Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M709410200 on December 13, 2007

J. Biol. Chem., Vol. 283, Issue 9, 5899-5907, February 29, 2008
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
283/9/5899    most recent
M709410200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by 't Hoen, P. A. C.
Right arrow Articles by den Dunnen, J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by 't Hoen, P. A. C.
Right arrow Articles by den Dunnen, J. T.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Generation and Characterization of Transgenic Mice with the Full-length Human DMD Gene*Formula

Peter A. C. 't Hoen{ddagger}1, Emile J. de Meijer{ddagger}, Judith M. Boer{ddagger}, Rolf H. A. M. Vossen{ddagger}, Rolf Turk{ddagger}, Ronald G. H. J. Maatman{ddagger}, Kay E. Davies§, Gert-Jan B. van Ommen{ddagger}, Judith C. T. van Deutekom{ddagger}, and Johan T. den Dunnen{ddagger}

From the {ddagger}Center for Human and Clinical Genetics, Leiden University Medical Center, Postal Zone S4-P, P.O. Box 9600, 2300 RC Leiden, The Netherlands and the §Department of Physiology, Anatomy, and Genetics, Medical Research Council Functional Genetics Unit, Oxford, OX1 3QX United Kingdom

Received for publication, November 15, 2007


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We report the generation of mice with an intact and functional copy of the 2.3-megabase human dystrophin gene (hDMD), the largest functional stretch of human DNA thus far integrated into a mouse chromosome. Yeast spheroplasts containing an artificial chromosome with the full-length hDMD gene were fused with mouse embryonic stem cells and were subsequently injected into mouse blastocysts to produce transgenic hDMD mice. Human-specific PCR, Southern blotting, and fluorescent in situ hybridization techniques demonstrated the intactness and stable chromosomal integration of the hDMD gene on mouse chromosome 5. Expression of the transgene was confirmed by RT-PCR and Western blotting. The tissue-specific expression pattern of the different DMD transcripts was maintained. However, the human Dp427p and Dp427m transcripts were expressed at 2-fold higher levels and human Dp427c and Dp260 transcripts were expressed at 2- and 4-fold lower levels than their endogenous counterparts. Ultimate functional proof of the hDMD transgene was obtained by crossing of hDMD mice with dystrophin-deficient mdx mice and dystrophin and utrophin-deficient mdx x Utrn-/- mice. The hDMD transgene rescued the lethal dystrophic phenotype of the mdx x Utrn-/- mice. All signs of muscular dystrophy disappeared in the rescued mice, as demonstrated by histological staining of muscle sections and gene expression profiling experiments. Currently, hDMD mice are extensively used for preclinical testing of sequence-specific therapeutics for the treatment of Duchenne muscular dystrophy. In addition, the hDMD mouse can be used to study the influence of the genomic context on deletion and recombination frequencies, genome stability, and gene expression regulation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The dystrophin gene (DMD) is the largest gene identified in the human genome. It is located on the X chromosome (band Xp21.2), spans 2.3 Mb,2 and contains 79 exons (1-3). Transcripts originating from seven different promoters throughout the gene have been described, whereas, in addition, extensive differential splicing of these transcripts has been acknowledged (details can be found on the Leiden Muscular Dystrophy Web pages). The Dp427m transcript is most prominent in skeletal and cardiac muscle. This transcript gives rise to the production of the 427-kDa muscle isoform of the dystrophin protein (4). In muscle, dystrophin is localized on the cytoplasmic side of the sarcolemma (5). Together with the dystroglycan transmembrane protein complex, it forms the dystrophin-glycoprotein complex, which links the cytoskeletal actin filaments and the extracellular matrix and is essential for the force transduction in the muscle fiber (6). The dystrophin protein consists of an N-terminal domain that interacts with actin, a central rod and cysteine-rich domain, and a C-terminal domain that binds to β-dystroglycan. More recently, dystrophin has been implicated in signal transduction, probably via interactions with syntrophin, calmodulin, and nitric-oxide synthase (7). The dystrophin protein is highly conserved in vertebrates. Mouse dystrophin has 91% amino acid identity with its human counterpart. Utrophin is a homologue of dystrophin that is mainly functional at the neuromuscular junction (8). It can substitute for dystrophin in the dystrophin-glycoprotein complex (9, 10).

Mutations in the dystrophin gene are responsible for Duchenne/Becker Muscular Dystrophy and X-linked dilated cardiomyopathy (11). Mutations that disrupt the reading frame of the DMD transcript cause Duchenne muscular dystrophy (DMD), a severe form of muscular dystrophy with an incidence of 1 in 3,500. It is characterized by progressive muscle weakness and premature death from cardiac or respiratory failure. Inframe deletions are responsible for the milder Becker muscular dystrophy. The mdx mouse is a genetically homologous mouse model for DMD with a mutation in exon 23 of the Dmd gene. Although genotypically similar, major phenotypic differences exist between the mdx mouse model and human DMD patients. Mdx mice show very effective muscle regeneration, leading to an almost complete recovery from the muscle wasting in early life (12, 13). Crossing of mdx mice with utrophin-deficient mice gives a much more severe phenotype, which is more similar to DMD (14, 15). These mdx x Utrn-/- mice suffer from extreme muscle weakness and die within 20 weeks.

