucleotide (ISIS 3521/LY900003) showed slight or no benefit in NSCLC patients, either alone or in combination with other chemotherapeutic agents (20). This is not unexpected since PKC{alpha}, like other PKCs, has been shown to be either growth inhibitory or pro-apoptotic in various cancer cell models (21-23). One may speculate that activators of growth inhibitory PKCs rather than PKC inhibitors could have therapeutic benefits for lung cancer, as demonstrated for other types of cancers. It is evident that a deeper knowledge of the roles of individual PKC isozymes in lung cancer would be needed to rationalize the use of PKC as a therapeutic target.

Our recent studies have established that treatment of NSCLC cells with phorbol ester in early G1 impairs the progression through S phase, and we have identified PKC{delta} as the PKC responsible for this effect. PKC{delta}-induced G1 arrest is mediated through the transcriptional up-regulation of the cell cycle inhibitor p21Cip1 (24). However, as shown in the present article, the paradox seems to be more complex, because in asynchronously growing NSCLC cells phorbol esters lead to the accumulation of cells in G2/M, thus suggesting multiple points of regulation in the cell cycle by PKCs. A more detailed analysis revealed that activation of PKC in late G1-early S leads to a delay in the progression through S phase and irreversible arrest of cells in G2/M, followed by the appearance of a senescence phenotype. Both G2/M arrest and senescence depend on the up-regulation of p21Cip1, but strikingly these effects are mediated by PKC{alpha} rather than PKC{delta}. Exploiting this irreversible induced growth arrest of lung cancer cells in response to PKC{alpha} activation may have significant therapeutic implications.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Cell culture media was purchased from Invitrogen (Carlsbad, CA). PMA was obtained from LC Laboratories (Woburn, MA). The pan-PKC inhibitor GF109203X (bisindolylmaleimide I) was from BIOMOL Research Laboratories Inc. (Plymouth Meeting, PA). Gö6976 and rottlerin were purchased from Alexis (San Diego, CA). Propidium iodide, DAPI, and hydroxyurea were from Sigma-Aldrich.

Cell Culture—H358 and H441 lung bronchoalveolar adenocarcinoma cells were obtained from ATCC (Manassas, VA). H322 lung bronchoalveolar carcinoma cells were kindly provided by Dr. Steven Albelda (University of Pennsylvania School of Medicine). Cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, penicillin (100 units/ml), streptomycin (100 µg/ml), and L-glutamine (2 mM) at 37 °C in a humidified 5% CO2 atmosphere. For synchronization at the G1/S boundary, cells were cultured in normal medium for 24 h, serum-starved for 24 h, and then treated with 1 mM hydroxyurea (HU) in complete medium. For synchronization in G0, cells were serum-starved for 48 h, and released from G0 by the addition of serum.

Cell Proliferation and Cell Cycle Analysis—Cells (2 x 105) were seeded in 60-mm dishes in triplicate and synchronized at the G1/S boundary with HU as described above. Upon release by extensive washing, cells were treated with PMA or vehicle for different times. After extensive washing to remove the PMA, complete growth medium was added. Cells were trypsinized at different intervals and counted with a hemocytometer. Proliferation was assayed by [3H]thymidine incorporation. Briefly, 24, 48, or 72 h after PMA treatment cells were pulse-labeled with 3 µCi/ml of [methyl-3H]thymidine (Amersham Biosciences) for 3 h, followed by trichloroacetic acid precipitation and scintillation counting. For determination of cell cycle profile, cells were stained with propidium iodide (0.1 mg/ml) and analyzed by flow cytometry, as previously described (24).

Adenoviral Infections—Cells were infected with replication-deficient adenoviruses (AdV) for either PKC{alpha} or LacZ as a control (23, 25) 4 h (MOI, 100 pfu/cell) in serum-free RPMI 1640 medium. After removal of the AdV by extensive washing, cells were incubated in complete medium for 20 h. Expression of PKC{alpha} was readily detected 24 h after infection and remained stable for several days (data not shown). Amplification of AdVs was carried out in HEK293 cells. Titers of viral stocks were normally higher than 1 x 109 pfu/cell.

Western Blot Analysis—Cells were lysed in a buffer containing 50 mM Tris-HCl, pH 6.8, 10% glycerol, 2% SDS, and 5% β-mercaptoethanol. Cell extracts (20 µg of protein/lane) were subject to SDS-PAGE and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MD). After blocking with 5% milk in 0.1% Tween 20/PBS, membranes were incubated with the primary antibody. The following first antibodies were used: anti-PKC{alpha} and anti-cyclin D1 (Upstate Biotechnology Inc., Lake Placid, NY); anti-cyclin A1, anti-cyclin B1, anti-cyclin E, anti-E2F-1, anti-p27, anti PKC{epsilon} and anti-PCNA (Santa Cruz Biotechnology Inc., Santa Cruz, CA); anti-p21Cip1, anti-ATF-2 and anti-PKC{delta} (Cell Signaling Technology, Beverly, MA); anti-Rb (BD Transduction Laboratories); anti-actin and anti-vinculin (Sigma). Either anti-mouse or anti-rabbit horseradish peroxidase (1:3000, Bio-Rad) were used as secondary antibodies. Bands were visualized by enhanced chemoluminescence.

RT-PCR—Cells were lysed with TRIzol, and total RNA was extracted according to the manufacturer's protocol (Invitrogen). Total RNA (5 µg) from each sample was reverse-transcribed using SuperScriptTM II reverse transcriptase (Invitrogen). cDNA (2 µl) was subject to 20 PCR amplification cycles using the following primers: p21Cip1 forward 5'-GCGATGGAACTTCGACTTTGT and p21Cip1 reverse 5'-GGGCTTCCTCTTGGAGAAGAT; GADPH forward 5'-TGAAGGTCGGAGTCAACGGATTT and GADPH reverse 5'-GATGGGATTTCCATTGATGACAAGC.

RNA Interference (RNAi)—21-bp dsRNAs were purchased from Dharmacon Research, Inc. (Dallas, TX) or Ambion (Austin, TX) and transfected into H358 cells using Oligofectamine (Invitrogen) following the protocol provided by the manufacturer. The following targeting sequences were used: PKC{alpha} (1: AATCCTTGTCCAAGGAGGCTG; 2: GAACAACAAGGAATGACTT), p21Cip1 (1: AACATACTGGCCTGGACTGTT; 2: ATCGTCCAGCGACCTTCCT), and a control unrelated sequence (Silencer® negative control 7 siRNAi, Ambion).

