A Novel Tctex2-related Light Chain Is Required for Stability of Inner Dynein Arm I1 and Motor Function in the Chlamydomonas Flagellum*

  1. Linda M. DiBella,
  2. Elizabeth F. Smith§,
  3. Ramila S. Patel-King,
  4. Ken-ichi Wakabayashi and
  5. Stephen M. King
  1. Departments of Biochemistry and Molecular, Microbial, and Structural Biology, University of Connecticut Health Center, Farmington, Connecticut 06030-3305 and§Department of Biological Sciences, Dartmouth College, Hanover, New Hampshire 03755
  1. An investigator of the Patrick and Catherine Weldon Donaghue Medical Research Foundation. To whom correspondence should be addressed: Dept. of Molecular, Microbial, and Structural Biology, University of Connecticut Health Center, 263 Farmington Ave., Farmington, CT 06030-3305. Tel.: 860-679-3347; Fax: 860-679-3408; E-mail: steve{at}king2.uchc.edu.

Abstract

Tctex1 and Tctex2 were originally described in mice as putative distorters/sterility factors involved in the non-Mendelian transmission of t haplotypes. Subsequently, these proteins were found to be light chains of both cytoplasmic and axonemal dyneins. We have now identified a novel Tctex2-related protein (Tctex2b) within the Chlamydomonas flagellum. Tctex2b copurifies with inner arm I1 after both sucrose gradient centrifugation and anion exchange chromatography. Unlike the Tctex2 homologue within the outer dynein arm, analysis of a Tctex2b-null strain indicates that this protein is not essential for assembly of inner arm I1. However, a lack of Tctex2b results in an unstable dynein particle that disassembles after high salt extraction from the axoneme. Cells lacking Tctex2b swim more slowly than wild type and exhibit a reduced flagellar beat frequency. Furthermore, using a microtubule sliding assay we observed that dynein motor function is reduced in vitro. These data indicate that Tctex2b is required for the stability of inner dynein arm I1 and wild-type axonemal dynein function.

The dynein microtubule-based molecular motor performs a variety of functions within eukaryotic cells (1, 2). Ciliary and flagellar dyneins comprise the inner and outer arms of the axoneme and provide the power necessary for the motility of these organelles. Within flagella of the unicellular green alga Chlamydomonas, the apparently homogeneous ∼2-MDa outer arms are assembled at 24-nm intervals along the length of the A tubules of the outer doublet microtubules. This motor complex helps define the beat frequency of the flagellum and provides ∼⅘ of the power output (3, 4). Flagellar waveform is regulated by a complex inner arm system comprised of seven dynein subspecies (for review, see Refs. 5 and 6). Indeed, strains that lack various subsets of inner arms exhibit defects in waveform associated with reductions in shear amplitude (4). Subspecies f, or inner arm I1, contains 2 HCs1 (1α and 1β), three ICs (IC110, IC138, and IC140), and several LCs, including LC8 and Tctex1 (7-13). Both the 1α and 1β HCs are essential for the assembly of inner arm I1 (9, 14), and a truncated 1β HC fragment containing the N-terminal ∼113 kDa but lacking the motor domain is sufficient for this activity (14). Of the three identified ICs, IC140 is an essential component and is involved in the localization of this motor (10, 11). In addition, cross-linking experiments indicate that IC140 is closely associated with IC110 (11). Genetic and biochemical studies reveal that inner arm I1 is involved in the regulation of microtubule sliding through phosphorylation (15-18). IC138 is the only phosphorylated subunit of inner arm I1 and plays an integral role in the control of dynein motor function (16, 17, 19).

Two inner arm I1 LCs have previously been identified, including the highly conserved 10-kDa protein LC8 and Tctex1 (13). In Chlamydomonas, LC8 is also found in the outer arms and radial spokes and is required for intraflagellar transport (13, 20, 21). Tctex1 is a member of the Tctex1/Tctex2 family of dynein LCs (13, 22) that includes rp3 (23) and the Chlamydomonas outer arm subunit LC2 (24). The Tctex1 and Tctex2 genes were initially identified in mice within a 30-40-mega-base pair region of chromosome 17 referred to as the t-complex and are both candidates for distorter/sterility factors, which play roles in the non-Mendelian inheritance of variant forms of this chromosome known as the t-haplotypes (25, 26). Tctex1 is also a component of cytoplasmic dynein (22) and participates in a variety of motor/cargo interactions that include an association with rhodopsin within the vertebrate photoreceptor (27). LC2 is a Tctex2 homologue (24) that is essential for the assembly of the Chlamydomonas outer dynein arm within the flagellar axoneme (28).

In this study we describe an additional member (here called Tctex2b) of the Tctex1/Tctex2 family of LCs in Chlamydomonas. This novel flagellar component associates with inner arm I1 but, unlike the Tctex2 homologue in the outer arm, is not essential for its assembly. Interestingly however, Tctex2b plays a role in maintaining the stability of this dynein complex. Furthermore, mutants lacking Tctex2b swim more slowly than wild type and show consistently slower velocities in an in vitro microtubule sliding assay. These data suggest that Tctex2b is required for wild-type axonemal motor function.

MATERIALS AND METHODS

Strains and Media—The following strains of Chlamydomonas reinhardtii were used in this study: cc124 (wild type), oda9, ida1, ida4, pf14, pf18, and pf28 (obtained from the Chlamydomonas Genetics Center, Duke University), pf28pf30 (from Dr. Winfield Sale, Emory University), A54-e18 (pf16-D2 parental strain), pf16A, pf16-D2, pf16-D2HA4C, pf16-D2HA5A, pf16-D2pf28, and pf16-D2λ8b (Table I). Methods for the generation of the pf16 insertional allele (pf16-D2) as well as transformation of the pf16A and pf16-D2 strains with the wild-type PF16 gene were described previously (29). The pf16-D2λ8b strain was generated by cotransformation of the pf16-D2 strain with the pArg7.8 plasmid and λ clone “8b” as previously described (29). The double mutant strain pf16-D2pf28 transformed with the wild-type PF16 gene was constructed from crosses of pf16-D2pf28 with pf16-D2 transformed with the wild-type PF16 gene. The strain of interest was identified in nonparental ditype tetrads as a very slow swimmer.