A therapy for DMD is currently not available. Among the most prominent therapeutic approaches that are tested in preclinical and clinical studies is reading frame correction by antisense oligonucleotide (AON)-induced modulation of splicing (16-23). Since AONs are sequence-specific, human-specific AONs cannot be readily tested in animal models. This was one of our rationales behind the generation of the hDMD mouse. Indeed, we demonstrated in an earlier report the use of hDMD transgenic mice for evaluation of the effectiveness of exon-skipping antisense oligonucleotides (24). Here we report the characterization of the hDMD transgenic mice and demonstrate the full functionality of the hDMD transgene. Apart from its usefulness in the preclinical evaluation of sequence-specific therapeutics, we discuss important future applications of this mouse model in more basic genetic studies.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Generation of hDMD Transgenic Mice—Generation of a yeast artificial chromosome (YAC) with the full-length human DMD gene and fusions of murine embryonic stem (ES) cells, isolated from F1 mice from a DBA2 x 129OLA cross, with yeast spheroplasts containing the DMD-YAC have been described elsewhere (25, 26). Following expansion, clones were validated by Southern blot, PCR, fluorescence in situ hybridization (FISH), and RT-PCR and Western blot analysis, using human-specific DMD probes, primers, and antibodies. Clones showing intactness, stable genomic integration, and expression of the hDMD gene were injected into C57BL/6J blastocysts that were subsequently implanted in pseudopregnant recipients. From the resulting chimeric offspring, mice with highest levels of ES cell contribution were selected and crossed to C57BL/6J females. Germ line transmission of the hDMD allele was determined by DNA genotyping following PCR using human-specific DMD primers. Through further breeding, hemizygous and homozygous transgenic hDMD mice were obtained that were analyzed for proper expression of the human dystrophin gene. The construction of these mice was authorized by the Dutch Ministry of Agriculture and described in Project VVA/BD01.284 (E21).

Mice—hDMD mice that were back-crossed with C57Bl/6J (Charles River Laboratories (Maastricht, The Netherlands)) for three generations were used for all experiments except for the gene expression profiling, where hDMD mice from earlier crossings with a more heterogeneous C57BL/6 x DBA2 x 129OLA background were used. C57BL/10ScSn-DMDmdx/J mdx mice were obtained from Jackson Laboratories (Bar Harbor, ME). Utrn-/- and Utrn-/- x mdx mice were described earlier (14). In gene expression profiling experiments, male mice with a mixed C57BL/10 x DBA2 x 129OLA background, aged 7 weeks, were used as wild-type controls to match the genetic background of the mdx and hDMD mice as closely as possible. Mice were housed under standard conditions and were fed regular chow.

Combined Binary Ratio (COBRA) Analysis—COBRA-FISH analysis was performed on metaphase chromosomes of tail skin fibroblasts from hDMDTg/Tg mice. The detailed protocol is described in Ref. 27. Briefly, probe sets were prepared by labeling of degenerate oligonucleotide-primed PCR-amplified individual chromosomes, isolated by flow sorting, with a specific combination of 1-4 fluorescent dyes (diethyl aminomethyl coumarin, Cy3, Cy5, and rhodamine green) (27). The color combinations enable unequivocal identification of the chromosome identity. Probes used for detection of the hDMD gene were derived from cosmids MA2B4 (L. Blonden) and RP5-1174H9 (Sanger) encompassing exons 3-7 and exons 65-72, respectively. MA2B4 was labeled with biotin, which was detected by incubation with streptavidin LaserPro IR 790 (1:200; Molecular Probes, Inc.), followed by biotin-labeled goat anti-streptavidin (1:500; Vector Laboratories), followed by streptavidin LaserPro IR 790 (1:500; Molecular Probes). RP5-1174H9 was labeled with digitonin, which was detected by incubation with mouse anti-digitonin (1:500; Sigma), followed by rabbit anti-mouse (1:100; Sigma) and goat anti-rabbit Alexa430 (1:500; Molecular Probes).

Pyrosequencing—DNA was isolated from mouse tail segments by overnight incubation at 55 °C with 245 µl of lysis solution (50 mM Tris·HCl, pH 8.9, including 0.45% IGEPAL and 100 µg of proteinase K). After proteinase K inactivation for 10 min at 95 °C, 1 µl of the solution was used for PCR amplification (32 cycles of 30 s of 94 °C denaturation, 30 s of 54 °C annealing, and 1 min of 72 °C extension) with unmodified exon 75 forward primer (GAATCTGCAAGCAGAATATG) and 5'-biotinylated exon 75 reverse primer (GACTCCAGCTGTTTATTGTG). The biotinylated PCR product (2.5-5 pmol) was incubated with 10 µl of streptavidin-coated Dynabeads (10 mg/ml; Dynal, Oslo, Norway) in BW buffer (5 mM Tris·HCl, pH 7.6, 1 M NaCl, 0.5 mM EDTA, 0.05% Tween 20) for 15 min at 65 °C. The immobilized PCR product was further processed with the SNP reagent kit (Pyrosequencing, Uppsala, Sweden). In brief, the beads were transferred to a Luc96 plate containing 50 µl of 0.5 M NaOH per well and agitated for 1 min to allow for strand separation. Then the beads were transferred to a plate containing 100 µl of annealing buffer (20 mM Tris acetate, pH 7.6, 5 mM magnesium acetate) per well and washed for 1 min by releasing and capturing the beads. Subsequently, the beads were transferred to a plate containing 40 µl of annealing buffer and 20 pmol of sequencing primer (TGCTGAGCTCATTGCTG) per well. Samples were denatured for 1 min at 95 °C, cooled to room temperature, and put into the holder of the apparatus. The reagent cassette was filled, and the sequencing reactions were performed according to the manufacturer's protocol.

RNA Isolation and RT-PCR Analysis—RNA isolations and RT-PCRs were performed as described earlier (24, 28). Quantitative PCR assays were run on the Lightcycler480 using SYBR-green as the detection method. To determine PCR efficiencies, a calibration curve was constructed by serial dilution of a cDNA pool from all of the samples. Glyceraldehyde-3-phosphate dehydrogenase and β-actin were used as housekeeping genes. For quantification of the different dystrophin transcripts, human- and mouse-specific primers were designed in homologous regions, where the forward primer was chosen in the promoter specific for the studied transcript and the reverse primer in a downstream exon. Primer sequences are given in the supplemental materials. To correct for differences in input between hDMD and wild-type samples, Ct values were corrected per tissue for the differences in housekeeping gene expression. Then the abundance was calculated relative to the expression of the murine transcript in a reference tissue (see the legend to Fig. 4) in the wild-type mice, using the formula, E = (1 + efficiency)Ct - Ct,ref.