Plasmid Transfections and Promoter Analyses—H358 cells in 12-well plates (5 x 104 cells/well) were transiently transfected with 0.5 µg of a p21Cip1 Firefly luciferase reporter vector (26) using Fugene 6 (Roche Applied Science, Indianapolis, IN). A Renilla luciferase expression vector (50 ng, pRL-TK, Promega, Madison, WI) was co-transfected for normalization of transfection efficiency. After transfection, cells were grown overnight in complete medium, synchronized at the G1/S boundary, and lysed. Cells extracts were subject to luciferase determination using the Dual-Luciferase Reporter Assay System (Promega). Results were expressed as the ratio between Firefly and Renilla luciferase.

Immunofluorescence—Cells were plated on coverslides placed on 35-mm dishes. After synchronization, cells were stimulated with either PMA or vehicle, and at the indicated times washed twice with PBS, fixed for 10 min with methanol, washed three times for 5 min with PBS, and permeabilized for 15 min with 0.25% Triton X-100 in PBS, followed by a 10-min incubation in 100 mM glycine in PBS. After blocking for 30 min with 3% fetal bovine serum in PBS, a mouse anti-p21Cip1 monoclonal antibody (1:250) was added (1 h), followed by washing with 0.1% Tween-20 in PBS, and incubation with a CY3-conjugated anti-mouse antibody (1:1000; Jackson Immunoresearch Laboratories, Inc.) was added. After additional washings, DNA was stained using DAPI (0.1 µg/ml, 10 min). Coverslides were washed three times with PBS, mounted with Vectashield, and visualized with a Nikon Eclipse TE2000 inverted microscope equipped with a q-imaging Exi digital cooled camera (1360 x 1036 pixels, Burnaby, Canada). Recordings were done using Northern Eclipse 6.0 software (Empix Imaging Inc., Cheektowaga, NY). A 40x planar objective (Nikon) was used for all recordings.

Subcellular Fractionation—Cells were washed, collected in ice-cold PBS, and then pelleted and fractionated into cytosolic and nuclear fractions, as described elsewhere (27). Separation of cytosolic and particulate fractions was performed by ultracentrifugation, as described previously (28).

Determination of Senescence-associated β-Galactosidase Activity—Senescence-associated β-Galactosidase (SA-β-Gal) staining was carried out as described by Dimri et al. (29). Briefly, 1 x 105 cells were seeded in 60-mm plates. After synchronization, cells were stimulated with either PMA or vehicle, and 3 days later fixed with 2% formamide/0.2% glutaraldehyde in PBS (10 min, room temperature) and incubated overnight at 37 °C with a solution containing 1 mg/ml 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal), 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 mM NaCl, and 2 mM MgCl2 in 40 mM citric acid/sodium phosphate buffer, pH 6.0. 24 h later the percentage of SA-β-Gal-positive (blue) cells in each sample was determined after scoring 300 cells using a bright-field microscope.

Analysis of Telomerase Activity—Non-isotopic telomerase activity was determined by the telomeric repeat amplification protocol (TRAP) using the TRAPEZE® telomerase detection kit (Chemicon International, Temecula, CA) according to the manufacturer's instructions.

Statistical Analysis—Data are presented as mean ± S.D. and were analyzed using a Student's t test. A p value of <0.05 was considered statistically significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
PMA Causes Irreversible G2/M Arrest in NSCLC Cells—PKC activation with phorbol esters causes a profound inhibition of cell proliferation in lung cancer cells, and our previous work has identified a PKC{delta}-dependent inhibitory mechanism that limits cell progression from G1 into S phase (24). However, when asynchronously growing H358 NSCLC cells were treated for 30 min with the PKC activator PMA (100 nM), a significant accumulation of cells in G2/M was observed, as determined by flow cytometry analysis (Fig. 1A, left panel). At 48 and 72 h the population of G2/M cells in response to PMA treatment doubled relative to vehicle-treated cells. A significant accumulation of cells in G2/M in response to PMA was also observed in H441 and H322 cells (Fig. 1A, right panel). PKC activation by PMA induces apoptosis in several cellular models (1, 5, 23), but no evidence of apoptosis in response to PMA was observed in H358, H441, or H322 cells either by flow cytometry (absence of a sub-G0/G1 cell population) or by microscopy (absence of fragmented nuclei after DAPI staining, data not shown).

To begin dissecting the mechanisms that lead to the accumulation of H358 cells in G2/M, we decided to synchronize cells with hydroxyurea (HU) and analyze the effects of PMA on S -> G2 progression. Approximately 70% of H358 cells were synchronized in late G1 after HU treatment. Upon removal of HU by extensive washing, cells began progressing into S phase at ~2 h, and into G2 phase at ~6 h. HU treatment did not seem to cause significant replicative stress, as judged by the ability of cells to complete the cell cycle (supplemental Fig. S1) and reach confluence, the absence of apoptosis, as well as the possibility of subculturing cells for several passages after HU treatment (data not shown). To analyze the effect of phorbol ester treatment on S -> G2 progression, H358 cells were treated with PMA (100 nM, 30 min) or vehicle 2 h after HU release, and cell cycle distribution was determined at different times. Fig. 1B shows that PMA caused a significant delay in S -> G2 transition. Indeed, while it takes 8 h to reach the maximum % of control cells in G2, this effect is achieved at 11 h in PMA-treated cells. The effect was dependent on the PMA concentration (Fig. 1C, upper panel), as well as the length of incubation, with maximum response at 30 min (Fig. 1C, center panel). The S -> G2 delay was observed only when PMA was added in late G1-early S phase (t = 2-5 h) but not when the phorbol ester was added in late S phase (t = 6 h) (Fig. 1C, lower panel). Notably, despite the short duration of the incubation with PMA, the majority of the cells still remained in G2/M 72 h after treatment (Fig. 1B, right panel). Therefore, the delay in S -> G2 transition was accompanied by an irreversible arrest that prevented cells to complete the cycle and progress into G1. Indeed, treatment of cells synchronized in the G1/S phase boundary (t = 2 h after HU release) with 100 nM PMA (30 min) abolished proliferation, as determined by cell counting (Fig. 1D, left panel). In agreement with this data, PMA treatment of HU-synchronized cells resulted in a marked inhibition of DNA synthesis, as judged by analysis of [3H]thymidine incorporation (Fig. 1D, right panel). Irreversible arrest by PMA was also observed in asynchronous cultures of H358 cells, as determined both by cell counting and [3H]thymidine incorporation (Fig. 1E). Thus, PMA treatment of H358 cells in S phase leads to irreversible accumulation of cells in G2, arguing for multiple points of regulation of the cell cycle by PKC activation.


