QSR1, an Essential Yeast Gene with a Genetic Relationship to a Subunit of the Mitochondrial Cytochrome bcGraphicComplex, Is Homologous to a Gene Implicated in Eukaryotic Cell Differentiation (*)

  1. Thierry Tron(§),
  2. Meijia Yang,
  3. Frederick A. Dick,
  4. Mark E. Schmitt(¶) and
  5. Bernard L. Trumpower(**)
  1. From the (1) Department of Biochemistry, Dartmouth Medical School, Hanover, New Hampshire 03755
  1. ** To whom correspondence and reprint requests should be addressed:
    Dept. of Biochemistry, Dartmouth Medical School, 7200 Vail, Hanover, NH 03755.
    Tel.: 603-650-1621; Fax: 603-650-1389.
  • Present address: Dept. of Biochemistry and Molecular Biology, SUNY Health Science Center, 750 E. Adams St., Syracuse, NY 13210.

Abstract

Subunit 6 of the mitochondrial cytochrome bc1complex regulates the activity of the bc1complex in Saccharomyces cerevisiae but is not essential for respiration. To test whether QCR6, the nuclear gene which encodes subunit 6, might be functionally redundant with any other gene(s), we screened for mutations in yeast genes which are essential when the otherwise non-essential QCR6 is deleted from the yeast chromosome. We obtained such q uinol-cytochrome c reductase subunit-requiring mutants in two complementation groups, which we named qsr1 and qsr2. The qsr mutants require QCR6 for viability on fermentable and non-fermentable carbon sources, indicating that QCR6 is covering lethal mutations in qsr1 and qsr2, even when the yeast do not require respiration.

QSR1 was cloned by rescuing the synthetic lethality of a qsr1-1 mutant. QSR1 encodes a 25.4-kDa protein which is 65% identical to a protein encoded by QM, a highly conserved human gene which has been implicated in tumorigenesis. In mammals QM is down-regulated during adipocyte, kidney, and heart differentiation, and in Nicotiana the homolog of QM is also down-regulated during differentiation. When one chromosomal copy of QSR1 was deleted in a diploid yeast strain, haploid spores derived therefrom and carrying the deletion were unable to grow on fermentable or non-fermentable carbon sources. Although QCR6 allows the qsr1-1 mutant to grow, it will not substitute for QSR1, since the deletion of QSR1 is lethal even if QCR6 is present. These results indicate a novel genetic relationship between a subunit of the mitochondrial respiratory chain and an essential gene in yeast which is homologous to a gene implicated in differentiation in other eukaryotes.

INTRODUCTION

The cytochrome bc1complex is an oligomeric energy transducing enzyme occurring in specialized membranes of numerous respiratory and photosynthetic organisms (1). The mechanism by which the bc1complex transfers electrons from ubiquinol to cytochrome c requires three redox proteins, cytochrome b, an iron-sulfur protein, and a membranous cytochrome c. While only these three redox subunits are present in the bc1complexes of numerous bacteria (2, 3, 4, 5), the bc1complexes of mitochondria contain 7 or 8 additional subunits lacking prosthetic groups (6, 7). The functions of these supernumerary subunits in the mitochondrial bc1complexes are largely unknown.

Subunit 6 of the bc1complex is an acidic protein which resides on the electropositive surface of the complex in association with cytochrome c1(8) and regulates half-of-the-sites reactivity of the dimeric bc1complex in response to protonmotive force (9). Disruption or deletion of QCR6, the nuclear gene for subunit 6 (10), does not impair growth of yeast on respiratory substrates at temperatures up to 35°C (9, 11, 12), although it does result in a temperature-sensitive petite phenotype at 37°C (13).

The fact that the absence of subunit 6 modifies the kinetic properties of the bc1complex without impairing respiration raises the possibility that deletion of QCR6 might be covered by another, functionally redundant gene. To test this possibility, we screened for mutants that require the otherwise nonessential subunit 6 and identified quinol-cytochrome c reductase subunit requiring mutants in two complementation groups. Surprisingly, the qsr mutants require QCR6 to grow under conditions where respiration is not required.

We have cloned and characterized QSR1, a gene which complements a qsr1-1 mutant. QSR1 is an essential gene in yeast and encodes a highly conserved protein which has been implicated in differentiation in higher eukaryotes.

EXPERIMENTAL PROCEDURES

Materials

L-Amino acids, uracil, and adenine sulfate were obtained from Sigma. Phenol was purchased from Mallinckrodt. Yeast extract, peptone, tryptone, and yeast nitrogen base without amino acids were from Difco. Restriction enzymes and T4-DNA ligase were purchased from New England Biolabs or Life Technologies, Inc.

Saccharomyces cerevisiae strains W303-1A (MATa, ade2-1, his3-11, 15, ura3-1, leu2-3, 112, trp1-1, can1-100) and W303-1B (MATα , ade2-1, his3-11, 15, ura3-1, leu2-3, 112, trp1-1, can1-100) were from Dr. R. Rothstein (Columbia University). S. cerevisiae strains YPH499 (MATa, ura3-52, lys2-801 (amber), ade2-101 (ochre), trp1-Δ63, his3-Δ200, leu2-Δ1) and YPH500 (MATα, ura3-52, lys2-801 (amber), ade2-101 (ochre), trp1-Δ63, his3-Δ200, leu2-Δ1) were from Dr. R. S. Sikorski (John Hopkins University). W303-1A Graphic W303-1B and YPH499 Graphic YPH500 diploid strains were used to construct deletion strains as described below. Strain SL210-2A (MATα his5-2, lys2-1, trp1-1, tyr7-1, ilv1-1, leu2-1, ade3-26, met8-1) was obtained from the Cold Spring Harbor Collection (Cold Spring Harbor, NY). Strain FY23 (MATa , ura3-52, trp1Δ63, leu2Δ1) was obtained from Dr. F. Winston (Harvard Medical School). Yeast strains constructed in this study are described in. Escherichia coli strain DH5-α (psi80d lacZΔM15 , endA1 , recA1 , hsdR17 (rkGraphicmkGraphic) , supE44 , thi-1, GraphicGraphic, gyrA96 , relA1, Δ(laczya- argF)U169, FGraphic(14) was used to amplify plasmids.

Construction of the Plasmid pMES32

The sectoring plasmid pMES32, shown in Fig. 1, was constructed from pMES20, which contains a 1.9-kbp SphI fragment encompassing QCR6 (9) in the yeast episomal plasmid YEp352 (15). A 5.3-kbp BamHI/ SalI fragment containing the ADE3 gene was isolated from pSB32 (16) and cloned into the BamHI/ SalI sites of pMES20 to create the plasmid pMES32 ().

Figure 1:

Plasmid sectoring protocol used to isolate qsr mutants. The parental yeast strain, MES12-1D, has mutations in ade2, ade3, ura3, trp1, and qcr6 and carries a yeast episomal plasmid, pMES32, that contains URA3, ADE3, and QCR6. Yeast carrying the plasmid are red due to the ade2 mutation, which causes accumulation of a red pigment. In the absence of selection the plasmid is spontaneously lost at low frequency, giving rise to red and white sectored colonies. Mutants that require the plasmid for viability form solid red, non-sectored colonies.

Mutagenesis of Yeast

Yeast grown to late exponential phase (107cells/ml) on selective minimal dextrose media were resuspended in 1 ml of 100 mM NaPi, pH 7.0 at 107cells/ml. EMS11 was added to a concentration of 3%, after which the cells were incubated on a rotator wheel for 1 h at 30°C. EMS was then inactivated by adding 50 ml of 5% sodium thiosulfate. The cells were collected by centrifugation, washed once with distilled water, and then spread on selection plates. This method of mutagenesis gave a 30-50% survival rate when compared to yeast treated without EMS (,17, 18).

Screening for Sectoring Mutants

The sectoring strain MES12-1D (MATa, his5-2, ura3-1, leu2-3, 112, trp1-1, ade2, ade3-26, qcr6Δ1::LEU2, pMES32 [ADE3, URA3, QCR6]) was constructed by crossing MES8 (MATa, ade2-1, his3-11, 15, ura3-1, leu2-3, 112, trp1-1, can1-100, qcr6Δ1::LEU2) to SL210-2A (MATα, his5-2, lys2-1, trp1-1, tyr7-1, ilv1-1, leu2-1, ade3-26, met8-1). The diploid was sporulated and haploid cells that were ade2Graphic, ade3Graphic, ura3Graphic, Leu2Graphicwere saved. Two such haploid strains, MES11-13A (MATα , ade2, leu2-3, 112, ade3-26, ura3-1, trp1-1, met8-1, lys1-1, ilv1-1, his3-11, 15, qcr6Δ1::LEU2) and MES11-14A (MATa, ade2, ade3-26, ura3-1, trp1-1, his5-2, leu2-3, 112, qcr6Δ1::LEU2), were transformed with the plasmid pMES32 (see below). These were then crossed, and the diploid was sporulated. One haploid strain from this cross, MES12-1D, was selected for mutagenesis due to its ability to produce a dark red color when maintaining the plasmid pMES32. MES12-1D also grew well on non-fermentable carbon sources and did not agglutinate. To test for high copy maintenance of the plasmid in the strain MES12-1D, genomic DNA was purified and Southern analysis was performed. The strain contained at least 35 copies of the 1.9-kbp SphI fragment encompassing QCR6 and a single 3.7-kbp SphI fragment remaining from the LEU2 marked, deleted chromosomal copy of QCR6 (18) . Hence the only source of QCR6 in this strain is from the plasmid, pMES32, and this plasmid is maintained at a substantially high copy number. The strain MES12-1D was also subjected to Northern analysis for QCR6 transcripts, and as shown below, the QCR6 transcript is present in substantially greater amounts in the strain expressing pMES32.

The strain MES11-13A was crossed to FY23, after which the diploid strain was sporulated and one haploid strain, MMY-15D (MATα , ade2-1, ade3-26, leu2-3, 112, trp1-1, ura3-52, lys1-1, qcr6Δ1::LEU2), was then used for backcrossing and complementation analysis. MES12-1D was mutagenized as described above and plated on D-plates (1% yeast extract, 2% peptone, 4% ethanol, 3% glycerol, 0.1% dextrose) at a density of 400 colonies/plate. Plates were incubated at 30°C for 1 week and then at room temperature for 4-5 days. A total of 60,000 colonies were screened. Colonies that remained solid red were collected. These potential mutants were streaked onto minimal dextrose plates to recover, and then restreaked on D-plates to retest the non-sectoring phenotype. Non-sectoring mutants were crossed to MMY-15D to test recessiveness of the mutation.

Complementation Grouping

Five non-sectoring strains from the screening described above were crossed to MMY-15D, and 15 or more tetrads from each cross were analyzed for segregation of the non-sectoring phenotype. Three of the strains always segregated the non-sectoring phenotype in 2:2 fashion, and these non-sectoring mutants also grew more slowly than the parental strain at 15°C on both fermentable and non-fermentable carbon sources. Mutant spores were then crossed to each other for assignment of complementation groups. Two complementation groups, qsr1 and qsr2, were determined by complementation analysis.

Cloning of QSR1

QSR1 was cloned by a two-step plasmid shuffling procedure in which the requirement of the qsr1-1 mutant for the QCR6 plasmid was complemented from a yeast genomic library. The library contains 8-10 kbp inserts cloned into pRS200, a single copy plasmid carrying TRP1 as a prototrophic marker. The library in pRS200 and the pRS200 plasmid without inserts were provided by Dr. P. Hieter (Johns Hopkins University). The qsr1-1 mutant was transformed with the library and approximately 13,000 TrpGraphictransformants were selected on plates containing minimal medium. The TrpGraphictransformants were then replica plated onto plates containing 5-FOA to select for cells carrying a library plasmid that allowed the mutant to live without the URA3 plasmid carrying QCR6. Transformants able to grow on 5-FOA-containing plates were cultured in YPD (1% yeast extract, 2% peptone, 2% dextrose), and the complementing plasmid DNA was isolated and subjected to restriction analysis.

Sequencing of the QSR1 Gene

Restriction fragments from the plasmid pMY7 (see below) were subcloned into pRS200, and the DNA was sequenced on both strands by chain termination using double-stranded DNA templates. M13 universal and reverse primers for sequencing were obtained from the Molecular Genetics Center, Dartmouth College. Nucleic acid and protein data bases were searched by the FASTA-FASTP algorithms using the Genetics Computer Group Sequence Analysis software package (19) on a Digital VAX117-80 computer at Dartmouth College Computing Center. MacVector Software (IBI) was used for DNA and protein analysis. Sequencing of the qsr1-1 Mutation-The genomic qsr1-1 locus was amplified by PCR, using oligonucleotides P1(GTAGCGGTTATTTCCGTGGGGTGC) and P2 (GGATATATCACTACCCAACATGC) as primers. After purification, the PCR product was directly sequenced using the CircumVent kit (New England Biolabs) and oligonucleotides synthesized from various internal sequences.

Construction of QSR1 Deletion Strains

A 3.0-kbp EcoRV fragment, beginning approximately 670 bp 3′ of QSR1 and extending into the polylinker of pRS200, was deleted from pMY3 to form pHFF15. An 825-bp SpeI- EcoRI fragment carrying the first 636 bp of the QSR1 reading frame and 189 bp of sequence 5′ of the reading frame was removed from pHFF15 and replaced with a 1.8-kbp XbaI- EcoRI fragment carrying the yeast HIS3 gene (20). From the resulting deletion plasmid (pHFF19), a 3.3-kbp XbaI- EcoRV fragment was released which carried the HIS3 gene flanked by genomic DNA from the QSR1 region. This fragment was transformed into a his3Graphicdiploid yeast strain (W303-1A Graphic W303-1B or YPH499 Graphic YPH500), and HisGraphictransformants were selected. The QSR1/qsr1Δ1::HIS3 diploid strain derived from W303-1A Graphic W303-1B was named HFF10; that derived from YPH499 Graphic YPH500 was named HFF12. Insertion of HIS3 at the QSR1 locus was verified by Southern analysis of genomic DNA.

Complementation of the QSR1 Deletion Strain

HFF10 was transformed with pHFF22, a CEN/ARS vector containing a 3.4-kbp KpnI- ClaI QSR1 fragment and a URA3 gene as a selectable marker, and uracil prototrophs were selected. After sporulation on acetate medium, asci were dissected by micromanipulation, and spores were allowed to germinate on YPD. HisGraphic, UraGraphicspores were selected and assayed for viability on YPD and on SD medium (0.67% yeast nitrogen base, 2% dextrose, 1% yeast extract, 2% peptone, 4% ethanol, 3% glycerol, 0.1% dextrose) containing 5-FOA.

Northern Analysis

Total RNA was isolated from cells in logarithmic phase growing on the carbon source indicated in the figure legends, separated by electrophoresis on 1% agarose, and transferred to nitrocellulose. The blots were probed with a GraphicPi-labeled 1.2 kbp SpeI- ClaI fragment of QSR1 excised from pMY7. Actin mRNA was probed as a control for RNA loading, using a 1.6-kbp EcoRI- HindIII fragment of the actin gene (ACT1).

Preparation of Antibodies

A plasmid for expressing a GST-QSR1 fusion protein was constructed by ligating the 0.5-kbp EcoRI fragment from the QSR1 open reading frame into the EcoRI site of pGEX-1GraphicT to create the plasmid pHFF17, which was amplified in DH5-α. E. coli cultures were grown to mid-log phase on LB (Luria broth)-ampicillin medium, then induced with 1 mM IPTG for 3 h. The insoluble GST-QSR1 fusion protein was purified from inclusion bodies by SDS-polyacrylamide gel electrophoresis and recovered by electroelution (21).

Polyclonal antibodies to the GST-QSR1 fusion protein were raised in rabbits by Cocallico Biologicals (Reamstown, PA). Preimmune sera were screened to identify rabbits which did not have antibodies to yeast proteins. When diluted 1:2000 the immune serum recognized a single protein which migrated with an apparent molecular mass of 28 kDa when 10 μg of total yeast proteins were analyzed by Western analysis (22). Yeast proteins which migrated with apparent molecular masses of 25-32.5 kDa were used to affinity purify anti- QSR1 protein antibodies for immunofluoresence microscopy (23).

Microscopy

Cells were prepared for microscopy as described by Pringle and co-workers (23). W303-1B cells were grown in YPD to an optical density of 0.4 at a wavelength of 600 nm. Formaldehyde was added to the YPD to a final concentration of 3.7%, and the cells were incubated at room temperature for 1 h. The cells were pelleted and washed three times in solution A (1.2 M sorbitol, 50 mM potassium Pi, pH 7.5). Spheroplasts were prepared by treating the cells with 15 μg/ml yeast lytic enzyme (ICN Biochemicals) in 0.3% β-mercaptoethanol for 30 min at 37°C. Cells were mounted on a 1% polyethylenimine coated slide and fixed in place with 1.8% formaldehyde. Slide wells were washed twice with TBS (150 mM NaCl, 20 mM Tris, pH 7.5) containing 0.1% BSA and once with TBS containing 0.1% BSA and 0.1% Nonidet P-40 (Calbiochem). Cells were incubated with affinity purified anti-QSR1 protein antibody diluted 1:25 in TBS with 0.1% BSA and incubated for 2 h. The cells were washed as before incubation with the primary antibody except that the first wash contained 1 μg/ml 4′-6-diamidino-2-phenylindole. Cells were then incubated with a fluorescein-conjugated goat anti-rabbit IgG secondary antibody for 1 h and washed again. The cells were then mounted and the coverslip sealed with clear nail polish. Cells were viewed at Graphic 1200 magnification with a Nikon Optiphot microscope with the appropriate optics or fluorescence filter and photographed at Graphic 375 magnification with Kodak T-Max 400 film.

RESULTS

Isolation of QSR Mutants

The screen for mutants exhibiting synthetic lethality with the QCR6 deletion is based on a plasmid loss assay as depicted in Fig. 1. We transformed a 2-μm plasmid carrying URA3 as a selective marker, ADE3 as a screening marker, and QCR6 into a ura3, ade2, ade3 yeast strain lacking QCR6. In the absence of any selection, this plasmid is lost at a rate of about 10%/generation, and the resulting cells grow as white, plasmid-free sectors in red colonies (Fig. 1). Any mutant cells that require QCR6 will retain the ADE3-containing plasmid, and the colony will be red. This type of sectoring screen was originally developed to monitor mitotic stability of minichromosomes (24, 25) and has also been used to look for haploid lethal mutations (23) and mutations exhibiting synthetic lethality with the cyclin genes (27).

MES12-1D was mutagenized with EMS to a 60-75% kill ratio, and the cells were then plated at 400 colonies/plate on either YPD plates, to look for mutations that cause non-sectoring on a fermentable carbon source, or onto D-plates, to search for mutations that cause non-sectoring only on non-fermentable carbon sources. Approximately 60,000 yeast colonies were screened. Strains that sectored on 10% dextrose plates but failed to sector on non-fermentable carbon source plates were searched for, but none were found. Thirty-five strains that failed to sector on any carbon source were saved as non-sectoring mutants. Twenty-eight of these mutant strains failed to regain sectoring after being crossed to a parental strain of opposite mating type and were thus considered genomic ade3-26 revertants or omnipotent suppressors. In order to examine whether the non-sectoring phenotype was due to a mutation which enhanced stability of the high copy plasmid, we tested the remaining seven non-sectoring mutants for growth on plates containing 5-FOA. Two of the seven non-sectoring mutants were able to grow, indicating they do not require the plasmid carrying QCR6 for viability, but rather maintained it with high efficiency when incubated on YPD plates.

After backcrossing and sporulation, non-sectoring mutants of opposite mating type were crossed. The parents of diploids which failed to regain sectoring were placed into the same complementation groups. The mutants in these two complementation groups were designated qsr1 and qsr2, for quinol-cytochrome c reductase subunit requiring. Again, the non-sectoring phenotype of all of these mutants was independent of carbon source. In addition, both qsr1 and qsr2 grew considerably slower than the MES12-1D and MMY-15D parental strains. QCR6 Copy Number Requirements of the qsr1-1 Mutant-MES12-1D carries QCR6 on a 2-μm plasmid and is an extensive overproducer of subunit 6 (see “Experimental Procedures”). In order to measure the extent of overproduction required to rescue the qsr1-1 mutant and to establish that QCR6, and not some other element on the plasmid, is covering the lethality of the qsr1-1 mutant, plasmids pMES34 and pMES36, centromeric and 2 μ-m plasmids, respectively, both marked with TRP1 and carrying the QCR6 gene (), were transformed into the qsr1-1 mutant.

The TRP1-marked plasmids carrying QCR6 were exchanged for pMES32 by isolating TrpGraphictransformants, which were then replicated onto plates containing 5-FOA to select for loss of the plasmid pMES32, which carries a URA3 gene in addition to QCR6. The qsr1-1 mutant was able to grow on 5-FOA plates after transformation with either the centromeric or the 2-μm plasmid carrying QCR6 (results not shown). This establishes that qsr1-1 can be complemented by either a single copy or high copy plasmid carrying QCR6.

The qsr1-1 mutation can also be covered by a single chromosomal copy of QCR6. The qsr1-1 mutant was backcrossed with the wild-type strain W303 to obtain a strain with a wild-type chromosomal QCR6 locus (i.e. LeuGraphic) and which had lost the plasmid carrying QCR6 (i.e. UraGraphic). Two LeuGraphic, UraGraphicspores from the first backcross were used to form diploids with W303, and these were again sporulated. The slow growth phenotype segregated in a 2:2 manner through both backcrosses. After the second backcross, the two LeuGraphic,UraGraphicspores, designated MMY3-3B and MMY3-3C, exhibited the slow growth phenotype of the original qsr1-1 mutant on YPD medium, indicating that a chromosomal QCR6 can cover the mutation in the absence of the plasmid carrying QCR6 (see Fig. 3, below). The qsr1-1 Mutant Is Semidominant-During the backcrossing of the qsr mutants, we observed that when the qsr1-1, QCR6 haploid is mated to a parental strain carrying a wild-type QSR1 allele (MMY-15D), the resulting diploid fails to regain a normal sectoring phenotype. The diploid colonies are mostly red with very small white sectors appearing after a long period of incubation on YPD (results not shown). Apparently the sectoring plasmid containing QCR6 is conferring an advantage to the qsr1-1/QSR1 diploid, even though the qsr1-1 mutation is covered by a wild-type chromosomal copy of QSR1. The qsr1-1 mutation is also only partially covered in the haploid strain by QSR1 on a CEN plasmid, as indicated by the fact that the QSR1-complemented strain grows with a doubling time of 3.2 h on YPD at 30°C, compared to 1.6 h for that of the parental strain, MMY-15D (results not shown). This semidominant behavior of the qsr1-1 mutation suggests that it is a missense mutation, resulting in an altered protein which is non-functional unless covered by QCR6 or QSR1.

Figure 3:

Complementation of qsr1-1. W303-1A, the parental strain, and MMY3-3B, a qsr1-1 mutant which has a chromosomal copy of QCR6, will grow on medium containing 5-FOA. The qsr1-1 mutant has QCR6 deleted from its chromosomal locus and depends on a URA3, QCR6 plasmid for viability. The qsr1-1 mutant will not grow on medium containing 5-FOA, which selects for loss of the URA3 plasmid. pMY3, a subclone which carries QSR1 on a TRP1 plasmid (see Fig. 2), will allow the qsr1-1 mutant to live without the URA3, QCR6 plasmid.

The qsr1-1 mutation is also covered by QCR6, and the doubling time of the cells on YPD medium is the same as when the mutant is covered by QSR1, whether QCR6 is expressed from its chromosomal locus or from a high copy plasmid (results not shown). If the QCR6-encoded protein stabilizes the qsr1-1 mutant protein by a direct interaction, the latter observation suggests that this interaction is specific, since no growth advantage derives from overexpression of the QCR6 protein.

Although there is no growth advantage from overexpression of the QCR6 protein when the qsr1-1 mutant is grown on dextrose medium, there is a pronounced effect of QCR6 copy number when the mutant is grown on ethanol-glycerol. On the non-fermentable carbon source, the qsr1-1 mutant grows more slowly than the parental strain when complemented by a high copy QCR6 plasmid, but the mutant does not grow on these carbon sources when QCR6 is expressed from the single chromosomal locus (results not shown). This difference probably relates to the dual function of QCR6 protein and sequestration of limited amounts of that protein by other subunits of the bc1complex, which are expressed on ethanol-glycerol, as discussed below.

Complementation Cloning of QSR1

QSR1 was cloned by complementing the ability of the qsr1-1 mutant to grow without the QCR6 plasmid by a two-step, plasmid shuffle procedure as described under “Experimental Procedures.” From 13,000 TrpGraphictransformants of the qsr1-1 mutant, 19 colonies were able to grow on medium containing 5-FOA. Restriction analysis and hybridization of these 19 colonies with a labeled DNA fragment containing QCR6 indicated that 17 of the complementing plasmids contained genomic fragments encompassing QCR6. This cloning of QCR6 confirmed the validity of the cloning protocol. However, since our cloning strategy employed a centromeric plasmid library, it leaves open the possibility that other, high copy suppressors of qsr1-1 might exist.

Two of the complementing plasmids contained genomic fragments which were overlapping for approximately 7 kbp and which did not contain QCR6. A restriction map of one of these clones, pMY1, is shown in Fig. 2. Sequence analysis from the multicloning site into the 5′ end of the insert in pMY1 yielded a stretch of 158 nucleotides which is identical to a sequence within the open reading frame of RGR1, a previously mapped gene which is required for glucose repression (28). On this basis and subsequent sequencing of QSR1, we conclude that QSR1 is located on the right arm of chromosome XII, approximately 4 kbp from RGR1 as shown in Fig. 2. The orientation of RGR1 and QSR1 relative to the centomere have not been established.

Figure 2:

Restriction map of qsr1-1 complementing clone. The original complementing clone, pMY1, was digested with restriction enzymes to deduce a restriction map. Subclones pMY2 to pMY7, containing segments of the original complementing DNA indicated by the thick lines, were tested for complementation of the qsr1-1 mutation as shown in Fig. 3. The + or Graphic sign to the right indicates whether or not the subclone complemented the mutation. The black box designates the QSR1 open reading frame. The 1-kbp size marker refers to distances on the subclones in plasmids pMY1 through pMY7. The 1.2-kbp SpeI- ClaI insert in pMY7 is expanded at the bottom of the figure. The abbreviations are: A, AccI; B, BamHI; BII, BglII; C, ClaI; E, EcoRI; H, HindIII; K, KpnI; P, PstI; R, EcoR5, S, SpeI; Sau, Sau3A; Sa, SalI; X, XbaI.

Restriction fragments of pMY1 were subcloned into pRS200 to generate the plasmids pMY2-pMY7 (Fig. 2), which were assayed for complementation of qsr1-1 on plates containing 5-FOA as shown in Fig. 3. The shortest fragment that complemented the qsr1-1 mutation was the 1.2-kbp SpeI- ClaI fragment in the subclone pMY7. Although the SpeI- ClaI fragment allowed the mutant to grow without the QCR6-containing pMES32 plasmid, this strain grew more slowly than a strain complemented with the longer pMY3 fragment (Fig. 2). As discussed below, this difference is probably due to the elimination of a constitutive promoter element in the DNA 5′ of the SpeI site.

QSR1 Encodes for the Yeast Counterpart of a Mammalian Protein Implicated in Differentiation

The 1.2-kbp SpeI- ClaI DNA fragment and approximately 200 base pairs upstream of the SpeI site were sequenced by chain termination. The SpeI- ClaI fragment includes a 663-bp open reading frame, capable of encoding a protein consisting of 221 amino acids, as shown in Fig. 4 a. The DNA sequence upstream of the QSR1 reading frame contains two putative TATA boxes at Graphic75 and Graphic109, a putative MIG1 binding element (29) at Graphic285, and two poly(dT) tracks at Graphic210 and Graphic240. The poly(dT) tracks are indicative of a constitutive promoter in yeast (30), and these are upstream of the SpeI restriction site, which accounts for the observation that the qsr1-1 mutant complemented by the SpeI- ClaI fragment grows more slowly than the mutant complemented by pMY3 as noted above.

Figure 4:

Nucleotide sequence of QSR1 and homology between QSR1 and the human QM protein. a, the deduced amino acid sequence is represented by single-letter code in bold face under the nucleotide sequence, which is numbered to the left starting with the A of the initial methionine codon. The amino acid sequence is also numbered to the left, starting with Met1. The asterisk refers to the position of the qsr1-1 mutation GGraphicGraphic D. Restriction sites are underlined and marked. b, alignment of the amino acid sequences of the human QM and yeast QSR1 proteins. Amino acids in the yeast QSR1 sequence which are identical to those in the human QM sequence are indicated by a dash (- - - -), and those which are conservative changes from the human QM sequence are indicated by lower case letters in the yeast QSR1 sequence.

The segment of DNA within the 1.2-kbp SpeI- ClaI fragment gives rise to a single mRNA, approximately 850 base pairs in length, as shown in Fig. 5. The amount of QSR1 mRNA is essentially identical in cells grown on dextrose, galactose, or ethanol-glycerol, indicating that expression of this gene is not subject to catabolite repression nor induced by non-fermentable carbon sources.

Figure 5:

Northern analysis showing a single transcript derived from the QSR1 locus. Total RNA was isolated from cells growing exponentially on 10% dextrose (D), 2% galactose (G), or 4% ethanol, 3% glycerol (E/G). The blot was probed with a GraphicPi-labeled 1.1-kbp SpeI- ClaI fragment excised from pMY7. Numbers to the right indicate the mobility and size of standards in kilobases.

A search of sequence data bases revealed that the DNA sequence of the QSR1 open reading frame is homologous to a human cDNA named QM. The QM cDNA was isolated by subtractive hybridization between a tumorigenic cell line derived from Wilms' tumor and a transfected, non-tumorigenic form of the same cell line (31). The amino acid sequences of the proteins encoded by QSR1 and QM are compared in Fig. 4 b. The calculated molecular masses of the yeast and human proteins are 25.4 and 24.5 kDa, and their calculated pI values are 10.1 and 10.5, respectively. The amino acid sequences of the yeast and human proteins are 63-65% identical over their entire length and 74% identical over the first 180 amino acids. This unusually high sequence identity suggests that QSR1 is the yeast counterpart of QM.

There are no obvious conserved sequence motifs in the QSR1 protein. However, two regions of the protein, from LeuGraphicto TyrGraphicand from LeuGraphicto TyrGraphicare more than 50% identical in sequence, indicating that this region is internally duplicated. In addition, searches of the data bases with different peptides from the QSR1 sequence revealed a low homology between the carboxyl terminus of QSR1 and regions of several proteins containing calcium-binding motifs. The qsr1-1 Allele Contains a Missense Mutation-Approximately 1000 bp encompassing the qsr1-1 allele were sequenced from genomic DNA extracted from the mutant. The qsr1-1 allele contains a G to A mutation at nucleotide 581, which changes a codon in the COOH terminus of the open reading frame from GGT to GAT, resulting in the replacement of a glycine by an aspartic acid (Fig. 4 a). Although the COOH terminus of the protein is not highly conserved, glycine 194 is conserved in all species where QSR1 has been identified (32). The occurrence of a missense mutation in qsr1-1 is consistent with the semidominant phenotype noted above.

QSR1 Is an Essential Gene in Yeast

To evaluate the function of the QSR1 protein, we constructed diploid yeast strains in which one chromosomal copy of QSR1 was replaced with the auxotrophic marker, HIS3, as shown in Fig. 6. Since QSR1 has some, as yet uncharacterized, relationship to a subunit of a mitochondrial respiratory enzyme complex we constructed the deletion in two diploid strains, HFF10 (W303-1A Graphic W303-1B) and HFF12 (YPH499 Graphic YPH500), which differ in their catabolite repression response,22 to ascertain whether any phenotype resulting from the QSR1 deletion may depend on the genetic background of the yeast strain.

Figure 6:

QSR1 is an essential gene. a, Southern blot hybridization. Genomic DNA isolated from the wild-type diploid (W303D) or from the QSR1/qsr1Δ1::HIS3 diploid (HFF10) was digested with EcoRI or ClaI, separated by agarose gel electrophoresis, and transferred to nitrocellulose. The blots were probed either with a 1.2-kbp XbaI- XbaI fragment located 5′ of the QSR1 ORF (probe 1) or with a 1.8-kbp fragment containing the HIS3 gene (probe 2). b, meiotic segregation of the qsr1Δ1::HIS3 allele. The QSR1/qsr1Δ1::HIS3 diploid (HFF10) was sporulated, and asci were dissected on YPD medium. The abbreviations for restriction enzymes are the same as in Fig. 2.

Integration of the marker and replacement of the QSR1 locus was verified by Southern analysis as shown in Fig. 6 a. Integration of the HIS3 fragment changed a 3.0-kbp EcoRI fragment overlapping and extending 5′ of the QSR1 locus to a 4.5-kbp fragment (see Fig. 2), both of which are detected in HFF10, the diploid deletion strain derived from W303. When this same DNA was digested with ClaI and probed with the HIS3 gene, the probe detected the endogenous HIS3 DNA as a 3-kbp fragment (Fig. 6 a), and the integrated HIS3 as an approximately 6-kbp fragment encomposing the QSR1 locus and extending into the 5′-terminus of RGR1 (see Fig. 2). The lack of any other hybridizing fragments also indicates that QSR1 is a single copy gene. Identical results were obtained with HFF12, a diploid derived from YPH499 Graphic YPH500 (results not shown).

The QSR1/qsr1Δ1::HIS3 diploid strains were sporulated, and 20 tetrads were dissected for each strain. In every tetrad from both strains, only two spores were viable on YPD (Fig. 6 b), and none of the viable spores were prototrophic for histidine. Cosegregation of the HIS3 marker with lethality establishes that QSR1 is an essential gene in yeast.

That deletion of QSR1 was responsible for the lethality was demonstrated by rescuing the lethality by a plasmid born copy of QSR1. The HFF10 and HFF12 diploids were transformed with pHFF22, a CEN/ARS, URA3, QSR1 plasmid (), and the UraGraphicprototrophs were sporulated and dissected. Among the progeny, HisGraphic, UraGraphicprototrophs were found at a frequency compatible with segregation of a centromeric plasmid, indicating that the URA3 marked plasmid carrying QSR1 covers the otherwise lethal deletion of QSR1. Rescue of the qsr1-1 Mutation by QCR6 Does Not Involve Transcriptional Regulation-It has been reported that Jif-1, the chicken equivalent of QSR1, interacts with Jun and may be a negative regulator of transcription (34). We thus tested whether the relationship between QSR1 and QCR6 might involve regulation of transcription. As shown in Fig. 7, the amount of QSR1 mRNA detected by Northern analysis is identical in strain W303 and the qsr1-1 mutant covered by QCR6 on a high copy plasmid, and also identical in a qsr1-1, rhoostrain covered by the plasmid. The amount of QSR1 mRNA is also identical in the qsr1-1 mutant covered by QCR6 on a high copy plasmid, the parental strain MMY-15D, in which QCR6 is deleted, and the wild-type strain W303. In addition, when normalized to an internal actin mRNA standard, the amount of QSR1 mRNA is identical in MMY3-3A, a QSR1,QCR6 haploid and MMY3-3B, a qsr1-1,QCR6 haploid, which were derived from the same heterozygous diploid strain. Also, the qsr1-1 mutation does not affect the expression of QCR6. The amount of QCR6 transcript originating from the single chromosomal locus is identical in MMY3-3A and MMY3-3B (Fig. 7).

Figure 7:

QCR6 does not affect expression of QSR1. Total RNA was isolated from cells growing exponentially on YPD medium. The blot was probed simultaneously with a GraphicPi-labeled 1.1-kbp SpeI -ClaI fragment of QSR1 and a 1.6-kbp EcoRI- HindIII fragment of ACT1. The blot was then stripped and reprobed simultaneously with a 1.9-kbp SphI fragment of QCR6 and the EcoRI- HindIII fragment of ACT1. Arrows indicate the mobility of the QSR1, ACT1, and QCR6 transcripts. The figure also shows the high level of QCR6 expression from pMES32 in the qsr1-1 mutant, which is diminished in the rho° mutant. The QCR6 transcript derived from pMES32 is slightly longer than that derived from the chromosomal locus. This appears to be due to the use of a cryptic promoter, which is preferentially used when QCR6 is expressed from this plasmid, since trace amounts of a similar length transcript can be seen in the mRNA from W303, MMY3-1A, and MMY3-1B, but are absent in the QCR6 deletion strains qsr1-1[pMY3] and MMY-15D.

On the basis of these results, we conclude that there is no transcriptional interaction between QCR6 and QSR1 as reflected in the steady state levels of mRNA. Additionally, if the QSR1 protein is involved in transcriptional regulation, it should be located in the nucleus. However, as shown below, this protein appears to be concentrated in the cytoplasm and excluded from the nucleus. Rescue of the qsr1-1 Mutation by QCR6 Does Not Depend on Mitochondrial Function- QCR6 can not substitute for QSR1, since deletion of QSR1 is lethal in cells containing a chromosomal copy of QCR6. In addition the deletion of QSR1 is not rescued by QCR6 carried on a high copy plasmid. When the QSR1/qsr1Δ1::HIS3 diploid strain was transformed with pMES32 () and sporulated, only two spores from each tetrad were viable on YPD. None of the viable spores were HisGraphic, although 11 out of the 18 spores were UraGraphic, indicating that the QCR6 containing plasmid had segregated randomly but had not allowed any of the qsr1Δ1::HIS3 spores to live (results not shown).

These results indicate that the presence of QCR6, which encodes a regulatory subunit of a mitochondrial respiratory enzyme complex, is allowing the qsr1-1 mutation to function. One possibility is that the qsr1-1 mutation alters energy metabolism of the yeast cells and that QCR6 compensates by up-regulating the rate of mitochondrial respiration. However, we found that the qsr1-1 mutant is covered by QCR6 in rho° cells grown on YPD medium, which lack respiration and mitochondrial ATP synthesis due to the absence of the mitochondrial genome (results not shown). Thus, the energy requirements of the qsr1-1 mutant can be met by fermentation.

The QSR1 Protein is Located in the Cytoplasm

When exponentially growing yeast cells are stained with antibody to QSR1 protein the antibody is concentrated in the cytoplasm and appears to be excluded from the nuclear region, as shown in Fig. 8. An identical staining pattern for QSR1 protein was observed in the qsr1-1 mutant covered by QCR6 (results not shown). The QSR1 antigen consistently exhibits a granular or punctate staining pattern, which suggests that the protein may be associated with a larger protein complex or structural element, although the antigen does not colocalize with mitochondrial DNA (Fig. 8).

Figure 8:

The protein encoded by QSR1 is concentrated in the cytoplasm. The photograph on the left is of strain W303-1B yeast cells harvested during exponential growth and viewed by differential interference contrast (Nomarski) optics. The center photograph is the same field of cells stained for nuclear and mitochondrial DNA with 4′-6-diamidino-2-phenylindole. The right photograph is the same field of cells showing the localization of anti-QSR1p antibody by indirect immunofluoresence after staining with a fluorescein-labeled secondary antibody.

DISCUSSION

Subunit 6 of the cytochrome bc1complex is one of the supernumerary subunits found in the bc1complexes of mitochondria but absent from the bc1complexes of bacteria. Although this subunit regulates the activity of the cytochrome bc1complex, it is not essential for respiration, since deletion of QCR6 does not prevent growth of yeast on non-fermentable carbon sources. We suspected that the QCR6 deletion might be covered by another gene and thus screened for mutants in which QCR6 is essential. We obtained five such quinol-cytochrome c reductase subunit- requiring mutants, belonging to two complementation groups, qsr1 and qsr2.

Since QCR6 encodes a protein whose only known function is in a respiratory enzyme complex, we expected to find mutants that required QCR6 to grow only on non-fermentable carbon sources. For example, yeast strains in which both QCR6 and CYC1 are deleted are petite, while strains in which either gene alone is deleted are not (35). Similarly, we have observed that combined deletions of QCR6 and QCR9, the gene for subunit 9 of the bc1complex, results in a synthetic petite phenotype.33 That no such synthetic petite mutants were found suggests that the mutagenesis protocol we employed was probably not saturating.

We cloned QSR1 from a yeast genomic library by complementing the qsr1-1 mutant for ability to grow without QCR6. QSR1 is an essential yeast gene which encodes a protein which is 65% identical to a protein encoded by a human cDNA named QM (31). The human QM cDNA was isolated by subtractive hybridization between a tumorigenic cell line derived from Wilms' tumor and a transfected, non-tumorigenic form of the same cell line. The QM transcript is underexpressed in the tumorigenic cells.

QM encodes a protein which has been highly conserved throughout evolution (32). A mouse cDNA encoding a protein homologous to the QM protein has been cloned by differential hybridization of preadipocytes and adipocytes (36). The QM mRNA decreases 80% in primary cultures of adipocytes compared to preadipocytes and does not decrease when differentiation is blocked by growth factors. The QM mRNA also decreases markedly in adult heart and kidney (31). In Nicotiana tabacum QM transcription is turned on when seeds germinate, highly expressed in growing cell suspensions, but absent in adult leaves (37). There is also a preliminary report that the QM transcript fluctuates during differentiation of Arabadopsis (38). Taken together these results suggest that QM is down-regulated during differentiation in a variety of eukaryotic cells.

A chicken cDNA encoding a protein identical to QM has been cloned by screening an expressed cDNA library for proteins which interact with c-Jun (34). Jif-1, the “Jun interacting factor” from chicken, which is 94% identical to the protein encoded by human QM, binds Jun and inhibits DNA binding and transactivation by Jun. From this study it was suggested that QM is a component of a system that modulates the activity of transcription factors through protein complex formation. However, from the steady state mRNA levels, we could find no evidence of a transcriptional interaction between QSR1 and QCR6. In addition, we find that the protein encoded by QSR1 is concentrated in the yeast cytoplasm and appears to be excluded from the nucleus, although we cannot exclude the possibility that a subpopulation of QSR1 might traffic to the nucleus under some specific conditions that we have not tested.

At the present time, the only mutation known in the QM protein family is the G194D allele we have characterized in the qsr1-1 allele. The G194D allele of qsr1-1 is semidominant, as indicated by the retention of the QCR6 plasmid when heterozygous qsr1-1/QSR1 diploids are plated onto non-selective medium. This means that the lethality of the qsr1-1 allele is only partially compensated by either QSR1 or QCR6. Glycine residues very often mark a turn or terminate helices in proteins and are considered a punctuation in peptide sequences. It is possible that replacement of glycine 194 by aspartic acid would induce a conformational change in the QSR1 protein and modify its function. It has been found that Jif-1 can homodimerize (34). If yeast QSR1 protein also forms an oligomer, the qsr1 (G194D) protein may form a heterodimer with the QSR1 protein, thus explaining the semidominant behavior.

Although glycine 194 is totally conserved, this amino acid is in a region of the protein that is the most divergent among species (32). The repetitive peptides 167-181 and 200-216 which flank glycine 194 in the QSR1 protein are not found in the other proteins of the QM family thus far identified, which allows for the possibility that this region reflects a function of the QSR1 protein specific to yeast. Secondary structure predictions suggest that this motif forms two α-helices linked by a short coil segment, and data base searches with this region of QSR1 revealed a low homology with several calcium-binding proteins, which typically contain helix-coil-helix motifs (39). When the QSR1 protein has been purified it will be possible to test whether it binds calcium, and if so, whether the G194D mutation alters such binding.

Our finding that QCR6 covers the qsr1-1 mutation raises the possibility that subunit 6 of the mitochondrial cytochrome bc1complex may have dual functions. In this regard it is notable that haploid yeast which carry the qsr1-1 allele and a single chromosomal copy of QCR6 are unable to grow on non-fermentable carbon sources, although QCR6 expressed from the multicopy pMES32 will allow the yeast to grow slowly on these carbon sources. This is consistent with the idea that the QCR6 encoded protein (subunit 6) can perform two functions, but the limited amount of QCR6 protein encoded from the chromosomal locus is sequestered into the cytochrome bc1complex when synthesis of the respiratory enzyme is induced, and not available to cover the qsr1-1 mutation. Such dual function is not unprecedented. For example, core protein 1 of the Neurospora crassa cytochrome bc1complex also participates in proteolytic processing of imported mitochondrial precursor proteins (40).

Our results indicate that the QSR1 protein is concentrated in the cytoplasm. If the QCR6 protein interacts with the qsr1-1 mutant protein, as suggested below, we would predict that a population of subunit 6 of the bc1complex is located outside of the mitochondria in the mutant. In this regard it should be noted that subunit 6 has a 25-amino-terminal presequence, which is absent from the mature subunit in the bc1complex. However, whereas presequences which target proteins to mitochondria are enriched in basic amino acids and generally lack acidic amino acids, this presequence contains a single basic amino acid (lysine) and is enriched in acidic amino acids (10, 18). Whether subunit 6 can be targeted to both cytoplasmic and mitochondrial locations and the possible role of the unusual presequence in such targeting can be tested when antibodies to subunit 6 become available.

At present we do not understand how QCR6 covers the qsr1-1 mutation. QCR6 can not substitute for QSR1, since deletion of QSR1 is lethal when QCR6 is present. In some manner, the presence of QCR6 allows the qsr1-1 mutant to function. Transcription of QSR1 is not affected by deletion or over-expression of QCR6. One possibility is that there is an interaction between the QCR6 and QSR1 proteins. If an interaction between these two proteins is involved, it is significant that suppression of the qsr1-1 phenotype by QCR6 appears to be specific. QCR6 was the only gene, other than QSR1, that we cloned by complementing the qsr1-1 mutant, and we isolated QCR6 eight times more frequently than QSR1. A single chromosomal copy of QCR6 will cover the qsr1-1 mutation, and this is the only gene for a mitochondrial protein which will do so, since the qsr1-1 mutant contains functional chromosomal copies of all of the other genes required for mitochondrial respiration and oxidative phosphorylation. The observation that overexpression of the QCR6 protein does not enhance the growth rate of the qsr1-1 mutant on dextrose medium in comparison to a chromosomal copy of QCR6 also argues that the speculated interaction between the qsr1-1 and QCR6 proteins is specific, since a nonspecific interaction would likely be enhanced by overexpression of either protein.

Our discovery that the qsr1 and qsr2 mutants require QCR6 to grow on fermentable and non-fermentable carbon sources indicates a genetic relationship between a protein of the mitochondrial respiratory chain and two genes or gene products which are essential under respiring and non-respiring growth conditions. Further genetic and biochemical studies in yeast should allow us to better understand the nature of this relationship.

Table I:

Yeast strains constructed in this study

Table II:

Plasmids used in this study

ACKNOWLEDGEMENTS

We thank Martha Jiminez and Pascale Tron for technical assistance and Tim Brown and Henry Riley for their helpful comments and stimulating discussion. We also thank Drs. P. Hieter, R. Rothstein, R. S. Sikorski, A. Tzagoloff, and F. Winston for yeast strains and plasmids.

Footnotes

  • § Recipient of a Human Frontier Science Program fellowship.

  • * This work was supported by National Institutes of Health Grant GM 20379. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

    The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EMBL Data Bank with accession number(s) U06952.

  • 1 The abbreviations used are;

    EMS

    ethyl methane sulfonic acid

    5-FOA

    5-fluoro-orotic acid

    PCR

    polymerase chain reaction

    BSA

    bovine serum albumin

    IPTG

    isopropyl-β-D-thiogalactopyranoside

    QSR

    quinol-cytochrome c reductase subunit requiring

    QCR

    quinol-cytochrome c reductase

    bp

    base pairs

    kbp

    kilobase pairs.

  • 2 W303-1A and W303-1B exhibit very little catabolite repression of nuclear encoded genes for mitochondrial proteins, whereas YPH499 and YPH500 exhibit pronounced catabolite repression of the same family of genes (33).

  • 3M. Yang, J. D. Phillips, and B. L. Trumpower, unpublished results.

REFERENCES

  1. 1.
  2. 2.
  3. 3.
  4. 4.
  5. 5.
  6. 6.
  7. 7.
  8. 8.
  9. 9.
  10. 10.
  11. 11.
  12. 12.
  13. 13.
  14. 14.
  15. 15.
  16. 16.
  17. 17.
  18. 18.
  19. 19.
  20. 20.
  21. 21.
  22. 22.
  23. 23.
  24. 24.
  25. 25.
  26. 26.
  27. 27.
  28. 28.
  29. 29.
  30. 30.
  31. 31.
  32. 32.
  33. 33.
  34. 34.
  35. 35.
  36. 36.
  37. 37.
  38. 38.
  39. 39.
  40. 40.
« Previous | Next Article »Table of Contents
  • Advertisement
  • Advertisement
Advertisement