Figure 1
View larger version (27K):
[in this window]
[in a new window]

  		FIGURE 1.
COBRA analysis of chromosomal integration of hDMD gene. Chromosomal integration of the hDMD transgene was demonstrated by COBRA analysis on metaphase chromosomes from cultured skin fibroblasts derived from hDMDTg/Tg mice. The presence of the hDMD gene (arrows) was detected with fluorescently labeled cosmid probes, spanning exons 3-7 (a) and exons 65-72 (b) of the hDMD gene. The COBRA color coding of chromosomes (c) makes it possible to unambiguously identify each chromosome and demonstrates integration of the transgene into the telomeric part of chromosome 5.

 
Western Blotting—Western blotting on muscular protein extracts was done as described previously (17). The MANDYS106 and NCL-DYS2 antibodies were obtained from Dr. G. Morris (North East Wales Institute) and Novacastra Laboratories (Newcastle Upon Tyne, United Kingdom), respectively.

Hematoxilin-eosin Staining and Immunohistochemistry—Serial transverse sections (10 µm) from frozen gastrocnemius muscle were made with a cryotome (Thermo Shandon). Hematoxilin-eosin and antibody stainings of these sections were performed as described earlier (24). To demonstrate restoration of the dystrophin-glycoprotein complex, we incubated with mouse anti-{alpha}-sarcoglycan and anti-β-dystroglycan antibodies (both from Novocastra, Newcastle upon Tyne, United Kingdom). For detection, a horseradish peroxidase-conjugated rabbit anti-mouse antibody (DAKO, Carpinteria, CA) and the 3'-diaminobenzidine tetrahydrochloride (DAB, Amresco, Solon, OH) chromogenic substrate were used. To monitor fibrosis, the sections were sequentially stained with the LF67 anti-collagen type I (Col1A1) primary antibody (diluted 1:500) (29), detected with an Alexa594 goat anti-rabbit secondary antibody (Molecular Probes).

Fiber Typing—Fiber typing was done by actomyosin ATPase staining of 10-µm transverse cryosections of the complete lower hind limb, with acid preincubation, according to previously published protocols (30). In this staining, type I fibers stain dark, whereas type II fibers remain light.

Analysis of Creatine Kinase (CK) Levels—Blood, drawn from the tail vein from 21-day-old mice, was collected in Mini Collect tubes coated with lithium heparin (Greiner Bio-One). Plasma was isolated by spinning for 4 min at full speed in an Eppendorf centrifuge. CK activity was measured by application of 30 µl of plasma on a Reflotron® CK strip and detection in the Reflotron® instrument (Roche Applied Science).

Gene Expression Profiling—For expression profiling, 15-20 µg of total RNA (integrity checked with the Agilent Lab-on-a-Chip total RNA nanobiosizing assay) was used to generate a biotinylated cRNA target. 15 µg of cRNA was hybridized on Affymetrix U74v2 gene chips, as described previously (28). Resulting CEL files were loaded into Rosetta Resolver version 4.0 (Rosetta Biosoftware, Seattle, WA) and processed with the standard error model for Affymetrix U74 chips. An error-weighted one-way analysis of variance (cut-off, p < 1 x 10-4) was used to find differentially expressed genes between male dystrophic (mdx and Utrn-/- x mdx) and nondystrophic mice (wild type, hDMD, hDMD x mdx, hDMD x Utrn-/- x mdx). Similarity searches in gene expression patterns were facilitated by the Trend match tool. Pearson correlation was used as a similarity measure. Microarray data were submitted to the Gene Expression Omnibus (NCBI) and have accession number GSE6790 [NCBI GEO] . In this paper, only samples GSM156809 [NCBI GEO] -GSM156816 were used in the analysis.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Genetic Engineering of Transgenic hDMD Mice—After spheroplast fusion of yeast cells carrying a YAC of 2.7 Mb that contains the full-length 2.3-Mb human dystrophin gene (25) with murine ES cells and confirmation of stable single copy integration, the ES cells were injected into blastocysts. These were subsequently implanted in pseudopregnant females. From the resulting chimeric offspring, mice with the highest levels of ES cell contribution were selected, tested for germ line transmission, and back-crossed with C57BL/6J mice to obtain hemi- and homozygous hDMDTg/0 and hDMDTg/Tg mice.

Assessment of Chromosomal Integration Site and Copy Number—COBRA-FISH analysis on metaphase chromosomes from cultured skin fibroblasts with two different cosmid probes encompassing exons 3-7 and 65-72 of the hDMD gene demonstrated single copy integration of the hDMD gene into mouse chromosome 5 (Fig. 1).

Due to the presence of the highly homologous murine DMD gene, genotyping of the hDMD mice was complicated. A quantitative pyrosequencing-based methodology was developed to discriminate between hDMD0/0, hDMDTg/0, and hDMDTg/Tg mice. In this assay, the signal is derived from the degree of extension of a sequence primer, adding one nucleotide at a time. A CC/CT dinucleotide variation between the mouse and human isoform in a conserved region in exon 75 of the dystrophin gene results in incorporation of two C nucleotides in case of a human allele and one C and one T in case of a mouse allele (Fig. 2a). The mice can then be genotyped based on the C/T ratios (Fig. 2b). The observed C/T ratios were always slightly higher than expected (Fig. 2c). This is probably attributable to the higher incorporation efficiency of cytosine over thymidine nucleotides. However, the difference between the observed and expected C/T ratios was highly consistent, as demonstrated by low S.D. values and female hDMDTg/Tg (expected ratio 6:2) and male hDMDTg/0 mice (expected ratio 3:1) having nearly identical C/T ratios. The quantitative pyrosequencing assay produced more robust results than a concurrently developed species-specific quantitative PCR assay (data not shown).