Figure 1
View larger version (26K):
[in this window]
[in a new window]

  		FIGURE 1.
PMA promotes irreversible G2/M arrest in NSCLC cells. A, asynchronous cultures of cells were treated with 100 nM PMA (+PMA) or vehicle (-PMA) for 30 min. Cells were collected at 24, 48, or 72 h, stained with propidium iodide and analyzed by flow cytometry. Left panel, a representative cell cycle profile for each treatment in H358 cells is shown. Right panel, accumulation of H358, H441, and H322 cells in G2/M in response to PMA; data are presented as mean ± S.D. (n = 3), and represent the percentage of increase of cells in G2/M after PMA treatment relative to vehicle-treated cells. B, H358 cells were synchronized in the G1/S phase boundary with HU, as described under "Experimental Procedures" and released by extensive washing. Cells were treated for 30 min with either vehicle (-PMA) or 100 nM PMA (+PMA) 2 h after HU release (late G1-early S, see supplemental Fig. S1A). Cells were collected at the indicated times and analyzed for cell cycle distribution using flow cytometry. Results are expressed as mean ± S.D. (n = 3). C, HU-synchronized H358 cells were stimulated with PMA at different times after HU release and cell cycle distribution was determined at t = 9 h (late S-early G2). Upper panel, effect of different PMA concentrations, added at t = 2 h for 30 min. Center panel, analysis of different lengths of incubation with PMA (100 nM, added at t = 2 h). Low panel, effect of addition of 100 nM PMA for 30 min at different times after HU release. Results (mean ± S.D., n = 3) are expressed as fold-increase in the number of cells in S phase. D, cells synchronized with HU were released and treated with PMA (100 nM, 30 min) 2 h after release. Left panel, cell number; right panel, [3H]thymidine incorporation. E, asynchronous H358 cells were treated with PMA (100 nM, 30 min) and cell number (left panel) or [3H]thymidine incorporation (right panel) were determined. For all panels, two additional experiments gave similar results.

 


Figure 2
View larger version (40K):
[in this window]
[in a new window]

  		FIGURE 2.
PMA induces senescence in a cell cycle phase-specific manner in NSCLC cells. A, asynchronous or HU-synchronized H358 cells were treated with PMA (100 nM, 30 min, 2 h after HU release for the synchronized cells), and cell morphology was recorded by phase-contrast micrograph 3 and 10 days after treatment. B, HU-synchronized H358 cells were treated with PMA (100 nM, 30 min, added at t = 2 h), and 3 days later telomerase activity was assayed by TRAP, as described under "Experimental Procedures." Three experiments gave similar results. Inactivation by heat of telomerase from cell lysates was included as a negative control. IC, internal control for PCR efficiency. C, induction of SA-β-Gal activity was assessed 3 days after PMA treatment (100 nM, 30 min). Treatment was carried out in asynchronous cultures, 2 h after HU release (late G1/S), or after addition of serum to cells arrested in G0 by 24 h serum starvation (early G1), as in Nakagawa et al. (24). Data are expressed as mean ± S.E. (n = 4-6).

 
PMA Induces Senescence in H358 Cells in a Cell Cycle Phase-specific Manner—Morphological analysis of H358, H441, and H322 cells 72 h after PMA treatment, either in asynchronous or HU-synchronized cultures, showed that a significant number of cells became large and flat, and exhibited enlarged nuclei. These features, together with irreversible growth, are hallmarks of senescence (30). Remarkably, cells remain attached for at least 10 days post-PMA treatment. At that time the phenotypic changes were more pronounced (Fig. 2A), with cells even larger, multinucleated, and with a characteristic vacuolization. We then determined the effect of PMA on telomerase activity, using a telomeric repeat amplification protocol (TRAP). PMA treatment in S phase caused a significant reduction of telomerase activity in H358 cells (Fig. 2B). To further establish the presence of a senescence phenotype, we measured the expression of SA-β-Gal, a well-established marker of senescence (29). Notably, >50% of H358 cells in asynchronous cultures became SA-β-Gal positive after PMA treatment, compared with <10% in response to vehicle. Similarly, a significant fraction of H441 and H322 become SA-β-Gal positive (Fig. 2C). The proportion of SA-β-Gal positive H358 cells was even higher (>75%) when PMA treatment was carried out in HU-synchronized cells. However, when PMA was added to H358 cells synchronized in early G1 phase, there was only a slight increase in the number of β-Gal positive cells. Therefore, the PMA effect is phase specific, as senescence does not occur when PKC activation was triggered in early G1. Altogether, these data strongly suggest that the irreversible G2/M arrest induced by PMA during S phase leads to senescence. The senescence phenotype was also observed in H460 lung cancer cells, as well as in HT-29 and HCT-116 colon cancer cells.5

p21Cip1 Is Required for PMA-induced G2/M Arrest and Senescence Induction—Analysis of relevant cell cycle markers in NSCLC cells upon HU release revealed a marked elevation in the levels of the Cdk inhibitor p21Cip1 in response to PMA, which was sustained even 72 h after treatment (Fig. 3, A and B). p21Cip1 up-regulation is a characteristic feature of senescent cells (31). Additional studies in H358 cells revealed no significant changes in p27 levels. PMA treatment led to a marked reduction in Rb phosphorylation and in the levels of the transcription factor E2F-1. A sustained reduction in the levels of cyclin E, cyclin A, and cyclin B, as well as induction of cyclin D1, were also observed (Fig. 3B). While the levels of p21Cip1 protein did not change significantly across S phase in H358 cells after HU release (Fig. 3C, upper panel, -PMA), a progressive p21Cip1 up-regulation was observed in response to PMA (Fig. 3C, upper panel, +PMA). Similar results were observed at the mRNA level, as determined by RT-PCR (Fig. 3C, lower panel). In addition, PMA treatment of HU-synchronized cells promoted a significant activation of a p21Cip1 luciferase reporter (Fig. 3D). As newly synthesized p21Cip1 protein translocates to the nucleus to exert its inhibitory activity on cyclin-Cdk complexes (32), we carried out a subcellular fractionation analysis. ATF-2 and vinculin were used as controls for the nuclear and cytosolic fractions, respectively. A marked elevation of nuclear p21Cip1 in response to PMA was observed (Fig. 3E). Elevated p21Cip1 levels were also detected in the cytosolic fraction, which probably reflects protein recently synthesized. Likewise, immunofluorescence staining revealed a prominent nuclear p21Cip1 staining in PMA-treated compared with vehicle-treated H358 cells (Fig. 3F).