Table I

Strains used in this study

To generate the pPF16-HA constructs, an HA-tag encoding three copies of the 9-amino acid hemagglutinin epitope ((3xHA, obtained from Dr. Carolyn Silflow (30)) was amplified with flanking MluI sites and then ligated into MluI-digested pb6D2 (31), resulting in the 3xHA tag inserted after Asp-418 (148 residues from the carboxyl terminus). pf16, arg- cells were cotransformed with 1 μg each of the pPF16-HA and pARG7.8 (32) plasmids using the glass bead method (33). Successful transformants were identified as swimming cells and then further analyzed by Western blot and immunoelectron microscopy using antibodies to the HA tag (Santa Cruz Biotechnology, Inc.) as previously described (31). The presence of two central tubules and the correct localization of PF16-HA were verified. All cells were grown in Tris acetate-phosphate media. pf16A, pf28, A54-e18, and all pf16-D2-related strains were grown under continuous light.

Purification of Axonemes and Dynein—Wild-type and mutant strains of C. reinhardtii were deflagellated with dibucaine using standard methods and demembranated with 1% IGEPAL CA-630 (Sigma catalog I-3021; replaces Nonidet P-40) (34). For dynein purification, isolated axonemes were subjected to extraction with 0.6 m NaCl (35). Extracted proteins were fractionated using either a 5-20% sucrose density gradient as described previously (34) or anion exchange chromatography (see below). Samples were routinely electrophoresed in 5-15% gradient polyacrylamide gels and either stained with Coomassie Brilliant Blue or transferred to nitrocellulose for Western blotting.

Anion Exchange Chromatography—To separate the different species of axonemal dynein, the 0.6 m NaCl axonemal extract was dialyzed against buffer A (20 mm Tris, pH 7.5, 60 mm KCl, 0.5 mm EDTA, 0.1% Tween 20, 1 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride) and applied to an anion exchange column (Mono Q HR5/5, Amersham Biosciences) using a Bio-Rad Biologics chromatography work station. Proteins were eluted at a flow rate of 0.5 ml/min using a linear salt gradient of 0-50% buffer B (buffer A with 1 m KCl) and collected in 0.3-ml fractions. To initially identify fractions pertinent to this study, samples were electrophoresed in 8% acrylamide gels and silver-stained (36). Molecular Analysis of Tctex2b—The entire coding region for Chlamydomonas Tctex2b was obtained by polymerase chain reaction using a Chlamydomonas λZapII wild-type cDNA library enriched for flagellar messages as the template. Both the forward primer, 5′ → 3′ GCGCGAATTCATGGCGGAAGCGGCTGACTTC, and reverse primer, 3′ → 5′ GCGCCTCGAGTCAGTACAGGTACACGCCGAA, were designed based on the entire coding sequence derived from the Chlamydomonas Expressed Sequence Tag BE122193 and incorporate an EcoRI site at the 5′ end and a XhoI site at the 3′ end, respectively. After restriction digestion, the gel-purified product was subcloned into pBluescript II SK- (Stratagene) across the EcoRI/XhoI restriction sites. 32P-labeled oligonucleotides were generated from the sequenced clone and used to probe a Southern blot of Chlamydomonas wild-type genomic DNA and a northern blot of Chlamydomonas RNA obtained from wild-type non-deflagellated cells and from cells 30 min post-deflagellation that were enriched for flagellar messages. The entire coding region was also used to isolate an ∼6.5-kb genomic fragment containing the full-length TCTEX2B gene from a λDashII (Stratagene) genomic DNA library previously constructed from wild-type strain 1132D-.2

Preparation of Recombinant Protein and Antibody—The coding region for Tctex2b was subcloned into the pMAL-c2 vector (New England Biolabs, Inc.) across the XmnI and BamHI restriction sites. This resulted in the Tctex2b protein fused to the C terminus of maltose-binding protein (MBP) via a 19-residue linker containing a Factor Xa cleavage site. The overexpressed fusion protein was purified by amylose affinity chromatography. The full-length fusion protein was used as the immunogen to generate rabbit antiserum CT117. Nitrocellulose membrane containing recombinant Tctex2b after separation from MBP was utilized to affinity-purify the antibody (37).

Swimming Speed Measurements—For measurement of swimming speeds, cells were suspended in fresh Tris-acetate-phosphate media, and ∼30 μl of cells were placed on a microscope slide and examined using a Nikon E600 microscope equipped with a 100-watt halogen light source and a Diagnostic Instruments Spot RT monochrome camera. To avoid cell compression and possible impedance of motility cells were examined using a 10× PlanFluor objective (NA 0.25) without a cover-slip. Time-lapse images were generated (50 images in 7 s), and swimming speed was measured using Diagnostic Instruments Spot Advanced imaging software. All swimming speed data were calculated as the mean ± S.D. from a minimum of two experiments and a total sample size of greater than 150 cells. Student's t test was used to determine the significance of differences between means.