Phenotyping and Evaluation of Full-length mRNA and Protein Expression—Transgenic hDMD mice are born at the expected Mendelian frequencies. They have no obvious functional deficits and have a normal fertility and life span. RT-PCR analysis with human-specific primers, chosen in various regions of the mRNA, ranging from the 5' to the 3' part, revealed the expression of full-length human dystrophin mRNA in the muscle of hDMD mice. An example of such an RT-PCR assay, demonstrating the simultaneous presence of human and mouse dystrophin mRNAs, is given in Fig. 3a. Analysis of protein extracts and sections from the muscle of hDMD mice by Western blotting and staining with the human-specific MANDYS106 antibody demonstrated the presence of a full-length 427-kDa human dystrophin protein at the sarcolemma (Fig. 3, b and c). The added levels of human and mouse dystrophin protein (assessed by staining with the cross-reactive Dys2 antibody) (Fig. 3b) were similar to the levels of the murine protein in wild-type mice.


Figure 2
View larger version (20K):
[in this window]
[in a new window]

  		FIGURE 2.
Copy number determination of human and mouse dystrophin by pyrosequencing. a, original tracings of exon 75 pyrosequencing results. At the position indicated by the arrow, a CT dinucleotide is present in the mouse allele and a CC dinucleotide in the human allele. The ratio of peak height of the C and T nucleotides is therefore a measure for the ratio between the human and mouse allele. b, expected C/T ratios in male and female hDMD0/0, hDMDTg/0, and hDMDTg/Tg mice. c, observed C/T ratios in male (closed bars) and female (open bars) hDMD0/0, hDMDTg/0, and hDMDTg/Tg mice. Average and S.D. values of the indicated number of animals per group are shown.

 


Figure 3
View larger version (34K):
[in this window]
[in a new window]

  		FIGURE 3.
Expression of full-length human dystrophin gene in muscle. a, RT-PCR analysis of DMD exons 18-21 and 45-47 with human- and mouse-specific primers on hind limb muscle total RNA. b, Western blot analysis of hind limb muscle protein extracts from wild-type mice, hDMD mice, and humans with cross-reactive (Dys2) and human-specific antibody (MANDYS106) against dystrophin (repeat region and C terminus, respectively). c, immunohistochemistry of hind limb muscle sections from wild-type mice, hDMD mice, and humans with cross-reactive (Dys2) and human-specific antibody (MANDYS106) against dystrophin.

 
We investigated whether the tissue-specific expression patterns of other transcripts originating from the DMD gene were maintained in mice. Results of the quantitative RT-PCR analysis of the murine and human Dp427p, Dp427c, Dp427m, Dp260, and Dp71 transcripts in the different tissues of hDMD and wild-type mice are displayed in Fig. 4. Our sets of PCR primers appeared to be entirely species-specific. All hDMD gene-derived transcripts were expressed in the same tissues as their endogenous counterparts, the Dp427-Purkinje and Dp260 isoforms being most prominent in the eye, the Dp427-cortical in the brain, and the Dp427-muscle in the muscle and heart. By designing primers in homologous regions and carefully controlling PCR efficiencies, we made a quantitative comparison of the expression of the human and mouse transcripts in hDMDTg/Tg and wild-type mice. Although qualitatively similar, we observed considerable quantitative differences in expression. In hDMDTg/Tg mice, we observed 2-fold higher expression of the human Dp427p and Dp427m transcripts, but lower expression of the human Dp427c and Dp260 transcripts (2- and 4-fold, respectively), when compared with their murine counterparts (Figs. 4 and 5). In general, the expression level of the endogenous mouse transcript is lower in the hDMDTg/Tg than in the wild-type mice (Fig. 4), indicative of a negative feedback of the human protein on the transcription of the murine gene.


Figure 4
View larger version (21K):
[in this window]
[in a new window]

  		FIGURE 4.
Quantitative RT-PCR analysis of different dystrophin transcripts in different tissues. RNA was isolated from the gastrocnemius muscle, heart, kidney, liver, brain, eye, and testis from an hDMDTg/Tg and wild-type mouse. Levels of the Dp427p, Dp427c, Dp427m, Dp260, and Dp71 were measured by quantitative RT-PCR with human-specific (black bars) and mouse-specific (open bars) primers and plotted relative to the expression of the endogenous mouse transcript in the wild-type mouse in a reference tissue (eye, brain, muscle, eye, and testis, respectively).

 
Restoration of Dystrophic Phenotype by hDMD Expression—To demonstrate the functionality of the hDMD transgene, we crossed the hDMD mice with dystrophin-deficient mdx mice. hDMDTg/0 x mdx mice do not show any signs of muscular dystrophy or ongoing regenerative processes (Fig. 6). Together with the dystrophin protein, the dystrophin-glycoprotein complex was restored at the sarcolemmal membrane, as shown by staining for {alpha}-sarcoglycan and β-dystroglycan (Supplemental Fig. 2). In contrast, 8-week-old mdx mice display high numbers of centrally nucleated fibers in hematoxilin-eosin-stained sections and substantial fibrosis, as monitored by immunohistochemical staining with an antibody against collagen type I (29) (Fig. 6). We have not observed significant differences in fiber type composition between rescued and wild-type mice. Representative stainings are shown in supplemental Fig. 1. In both strains, the gastrocnemius muscle contained nearly 100% type II fast fibers. The soleus muscle of wild-type mice consisted of 23 ± 17% (n = 4 mice) type I slow fibers, whereas 37 ± 15% type I fibers were found in the soleus muscle of hDMDTg/0 x mdx mice (n = 6; difference not significant with a p value of 0.4). The CK levels, which are elevated in dystrophic mice due to loss of sarcolemmal integrity, were normal in hDMDTg/0 x mdx mice (239 ± 129 units/liter). The combined observations indicate that a single copy of the hDMD gene completely rescues the mdx phenotype.


Figure 5
View larger version (17K):
[in this window]
[in a new window]

  		FIGURE 5.
Quantitative RT-PCR analysis of mouse and human dystrophin transcripts in muscle and heart. Quantification of the levels of the human (black bars) and mouse (open bars) Dp427m transcripts in the gastrocnemius and the heart muscle of hDMDTg/Tg and wild-type mice. Abundance is quantified relative to the expression of the endogenous transcript in wild-type mice in gastrocnemius (left) and heart (right). The error bars reflect S.D. values in the group of hDMDTg/Tg (n = 6) and wild-type (n = 4) mice.

 


Figure 6
View larger version (71K):
[in this window]
[in a new window]

  		FIGURE 6.
Rescue of mdx phenotype by expression of the hDMD transgene. Hematoxilin-eosin stainings (a-f) and immunohistochemical stainings with a collagen type I antibody (g-j) of cross-sections of the gastrocnemius muscle from wild-type (a), hDMDTg/0 (b), mdx (c and g), hDMD+/- x mdx (d and h), mdx x Utrn-/- (e and i), and hDMDTg/0 x mdx x Utrn-/- (f and j) mice.

 
A more dramatic rescue is seen in utrophin/dystrophin double mutant (Utrn-/- x mdx) mice, which are extremely weak and die between 8 and 20 weeks after birth. In contrast, the incidence of premature death observed in the hDMDTg/0 x Utrn-/- x mdx mice was not different from that in wild-type mice, and the oldest rescued mouse in our data base lived without health problems up to the age of 16 months, after which it was euthanized. The mice have normal muscle strength and do not shows signs of scoliosis. Furthermore, histological examination of muscles of these mice does not show any signs of muscular dystrophy (Fig. 6). Centrally nucleated fibers were absent, fiber size was normal, and fibrosis was not apparent. In addition, CK levels were completely normalized in the rescued animals; in the Utrn-/- x mdx mice, CK levels amounted to 2,705 ± 635 units/liter, whereas levels in hDMDTg/0 x Utrn-/- x mdx and hDMDTg/Tg x Utrn-/- x mdx were 142 ± 66 and 198 ± 130 units/liter, respectively.

To assess if expression the hDMD transgene could not only reverse the apparent structural characteristics of dystrophic muscles but also restore wild-type gene expression patterns in dystrophic animals, we performed quantitative RT-PCR and expression profiling experiments. In a previous study, we identified a panel of genes for which the expression correlates with the severity of muscular dystrophies (31). When tested, the expression of three characteristic dystrophy marker genes, involved in extracellular matrix remodeling (Bgn) and inflammatory response (CD68, Lgals3), does not differ significantly between hDMDTg/0 x Utrn-/- x mdx, hDMDTg/Tg x Utrn-/- x mdx and wild-type mice (Fig. 7).

We also used microarrays to compare global muscular expression profiles of mice carrying the hDMD gene on an mdx or Utrn-/- x mdx background. In Fig. 8, we plotted the expression profiles of a selection of genes that are strongly up-regulated in dystrophic mdx mice and Utrn-/- x mdx mice. Many of these genes (listed in supplemental Table 2A), such as myosin light chain 4 (Myl4), insulin growth factor 2 (Igf2), myogenin (Myog), cardiac troponin T2 (Tnnt2), and H19, have also been shown to be up-regulated in other expression profiling studies in mdx mice (13, 32) and DMD patients (33-35). From Fig. 8, it is evident that expression levels for the listed genes up-regulated in dystrophic muscles from mdx and mdx x Utrn-/- mice return to wild-type levels in animals deficient for murine dystrophin but carrying the human dystrophin gene. Expression levels of genes down-regulated in dystrophic animals (listed in supplemental Table 2B), are also normalized by expression of the hDMD transgene. At a significance level of 1 x 10-4, only five genes were found differentially expressed between control mice and the rescued mdx and mdx x Utrn-/- mice (supplemental Table 2C). None of these genes has been associated with muscular dystrophy before, and they were not located in the telomeric region on chromosome 5, where the hDMD gene is integrated. Also from additional expression profiling experiments in total blood (not shown), we found no evidence for disturbances in local gene expression levels of genes in this chromosomal region. Collectively, these results demonstrate that expression of the hDMD gene normalizes the expression profile of dystrophin- and dystrophin/utrophin-deficient muscles.


Figure 7
View larger version (10K):
[in this window]
[in a new window]

  		FIGURE 7.
Quantitative RT-PCR analysis of marker genes for muscular dystrophy severity. Quantitative RT-PCR analysis of the expression of Bgn, Cd68, and Lgals3 in hind limb muscles of male wild-type (Bl6 and Bl10), hDMD0/0 x mdx x Utrn-/-, hDMDTg/0 x mdx x Utrn-/-, and hDMDTg/Tg x mdx x Utrn-/- mice.S.D.valuesofthreemicepergrouparedisplayed.*,p<0.05comparedwith wild type.

 


Figure 8
View larger version (20K):
[in this window]
[in a new window]

  		FIGURE 8.
hDMD expression restores wild-type gene expression patterns in mdx and mdx x Utrn-/- phenotype. Expression profiling of hind limb muscle RNA from wild-type, mdx, hDMDTg/0, mdx x hDMDTg/0, mdx x Utrn-/-, and hDMDTg/0 x mdx x Utrn-/- mice was performed on Affymetrix U74 DNA chips. After data processing with the appropriate Rosetta Resolver error model, log 2 ratios of expression levels over those in wild-type animals were calculated. Only expression profiles of 56 genes up-regulated in mdx and mdx x Utrn-/- mice but not in the nondystrophic animal models are shown. These were identified by searching for expression profiles most similar to myosin light chain-4 (Myl4; green), insulin growth factor 2 (Igf2; red), myogenin (Myog; pink), and troponin T2 (Tnnt2; blue), which were most significantly differentially expressed between dystrophic and nondystrophic animal profiles according to analysis of variance. The corresponding list of genes is provided in supplemental Table 2A.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
In the present paper, we show that fusion of YAC-containing yeast spheroplasts with murine embryonic stem cells is a suitable method for the transfer of megabase-sized functional human DNA segments to the mouse. To our knowledge, our mice with the full-length 2.3-Mb hDMD transgene carry a much larger noninterrupted and functional segment of human DNA integrated into a mouse chromosome than reported thus far. A mouse with an even larger stretch of DNA (i.e. ~42 Mb of the human chromosome 21) has been described (36). This segment of DNA is, however, maintained as a separate "transchromosome," which has a maternal germ line transmission of only 40% and no paternal transmission. In contrast, our hDMD gene demonstrates stable germ line transmission.

The correct expression of full-length hDMD transcripts and the 427-kDa human dystrophin protein were confirmed by RT-PCR, expression profiling, histological stainings, and Western blotting. As an ultimate proof for its functionality, the expression of the hDMD transgene, at levels close to the levels of the endogenous mouse dystrophin in wild-type mice, fully rescued the dystrophic phenotype of mdx and mdx x Utrn-/- mice. This was not only apparent at the histopathological level but also from quantitative RT-PCR- and microarray-based profiling of the expression of a highly sensitive, muscular dystrophy-related biomarker gene set (31).

Our results compare nicely with the observed rescue of the mdx phenotype by administration of viral and nonviral vectors containing hDMD cDNA constructs (37-40). Apparently, the human dystrophin protein, which has 91% amino acid identity with mouse dystrophin, is able to functionally replace its murine counterpart. This indicates a strong evolutionary conservation of the protein structure and function. In the hDMD mouse, we now demonstrate for the first time that also regulatory elements for transcription, splicing and translation of the dystrophin are well conserved between humans and mice. The tissue-specific orchestration of the expression of dystrophin transcripts seems to be well preserved for the hDMD transgene in the murine context. We observed, however, some quantitative differences between the expression from the transgene and the endogenous Dmd gene. The human Dp427p and Dp427m promoters seem to be more active than their endogenous counterparts, whereas the reverse is true for Dp427c and Dp260. This may be intrinsic to the human promoter sequences, which are possibly not fine tuned toward the murine transcription machinery. Alternatively, it could be attributable to the different genomic contexts and associated chromatin structures in which the murine and the human DMD genes are embedded. The hDMD mouse model could generate important new insights in the mechanisms governing the tissue- and context-specific activity of the different promoters in the DMD gene.

In our laboratory, we now intercross hDMDTg/0 x mdx x Utrn-/- mice. In our experience, this is an efficient way to obtain a constant supply of mdx x Utrn-/- mice, an extremely valuable animal model for DMD research, and healthy control littermates.

The hDMD mouse is of great value for the optimization and evaluation of human sequence-specific therapeutics for DMD. AON-induced exon skipping, with the aim of reading frame restoration, is a highly promising approach to convert the DMD phenotype into the milder Becker phenotype. So far, most in vivo experiments with exon-skipping AONs were done in the mdx mouse, where exon 23 was targeted (18-22). In the hDMD mouse, it is possible to evaluate the exon skipping efficiencies of human AONs with the exact same sequence as will be therapeutic for DMD patients (24). Also for DMD therapies that aim at gene correction (41), in vivo testing of repair efficiencies with the exact sequences that will be therapeutic for the mutations seen in DMD patients will be pivotal. Another important question to consider in exon skipping therapy lies in the functionality of the resulting internally deleted DMD transcripts. For some of them, Becker patients carrying the same deletion have been described, but data regarding their clinical features and how these develop during life are largely lacking. For other deletions, no Becker patients have been described. In these cases, it would be helpful to study functionality in vivo, since good in vitro models for dystrophin function are not available. These models might be generated by application of the same exon skip technology in the hDMD x mdx mouse, but the analysis will be hampered by the presence of the remaining full-length hDMD transcripts. A superior alternative would be to introduce point mutations or deletions in the YAC or in the targeted ES cells containing the hDMD gene. With the described technology, it will be possible to generate transgenic animals carrying any predefined mutation in the DMD gene. Similarly, in-frame Becker-like mutations can be evaluated for their functionality on an mdx or mdx x Utrn-/- background. In addition, out-of-frame deletions identical to those found in DMD patients can be generated. Crossing of mice with these mutations with mdx or mdx x Utrn-/- mice will enable study of the therapeutic effectiveness of human exon-skipping AONs in the most realistic fashion.

The transgenic hDMD mouse model can also be used for more basic genetic studies. The presence of deletion hot spots in the hDMD gene is well established (1, 42). The reason for this is presently unclear but may lie in the chromosomal context (e.g. regions being more susceptible toward or less protected against breaks and recombination events). Since breakpoint locations do not seem to share sequence characteristics (43), it is assumed that structural characteristics, such as local chromatin structure, influence the frequency of genomic rearrangements in the different regions of the dystrophin gene. The hDMD mouse model, having two full-length dystrophin genes in different genomic contexts, would be ideal to test whether the frequency of (radiation-induced) mutations in germ line cells is affected by the chromosomal context. This type of study may also be done in cultures of ES and somatic cells from hDMD mice and may be aided by the introduction of selection and/or reporter genes in the different mutation hot spot regions.

In conclusion, the hDMD mouse is a unique model due to the exceptionally large part of foreign DNA inserted in the mouse genome and its potential application in functional, genetic, and gene therapeutic studies for DMD.


   FOOTNOTES
 
* This work was financially supported by Muscular Dystrophy Association (United States) Project 3562, the Muscular Dystrophy Campaign (United Kingdom) Project RA3/647, and the Center for Biomedical Genetics. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. 1 and 2 and Tables 1 and 2. Back

1 Recipient of a VENI grant from the Dutch Organization for Scientific Research (NWO Grant 2005/03808/ALW). To whom correspondence should be addressed. Tel.: 31-71-5269421; Fax: 31-71-5268285; E-mail: p.a.c.hoen{at}lumc.nl.