Figure 3
View larger version (44K):
[in this window]
[in a new window]

  		FIGURE 3.
PMA up-regulates p21Cip1 during S phase in NSCLC cells. HU-synchronized H358, H441, or H322 cells were treated with PMA (100 nM, 30 min) or vehicle, 2 h after HU release (t = 2 h). All experiments were carried out three times with similar results. A, Western blot of p21Cip1 4 h after PMA treatment (t = 6 h post-release). B, Western blot analysis of relevant cell cycle markers 24, 48, or 72 h after treatment in H358 cells. C, analysis of p21Cip1 protein (upper panel) and mRNA (lower panel) levels from 0-6 h after HU release in H358 cells. D, H358 cells were co-transfected with a p21Cip1 Firefly luciferase reporter and pTK-Renilla 24 h prior to synchronization with HU. Firefly luciferase activity was determined at the indicated times after HU release and normalized to Renilla luciferase activity. Results, as arbitrary units (A.U.) are expressed as mean ± S.D. (n = 3). E, H358 cell extracts were collected 4 h after PMA treatment (t = 6 h after HU release) and subject to fractionation as described under "Experimental Procedures." p21Cip1 protein was determined by Western blot in cytosolic and nuclear fractions. ATF-2 and vinculin were used as markers for the nuclear and cytosolic fractions, respectively. F, localization of p21Cip1 by immunofluorescence in H358 cells 4 h after PMA treatment (t = 6 h). Green, p21Cip1; blue, DAPI.

 
To determine whether a causal relationship exists between p21Cip1 up-regulation, G2/M arrest and the senescent phenotype, we used a RNAi approach. Two different RNAi target sequences were used in order to minimize the chances of off-target effects. H358 cells were transfected with either p21Cip1 RNAi or control duplexes, and 24 h later cells were HU-synchronized and treated with either PMA or vehicle. A >90% reduction in the induction of p21Cip1 was achieved with either RNAi duplex (Fig. 4A), which lasted for at least 4 days (data not shown). p21Cip1 depletion did not affect the synchronization protocol (supplemental Fig. S2). Notably, p21Cip1-depleted H358 cells failed to arrest in G2/M in response to PMA (Fig. 4B). Moreover, p21Cip1 RNAi markedly reduced the induction of the senescence marker SA-β-Gal by the phorbol ester (Fig. 4C). Therefore, p21Cip1 up-regulation is required for G2/M arrest and the induction of a senescence phenotype by PMA in H358 cells.

PMA-induced p21Cip1 Up-regulation, G2/M Arrest, and Senescence Are Mediated by PKC{alpha}—H358, H441, and H322 cells express three phorbol ester-responsive PKCs: the classical PKC{alpha}, and the novel PKCs {delta} and {epsilon} (24, and data not shown). While PKC{epsilon} is mostly a mitogenic/survival kinase, growth inhibitory roles have been ascribed to PKC{alpha} and/or PKC{delta} in several cell models. We have previously described that PKC{delta} mediates PMA-induced G1 arrest in H358 cells (24). Expression levels of PKC{alpha}, PKC{delta}, and PKC{epsilon} in H358 cells remained constant across the S phase (supplemental Fig. S3A). To determine the involvement of PKC isozymes in p21Cip1 induction by PMA we first used a pharmacological approach. As we have found that translocation of PKC{alpha}, PKC{delta}, and PKC{epsilon} in response to PMA (a hallmark of PKC activation) remained for the whole S phase (Fig. S3B), PKC inhibitors were added before PMA treatment (-50 min) and left until the end of the S phase. As shown in Fig. 5A, the pan-PKC inhibitor GF109203X (bisindolylmaleimide I) completely blocked p21Cip1 up-regulation by PMA in H358, H441, and H322 cells. Gö6976, a specific inhibitor of cPKCs (33), also blocked p21Cip1 up-regulation. On the other hand, the PKC{delta} inhibitor rottlerin was ineffective or less effective. As PKC{alpha} is the only cPKC present in H358 cells, these experiments suggest that this PKC mediates p21Cip1 induction, and presumably also mediates G2/M arrest. To determine the involvement of PKC{alpha} in mediating the G2/M arrest we used RNAi. Fig. 5B shows that >90% reduction in PKC{alpha} levels was achieved upon delivery of two different specific PKC{alpha} RNAi duplexes into H358 cells, without affecting the expression of other phorbol ester-responsive PKC isozymes (Fig. 5B). In agreement with the results using inhibitors, PKC{alpha} depletion impaired PMA-induced up-regulation of p21Cip1 (Fig. 5C), suggesting a crucial role for this cPKC in mediating p21Cip1 up-regulation in S phase. Moreover, in PKC{alpha}-depleted cells PMA failed to stimulate p21Cip1 reporter luciferase activity (Fig. 5D).


Figure 4
View larger version (13K):
[in this window]
[in a new window]

  		FIGURE 4.
p21Cip1 is required for PMA-induced G2/M arrest and senescence in H358 cells. H358 cells were transfected with two different p21Cip1 duplexes (nos. 1 or 2) or a control RNAi duplex, 24 h before HU-synchronization, and then treated with PMA (100 nM, 30 min, t = 2 h after HU release). A, expression of p21cip1, 4 h after PMA treatment (t = 6 h after HU release). B, accumulation of cells in G2/M in response to PMA; data are presented as mean ± S.D. (n = 3), and represent the percentage of increase of cells in G2/M after PMA treatment relative to vehicle-treated cells. Similar results were observed in four independent experiments. C, determination of SA-β-Gal activity 72 h after PMA treatment. Data are expressed as mean ± S.D. Three additional experiments gave similar results.

 
Because p21Cip1 up-regulation is required for G2/M arrest and senescence induced by PMA, we reasoned that PKC{alpha} is involved in mediating the senescence phenotype. Analysis of cell cycle distribution revealed that PKC{alpha}-depletion impaired PMA-induced G2/M arrest in H358 cells (Fig. 6A). Interestingly, in PKC{alpha}-depleted cells the morphological alterations induced by PMA could not be observed (Fig. 6B). Moreover, the percentage of SA-β-Gal-positive cells as a consequence of PMA stimulation was drastically reduced in H358 cells subject to PKC{alpha} RNAi (Fig. 6C). Furthermore, when PKC{alpha} was knocked down, the inhibitory effect of PMA on telomerase activity was impaired (Fig. 6D).


Figure 5
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 5.
PKC{alpha} mediates PMA-induced p21Cip1 up-regulation in NSCLC cells. A, PKC inhibitors (5 µM) were added 50 min before PMA treatment (100 nM, 30 min, t = 2 h) and left in the medium until t = 6 h. At that time, cell lysates were prepared and subject to Western blot analysis. A representative blot of three independent experiments is shown. B-D, H358 cells were transfected with two different PKC{alpha} duplexes (nos. 1 or 2) or a control RNAi duplex, 24 h before HU-synchronization, and analyzed for PKC isozyme expression (B), or then treated with PMA (100 nM, 30 min, t = 2 h after HU release) and subject to Western blot for p21Cip1 (C) or luciferase reporter analysis (D) at t = 6 h. For the luciferase studies, 24 h after transfection with RNAi duplexes, cells were co-transfected with a p21Cip1 Firefly luciferase reporter and pTK-Renilla. Results represent the ratio between Firefly and Renilla luciferase activity, and are expressed as fold-induction relative to vehicle-treated cells transfected with the control RNAi duplex. Data are expressed as mean ± S.D. (n = 3). Four experiments gave similar results.