Microtubule Sliding Assay—Flagella were resuspended in 10 mm Hepes, pH 7.4, 5 mm MgSO4, 1 mm dithiothreitol, 0.5 mm EDTA, and 50 mm potassium acetate (HMDEKAc). Axonemes were prepared by adding Nonidet P-40 (Calbiochem) at a final concentration of 0.5% (v/v) to remove flagellar membranes. Sliding velocity between doublet microtubules was measured by the method of Okagaki and Kamiya (38) and as previously described (15). Approximately 8 μl of axonemes were applied to a perfusion chamber, and the chamber was washed with HMDEKAc containing 1 mm ATP to remove nonadherent axonemes. To initiate microtubule sliding, the chamber was perfused with HMDEKAc containing 1 mm ATP and 2 μg/ml Type VIII protease (P-5380; Sigma). Microtubule sliding was observed using an Axioskop 2 microscope (Zeiss Inc., Thornwood, NY) equipped for dark-field optics including a Plan-Apochromat 40× oil immersion objective with iris and ultra dark-field oil immersion condenser. All microtubule sliding velocity data were calculated as the mean ± S.D. from a minimum of two experiments and a total sample size of greater than 45 axonemes. Student's t test was used to determine the significance of differences between means.

Flagellar Beat Frequency Analysis—Flagellar beat frequency was measured based on the method of Kamiya and Hasegawa (39) (40). This method uses a darkfield microscope equipped with a photodetector fitted with a linear density gradient filter at the detection plane and a fast Fourier transform analyzer. Chlamydomonas cells grown at low density in liquid media were analyzed using an Olympus BX51 with a UPLANF1 20X/0.050 PH1 objective, a dry darkfield condenser (U-DCD, Olympus), and a red filter (Marumi, Japan) placed on the light source. Cell movement was detected by the photodetector that was constructed by Drs. Shoji Baba and Yoshihiro Mogami (Ochanomizu University, Tokyo, Japan). Data were captured and analyzed using a sound card (Creative Live!, Creative Sound Blaster) and SIGVIEW v1.81 fast Fourier transform signal analysis software.

RESULTS

Identification of a Novel Tctex2-related Protein—To identify additional dynein-associated flagellar components, we searched the Chlamydomonas EST and nonredundant databases using LC2, the Tctex2 homolog from the outer dynein arm (accession number U89649) as the initial query sequence. This search identified a Chlamydomonas EST (accession number BE122193; Pn = 5 × 10-15). The BE122193 sequence exhibits 33% identity (63% similarity) with LC2. Consequently, we surmised that this clone may encode a member (here termed Tctex2b) of the Tctex1/Tctex2 family of dynein LCs. To further characterize this putative dynein LC, the full-length cDNA was obtained from a λZapII cDNA library enriched for flagellar messages. The cDNA is 1105 bp in length and contains a single open reading frame encoding a 120-residue protein with a calculated molecular mass of 13,751 Da and a pI of 5.31 (Fig. 1a).

Fig. 1.

Molecular cloning and phylogenetic analysis of Tctex2b. a, nucleotide and predicted amino acid sequence of the cDNA clone encoding Tctex2b. The 5′-UTR contains four in-frame stop codons upstream of the first Met, and the 3′-UTR contains a perfect copy of the Chlamydomonas polyadenylation signal (underlined). Nucleotide sequence data reported are available in the Third Party Annotation Section of the DDBJ/EMBL/GenBank™ databases under the accession number TPA:BK004867. b, phylogenetic analysis of the Tctex1/Tctex2 family of LCs. Distances were calculated using PROTDIST and FITCH from the Phylip group of programs, and the unrooted tree was generated using DRAWTREE. The tree reveals two Tctex2 subfamilies designated as Tctex2a and Tctex2b. Chlamydomonas Tctex2b shares 44% identity with a homolog from human kidney (AW612564) and a mouse embryo EST (W64276). The Tctex2a family members include Chlamydomonas flagellar LC2 (489649), human testis Tctex2 (AA781436), mouse Tctex2 (U21673), human glioblastoma EST (AI421187), and Anthocidaris crassispina flagellar LC1 (BAA24185). Members of the Tctex1 subfamily are murine Tctex1 (A32995), human Tctex1 (U56255), A. crassispina Tctex1 (AB004251), Chlamydomonas flagellar Tctex1 (AF039437), and human rp3 (U02556). We have also identified three distantly related Caenorhabditis elegans proteins (D1009-5, C48724, and T05C12-5) in this family. c, the secondary structure of Tctex2b was predicted using PredictProtein. E, extended sheet; H, helix.

Secondary structure analysis using Predictprotein (41) suggests that the LC consists of two N-terminal α-helices followed by four β strands that occupy almost the entire C-terminal portion of the polypeptide (Fig. 1c). This prediction is consistent with structural studies of the related protein Tctex1 (42, 43). Tctex1 is a dimeric protein, whereas LC2 from the outer arm is a monomer in solution (44). Analysis of the MBP-Tctex2b fusion protein by native gel electrophoresis yielded a molecular mass of 107.4 kDa, compared with the calculated mass of 53.8 kDa. In contrast, the MBP-LacZ control protein (calculated mass of 50.8 kDa) appeared to be monomeric with a measured native molecular mass of 56.2 kDa. This suggests that Tctex2b forms dimers in solution.

Tctex2b shares 31% identity (42% similarity) with murine Tctex2 and 30% identity (49% similarity) with Chlamydomonas LC2. An unrooted phylogenetic tree for the Tctex1/Tctex2 family suggests three major subdivisions (Fig. 1b). The Tctex1 group includes Chlamydomonas flagellar Tctex1, human and mouse Tctex1, and human cytoplasmic rp3. A group we now term Tctex2a includes Chlamydomonas outer arm LC2, human and mouse Tctex2, and an EST identified in human glioblastoma. Tctex2b appears to define a distinct branch of the Tctex2 subfamily that also includes several mammalian ESTs that share 44% identity (55% similarity) with Chlamydomonas Tctex2b.

A Southern blot of Chlamydomonas genomic DNA digested with either PstI or BamHI and probed with the Tctex2b cDNA yielded single bands for each digest, suggesting that a single gene exists for this protein (Fig. 2a). On northern blots a single mRNA of ∼1.4 kb was observed that was greatly up-regulated in cells actively regenerating flagella (Fig. 2b). This suggested that Tctex2b may be a flagellar protein.

Fig. 2.

Southern and northern blot analysis of TCTEX2B. a, Southern blot of Chlamydomonas wild-type genomic DNA digested with either SmaI, PvuII, PstI, or BamHI. A probe generated from the full-length TCTEX2B coding region detects single bands in SmaI- and BamHI-digested DNA, suggesting a single gene. b, Northern blot of total RNA isolated from non-deflagellated cells (NDF) and cells actively regenerating their flagella for 30 min (30postDF). A faint signal at ∼1.3 kb was detected in NDF RNA, and a highly up-regulated band of the same size was observed in 30′postDF RNA. c, map of the TCTEX2B genomic region. Restriction fragment length polymorphism analysis revealed that the TCTEX2B gene maps to linkage group IX. Sequencing of this genomic region indicated that this gene was ∼ 2 kb downstream of the PF16 gene. TCTEX2B spans an ∼1.9-kb region; 5′- and 3′-UTRs (dark gray), 5 exons (black), and a portion of the PF16 5′-UTR (light gray) are indicated.

The TCTEX2B and PF16 Genes Are Adjacent—To determine the location of TCTEX2B within the Chlamydomonas genome, we obtained an ∼ 6.5-kb clone containing the TCTEX2B gene from a λDashII genomic DNA library. Sequence analysis revealed that the TCTEX2B gene consists of an ∼1.9-kb DNA segment containing 5 exons (Fig. 2C). Furthermore, we found that the 5′ end of the genomic clone also included a portion of the 5′-UTR of the PF16 gene (positioned in the opposite orientation relative to TCTEX2B), indicating that the two genes are in close proximity (within ∼ 2 kb). A subsequent search of the previously published genomic segment that includes the Chlamydomonas flagellar PF16 gene (accession number U40057) (29) revealed that it contained part of TCTEX2B. Restriction fragment length polymorphism analysis indicated that both the PF16 (29) and TCTEX2B genes map to linkage group IX.

Generation of Antibody against Tctex2b—The Tctex2b coding sequence was subcloned into the pMAL-c2 vector (New England Biolabs, Inc.) and expressed as an N-terminal fusion to MBP. The purified fusion protein was used as the immunogen to generate rabbit polyclonal antiserum CT117. The specificity of CT117 for Tctex2b was examined using recombinant versions of each LC from the Chlamydomonas outer dynein arm as well as the inner arm I1 LC, Tctex1. CT117 recognized only its target antigen and specifically did not react with the outer dynein arm LC2 (Tctex2a) or Tctex1 (Fig. 3a). Furthermore, Tctex2b was not detected by antibodies against Tctex1 (R5205) or LC2 (R5391; not shown). A single discrete band corresponding to Tctex2b was detected in wild-type axonemes probed with the CT117 antibody (Fig. 3b).

Fig. 3.

Specificity of the Tctex2b polyclonal antibody. In panels a and b gels were either stained with Coomassie Brilliant Blue (CBB) or transferred to nitrocellulose. a, MBP fusions to Tctex2b, Tctex1, and LC2 were digested with Factor Xa, and the LCs were separated from MBP by SDS-PAGE. Blots were probed with either affinity-purified rabbit polyclonal antibody CT117 (Tctex2b) or R5205 (Tctex1) (22). Both antibodies are specific and only recognize their respective LC. b, approximately 50 μg of wild-type (cc124) axonemes were electrophoresed in a 5-15% polyacrylamide mini-gel. The blot was probed with affinity-purified CT117, which detected a single discrete band of ∼Mr14,000.

Tctex2b Is a Component of Inner Arm I1—To determine the location of Tctex2b, axonemes were isolated from Chlamydomonas strains lacking various components (Fig. 4). Tctex2b was present in wild type axonemes (cc124) as well as in mutants missing the I2 inner arm class (ida4), the outer arms (oda9), the radial spokes (pf14), and the central pair microtubule complex (pf18). The levels of Tctex2b were significantly reduced in ida1, which lacks inner arm I1, as well as in the double mutant pf28pf30, which is missing both the outer arms and inner arm I1. The markedly reduced levels seen in the ida1 and pf28pf30 strains suggested that Tctex2b associates with inner arm I1. We also observed that the Tctex2b protein is completely absent in axonemes isolated from pf16-D2, a null PF16 allele generated by insertional mutagenesis (29).

Fig. 4.

Localization of Tctex2b in Chlamydomonas axonemes. Approximately 150 μg of isolated axonemes from various strains were electrophoresed in 5-15% gradient acrylamide gels and stained with Coomassie Blue (upper panel) or transferred to nitrocellulose and probed with CT117 (lower panel). Strains used include wild type (cc124) and mutants lacking various axonemal components: ida1 (inner arm I1), oda9 (outer arm), ida4 (inner arm subtypes a, c, and d from I2), pf28pf30 (outer arm and inner arm I1), pf14 (radial spokes), pf16-D2 (C1 tubule from central pair), and pf18 (central pair). Levels of Tctex2b are significantly reduced in axonemes that lack inner arm I1 (ida1 and pf28pf30); this protein is completely absent in pf16-D2. Molecular weight markers are indicated on the left.

To further confirm that Tctex2b is indeed a component of inner arm I1, high salt extracts from wild type axonemes were fractionated using sucrose gradient centrifugation (Fig. 5a). The majority of the inner arm I1 subunit, IC140 and Tctex2b, cosedimented in fractions 5-7. When inner arm I1 was purified from wild-type axonemal salt extracts by anion exchange chromatography, IC140 and Tctex2b again cofractionated (Fig 5b). These data strongly suggest that Tctex2b is a subunit of inner dynein arm I1.

Fig. 5.

Tctex2b is a component of inner arm I1. a, a 0.6 m NaCl extract of wild-type axonemes was loaded onto a 5-20% sucrose gradient. After sedimentation, fractions were electrophoresed in 5-15% acrylamide gels and either stained with Coomassie Blue (upper panel) or blotted to detect Tctex2b and IC140 from inner arm I1. Tctex2b comigrates with the peak of inner arm I1 in fractions 5-7. Molecular weight markers are indicated at the left. b, wild-type high salt extracts were subject to anion exchange chromatography. A linear KCl gradient was used to elute the various dynein subspecies. Fraction f (inner arm I1) eluted at ∼380-400 mm salt. Tctex2b copurified with the peak IC140 fractions. IC138 and IC140 (from inner arm I1) and IC1 and IC2 (from the outer arm) are indicated at the right.

IC140 from Inner Arm I1 Assembles in the Absence of Tctex2b—To determine whether Tctex2b is essential for assembly of inner arm I1, we took advantage of the pf16-D2 strain that lacks this component. Immunoblot analysis of isolated axonemes from pf16-D2 revealed that significant levels of IC140 were present (Fig. 6). Because IC140 is essential for assembly of this dynein (10), this result suggests that inner arm I1 is present in pf16-D2 mutant axonemes and that the lack of Tctex2b in this strain does not prevent assembly of inner arm I1. Similar results were obtained with two additional pf16-D2 strains rescued with an HA-tagged PF16 gene (pf16-D2HA4C and pf16-D2HA5A) (Fig. 6). Moreover, Tctex1 is present in pf16-D2HA4C axonemes as well as the double mutant, pf16-D2pf28 Resc. w/PF16, which lacks both Tctex2b and the outer dynein arm (see Fig. 7, b and c). These data indicate that lack of the PF16 protein in pf16-D2 is not responsible for the absence of Tctex2b or for its failure to assemble. It is unclear whether inner arm I1 is present at completely wild-type levels in strains lacking Tctex2b.

Fig. 6.

Inner arm I1 components can assemble in the absence of Tctex2b. Axonemes from wild-type (cc124) and mutant strains lacking either PF16 and Tctex2b (pf16-D2) or only Tctex2b (pf16-D2HA4C, pf16-D2HA5A) were electrophoresed in 5-15% acrylamide gels and either stained with Coomassie Blue (upper panel) or blotted to detect Tctex2b and IC140. IC140 assembles even in the absence of Tctex2b.

Fig. 7.

Absence of Tctex2b results in instability of inner arm I1 in vitro. In a-c, Coomassie Blue-stained 5-15% acrylamide gels are shown in the upper panel, and immunoblots are shown in the lower panels. a, sucrose gradient analysis of a high salt extract from oda9 axonemes. Tctex1 comigrates with the inner arm I1 ICs at ∼18 S (fractions 5-7). Thus, the absence of the outer arm alone does not result in dissociation of inner arm I1. b, sucrose gradient analysis of a salt extract from the Tctex2b “knockout” (pf16-D2) rescued for PF16 in the pf28 (lacks outer arms) background (pf16-D2pf28 Resc. w/PF16). Tctex1 is dissociated from the I1 complex and migrates near the top of the gradient, whereas most IC140 is present in fractions 7-12. c, sucrose gradient analysis of a high salt extract from Tctex2b “knockout” axonemes (pf16-D2HA4C). In the absence of Tctex2b alone, Tctex1 no longer migrates at ∼18 S but appears near the top of the gradient (similar to panel b), indicating that the absence of outer arms is not responsible for the instability of Tctex1. Because of the high levels of protein in the pf16-D2HA4C fractions and the high affinity of the IC140 antibody, a blot containing ∼20% of the level of protein shown in the Coomassie Brilliant Blue (CBB)-stained gel was probed to obtain the IC140 signal shown in c.

Absence of Tctex2b Destabilizes Inner Arm I1—When salt extracts were prepared from wild type axonemes or axonemes lacking the outer dynein arms and fractionated using sucrose density gradients, all the known components of inner arm I1 copurified at ∼18 S. For example, in the outer armless mutant oda9, all three inner arm I1 ICs as well as Tctex1 cosedimented in fractions 5-7 (Fig. 7a). However, when high salt extracts from axonemes lacking both the outer arms and Tctex2b (pf16-D2pf28 Resc. w/PF16) were fractionated in a sucrose gradient, the inner arm I1 complex was no longer found at 18 S (Fig. 7b). The majority of IC140 was present at ∼10 S in fractions 7-11, indicating that the inner arm I1 complex had dissociated. In addition, Tctex1 now appeared at the top of the gradient in fractions 12-15. Similarly, when high salt extracts of axonemes lacking only Tctex2b were fractionated, Tctex1 also appeared at the top of the gradient, indicating that it had dissociated from inner arm I1 (Fig. 7c). These data suggest that the lack of Tctex2b alone causes the instability of inner arm I1 and that this is independent of the status of the outer arms.

Rescue of pf16-D2 with Both PF16 and TCTEX2B Genes—Isolation of the PF16 gene from a bacteriophage λ library originally created from wild-type genomic DNA yielded several overlapping clones that included λ8b (29). This ∼12-13-kb clone was transformed into both pf16-D2 and pf16A (the original allele (45)) and rescued the paralyzed phenotype of both strains, signifying the presence of a functional PF16 gene. At that time, however, it was not known that TCTEX2B existed, that it mapped in the immediate vicinity of PF16, or that it might be present in the isolated λ clone. To determine whether Tctex2b was encoded within λ8b, PCR was performed with TCTEX2B-specific primers using λ8b as the template. A DNA fragment of the expected size (∼1.2 kb) for the genomic region of TCTEX2B encompassing all 5 exons (see Fig. 4) was amplified (data not shown). To rescue both the pf16 and tctex2b defects, λ8b was transformed into the pf16-D2 strain. Cells were screened based on their ability to swim, and a transformant (pf16-D2λ8b) was isolated. Immunoblot analysis of axonemes from the rescued strain revealed that Tctex2b was expressed and incorporated into the axonemes (Fig. 8a). This verified that the λ8b clone encodes functional PF16 and TCTEX2B genes.

Fig. 8.

Lack of Tctex2b results in decreased swimming speeds. a, approximately 150 μg of axonemes from wild-type (cc124), pf16-D2 (lacking both PF16 and Tctex2b), pf16-D2HA4C (lacking only Tctex2b), and pf16-D2λ8b (transformed with both PF16 and TCTEX2B genes) were electrophoresed in 5-15% acrylamide gradient gels and either stained with Coomassie Blue or transferred to nitrocellulose. Western blot analysis using affinity-purified CT117 verified that pf16-D2λ8b expressed Tctex2b and that it is localized to the axoneme. b, swimming speeds for A54-e18 (parental strain to pf16-D2), Tctex2b “knockout” (pf16-D2 Resc. w/PF16), pf16-D2λ8b (pf16-D2 rescued with both the PF16 and TCTEX2B genes), and pf16A rescued with PF16 were calculated using Diagnostic Instruments Spot Advanced imaging software. The histogram reveals the mean swimming speeds (±S.D.) in μm/s from total sample sizes of >150 cells, from a minimum of two experiments.

Lack of Tctex2b Results in Reduced Swimming Speeds and Microtubule Sliding Velocities—Although transformation of the pf16-D2 insertional allele with the wild-type PF16 gene rescued both the motility and the central apparatus defects in this mutant (29), subsequent observations revealed that the rescued strain exhibited somewhat reduced swimming speeds compared with wild-type cells (Fig. 8b). To quantitate these differences, we measured the swimming speeds of wild-type cells, pf16-D2 cells rescued with the wild-type PF16 gene, and pf16-D2 cells rescued with the λ8b clone. The average swimming speed of pf16-D2 cells transformed with only the PF16 gene was significantly slower (∼72%) than that of wild-type cells (P << 0.001). In contrast, the average swimming speed of pf16-D2 cells transformed with both the PF16 and TCTEX2B genes was not significantly different from that of wild-type cells or from pf16A cells transformed with the wild-type PF16 gene. These results indicate that transformation of pf16-D2 with the wild-type PF16 gene alone does not completely restore wild-type motility.

To further investigate differences in motility between wild-type cells and pf16-D2 cells rescued with either PF16 or the PF16 and TCTEX2B genes, we measured dynein motor activity using a microtubule sliding assay. In this assay microtubule sliding is uncoupled from flagellar bending, and therefore, dynein activity is quantified as the velocity at which the doublet microtubules slide past one another (e.g. Ref. 38). Microtubule sliding velocities of axonemes isolated from both pf16A and pf16-D2 were approximately half that of wild-type axonemes, as previously reported (46). In the present study, microtubules from pf16A exhibited similar sliding velocities (∼60% compared with wild-type) and regained near wild-type sliding levels when rescued with the wild-type PF16 gene (pf16A Resc. w/PF16) (Fig. 9a). Velocities for the pf16tctex2b double mutant (pf16-D2) were measured at only ∼36% that of wild-type and ∼61% that of the pf16 single mutant, which suggests that the absence of Tctex2b further impairs sliding speeds. Evidence that a loss of Tctex2b may alter axonemal function can be seen in the mutant lacking only Tctex2b (pf16-D2 Resc. w/PF16). Unlike the pf16A mutant rescued with PF16, this mutant displays sliding velocities significantly different from wild-type levels (P << 0.001), presumably because of the missing dynein subunit. Alternatively, the presence of less than wild-type levels of inner arm I1 might account for this reduction. The double mutant rescued with both PF16 and TCTEX2B (pf16-D2λ8b) regains wild-type microtubule sliding velocities, supporting the hypothesis that Tctex2b is essential for wild-type motor function.

Fig. 9.

Microtubule sliding velocity and flagellar beat frequency analysis. a, isolated axonemes from various strains were demembranated before initiation of microtubule sliding by the addition of protease and ATP. Strains analyzed were parental strain (A84-e18), a pf16 point mutant (pf16A), pf16A rescued with PF16, the pf16 and tctex2b double mutant (pf16-D2), pf16-D2 rescued for only PF16, pf16-D2 rescued for both PF16 and Tctex2b (pf16-D2λ8b), an outer armless mutant (pf28), and a double mutant lacking both Tctex2b and outer arms (pf16-D2pf28 Resc. w/PF16). Microtubule sliding velocities are expressed in μm/s as the mean ± S.D. b, flagellar beat frequency was determined using the fast Fourier transform method. Cells from strains that lack Tctex2b (pf16-D2, pf16-D2 Resc. w/PF16) show a decreased beat frequency compared with the parental strain (A84-e18) or cells rescued for PF16 and Tctex2b (pf16-D2λ8b).

This reduction in inner arm dynein activity is even more dramatic in strains lacking the outer dynein arms. We compared microtubule sliding velocities in mutant axonemes lacking only the outer dynein arms (pf28) with those of a double mutant strain lacking both the outer dynein arms and Tctex2b (pf16-D2pf28 double mutant rescued with the PF16 gene). In the absence of the outer dynein arms and Tctex2b, microtubule sliding velocities were reduced to ∼1.6 μm/s compared with 5.8 μm/s, measured for axonemes lacking only the outer dynein arms.

Absence of Tctex2b Results in Reduced Flagellar Beat Frequency—To further investigate the functional significance of Tctex2b in vivo, we analyzed flagellar beat frequency of wild-type and mutant strains. The paralyzed pf16-D2 insertional mutant strain, when rescued only with PF16, exhibited a beat frequency that peaked at ∼28-32 Hz (Fig. 9b). In contrast, when this strain was rescued with both PF16 and TCTEX2B, the peak beat frequency rose to ∼33-40 Hz, with a significant shoulder at close to 50 Hz. This value is similar to the parental strain (A54-e18) used to generate pf16-D2, which exhibited two significant peaks between ∼38 and 42 Hz with a smaller population at >50 Hz. These observations suggest that the lack of Tctex2b contributes to a reduction in flagellar beat frequency. Together with the swimming speed and microtubule sliding data, these results suggest that although Tctex2b is not essential for incorporation of inner arm I1 into the axoneme, it does increase the stability of the enzyme and, thus, enhances the overall performance of the inner dynein arm system.

DISCUSSION

Tctex2b Defines a New Subfamily of Dynein LCs—To date, three members of the Tctex1/Tctex2 family have been identified in Chlamydomonas; they are Tctex1, an inner arm I1 subunit (13) that also functions as a component of cytoplasmic dynein (22), LC2 (24), an outer arm LC that is required for assembly of that dynein (28), and Tctex2b, which is described here. Identification of Tctex2b allowed us to subdivide the Tctex2 family into two major groups. The branch designated Tctex2a contains sea urchin LC1 and Chlamydomonas LC2, which are outer dynein arm LCs, and the eponymous human and mouse flagellar Tctex2 proteins. Chlamydomonas Tctex2b establishes the second branch of this protein family and is most closely related to ESTs identified from both human B cell lymphocytic leukemia (EST AI492091), human kidney (EST AW612564), and murine embryo (EST W64276) libraries. These mammalian proteins are as yet undescribed, so it remains unknown whether they have a common function with Chlamydomonas Tctex2b.

Tctex2b Is a Component of Inner Arm I1—All characterized Tctex2 family LCs are flagellar components (24, 47). Here we have shown that in Chlamydomonas Tctex2b is encoded by a single gene and that its message is up-regulated in response to deflagellation, suggesting that it functions in the flagellum. Furthermore, we observed that Tctex2b levels are drastically reduced only in Chlamydomonas strains that do not assemble inner arm I1 (i.e. ida1, which lacks I1, and pf28pf30, which is missing both I1 and the outer arms). That even minor amounts of this LC are present in these strains implies that Tctex2b can partially assemble within the axoneme even in the absence of intact inner arm I1. This notion is consistent with earlier data demonstrating that low levels of IC140 assemble in pf28pf30 and pf9-3 axonemes, which completely lack the 1α HC (11). In addition, reconstitution experiments revealed that a 53-kDa, C-terminal portion of IC140 binds only to axonemes lacking inner arm I1 and is presumably localized to the correct axonemal location independent of additional inner arm I1 subunits (11).

Further evidence that Tctex2b is associated with inner arm I1 was obtained after sucrose gradient centrifugation and anion exchange chromatography of axonemal extracts. Tctex2b copurified with known components of inner arm I1 (notably LC8, Tctex1, IC110, IC138, and IC140), which under wild-type conditions sediment together as a complex at ∼18 S (7, 48). Based on these biochemical and genetic data, we conclude that Tctex2b is an integral component of inner arm I1. This novel LC is the first Tctex2 protein to be identified within the inner arm system. Because Tctex1 is present in both inner arm I1 and cytoplasmic dynein (13, 22) it will be interesting to determine whether Tctex2b also functions as a cytoplasmic dynein subunit.

It was initially established in studies of Chlamydomonas and sea urchin sperm outer arm dynein that the ICs localize to the base of the soluble dynein particle and that they interact with each other and a series of LCs to form a basal or cargo binding complex (49-53). Thus, it is likely that the related IC140 of inner arm I1 also has several binding partners. For example, chemical cross-linking of pf28 axonemes or purified dynein using the zero-length reagent l-ethyl-3-(3-dimethylaminopropyl)carbodiimide suggests that IC140 also interacts with IC110 (11). The presence of both Tctex2b and IC140 in strains that lack other components of this inner arm raises the possibility that these two dynein polypeptides also interact.

Inner Arm I1 Components Assemble in the Absence of Tctex2b—Both the 1α and 1β HCs and IC140 are required for inner arm I1 assembly (8-10, 14, 48), and mutants lacking this motor display an impaired swimming phenotype because of alterations in waveform. Of the previously identified I1-associated LCs (LC8 and Tctex1), LC8 is apparently required for assembly because the LC8 null mutant (fla14) produces short flagella due to defects in intraflagellar transport (21) that have inner arm, outer arm, and radial spoke defects (LC8 is a component of all three complexes) (12, 13, 20). No tctex1 mutant has been identified in Chlamydomonas. However, in Drosophila a homozygous mutant at the dtctex1 locus is viable, although males are sterile due to defects in sperm motility (54). This suggests that Tctex1 is not absolutely required for cytoplasmic dynein function but does play an essential role in either sperm development, sperm axonemal function, or perhaps both. In contrast to the requirement for LC2 (Tctex2a) in outer arm dynein assembly (28), we found that axonemes from mutants lacking either Tctex2b or both PF16 and Tctex2b contained significant amounts of IC140, suggesting that this novel LC is not essential for assembly of inner arm I1.

Tctex2b Maintains the Integrity of Inner Arm I1—Although Tctex2b does not appear to be required for the assembly of inner arm I1, our data suggest that it augments the stability of this dynein motor. In wild type axonemal salt extracts, inner arm I1 (including Tctex2b) sediments as an ∼18 S particle. Furthermore, this association occurs in both the presence and absence of outer arms, eliminating the possibility of this dynein influencing the localization of Tctex2b as is the case for a novel member of the LC7/Roadblock family.3 However, the lack of Tctex2b did result in a very different sedimentation pattern for inner arm I1. In these strains the subunits of this dynein no longer remained associated after extraction from the axoneme. IC140 sedimented at ∼10 S, and Tctex1 no longer cofractionated with the higher molecular weight ICs, indicating that the entire complex had disassembled. This suggests that Tctex2b stabilizes the inner dynein arm through salt-insensitive associations.

Tctex2b Is Required for Dynein Motor Function—We have demonstrated that in the absence of Tctex2b, inner arm I1 is unstable in vitro. Furthermore, our microtubule sliding data indicate that the in situ inner arm lacking Tctex2b displays deficiencies in motor function as well. Using axonemes prepared from a Tctex2b null mutant (pf16-D2 rescued with PF16), we observed an ∼25% reduction in microtubule sliding velocity relative to the parental strain. An even more dramatic reduction occurred in the absence of the outer arm. When Tctex2b was reintroduced back into the null strain, sliding velocities recovered to those of the parent. These in vitro data implicating Tctex2b as a factor required for efficient motor function were also supported by in vivo observations. Cells lacking Tctex2b exhibited reductions of ∼27 and 29% in both swimming speed and beat frequency, respectively, compared with the parental strain. This indicates that the Tctex2b deficiency translates into functional inadequacies in vivo. It has been shown that the Tctex2a family members in salmonid and sea urchin sperm outer arm dynein are subject to phosphorylation that occurs coincident with the activation of sperm motility (47), suggesting that these LCs perform a regulatory function within the axoneme. Unlike the sperm Tctex2a proteins, however, Chlamydomonas Tctex2b lacks any predicted phosphorylation sites, and inner arm I1 LCs do not appear to be phosphorylated in vivo (55). Together, these data suggest that the reintroduction of Tctex2b corrects impaired motor function by increasing the structural stability of the motor rather than through a direct regulatory mechanism.

A Model for the Organization of Inner Arm I1—This dynein consists of two distinct heavy chains (1α and 1β), three ICs, and several LCs including Tctex1, Tctex2b, and LC8 (Fig. 10). Previously, we observed an additional 12-kDa component (13) that may represent a member of the LC/Roadblock family of dynein LCs.3 Current models for the arrangement of proteins within this dynein (7, 10) place the ICs and LCs at the base of the particle by analogy with the known location of outer arm and cytoplasmic dynein components. In axonemes from the double mutant pf28pf30, which lacks both the outer arm and inner arm I1, we detected both IC140 and Tctex2b. This observation implies that these two subunits can assemble in the absence of other dynein components and suggests that they may interact directly with an inner arm docking complex (analogous to that needed for outer arm assembly) (56), which is presumably necessary to specify the appropriate binding site within the axoneme.

Fig. 10.

Model for the organization of inner arm I1. This inner arm subspecies is composed of two HCs (1α and 1β) whose N-terminal stems lead to a basal/cargo binding region that also includes three ICs (IC140, IC138, and IC110) and several LCs (LC8, Tctex1, and Tctex2b and an unidentified 12 kDa component). The arrangement of ICs and LCs at the base of the dynein particle is hypothetical. Based on chemical cross-linking data, IC140 and IC110 are thought to interact (11). Tctex1 is positioned near the N terminus of IC140 because this region contains a Tctex1 binding consensus sequence (42). A potential interaction between Tctex2b and IC140 is predicted based on the ability of both proteins to assemble in small amounts in inner arm I1-defective strains. An additional association between Tctex2b and Tctex1 is predicted because in high salt extracts Tctex1 dissociates from inner arm I1 in the absence of Tctex2b. Phosphorylation (P) of IC138 is involved in the regulation of flagellar activity.

In cytoplasmic dynein Tctex1 binds the consensus (K/R)(K/R)XX(K/R) within IC74 (43). A perfect copy of this motif is present in Chlamydomonas IC140 (residues 269-273) and may mediate the association of Tctex1 with inner arm I1. However, this cannot be the sole interaction involved in Tctex1 binding because we found that this protein completely dissociates from the I1 complex in the absence of Tctex2b. Quantitative densitometry indicated that two copies of Tctex1 are present within the inner arm complex (13). However, we have found that Tctex1 and Tctex2b precisely comigrate in SDS-polyacrylamide gels. Because Tctex1 and Tctex2b form dimers, it is possible that inner arm I1 actually contains a heterodimer formed from these two LCs. Alternatively, different classes of inner arm may exist depending on whether they contain a Tctex1 or Tctex2b homodimer.

In conclusion, we describe here a novel component of the Chlamydomonas inner dynein arm I1 that defines a distinct subfamily within the Tctex2 class of dynein LCs and is required for the structural integrity and motor function of this enzyme. Tctex2b has the intriguing property that it can assemble within the axoneme in the absence of many other components of this dynein. Further analysis will provide insight into the structural mechanisms by which Tctex2b modulates dynein motor activity.

Acknowledgments

We thank Dr. Winfield Sale (Emory University School of Medicine) for Chlamydomonas strain pf28pf30 and for the polyclonal antibody to IC140 and Drs. Carolyn Silflow and Paul Lefebvre (University of Minnesota) for mapping the TCTEX2B gene. We also thank the following for help in developing the beat frequency analysis system: Drs. Ritsu Kamiya, Shinji Kamimura, and Toshiki Yagi (University of Tokyo), Drs. Shoji A. Baba and Yoshihiro Mogami (Ochanomizu University), and Dr. Miho Sakato (University of Connecticut Health Center).

Footnotes

  • 1 The abbreviations used are: HC, heavy chain; HA, hemagglutinin; IC, intermediate chain; LC, light chain; Resc., rescued; kb, kilobase; MBP, maltose-binding protein; UTR, untranslated region.

  • 2 R. Patel-King and S. M. King, unpublished information.

  • 3 L. M. DiBella and S. M. King, manuscript in preparation.

  • The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EBI Data Bank with accession number(s) BK004867.

  • * This study was supported by Grants GM51293 (to S. M. K.) and GM51379 (to E. F. S., as a consortium agreement, P. A. Lefebvre, University of Minnesota) from the National Institutes of Health, Grant 5-FY99-766 (to E. F. S.) from the March of Dimes Birth Defects Foundation, and a postdoctoral fellowship from the Lalor Foundation (to K. W.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

    • Received December 10, 2003.
    • Revision received January 26, 2004.

References

« Previous | Next Article »Table of Contents
  • Advertisement
  • Advertisement
Advertisement