2 The abbreviations used are: Mb, megabase(s); DMD, Duchenne muscular dystrophy; AON, antisense oligonucleotide; YAC, yeast artificial chromosome; ES, embryonic stem; RT, reverse transcription; FISH, fluorescent in situ hybridization; COBRA, combined binary ratio labeling; CK, creatine kinase. Back


   ACKNOWLEDGMENTS
 
We highly appreciate skillful technical assistance by Bianca van Rijn, Mattie Bremmer-Bout, Wendy Kaman (Human Genetics, Leiden University Medical Center), and Eveline Mank (Leiden Genome Technology Center). We thank the Transgenesis Facility Leiden for technical support. Karoly Szuhai and Marja van der Burg (Molecular Cell Biology, Leiden University Medical Center) are gratefully acknowledged for work on the COBRA analysis. We are indebted to Joris Heus (Human Genetics, Leiden University Medical Center) and C. Tyler-Smith (Department of Biochemistry, University of Oxford, UK), who provided mouse embryonic stem cells.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. den Dunnen, J. T., Bakker, E., van Ommen, G. J., and Pearson, P. L. (1989) Br. Med. Bull. 45, 644-658[Abstract/Free Full Text]
  2. Koenig, M., Hoffman, E. P., Bertelson, C. J., Monaco, A. P., Feener, C., and Kunkel, L. M. (1987) Cell 50, 509-517[CrossRef][Medline] [Order article via Infotrieve]
  3. Koenig, M., Monaco, A. P., and Kunkel, L. M. (1988) Cell 53, 219-226[CrossRef][Medline] [Order article via Infotrieve]
  4. Hoffman, E. P., Brown, R. H., Jr., and Kunkel, L. M. (1987) Cell 51, 919-928[CrossRef][Medline] [Order article via Infotrieve]
  5. Ervasti, J. M., and Campbell, K. P. (1991) Cell 66, 1121-1131[CrossRef][Medline] [Order article via Infotrieve]
  6. Michele, D. E., and Campbell, K. P. (2003) J. Biol. Chem. 278, 15457-15460[Free Full Text]
  7. Rando, T. A. (2001) Muscle Nerve 24, 1575-1594[CrossRef][Medline] [Order article via Infotrieve]
  8. Tinsley, J. M., Blake, D. J., Roche, A., Fairbrother, U., Riss, J., Byth, B. C., Knight, A. E., Kendrick-Jones, J., Suthers, G. K., and Love, D. R. (1992) Nature 360, 591-593[CrossRef][Medline] [Order article via Infotrieve]
  9. Matsumura, K., Ervasti, J. M., Ohlendieck, K., Kahl, S. D., and Campbell, K. P. (1992) Nature 360, 588-591[CrossRef][Medline] [Order article via Infotrieve]
  10. Tinsley, J., Deconinck, N., Fisher, R., Kahn, D., Phelps, S., Gillis, J. M., and Davies, K. (1998) Nat. Med. 4, 1441-1444[CrossRef][Medline] [Order article via Infotrieve]
  11. den Dunnen, J. T., Grootscholten, P. M., Bakker, E., Blonden, L. A., Ginjaar, H. B., Wapenaar, M. C., van Paassen, H. M., van Broeckhoven, C., Pearson, P. L., and van Ommen, G. J. (1989) Am. J. Hum. Genet. 45, 835-847[Medline] [Order article via Infotrieve]
  12. Coulton, G. R., Morgan, J. E., Partridge, T. A., and Sloper, J. C. (1988) Neuropathol. Appl. Neurobiol. 14, 53-70[Medline] [Order article via Infotrieve]
  13. Turk, R., Sterrenburg, E., de Meijer, E. J., van Ommen, G. J., den Dunnen, J. T., and 't Hoen, P. A. (2005) BMC Genomics 6, 98[CrossRef][Medline] [Order article via Infotrieve]
  14. Deconinck, A. E., Rafael, J. A., Skinner, J. A., Brown, S. C., Potter, A. C., Metzinger, L., Watt, D. J., Dickson, J. G., Tinsley, J. M., and Davies, K. E. (1997) Cell 90, 717-727[CrossRef][Medline] [Order article via Infotrieve]
  15. Grady, R. M., Teng, H., Nichol, M. C., Cunningham, J. C., Wilkinson, R. S., and Sanes, J. R. (1997) Cell 90, 729-738[CrossRef][Medline] [Order article via Infotrieve]
  16. van Deutekom, J. C., and van Ommen, G. J. (2003) Nat. Rev. Genet. 4, 774-783[CrossRef][Medline] [Order article via Infotrieve]
  17. Aartsma-Rus, A., Janson, A. A., Kaman, W. E., Bremmer-Bout, M., den Dunnen, J. T., Baas, F., van Ommen, G. J., and van Deutekom, J. C. (2003) Hum. Mol. Genet. 12, 907-914[Abstract/Free Full Text]
  18. Lu, Q. L., Mann, C. J., Lou, F., Bou-Gharios, G., Morris, G. E., Xue, S. A., Fletcher, S., Partridge, T. A., and Wilton, S. D. (2003) Nat. Med. 9, 1009-1014[CrossRef][Medline] [Order article via Infotrieve]
  19. Lu, Q. L., Rabinowitz, A., Chen, Y. C., Yokota, T., Yin, H., Alter, J., Jadoon, A., Bou-Gharios, G., and Partridge, T. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 198-203[Abstract/Free Full Text]
  20. Mann, C. J., Honeyman, K., Cheng, A. J., Ly, T., Lloyd, F., Fletcher, S., Morgan, J. E., Partridge, T. A., and Wilton, S. D. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 42-47[Abstract/Free Full Text]