 
In the last set of experiments we used an adenoviral approach to overexpress PKC{alpha}. H358 cells were infected with either control LacZ or PKC{alpha} AdVs (24). Cells were synchronized with HU and subject to PMA treatment, as described above. Neither LacZ nor PKC{alpha} overexpression affected the synchronization protocol (supplemental Fig. S4). Interestingly, the induction of p21Cip1 expression by PMA was significantly enhanced in PKC{alpha}-overexpressing H358 cells (Fig. 7A). While overexpression of PKC{alpha} using 100 MOI of PKC{alpha} AdV did not cause significant p21Cip1 up-regulation in the absence of PMA stimulation, higher MOIs (500 pfu/cell) slightly increase the basal levels of p21Cip1 (data not shown). The percentage of cells accumulated in G2/M in response to PMA was higher in PKC{alpha} AdV-infected cells (100 MOI) compared with control cells (Fig. 7B). Lastly, we took advantage of a specific PKC{alpha} agonist, the DAG-lactone HK-434 (34). Treatment of H358 cells with HK-434 induced p21Cip1 levels to a similar extent than PMA (Fig. 7C). Furthermore, HK-434 caused a marked accumulation of cells in G2/M (Fig. 7D), as well as characteristic senescence features, including cell flattening and enlargement (Fig. 7E), and induction of SA-β-Gal activity (Fig. 7F). Taken together, these data strongly suggest that activation of PKC{alpha} by PMA during S phase leads to p21Cip1 up-regulation, irreversible G2/M arrest, and the induction of a senescence phenotype in H358 lung cancer cells.


Figure 6
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 6.
PKC{alpha} RNAi impairs both PMA-induced G2/M arrest and senescence of H358 cells. Cells were transfected with two different PKC{alpha} duplexes (nos. 1 or 2) or a control RNAi duplex. 24 h later cells were synchronized with HU and treated with PMA (100 nM, 30 min) or vehicle 2 h after HU release. A, accumulation of cells in G2/M in response to PMA; data are presented as mean ± S.D. (n = 3), and represent the percentage of increase of cells in G2/M after PMA treatment relative to vehicle-treated cells. B, cell morphology, as determined by phase-contrast microscopy 72 h after PMA (+PMA) or vehicle (-PMA) treatment. C, determination of SA-β-Gal activity 72 h after PMA treatment. Results are expressed as mean ± S.D. (n = 3). D, determination of telomerase activity 72 h after PMA treatment using the TRAP assay, as described under "Experimental Procedures." Inactivation by heat of telomerase from cell lysates was included as a negative control. IC, internal control for PCR efficiency in the TRAP assay. In all cases, at least three independent experiments were carried out, and similar results were obtained.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
A considerable body of evidence supports the notion that the differential proliferative versus antiproliferative effects of phorbol esters is conferred by the distinct ability of PKC isozymes to regulate the cell cycle machinery. This study introduces three novel paradigms. The first is that activation of PKC{alpha} can lead to a senescence phenotype, an effect mediated by the induction of p21Cip1. Second, senescence is strictly dependent upon the phase of the cell cycle in which PKC activation occurs. Third, this is the first study to our knowledge showing that in a defined cellular model phorbol esters trigger cell arrest in different phases of the cell cycle via a common mechanism (p21Cip1 induction) but through distinct PKC isozymes. Our previous studies have shown that phorbol ester treatment of lung cancer cells in early G1 impairs their progression into S phase. This G1 arrest is mediated by PKC{delta} (24). In contrast, when cells are treated with PMA in late G1 or S phases, they undergo permanent arrest in G2/M accompanied by senescence, and in this case the effect is mediated by PKC{alpha} rather than PKC{delta}. Despite the differential involvement of PKC isozymes, both effects occur via the up-regulation of the cell cycle inhibitor p21Cip1. These cell cycle phase-specific effects not only attest to the functional complexity of PKC isozymes, but also suggest that PKC regulation of cell cycle via p21Cip1 involves multiple mechanisms.

While phorbol esters are mitogenic in some cellular models (35, 36), they can also inhibit proliferation or promote apoptosis in a large number of cell types. Dual G0/G1 and G2/M arrest by phorbol esters has been reported in endothelial (13), breast cancer (37) and melanoma cells (38). PKC{alpha} was shown to play negatives roles in G1 -> S transition as well as in G2 -> M transition (4, 5, 38, 39). However, there has been little information on the role of PKC activation in S phase. It has been reported that in G1/S-synchronized Demel and MCF-7 cells, phorbol ester stimulation induces a transitory G2 arrest (37, 38). This fits well with our observations that in H358 lung cancer cells PKC activation in late G1 or early S phases causes a significant delay in S -> G2 transition. In addition to this effect, our data provide strong evidence that PMA activation promotes irreversible G2/M arrest and inhibition of proliferation by inducing cellular senescence. The cellular senescent phenotype is defined by the appearance of characteristic morphological changes and biochemical markers, including the induction of SA-β-Gal activity and p21cip1, and inhibition of telomerase activity, leading ultimately to irreversible proliferation arrest. Cellular senescence has been originally described in primary cells as a consequence of telomere shortening (40). However, senescence can be also triggered by a variety of signals such as DNA damage, loss of tumor suppressors, and oncogenic hyperproliferative signals (30). The fact that PMA triggers cellular senescence in lung cancer cells argues for the existence of senescence mechanisms dependent on PKC. In support of our data, a very recent study has shown that long-term (24 h) treatment with the diterpene ester PEP005 induces irreversible cell cycle arrest in G1 and G2/M phases and senescence in melanoma cells via PKC (41). However, long-term PKC activation leads to PKC down-regulation, and therefore it is unclear from that study whether PKC activation or PKC depletion was responsible for the phenotype in melanoma cells, as well as which PKC isozymes were responsible for the effect. In our studies in H358 cells, a short incubation with PMA is capable of inducing senescence, suggesting that PKC{alpha} activation rather than down-regulation is triggering a senescence program. Indeed, we do not detect PKC down-regulation as a consequence of the PMA treatment (supplemental Fig. S3B). Interestingly, H358 lung cancer cells go into senescence when treated with PMA in late G1-S, but only a small percentage of cells undergo a senescence phenotype when treated with PMA in early G1. This small fraction of senescent cells may arise from cells in late G1 present as a consequence of incomplete G0 synchronization by serum starvation (24). Altogether, these results argue that the senescent population originates from cells arrested in G2/M.


Figure 7
View larger version (14K):
[in this window]
[in a new window]

  		FIGURE 7.
PKC{alpha} selective activation during S phase induces p21Cip1 up-regulation, G2/M arrest and senescence. A and B, H358 cells were infected with either PKC{alpha} or LacZ (control) AdVs (MOI = 100 pfu/cell) and 24 h later synchronized with HU. 2 h after HU release, cells were treated with PMA (100 nM, 30 min). 24 h after PMA treatment, cells were subject to Western blot (A) or flow cytometry analysis (B). Data are expressed as mean ± S.D. (n = 3). *, p < 0.05. Three additional experiments gave similar results. C-F, HU-synchronized H358 cells were stimulated with the DAG-lactone HK-434 (10 µM, 30 min), PMA (100 nM, 30 min), or vehicle, 2 h after HU release. C, p21Cip1 expression was assessed by Western blot at t = 6 h. D, cell cycle analysis was performed 24 h after treatment. E, cell morphology 3 days after treatment. F, determination of SA-β-Gal activity 3 days after treatment; data are expressed as mean ± S.D. Three additional experiments gave similar results.

 
Although the molecular mechanisms underlying the induction of senescence by PKC{alpha} still require investigation, our studies unambiguously show the involvement of the cell cycle inhibitor p21Cip1. PMA promotes a robust elevation in p21Cip1 mRNA and protein levels during S phase. Furthermore, p21Cip1 up-regulation represents an obligated event, as p21Cip1 RNAi significantly impaired the induction of G2/M arrest and senescence by the phorbol ester. PKC{alpha} RNAi depletion inhibited the induction of p21Cip1 by PMA, both at the level of mRNA (data not shown) and protein, and consequently blocked the induction of G2/M arrest and senescence by PMA, thus providing strong evidence for a PKC{alpha}-p21Cip1-G2 arrest-senescence link. The unique phenotypes observed in response to PKC activation at different cell cycle phases probably reflect distinct roles for p21Cip1 in G1 and G2. Indeed, while p21Cip1 is an inhibitor of G1 cyclin-Cdk complexes, it also inhibits the activation of Cdc2 in G2 (42, 43). PKC{alpha} was shown to play a role in G1/S arrest via p21 induction and to mediate cell cycle exit and a differentiation program in intestinal cells (4), suggesting that this cPKC can exert multiple effects depending on the cell type. p21Cip1 mRNA stability can be regulated by diverse factors such as the RNA-binding proteins HuR and CP1 (44). A very recent study showed that PKC{alpha} modulates HuR nuclear-cytosolic shuttling, thus favoring mRNA stabilization (45). One attractive hypothesis is that the specific PKC{alpha}-mediated p21Cip1 up-regulation in late G1/S phase could be mediated by HuR-dependent p21Cip1 mRNA stabilization. However, preliminary studies have not revealed any noticeable changes in HuR total levels or relocalization during G1, S, or G2, either in response to PMA treatment or after PKC{alpha} overexpression (data not shown). Further studies would be required to address the mechanistic basis of the differential regulation of p21Cip1 by PKCs.

Which of the major senescence pathway(s) play a role in PMA-induced senescence? Most senescence responses converge on either p53 (involving DNA damage) and/or pRB (mostly through stress or oncogene activation of p16) (30). It is well established that DNA lesions can trigger a checkpoint, which delays cell cycle progression and activate DNA-repair mechanisms (reviewed in Ref. 46). Preliminary data show no detectable Chk-1 or histone H2A.X phosphorylation during S-phase in response to PMA (data not shown), suggesting the absence of checkpoint activation by PKC{alpha}. It has been postulated that G2 arrest via p21Cip1 induction may involve the suppression of cdk2/cyclin A and cdc2/cyclin B activities, changes in cdc2 phosphorylation status, and inhibition of cdc25 expression (4). PKC activation can inhibit Cdc2 and entry into mitosis by reducing the activity of Cdc25 phosphatases (which dephosphorylate and activate Cdc2), a mechanism that bypasses Chk1 (38). H358 cells do not express p16 (47), suggesting that senescence is independent of this cell cycle inhibitor. Also, the cell lines used in this study are p53-null or mutant (48, 49), arguing for a p53-independent mechanism in the induction of p21Cip1 by PKC{alpha}. Recent studies have implicated ERK activation as a mediator of p53-independent p21Cip1 induction and G2/M arrest in response to PMA (50). p21Cip1 up-regulation in HeLa and SKOV-3 cells in response to growth factors, oxidative stress, or PMA is dependent upon the ERK MAPK cascade (10, 51, 52). Regulation of p21Cip1 via ERK may involve transcriptional or post-transcriptional mechanisms that extend p21Cip1 half-life (26, 53). Pharmacological inhibition of MEK blocks the senescence phenotype triggered by the diterpene PEP005 in melanoma cells (41). We have observed a strong and sustained activation of ERK in H358 cells upon PMA stimulation that preceded p21Cip1 up-regulation in S phase, and we found that MEK inhibition markedly reduced p21Cip1 mRNA and protein up-regulation (data not shown), suggesting that a similar mechanism might take place in lung cancer cells.

NSCLC cells are very resistant to conventional anti-cancer treatment. Induction of cellular senescence has been proposed as a strategy for cancer therapy (reviewed in Ref. 54). Studies in breast cancer have shown that induction of senescence following adjuvant therapy correlates with favorable outcome (55). One attractive scenario is that targeting PKC{alpha} in NSCLC with specific activators may promote senescence in tumor cells. Our studies strongly suggest that activation rather than inhibition of PKC{alpha} function/expression may serve for therapeutic purposes, and may help to explain the failure of PKC{alpha} antisense approaches for NSCLC treatment (20). Indeed, PKC agonists have been examined as antitumor agents in vivo. Bryostatin 1, a potent PKC activator that induces only a subset of those responses induced by PMA, has been in clinical trials for a number of malignancies, including lung cancer (1, 17). Moreover, PMA has been administered to patients for the treatment of hematological malignancies (15-17). DAG lactones that selectively activate PKC{alpha} have anti-proliferative activity not only in lung cancer cells but also in other cancer cell lines (34). The fact that senescence induction in normal cells may facilitate tumor progression (56) argues for the need of additional studies to better assess the validity of PKC{alpha} or downstream effectors as a therapeutic targets.

In summary, our studies established that activation of PKC{alpha} in lung cancer cells during late G1-early S phase leads to cellular senescence, an effect that involves p21Cip1 up-regulation and irreversible inhibition of cell proliferation. In addition, our results revealed important differences with regards to the role of individual PKC isozymes in different phases of the cell cycle. In our previous study we demonstrated that PMA-induced activation of PKC{delta} in early-mid G1 inhibits H358 cell progression into S phase, inducing cell accumulation in G1 (24), whereas PKC{alpha} was dispensable for this effect. The unique growth inhibitory effect of PKC isozymes in specific phases of the cell cycle opens a window of opportunity for targeting individual PKCs for therapeutic purposes.


   FOOTNOTES
 
* This work was supported by Grants CA-89202 and CA-92537 from the National Institutes of Health (to M. G. K.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1-S4. Back

1 Both authors contributed equally to this work. Back

2 To whom correspondence may be addressed: Unidad de Biología Celular, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Carretera Majadahonda-Pozuelo, Km. 2 Majadahonda-28220 Madrid, Spain. E-mail: jloliva{at}isciii.es. 3 To whom correspondence may be addressed: Dept. of Pharmacology, University of Pennsylvania School of Medicine, 816 Biomedical Research Bldg. II/III, 421 Curie Blvd., Philadelphia, PA 19104-6160. E-mail: marcelo{at}spirit.gcrc.upenn.edu.

4 The abbreviations used are: PKC, protein kinase C; DAPI, 4',6-diamidino-2-phenylindole; NSCLC, non-small cell lung cancer; PBS, phosphate-buffered saline; PMA, phorbol 12-myristate 13-acetate; HU, hydroxyurea; MOI, multiplicity of infection; SA-β-Gal, senescence-associated β-galactosidase. Back

5 M. C. Caino, J. L. Oliva, and M. G. Kazanietz, data not shown. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Victor E. Marquez (Center for Cancer Research, NCI-Frederick), for providing the DAG-lactone HK-434 and Dr. Steven Albelda (University of Pennsylvania) for providing H322 cells.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Griner, E. M., and Kazanietz, M. G. (2007) Nat. Rev. Cancer 7, 281-294[CrossRef][Medline] [Order article via Infotrieve]
  2. Newton, A. C. (2001) Chem. Rev. 101, 2353-2364[CrossRef][Medline] [Order article via Infotrieve]
  3. Fishman, D. D., Segal, S., and Livneh, E. (1998) Int. J. Oncol. 12, 181-186[Medline] [Order article via Infotrieve]
  4. Black, J. D. (2000) Front Biosci. 5, D406-D423[Medline] [Order article via Infotrieve]
  5. Gavrielides, M. V., Frijhoff, A. F., Conti, C. J., and Kazanietz, M. G. (2004) Curr. Drug Targets 5, 431-443[CrossRef][Medline] [Order article via Infotrieve]
  6. Zhou, W., Takuwa, N., Kumada, M., and Takuwa, Y. (1993) J. Biol. Chem. 268, 23041-23048[Abstract/Free Full Text]
  7. Soh, J. W., and Weinstein, I. B. (2003) J. Biol. Chem. 278, 34709-34716[Abstract/Free Full Text]
  8. Ohba, M., Ishino, K., Kashiwagi, M., Kawabe, S., Chida, K., Huh, N. H., and Kuroki, T. (1998) Mol. Cell. Biol. 18, 5199-5207[Abstract/Free Full Text]
  9. Kashiwagi, M., Ohba, M., Watanabe, H., Ishino, K., Kasahara, K., Sanai, Y., Taya, Y., and Kuroki, T. (2000) Oncogene 19, 6334-6341[CrossRef][Medline] [Order article via Infotrieve]
  10. Akashi, M., Osawa, Y., Koeffler, H. P., and Hachiya, M. (1999) Biochem. J. 337, 607-616[CrossRef][Medline] [Order article via Infotrieve]
  11. Zeng, Y. X., and el-Deiry, W. S. (1996) Oncogene 12, 1557-1564[Medline] [Order article via Infotrieve]
  12. Thompson, L. J., and Fields, A. P. (1996) J. Biol. Chem. 271, 15045-15053[Abstract/Free Full Text]
  13. Kosaka, C., Sasaguri, T., Ishida, A., and Ogata, J. (1996) Am. J. Physiol. 270, C170-C178[Medline] [Order article via Infotrieve]
  14. Mackay, H. J., and Twelves, C. J. (2007) Nat. Rev. Cancer 7, 554-562[CrossRef][Medline] [Order article via Infotrieve]
  15. Strair, R. K., Schaar, D., Goodell, L., Aisner, J., Chin, K. V., Eid, J., Senzon, R., Cui, X. X., Han, Z. T., Knox, B., Rabson, A. B., Chang, R., and Conney, A. (2002) Clin. Cancer Res. 8, 2512-2518[Abstract/Free Full Text]
  16. Han, Z. T., Tong, Y. K., He, L. M., Zhang, Y., Sun, J. Z., Wang, T. Y., Zhang, H., Cui, Y. L., Newmark, H. L., Conney, A. H., and Chang, R. L. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 5362-5365[Abstract/Free Full Text]
  17. Barry, O. P., and Kazanietz, M. G. (2001) Curr. Pharm. Des. 7, 1725-1744[CrossRef][Medline] [Order article via Infotrieve]
  18. Schiller, J. H. (2001) Oncology 61, Suppl. 1, 3-13[CrossRef][Medline] [Order article via Infotrieve]
  19. Fong, K. M., Sekido, Y., Gazdar, A. F., and Minna, J. D. (2003) Thorax 58, 892-900[Abstract/Free Full Text]
  20. Paz-Ares, L., Douillard, J. Y., Koralewski, P., Manegold, C., Smit, E. F., Reyes, J. M., Chang, G. C., John, W. J., Peterson, P. M., Obasaju, C. K., Lahn, M., and Gandara, D. R. (2006) J. Clin. Oncol. 24, 1428-1434[Abstract/Free Full Text]
  21. Wen-Sheng, W. (2006) Cancer Lett. 239, 27-35[CrossRef][Medline] [Order article via Infotrieve]
  22. Russo, M., Palumbo, R., Mupo, A., Tosto, M., Iacomino, G., Scognamiglio, A., Tedesco, I., Galano, G., and Russo, G. L. (2003) Oncogene 22, 3330-3342[CrossRef][Medline] [Order article via Infotrieve]
  23. Garcia-Bermejo, M. L., Leskow, F. C., Fujii, T., Wang, Q., Blumberg, P. M., Ohba, M., Kuroki, T., Han, K. C., Lee, J., Marquez, V. E., and Kazanietz, M. G. (2002) J. Biol. Chem. 277, 645-655[Abstract/Free Full Text]
  24. Nakagawa, M., Oliva, J. L., Kothapalli, D., Fournier, A., Assoian, R. K., and Kazanietz, M. G. (2005) J. Biol. Chem. 280, 33926-33934[Abstract/Free Full Text]
  25. Fujii, T., Garcia-Bermejo, M. L., Bernabo, J. L., Caamano, J., Ohba, M., Kuroki, T., Li, L., Yuspa, S. H., and Kazanietz, M. G. (2000) J. Biol. Chem. 275, 7574-7582[Abstract/Free Full Text]
  26. Facchinetti, M. M., De Siervi, A., Toskos, D., and Senderowicz, A. M. (2004) Cancer Res. 64, 3629-3637[Abstract/Free Full Text]
  27. Zhou, B. P., Liao, Y., Xia, W., Spohn, B., Lee, M. H., and Hung, M. C. (2001) Nat. Cell Biol. 3, 245-252[CrossRef][Medline] [Order article via Infotrieve]
  28. Caloca, M. J., Fernandez, N., Lewin, N. E., Ching, D., Modali, R., Blumberg, P. M., and Kazanietz, M. G. (1997) J. Biol. Chem. 272, 26488-26496[Abstract/Free Full Text]
  29. Dimri, G. P., Lee, X., Basile, G., Acosta, M., Scott, G., Roskelley, C., Medrano, E. E., Linskens, M., Rubelj, I., Pereira-Smith, O., Peacocke, M., and Campisi, J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 9363-9367[Abstract/Free Full Text]
  30. Campisi, J. (2005) Cell 120, 513-522[CrossRef][Medline] [Order article via Infotrieve]
  31. Noda, A., Ning, Y., Venable, S. F., Pereira-Smith, O. M., and Smith, J. R. (1994) Exp. Cell Res. 211, 90-98[CrossRef][Medline] [Order article via Infotrieve]
  32. Sherr, C. J., and Roberts, J. M. (1995) Genes Dev. 9, 1149-1163[Free Full Text]
  33. Martiny-Baron, G., Kazanietz, M. G., Mischak, H., Blumberg, P. M., Kochs, G., Hug, H., Marme, D., and Schachtele, C. (1993) J. Biol. Chem. 268, 9194-9197[Abstract/Free Full Text]
  34. Marquez, V. E., and Blumberg, P. M. (2003) Acc. Chem. Res. 36, 434-443[CrossRef][Medline] [Order article via Infotrieve]
  35. Lacal, J. C., Fleming, T. P., Warren, B. S., Blumberg, P. M., and Aaronson, S. A. (1987) Mol. Cell. Biol. 7, 4146-4149[Abstract/Free Full Text]
  36. Hsiao, W. L., Housey, G. M., Johnson, M. D., and Weinstein, I. B. (1989) Mol. Cell. Biol. 9, 2641-2647[Abstract/Free Full Text]
  37. Barboule, N., Lafon, C., Chadebech, P., Vidal, S., and Valette, A. (1999) FEBS Lett. 444, 32-37[CrossRef][Medline] [Order article via Infotrieve]
  38. Arita, Y., Buffolino, P., and Coppock, D. L. (1998) Exp. Cell Res. 242, 381-390[CrossRef][Medline] [Order article via Infotrieve]
  39. Frey, M. R., Saxon, M. L., Zhao, X., Rollins, A., Evans, S. S., and Black, J. D. (1997) J. Biol. Chem. 272, 9424-9435[Abstract/Free Full Text]
  40. Harley, C. B., Futcher, A. B., and Greider, C. W. (1990) Nature 345, 458-460[CrossRef][Medline] [Order article via Infotrieve]
  41. Cozzi, S. J., Parsons, P. G., Ogbourne, S. M., Pedley, J., and Boyle, G. M. (2006) Cancer Res. 66, 10083-10091[Abstract/Free Full Text]
  42. Niculescu, A. B., 3rd, Chen, X., Smeets, M., Hengst, L., Prives, C., and Reed, S. I. (1998) Mol. Cell. Biol. 18, 629-643[Abstract/Free Full Text]
  43. Guadagno, T. M., and Newport, J. W. (1996) Cell 84, 73-82[CrossRef][Medline] [Order article via Infotrieve]
  44. Giles, K. M., Daly, J. M., Beveridge, D. J., Thomson, A. M., Voon, D. C., Furneaux, H. M., Jazayeri, J. A., and Leedman, P. J. (2003) J. Biol. Chem. 278, 2937-2946[Abstract/Free Full Text]
  45. Doller, A., Huwiler, A., Muller, R., Radeke, H. H., Pfeilschifter, J., and Eberhardt, W. (2007) Mol. Biol. Cell 18, 2137-2148[Abstract/Free Full Text]
  46. Zhou, B. B., and Elledge, S. J. (2000) Nature 408, 433-439[CrossRef][Medline] [Order article via Infotrieve]
  47. Khan, Q. A., and Anderson, L. M. (2001) Toxicol. Appl. Pharmacol. 173, 105-113[CrossRef][Medline] [Order article via Infotrieve]
  48. Zou, Y., Zong, G., Ling, Y. H., Hao, M. M., Lozano, G., Hong, W. K., and Perez-Soler, R. (1998) J. Natl. Cancer Inst. 90, 1130-1137[Abstract/Free Full Text]
  49. Deng, W. G., Kawashima, H., Wu, G., Jayachandran, G., Xu, K., Minna, J. D., Roth, J. A., and Ji, L. (2007) Cancer Res. 67, 709-717[Abstract/Free Full Text]
  50. Dangi, S., Chen, F. M., and Shapiro, P. (2006) Cell Prolif. 39, 261-279[CrossRef][Medline] [Order article via Infotrieve]
  51. Esposito, F., Cuccovillo, F., Vanoni, M., Cimino, F., Anderson, C. W., Appella, E., and Russo, T. (1997) Eur. J. Biochem. 245, 730-737[Medline] [Order article via Infotrieve]
  52. Liu, Y., Martindale, J. L., Gorospe, M., and Holbrook, N. J. (1996) Cancer Res. 56, 31-35[Abstract/Free Full Text]
  53. Ostrovsky, O., and Bengal, E. (2003) J. Biol. Chem. 278, 21221-21231[Abstract/Free Full Text]
  54. Roninson, I. B. (2003) Cancer Res. 63, 2705-2715[Abstract/Free Full Text]
  55. te Poele, R. H., Okorokov, A. L., Jardine, L., Cummings, J., and Joel, S. P. (2002) Cancer Res. 62, 1876-1883[Abstract/Free Full Text]
  56. Krtolica, A., Parrinello, S., Lockett, S., Desprez, P. Y., and Campisi, J. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 12072-12077[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Cancer Res.Home page
L. Jia, M. S. Soengas, and Y. Sun
ROC1/RBX1 E3 Ubiquitin Ligase Silencing Suppresses Tumor Cell Growth via Sequential Induction of G2-M Arrest, Apoptosis, and Senescence
Cancer Res., June 15, 2009; 69(12): 4974 - 4982.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. S. Kim and I. K. Lim
Phosphorylated Extracellular Signal-regulated Protein Kinases 1 and 2 Phosphorylate Sp1 on Serine 59 and Regulate Cellular Senescence via Transcription of p21Sdi1/Cip1/Waf1
J. Biol. Chem., June 5, 2009; 284(23): 15475 - 15486.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
283/9/5466    most recent
M707576200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oliva, J. L.
Right arrow Articles by Kazanietz, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oliva, J. L.
Right arrow Articles by Kazanietz, M. G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2008 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement