Transcriptional Repression from the c-myc P2 Promoter by the Zinc Finger Protein ZF87/MAZ*

MATERIALS AND METHODS

Cell Culture, Transfections, and Apoptosis

COS and CV1 cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% bovine calf serum or fetal calf serum. All transfection experiments were initiated on 50% confluent monolayer cultures. Plasmids (a total of 40 μg) were transfected by the calcium phosphate procedure (35). The cells were glycerol-shocked 5–6 h after DNA addition.

The ZF87/MAZ cDNA construct was originally isolated by screening a λgt11 expression library (renatured protein immobilized on filters) with a ³²P-radiolabeled ME1a2 element (28). The cDNA was then cloned into Bluescript KS just 3′ to a FLAG epitope tag sequence. The FLAG epitope tag was linked in frame to the open reading frame of ZF87/MAZ. A monoclonal antibody (M2, Eastman Kodak Co. and IBI) directed toward this epitope was used in the immunoblotting immunofluorescence and gel-shift experiments. For expression studies the tagged ZF87/MAZ gene was cloned into the pcDNA3 plasmid. All of the c-mycpromoter:CAT¹ constructs used were as described previously (23, 25).

Extracts were generated by multiple freeze-thaw cycles approximately 48 h after the glycerol shock and then CAT (chloramphenicol acetyltransferase) and β-galactosidase activity was assayed from the soluble extracts. Equal amounts of protein were assayed for CAT activity by thin layer chromatography, and β-galactosidase activity was measured by a color reaction (35). All transfections were performed multiple times. A plasmid containing the Rous sarcoma virus (RSV)-long terminal repeat controlling expression of the β-galactosidase gene (RSVβ-gal) was included in all transfections (5 μg) of the CAT constructs so that the CAT activity could be normalized for differences in transfection efficiency.

To determine if ZF87/MAZ induced apoptosis, COS cells were plated out onto glass coverslips and then transfected with the ZF87/MAZ expressing plasmid or a vector control. At 48 h after the glycerol shock, the coverslips were processed for fluorescent microscopy, using M2 as a primary antibody, followed by DAPI staining of the DNA. The altered nuclear morphology of an apoptotic cell, as assessed by DAPI staining, is represented by nuclear blebbing, DNA fragmentation, and DNA condensation (36).

Cells to be processed for flow cytometry were rinsed twice in chilled PBS and then trypsinized and resuspended in 10 ml of Dulbecco’s modified Eagle’s medium plus 10% serum. The cells were then pelleted and resuspended in 70% ethanol. The cells were kept on ice for 10 min, pelleted, and then treated with RNase A (1.8 μg) for 30 min at room temperature. Propidium iodide (Sigma) was added to a final concentration of 2 μg/ml for an additional 15 min at room temperature. Cell cycle analysis was then performed on a Coulter Profile 2 Flow Cytometer.

Generation of Extracts

Nuclear and cytosolic extracts for immunoblots and gel-shift assays were generated by lysing the cells on ice in 0.1% Nonidet P-40, 10 mm Tris (pH 7.9), 10 mm MgCl₂, 15 mm NaCl, and the protease inhibitors phenylmethylsulfonyl fluoride (0.5 mm), pepstatin (2 μg/ml), and leupeptin (1 μg/ml). The nuclei were pelleted by centrifugation at 800 × g for 10 min, and the soluble fraction was termed “cytosol.” The nuclei were resuspended in extraction buffer consisting of 0.42 m NaCl, 20 mm Hepes (pH 7.9), 20% glycerol, phenylmethylsulfonyl fluoride (0.5 mm), pepstatin (2 μg/ml), benzamidine (1 μg/ml), and leupeptin (1 μg/ml) for 10 min on ice and then centrifuged at 14,000 × g for 8 min to pellet the residual nuclear material. The supernatant fraction from this centrifugation spin was termed “nuclear extract.” For electrophoretic mobility shift assays and Western blots, the nuclear extract was diluted with extraction buffer minus NaCl to lower the salt concentration to approximately 0.1 m.

Electrophoretic mobility shift assays were performed essentially as described (23). Briefly, 0.5 ng of a ³²P-end-labeled, double-stranded oligonucleotide was incubated with nuclear extracts in the presence of 1.5 μg of sheared and denatured salmon sperm DNA as a nonspecific competitor. The final buffer conditions for protein binding to the radiolabeled DNA were 16 mm Hepes (pH 7.9), 16% glycerol, 80 mm KCl, 0.16 mm EDTA, 0.4 mm dithiothreitol, and 0.4 mmphenylmethylsulfonyl fluoride. The reactions were then electrophoresed in a low ionic strength (7 mm Tris (pH 7.9), 3.3 mm sodium acetate, 1 mm EDTA) 4% polyacrylamide gel. The gel was dried and exposed to x-ray film, and the protein-DNA complexes were visualized by autoradiography.

The double-stranded oligonucleotide representing the ME1a2 element used in the gel-shift assays is shown in Oligonucleotide 1. The underlined region denotes the sequence that is protected in DNase I footprinting studies (21, 22).

To generate constructs containing mutant and wild type ME1a2 elements, the following sequences were cloned (as double-stranded oligonucleotides) 5′ to the minimal promoter-CAT construct containing only the P2 TATA box, extending from position −48 to +176 relative to P2. The sequences are as follows: ME1a2 wild type, GCCTCCTGAAGGGCAGGGCTTCGC; ME1a2 mutant 1, GCCTCCTGAATTGCAGGGCTTCGC; and ME1a2 mutant 2, GCCTCCTGAAGGGCATTGCTTCGC. The sequence underlined in the wild type element is protected in DNase I footprinting experiments (21,22). The sequences in bold italics are those that were mutated in mutant 1 and mutant 2 (GG to TT).

Western Blots

Extracts were electrophoresed by SDS-PAGE. The proteins were electrophoretically transferred onto nitrocellulose, washed in TBST buffer (10 mm Tris (pH 8); 150 mm NaCl; 0.05% Tween 20), blocked with 2.5% bovine serum albumin in TBST for 30 min at room temperature, and then incubated with either the M2 anti-FLAG monoclonal antibody (10 ng/ml) or polyclonal antiserum generated against ZF87/MAZ (1:5,000 dilution). The blots were washed three times with TBST and then incubated with a 1:7500 dilution of secondary antibody (goat anti-mouse, or goat anti-rabbit Vector Laboratories) conjugated to alkaline phosphatase for 30 min at room temperature in TBST. The blots were washed three times with TBST and then stained using the Protoblot system from Promega.

Immunofluorescence

For indirect immunofluorescence, cells were plated on 10-cm tissue culture dishes containing glass coverslips and transfected with the ZF87/MAZ expression plasmid. The cells were washed once in PBS and the cells fixed with 4% paraformaldehyde in PBS for 20 min followed by an additional rinse in PBS. To permeabilize the cells, the coverslips were then treated with PBS plus 0.2% Triton X-100 for 15 min followed by three 5-min washes in PBS plus 0.2% gelatin (28). The M2 monoclonal antibody (VWR Scientific/Kodak/IBI) was diluted in PBS plus 0.2% gelatin. 50 μl of diluted antibody was added to a dish; coverslips containing the fixed and permeabilized cells were placed cell side down on the drop of diluted antibody and incubated for 1.5 h at 37 °C. The coverslips were washed three times in PBS plus 0.2% gelatin. Fluorescein-conjugated goat anti-mouse IgG (Vector Laboratories) was diluted to 30 μg/ml in PBS plus 0.2% gelatin. 50 μl of diluted antibody were placed in a dish and the coverslips placed cell side down and incubated for 30 min at 37 °C. The coverslips were washed in PBS plus 0.2% gelatin (10 min), PBS plus 0.2% gelatin plus 0.05% Tween 20 (10 min), and finally in PBS (10 min). The coverslips were rinsed in deionized water, dried, mounted, and analyzed by fluorescence microscopy.

RESULTS

Overexpression of ZF87/MAZ in COS Cells

To begin functional studies on ZF87/MAZ, the protein was epitope-tagged (FLAG) at the very amino terminus by engineering the tag at the very 5′ end of the cDNA. This tagged construct was cloned into the pcDNA3 expression vector, suitable for high level of expression in eukaryotic cells. The M2 monoclonal antibody (Kodak/IBI), directed to the epitope tag, was then used to detect the ectopically expressed protein. To initiate functional studies on ZF87/MAZ, the pcDNA3-ZF87/MAZ vector was transiently transfected into COS cells. At 48 h post-transfection the cells were harvested, and nuclear and cytosolic extracts were generated. These extracts were electrophoresed by SDS-PAGE, and the gel was immunoblotted. Separate blots were incubated with either the M2 monoclonal antibody or ZF87/MAZ specific antiserum. As seen in Fig. 1, A andB, ectopically expressed ZF87/MAZ is detected by both antibodies. The protein is present almost exclusively in the nuclear extracts. The protein band under the ectopically expressed ZF87/MAZ in Fig. 1 A is a nonspecific band detected by the secondary antibody.

Since the protein was present in the nuclear fraction, we next determined if the protein was actually targeted to the nucleus. COS cells cultured on glass coverslips were next transiently transfected with the ZF87/MAZ expression plasmid. The cells were fixed at 48 h post-transfection and were processed for indirect immunofluorescence using M2 as the primary antibody and a fluorescein-conjugated secondary antibody. As seen in Fig. 2 A, fluorescence microscopy reveals that the protein was targeted almost completely to the nucleus.

To test whether ZF87/MAZ overexpression had an adverse affect on the COS cells, apoptosis was measured. Cells grown on coverslips were transfected with the ZF87MAZ expression vector and then processed for indirect immunofluorescence as described above at 48 h post-transfection. Following the addition of the second fluorescein-conjugated antibody, the DNA in the cells was stained with the DNA dye DAPI. Apoptosis was measured in the transfected and untransfected cells by determining the percentage of fluorescent-positive cells undergoing nuclear blebbing, DNA fragmentation, and condensation (as in Ref. 36). As seen in Fig.2 B, ZF87/MAZ overexpression does not induce any significant apoptosis in these cells, compared with the untransfected control population.

c-myc P2 Promoter Analysis in COS Cells

Since the transfection data indicated that ZF87/MAZ could be transiently expressed to detectable levels by immunofluorescence and immunoblotting in COS cells, it was next important to determine the functional consequences of this expression, by focusing on the c-mycpromoter. Transfection experiments were therefore initiated, using c-myc promoter-CAT constructs. The c-myc promoter has been analyzed in detail in a variety of cell lines, using deletion constructs with varying promoter sequences (20-23, 25, 37). However, transcription from the P2 promoter has not been analyzed in detail with these constructs in COS cells. The promoter constructs to be utilized are outlined in Fig. 3 A. These show the various combinations of P2 promoter elements, utilizing the c-myc P2 transcriptional start site in all constructs and extending to residue +176 (relative to P2) within the first exon. These promoter constructs were individually transfected into COS cells along with an RSV-LacZ construct. Extracts generated at 48 h post-transfection were used to assay for CAT activity. It is clear from the data in Fig. 3 B that optimal transcription from the promoter is dependent primarily on the ME1a1 and ME1a2 elements. Note that the −77CAT construct contains E2F, ME1a1, and TATA, whereas the −61CAT construct contains only the ME1a1 and TATA elements. Elimination of the ME1a2 element results in the greatest drop in promoter activity. Although the E2F element does not appear to affect greatly the overall level of transcription in COS cells, it has been shown to control c-myc transcription in nontransformed cells (24). The data indicate that the ME1a2 and ME1a1 elements contribute the most to transcription from P2 in COS cells. Dependence of P2 promoter strength on these elements in COS cells therefore appears nearly identical to that seen in NIH3T3 fibroblasts, HeLa cells, and U87mg glioblastoma cells (23, 25, 37).

Transcription from the c-myc P2 Promoter Is Repressed by ZF87/MAZ

The constructs in Fig. 3 A were next used as a starting point in cotransfection experiments in COS cells along with the ZF87/MAZ expression plasmid. First, the largest c-mycpromoter fragment (−1367CAT) was cotransfected along with increasing amounts of the ZF87/MAZ expression plasmid. As seen below in Fig.4 A, ZF87/MAZ shows a dose-dependent repressive effect on transcription from this promoter construct. At the highest concentration used, a 10-fold repressive effect was evident. Optimal repression was seen at a 2:1 ratio of reporter to ZF87/MAZ expression plasmid. As controls, the ZF87/MAZ expression plasmid at the high concentration had no effect on transcription from either the Rous sarcoma virus-long terminal repeat or on the herpesvirus thymidine kinase promoter (Fig. 4 B). An RSV-LacZ construct was used in all transfections to normalize for any differences in transfection efficiency, as described above since it is not affected by ZF87/MAZ (Fig. 4 C). As a control for these experiments, CV1 cells, the parental cell line of COS but lacking SV40 T antigen, were transfected with the −1367CAT and the −140CAT constructs in the presence and absence of the ZF87/MAZ expression plasmid. As seen in Fig. 4 D, ZF87/MAZ significantly down-regulates transcription from these promoter constructs in CV1 cells. This indicates that the down-regulation in COS cells is not dependent on T antigen.

Experiments were next performed to identify the site(s) within the P2 promoter that were affected by ZF87/MAZ. Cotransfections were therefore performed on the deletion constructs outlined in Fig. 3 A, namely −140CAT, −77CAT, −61CAT, −48CAT (containing only the TATA element and the P2 start site), and −24CAT(containing only the P2 start site). Since the high concentration of the ZF87/MAZ expression plasmid led to the greatest repression of expression from the −1367CAT construct in COS cells, this ratio of reporter to ZF87/MAZ expression plasmid was used to test whether repression could occur on smaller promoter fragments. Significant repression (>5-fold) occurred to the −140CAT construct by ZF87/MAZ as shown in Fig.5, which would indicate that ZF87/MAZ is acting through elements in the P2 promoter. However, as also shown in Fig. 5, the other constructs, which all lack the ME1a2 site, were not repressed by ZF87/MAZ. In fact the −77CAT construct is activated by ZF87/MAZ. Although ZF87/MAZ is known to bind the ME1a1 element (28), the mechanisms responsible for this activation will be discussed below. However, the results would indicate that the repressive effect of ZF87/MAZ on P2 is primarily due to its action on the ME1a2 site and not on the E2F or ME1a1 sites. Also, since no repression was seen using a construct containing only the TATA box (−48CAT), it appears that ZF87/MAZ is not acting directly on the basal transcription machinery.

To analyze more thoroughly the effect of ZF87/MAZ on the P2 promoter, additional promoter CAT constructs were used in the cotransfection assays. These constructs include ME1a2-E2FCAT, ME1a2-ME1a1CAT, ME1a2CAT, and 3E2FCAT. As shown in Fig.6, transcription from each promoter construct, except the 3E2FCAT, is inhibited by ZF87/MAZ. The data in total are consistent with a role of ZF87/MAZ-inhibiting transcription from the P2 promoter through the ME1a2 site.

Constructs were next generated that contained the basal TATA box with the P2 start site (−48CAT). Cloned 5′ to the TATA box were two wild type ME1a2 elements or two sets of mutant elements. In mutant 1, two Gs within the first set of Gs were mutated to Ts. In mutant 2, the two Gs within the second set of G′2 were mutated to Ts. The mutant sequences are shown in Fig. 7 A. Previous DNase I footprinting analysis indicates that the central Gs are bound by protein (22). Following transfection of these constructs, it is clear that two wild type ME1a2 elements provide strong promoter activity, nearly equal to the level of the −140CAT construct (Fig.7 B). This is similar with the results of transfections of this construct into other cell types (23, 25). Mutant 1 shows significantly reduced transcriptional activity, and mutant 2 behaves nearly to wild type levels. This indicates that the central Gs are essential for optimal activity in COS cells. Consistent with these data, ZF87/MAZ has a potent effect on down-regulating activity from the wild type ME1a2 element and mutant 2. However, it appears that mutant 1 is not affected by ZF87/MAZ. Thus, the central Gs in the sequence AAGGGCAGGGC appear to mediate the effect of ZF87/MAZ on the c-myc P2 promoter.

Increased Protein Binding Occurs to the ME1a2 Element in the ZF87/MAZ-transfected Cell Extracts

Since it appeared that ZF87/MAZ is acting through the ME1a2 element, this sequence was radiolabeled and used in a gel-shift assay with extracts from the transfected cells. This would allow a determination of any alteration in binding activity on this element by ectopically expressed ZF87/MAZ. As seen in the Fig. 8, at least three protein complexes are formed on the ME1a2 element when incubated with the COS nuclear extracts. Two of the faster migrating complexes show increased intensity in the extracts from the ZF87/MAZ-overexpressing cells when compared with the control extracts. Thus, increased binding occurs to the ME1a2 element in the ZF87/MAZ-transfected cells. This binding appears specific since it can be competed away by 100-fold excess unlabeled ME1a2 element. Additionally, upon incubation with the M2 antibody directed toward the epitope tag, the two faster migrating complexes are reduced in intensity to the level seen in the control extract. This would indicate that the ectopically expressed ZF87/MAZ protein is functionally capable of binding the ME1a2 element within the promoter, and it forms multiple protein complexes with the DNA. The other band in the gel shift in Fig. 8 that is not affected by ZF87/MAZ overexpression is likely a distinct protein complex formed on the ME1a2 sequence.

ZF87/MAZ Contains a Potent Transcriptional Repressor Domain

To determine if ZF87/MAZ contains a transcriptional repressor domain that results in the repression of transcription from the c-myc promoter, ZF87/MAZ was cloned in frame with the yeast DNA-binding protein GAL4, in the eukaryotic expression plasmid pG4 (38). This plasmid contains the DNA sequence encoding only the binding domain of GAL4 (residues 1–147) (38). A target promoter containing five GAL4-binding sites upstream of the herpesvirus thymidine kinase promoter, linked to CAT, was used as a target in cotransfection studies in COS cells. As seen in Fig.9 A, the ZF87/MAZ-GAL4 fusion was able to repress transcription significantly from the GAL4-TKCAT reporter construct. This indicates that ZF87/MAZ contains a strong repressor domain that functions independently of its binding to the c-myc promoter.

Since the amino-terminal domain of ZF87/MAZ is a region rich in proline and alanine, it is possible that it may contain the sequences needed for transcriptional repression, as is known for other transcription factors that function to repress transcription (39-42). The amino-terminal (residues 1–246) and carboxyl-terminal (residues 246–493) halves of the ZF87/MAZ protein were therefore cloned in frame with the GAL4 binding domain in pG4. Cotransfection studies were then performed along with the GAL4-TKCAT reporter construct. As shown in Fig. 9 A, the construct containing the amino-terminal half of the protein is very effective at transcriptional repression, seen as a greater than 20-fold drop in transcription. In contrast the construct containing the carboxyl-terminal half of the protein was much less effective at transcriptional repression. These data indicate that the proline/alanine-rich region of ZF87/MAZ contains a potent transcriptional repressor domain. Shown in Fig. 9 B is an immunoblot of the ectopically expressed GAL4 fusion proteins from COS cell nuclear extracts (incubated with the anti-ZF87 antibody). The figure shows relatively equal levels of expression of each fusion.

DISCUSSION

Here we show that the ZF87/MAZ transcription factor represses transcription from the c-myc P2 promoter, when transiently overexpressed in COS cells. Using a variety of promoter constructs, repression was found to be mediated through the ME1a2 element. This is consistent with the fact that increased protein binding occurs to the ME1a2 element in extracts from cells overexpressing ZF87/MAZ. The complex banding pattern seen indicates that multiprotein complexes form on the ME1a2 element, but it appears that ZF87/MAZ is present in only some of these complexes since some of the bands were not affected by the M2 antibody in the gel shift assay. That ZF87/MAZ affects transcription from P2 through the ME1a2 element is in line with the fact that the protein was originally identified based on its ability to bind the ME1a2 element (28). The fact that ZF87/MAZ represses transcription from P2 is also in line with the findings regarding a recently identified protein known as THZif-1, which is related to ZF87/MAZ. THZif-1 has been shown to repress transcription of c-myc in HL60 cells (31). Thus it appears that a multiprotein ZF87/MAZ family (31, 33, 34) may be responsible for transcriptional repression of c-myc.

The repression of c-myc by ZF87/MAZ through the ME1a2 element is interesting in light of the fact that the ME1a2 element normally functions in a positive way, to increase the rate of transcription from the P2 promoter (20-23, 25, 37). Deletion of the ME1a2 site results in a significant drop in transcription from P2 in a variety of cell types (20-23, 25, 37). From the gel shift assay it is clear that multiple protein complexes form on the ME1a2 element in COS cell extracts. Only some of these complexes are affected by ZF87/MAZ overexpression, as evidenced by increased binding by ZF87/MAZ. It is possible that formation of one set of protein complexes on the ME1a2 element leads to activation from P2. Such a complex would be indicated by the band corresponding to the asterisk in Fig. 8. However, formation of a different set of protein complexes, composed in part by ZF87/MAZ for example, leads to repression from P2 in these COS cells. Thus both positive and negative affectors mediate transcription through the ME1a2 element. Interestingly, when overexpressed, ZF87/MAZ is able to act in a dominant fashion to these other factors, resulting in repression of transcription from P2. At this time the identities of the additional proteins binding to the ME1a2 site are not known.

The results presented here also indicate that ZF87/MAZ is a transcriptional repressor in COS cells independent of its ability to bind the c-myc promoter. The repressor domain is localized to the amino half of the protein, which is rich in proline and alanine residues. This is consistent with the fact that proline- and alanine-rich sequences comprise the repressor domains in the well characterized transcriptional repressor proteins Kruppel, Even Skipped, and Runt (40-42). The role of these domains may be to establish protein-protein interactions. Consistent with this idea, a number of cellular factors were found to associate with ZF87/MAZ in vitro (data not shown). These factors range in size from 59 to >200 kDa and may mediate the transcriptional repressive effect. One factor that is near in size to one of the associated proteins is the coactivator/repressor protein p300/CBP (the protein is >200 kDa). In cotransfection experiments CBP was found to enhance the repressive effect of ZF87/MAZ in a cotransfection assay (data not shown). This would be consistent with the dual role of CBP as both a coactivator and corepressor (49, 50).

That ZF87/MAZ is able to repress transcription from the c-myc promoter is interesting in light of the fact that it has been shown to enhance the expression of other genes. These include insulin (43, 44), the adenovirus major late promoter (46), the seratonin 1a receptor (47), and the CD4 receptor (48). Interestingly, that ZF87/MAZ can activate transcription is in line with the results presented here, where ZF87/MAZ overexpression increases transcription from a construct containing just the E2F and ME1a1 elements. At this time we do not know the basis for this activation, but our preliminary data indicate that due to the absence of the ME1a2 element, ZF87/MAZ indirectly increases the activity of the E2F factor on the c-myc promoter. The Sp1 transcription factor is known to bind the ME1a1 site, and Sp1 and E2F have been shown to interact with each other (51). Therefore, ZF87/MAZ may indirectly affect (increase) this interaction, which is particularly evident in the absence of the ME1a2 site (i.e. due to loss of repression). Current efforts are underway to determine if this is the case.

In addition to its ability to activate and repress transcription initiation, ZF87/MAZ also functions to terminate transcription at the 3′ end of the complement C2 gene (45). It therefore appears that activation and repression of transcription by ZF87/MAZ are contrasting features of this transcription factor. It is possible that these functions are accomplished by cell/tissue-dependent associated factors that act as coactivators or corepressors. It is also possible that since ZF87/MAZ is a multiprotein family, some members may be involved in repression and others in activation. This may have an important function, for example, in cells undergoing differentiation, where enhancement of differentiation specific genes (e.g.seratonin, CD4, and complement) and suppression of cell cycle genes (e.g. c-myc) are essential for the completion of the differentiation process. Further analysis into the structure and function of ZF87/MAZ will shed light on the role this factor plays in proliferation and differentiation.