  21. Alter, J., Lou, F., Rabinowitz, A., Yin, H., Rosenfeld, J., Wilton, S. D., Partridge, T. A., and Lu, Q. L. (2006) Nat. Med. 12, 175-177[CrossRef][Medline] [Order article via Infotrieve]
  22. Goyenvalle, A., Vulin, A., Fougerousse, F., Leturcq, F., Kaplan, J. C., Garcia, L., and Danos, O. (2004) Science 306, 1796-1799[Abstract/Free Full Text]
  23. McClorey, G., Moulton, H. M., Iversen, P. L., Fletcher, S., and Wilton, S. D. (2006) Gene Ther. 13, 1373-1381[CrossRef][Medline] [Order article via Infotrieve]
  24. Bremmer-Bout, M., Aartsma-Rus, A., de Meijer, E. J., Kaman, W. E., Janson, A. A., Vossen, R. H., van Ommen, G. J., den Dunnen, J. T., and van Deutekom, J. C. (2004) Mol. Ther. 10, 232-240[CrossRef][Medline] [Order article via Infotrieve]
  25. den Dunnen, J. T., Grootscholten, P. M., Dauwerse, J. G., Walker, A. P., Monaco, A. P., Butler, R., Anand, R., Coffey, A. J., Bentley, D. R., and Steensma, H. Y. (1992) Hum. Mol. Genet. 1, 19-28[Abstract/Free Full Text]
  26. Taylor, S. S., Larin, Z., and Tyler-Smith, C. (1996) Chromosoma 105, 70-81[Medline] [Order article via Infotrieve]
  27. Szuhai, K., and Tanke, H. J. (2007) Nat. Protoc. 1, 264-275[CrossRef]
  28. Boer, J. M., de Meijer, E. J., Mank, E. M., van Ommen, G. B., and den Dunnen, J. T. (2002) Neuromuscul. Disord. 12, S118-S124[CrossRef][Medline] [Order article via Infotrieve]
  29. Fisher, L. W., Stubbs, J. T., III, and Young, M. F. (1995) Acta Orthop. Scand. Suppl. 266, 61-65[Medline] [Order article via Infotrieve]
  30. Guth, L., and Samaha, F. J. (1969) Exp. Neurol. 25, 138-152[CrossRef][Medline] [Order article via Infotrieve]
  31. Turk, R., Sterrenburg, E., van der Wees, C. G., de Meijer, E. J., de Menezes, R. X., Groh, S., Campbell, K. P., Noguchi, S., van Ommen, G. J., den Dunnen, J. T., and 't Hoen, P. A. (2006) FASEB J. 20, 127-129[Abstract/Free Full Text]
  32. Porter, J. D., Merriam, A. P., Leahy, P., Gong, B., and Khanna, S. (2003) Hum. Mol. Genet. 12, 1813-1821[Abstract/Free Full Text]
  33. Bakay, M., Zhao, P., Chen, J., and Hoffman, E. P. (2002) Neuromuscul. Disord. 12, S125-S141[CrossRef][Medline] [Order article via Infotrieve]
  34. Chen, Y. W., Zhao, P., Borup, R., and Hoffman, E. P. (2000) J. Cell Biol. 151, 1321-1336[Abstract/Free Full Text]
  35. Haslett, J. N., Sanoudou, D., Kho, A. T., Bennett, R. R., Greenberg, S. A., Kohane, I. S., Beggs, A. H., and Kunkel, L. M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 15000-15005[Abstract/Free Full Text]
  36. O'Doherty, A., Ruf, S., Mulligan, C., Hildreth, V., Errington, M. L., Cooke, S., Sesay, A., Modino, S., Vanes, L., Hernandez, D., Linehan, J. M., Sharpe, P. T., Brandner, S., Bliss, T. V., Henderson, D. J., Nizetic, D., Tybulewicz, V. L., and Fisher, E. M. (2005) Science 309, 2033-2037[Abstract/Free Full Text]
  37. DelloRusso, C., Scott, J. M., Hartigan-O'Connor, D., Salvatori, G., Barjot, C., Robinson, A. S., Crawford, R. W., Brooks, S. V., and Chamberlain, J. S. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 12979-12984[Abstract/Free Full Text]
  38. Gilbert, R., Nalbantoglu, J., Petrof, B. J., Ebihara, S., Guibinga, G. H., Tinsley, J. M., Kamen, A., Massie, B., Davies, K. E., and Karpati, G. (1999) Hum. Gene Ther. 10, 1299-1310[CrossRef][Medline] [Order article via Infotrieve]
  39. Ferrer, A., Foster, H., Wells, K. E., Dickson, G., and Wells, D. J. (2004) Gene Ther. 11, 884-893[CrossRef][Medline] [Order article via Infotrieve]
  40. Clemens, P. R., Kochanek, S., Sunada, Y., Chan, S., Chen, H. H., Campbell, K. P., and Caskey, C. T. (1996) Gene Ther. 3, 965-972[Medline] [Order article via Infotrieve]
  41. Bertoni, C., and Rando, T. A. (2002) Hum. Gene Ther. 13, 707-718[CrossRef][Medline] [Order article via Infotrieve]
  42. Love, D. R., England, S. B., Speer, A., Marsden, R. F., Bloomfield, J. F., Roche, A. L., Cross, G. S., Mountford, R. C., Smith, T. J., and Davies, K. E. (1991) Genomics 10, 57-67[CrossRef][Medline] [Order article via Infotrieve]
  43. Sironi, M., Pozzoli, U., Cagliani, R., Giorda, R., Comi, G. P., Bardoni, A., Menozzi, G., and Bresolin, N. (2003) Hum. Genet. 112, 272-288[Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
283/9/5899    most recent
M709410200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by 't Hoen, P. A. C.
Right arrow Articles by den Dunnen, J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by 't Hoen, P. A. C.
Right arrow Articles by den Dunnen, J. T.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2008 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement