Involvement of Inflammation, Degradation, and Apoptosis in a Mouse Model of Glaucoma*♦
- Department of ‡Ophthalmology, §Dean A. McGee Eye Institute, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma 73104, the ∥Biofunctional Science Biomedical Engineering Research Organization, Tohoku University, Sendai, Miyagi 980-8575, Japan, and the ¶West China Hospital, Sichuan University, Chengdu, Sichuan 610041, China
- ** To whom correspondence should be addressed: Dept. of Ophthalmology, University of Oklahoma Health Sciences Center, Dean A. McGee Eye Inst., 608 Stanton L. Young Blvd., Oklahoma City, OK 73104. Tel.: 405-271-3370; Fax: 405-271-3721; E-mail: wei-cao{at}ouhsc.edu.
Abstract
Glaucoma is a common cause of blindness affecting at least 66 million people worldwide. Pigmentary glaucoma is one of the most common forms of secondary glaucoma, and its pathogenesis remains unclear. Interleukin-18 (IL-18) is an important regulator of innate and acquired immune responses and plays an important role in inflammatory/autoimmunity diseases. Using the DBA/2J mouse as an animal model of human pigmentary glaucoma, we demonstrated for the first time that the expression of the IL-18 protein and gene in the iris/ciliary body and level of IL-18 protein in the aqueous humor of DBA/2J mice are dramatically increased with age. This increase precedes the onset of clinical evidence of pigmentary glaucoma, implying a pathogenic role of inflammation/immunity in this disease. We also observed that activated NF-κB and phosphorylated MAPK are increased in the iris/ciliary body of DBA/2J mice, suggesting that both signaling pathways may be involved in IL-18 mediated pathogenesis of pigmentary glaucoma in the eyes of DBA/2J mice. In addition, matrix metalloproteinase-2 (MMP-2) expression in the iris/ciliary body and the activity of MMP-2 in the aqueous humor are increased whereas tissue inhibitor of matrix metalloproteinase-1 (TIMP-1) expression in the iris/ciliary body is decreased, indicating that the degradation process is involved in this mouse model of pigmentary glaucoma. Furthermore, the expressions of apoptosis-related genes, caspase-8, Fas, FADD, FAP, and FAF, and the activity of caspase-3 are increased in the iris/ciliary body of DBA/2J mice. Elucidation of biochemical and molecular mechanisms of IL-18 participation in the pathogenesis of pigmentary glaucoma should provide approaches for developing improved and targeted treatments to ameliorate this blinding disease. The possibility that altered IL-18 expression in the eye of DBA/2J mice initiates and/or amplifies the pathogenesis of pigmentary glaucoma requires further investigation.
Pigment dispersion syndrome affects approximate 220,000 Americans, and 25-50% of pigment dispersion syndrome patients eventually go on to manifest as pigmentary glaucoma (www.wills-glaucoma.org/2003symp/moster.htm). Since its initial description over 50 years ago, pigmentary glaucoma has become recognized as one of the most common forms of secondary open-angle glaucoma. It affects a much younger patient population than most other forms of open-angle glaucoma. Hallmarks of this disease include midperipheral iris transillumination defects and a heavily pigmented trabecular mesh-work. The primary causes of these abnormalities are unknown, and the etiology is poorly understood (1, 2). At the present time, the medical treatments of pigmentary glaucoma are the nonspecific reduction of intraocular pressure (IOP)1 with aqueous suppressants, laser trabeculoplasty, and filtering surgery. Yet, little is known about the molecular and biochemical mechanism(s) underlying this disorder.
The DBA/2J mouse has been described as an animal model of human pigmentary glaucoma (3, 4). This mouse strain presents several hallmarks of the human pigmentary glaucoma including iris atrophy, pigment dispersion, peripheral anterior synechiae that are associated with development of elevated IOP, retinal ganglion cell loss, and optic nerve head excavation and is not representative of other forms of glaucoma (4-6). The DBA/2J mouse has two missense mutations (Cys110 → Tyr, Arg326 → His) in the tyrosinase-related protein 1 (TYRP1) gene (5, 6), which causes disrupted melanosomes and clumping of pigment in affected tissues, and these abnormalities are likely to lead to the iris atrophy and subsequent glaucoma observed in the DBA/2J mouse. Glycoprotein (transmembrane) NMB (GPNMB) is important for melanin biosynthesis and the development of the retinal pigment epithelium and the iris (7). GPNMB is reported to be expressed in some types of dendritic cells (8). TYRP1 and melanin have been identified as antigens relevant to inflammatory eye disease (9, 10), and melanin can also exhibit adjuvant-like properties (9, 11). It has been demonstrated that the aqueous humor from eyes of affected DBA/2J mice lack the capacity to suppress T cell activation (12). This implies that the pigment disposal in the eyes of DBA/2J mice may involve immune dysfunction and that a mild but chronic inflammatory response occurs in DBA/2J mice.
Interleukin-18 (IL-18), previously known as interferon-γ-inducing factor and a recently described member of the IL-1 cytokine superfamily, is now recognized as an important regulator of innate and acquired immune responses (27). Increased levels of IL-18 have been reported in inflammatory/autoimmune diseases (13). Its functional activities include promotion of cytokine release, particularly TNF-α, GM-CSF, IFN-γ, and Fas-FasL-mediated cytotoxicity. In addition, IL-18 induces NO release, activates NF-κB, possesses prodegradative effects (14-16); up-regulates inducible NO synthase, stromelysin, cycloxy-genase-2, IL-6, IL-8, IL-13, and matrix metalloproteinase expression; down-regulates the antiapoptotic Bcl-2 and Bcl-XL gene expression; and activates caspases-8, -3, and -9 in many cells and tissues (17-19). IL-18 shares signaling pathways with other IL-1R family members responsible for phosphorylating NF-κB-inducing kinase and IkB-α degradation which allows NF-κB nuclear translocation. In addition, a role for mitogen-activated protein kinases (MAPK) in IL-18 signaling has recently been suggested (17, 19). The role of IL-18 in the eye is not clear. It has been reported that concurrent administration of IL-12 and IL-18 to mice induced epithelium apoptosis and caused serious atrophy in the lacrimal glands with markedly elevated serum levels of IFN-γ (20). In the cornea, IL-18 is expressed in epithelial cells. Increased bioactive corneal IL-18 production can be induced by a number of pro-inflammatory agents and may play an important role in initiating IFN-γ-mediated inflammatory responses (21). IL-18 is expressed in the epithelial cells of the iris/ciliary body and in the retina, but its role in these tissues remains undetermined (22).
In the present study, we have made novel observations showing that IL-18 expression in the iris/ciliary body and the level of IL-18 protein level in the aqueous humor of DBA/2J mice is significantly increased. We also observed that activated NF-κB and phosphorylated MAPK are increased in the iris/ciliary body of DBA/2J mice. In addition, matrix metalloproteinase-2 (MMP-2) expression in the iris/ciliary body and the activity of MMP-2 in the aqueous humor are increased, whereas tissue inhibitor of matrix metalloproteinase-1 (TIMP-1) expression in the iris/ciliary body is decreased. Furthermore, the expression of apoptosis-related genes and the activity of caspase-3 are increased in the iris/ciliary body of DBA/2J mice. These indicate that the events of inflammation, degradation, and apoptosis are involved in the pathogenesis of pigmentary glaucoma of DBA/2J mice.
EXPERIMENTAL PROCEDURES
Animals—The DBA/2J and C57BL/6J mice used in this study were from the Jackson Laboratory. All animals were born and raised in a 12-h on versus 12-h off cyclic light environment at an illumination of 50-60 lux. Animals were cared for and handled according to the Association for Research in Vision and Ophthalmology statement for the use of animals in vision and ophthalmic research and with IACUC approved animal use protocols, which comply with the University of Oklahoma Faculty of Medicine guidelines for use of animals in research.
IOP Measurement—IOP was measured using the TonoVet (Colonial Medical Supply, Franconia, NH), an impact (rebound) tonometer. Using this impact tonometer, we were able to measure IOP in awake and nonsedated mice of various ages. Eyes were topically anesthetized with 0.5% tetracaine before IOP measurement. Topical administration of 0.5% tetracaine did not affect IOP. Measurement of IOP was always performed in the morning between 10 and 11 a.m. Six measurements were taken from each eye and averaged.
Identification of Retinal Ganglion Cells—Retinal ganglion cells were identified by retrograde labeling with 4-di-10-ASP (catalog number D-291, Molecular Probes, Eugene, OR). Two-month-old mice were anesthetized by intraperitoneal administration of a mixture of xylazine and ketamine.
The skin over the cranium was incised, and the skull was exposed. Holes ∼1 mm in diameter were drilled in the skull 4 mm posterior
to bregma, 1 mm lateral to the midline on both sides of the midline raphe. These positions correspond to the superior colliculi
as determined from a stereotactic mouse brain atlas. Three microliters of neurotracer dye 4-di-10-ASP at a concentration of
25 mg/ml were injected into superior colliculi through both holes 2 mm deep. The skull openings were then sealed with a petroleum
based antibiotic ointment. The overlying skin was sutured and antibiotic ointment was applied externally. The mice were killed
by CO2 inhalation in an approved delivery system. Whole retinal flat mounts were prepared by detaching the retina at the ora serrata
and making eight radial relaxing incisions. Imaging of the labeled retinas was performed with a digital camera and a fluorescence
microscope at ×20 magnification. Two areas (0.1419 mm2 each) per retinal quadrant at
and
of the retinal radius were imaged. Cell counting was performed under masked conditions by two independent investigators.
We were able to observe labeled retinal ganglion cells in normal mice (C57BL/6J) even 12 months after injection of 4-di-10-ASP.
Retinal ganglion cell density was determined by counting the 4-di-10-ASP-labeled retinal ganglion cells (RGCs) from eight
designated areas in flat-mounted retinas. The total area of the eight fields was 1.1352 mm2, which was more than the area counted by others (63, 64).
Quantitative Real-time PCR—After the animals were killed as described previously, the eyes were immediately enucleated, and incisions were made at the ora seratta to remove the anterior segment of the eyes. The iris and ciliary body were separated from the other eye tissue carefully. The Iris/ciliary body tissues were homogenized in the RNA isolation agent TRIzol (Invitrogen) with a Dounce-type homogenizer as described. Total RNA in the extract was quantified by absorbance at 260 nm. Purified RNA was digested with DNase I (Promega, Madison, WI) to remove contamination from genomic DNA. Primers were designed with IDT design software (Integrated DNA Technologies, Inc.). All primers were designed with an annealing temperature of 60 °C and a GC content of 55-63%. Specificity of the primers was verified by determining amplicon sizes by gel electrophoresis and by melting curve analysis. In addition, the specificity of the selected primers was verified by a BLAST search of the GenBank™ data base. Real-time PCR was performed in 96-well plates using standard protocols with SYBR® Green as a fluorescent detection dye in a Bio-Rad iCycler. All PCR reactions were at a final volume of 30 μl comprised of SYBR Green PCR mix, 600 μm forward and reverse primers, and 1 ng of cDNA. We used the following PCR cycle parameters: polymerase activation for 15 min at 95 °C, 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 60 s. Fluorescence was measured at 72 °C. Melting curve analysis between 50 and 100 °C at 0.5 °C intervals was applied to characterize the generated amplicons and to control for contamination by nonspecific by-products. Standard curves for six 2-fold dilution steps between 4 and 0.125 ng of reverse-transcribed RNA samples were run for all primer pairs in triplicate to determine the PCR efficiency for the different target genes and the housekeeping gene. All PCR reactions for a given sample were performed in five replicates to control for the variability of the PCR amplification. After the exclusion of outliers as determined by irregularities in their amplification curves or their melting curves, the averages of the replicates were used for statistical data processing. At least three no amplification control, a minus-reverse transcriptase control) and three no template control (a minus sample control) were included in each reaction plate. The quantity of mRNA was calculated by normalizing the CT (threshold cycle) of the target gene to the CT of the GAPDH housekeeping gene in the same sample, according to the following formula. The average GAPDH CT (each multiplex PCR was performed in triplicate) was subtracted from the average target gene CT; the result represents the ΔCT. This ΔCT is specific and can be compared with the ΔCT of a calibration sample. The subtraction of control ΔCT from the ΔCT of the target gene is referred as ΔΔCT. The relative quantification of expression of a target gene (in comparison with control) was determined by using 2-ΔΔCT.
Semiquantitative Reverse Transcription (RT)-PCR—For RT-PCR, 4 μg RNA was mixed in water with random hexamers (50 ng/μl) and 10 mm dNTPs heated to 65 °C for 5 min. The 20-μl RT reaction, which contained RNA, primers, 5 mm MgCl2, 10 mm dithiothreitol, 0.5 mm dNTPs, 40 units of RNase inhibitor (RNase OUT), and 50 units of Superscript II reverse transcriptase (Invitrogen), were assembled. The mixture solution was heated at 42 °C for 1 h and then at 70 °C for 15 min. After chilling on ice, 2 units of RNase H was added to each reaction and incubated at 37 °C for 20 min. PCR was carried out in 50-μl reaction volumes, containing 2 μl of cDNA, 2 units of TaqDNA polymerase (Invitrogen), 0.2 mm dNTPs, 10 μm each of forward and reverse primers, and 1.5 mm MgCl2. Amplification cycles were: one cycle at 94 °C for 3 min, followed by 35 cycles of 94 °C for 20 s, 58 °C for 45 s, and 72 °C for 1 min, terminating with 72 °C for 10 min. The products were run on 1% agarose gel containing 10 ng/ml ethidium bromide and visualized under UV light.
Multiprobe RNase Protection Assay—To quantify multiple apoptosis and death receptors/activators mRNAs, a RiboQuant Multiprobe RPA system (PharMingen) with mouse multiprobe template set mAPO-3 was used. The mAPO-3 set contains templates of caspase-8, FASL, FAS, FADD, FAP, FAF, TRAIL, TNFR, TRADD, and RIP. The multiprobe template was biotin-labeled and hybridized overnight with ∼10 μg of RNA. The hybridized RNA was treated with RNase to digest unhybridized RNA and was purified according to the RiboQuant protocol. The samples were subjected to electrophoresis in 6% polyacrylamide-Tris borate-EDTA-urea gels using a Seqi-Gen GT nuclear acid electrophoresis cell (Bio-Rad). The gels were dried and exposed to x-ray film, and the blot densities were quantified in a NuclearVision 760 Imaging work station (Hayward, CA) using GAPDH bands as concentration standards.
Clinical appearance of anterior segments and iris morphology in C57BL/6J and DBA/2J mice. A, representative photograph of normal iris surface from a 9-month-old C57BL/6J mouse. B, little dispersed pigment was visible at the edge of the pupil from a 3-month-old DBA/2J mouse. C, widespread dispersed pigment and iris atrophy/neovascularization were observed from a 9-month-old DBA/2J mouse. D, normal iris morphology in paraffin-fixed cross-section from 9-month-old C57BL/6J mouse. E, slight iris atrophy was observed in 3-month-old DBA/2J mouse. F, severe iris atrophy and pigment dispersion were seen in a 9-month-old DBA/2J mouse.
Electrophoretic Mobility Shift Assay (EMSA)—The preparation of retinal nuclear extracts and determination of the NF-κB DNA binding activity were performed using a nuclear and cytoplasmic reagent kit (NE-PER; Pierce). Briefly, retina samples were homogenized in 100 μl of ice-cold cytoplasmic extraction reagent I with a Dounce homogenizer. The sample was vortexed vigorously for 15 s, followed by a 10-min incubation on ice, addition of 5.5 μl of ice-cold cytoplasmic extraction reagent II, and centrifugation at 14,000 × g for 5 min at 4 °C. The supernatant (cytoplastic extract) was immediately transferred to a clean prechilled tube. The nuclear pellet was extracted with 50 μl of ice-cold nuclear extraction reagent, vortexed 15 s, and incubated on ice for 40 min. The extract was centrifuged at 14,000 × g for 10 min at 4 °C, and the supernatant was frozen at -70 °C. The protein concentration was determined by the method of Lowry using bovine serum albumin (BSA) as a standard. EMSA was performed using EMSA chemiluminescence kit (LightShift; Pierce) according to the manufacturer's protocols. A biotin-labeled oligonucleotide containing an NF-κB DNA-binding consensus sequence, 5′-AGT TGA GGG GAC TTT CCC AGG C-3′ (Panomics, Inc.), and a unlabeled oligonucleotide, 5′-AGT TGA GGC GAC TTT CCC AGG C-3′, was used to study NF-κB DNA binding activity. Briefly, 3 μg of nuclear extracts from the whole retina was preincubated in a reaction mixture for 20 min, and biotin end-labeled oligonucleotide containing the κB consensus sequence was added. Five microliters of loading buffer was added to each sample. A 20-μl aliquot of the samples was electrophoresed through a 6% nondenaturing polyacrylamide gel. Finally, the gel was dried and exposed to x-ray film.
Western Blot Analysis—Western blot analysis was performed as described previously (23, 24). The iris/ciliary body tissues were sonicated in 0.0625 m Tris-HCl, pH 6.8, then centrifuged for 15 min and the supernatant assayed for protein using a Bradford assay. Aliquots (10 μg) of the sonicated supernatant were loaded onto SDS-PAGE mini-gels, electrophoresed, and transferred to nitrocellulose paper. After transferring, blots were washed for 2 × 10 min in TTBS (0.1% Tween 20 in 20 mm Tris-HCl, pH 7.4, and 410 mm NaCl) and blocked with 10% BSA in TTBS or with 1% milk and 1% BSA in TTBS for 2 h at room temperature or overnight at 4 °C. Blots were incubated with antibodies for 2 h at room temperature. Following primary antibody incubations, blots were washed three times for 5 min each with TTBS, then incubated for 1 h with HRP-linked secondary antibodies, washed four times for 10 min each with TTBS, and developed by ECL. In some instances, membranes were stripped by incubation in stripping buffer (62.5 mm Tris-HCl (pH 6.8), 2% SDS, and 100 mm 2-mercaptoethanol) for 30 min at 50 °C and reused.
ELISAs for Enzymatic Activity Assays—Commercially available ELISA kits were used for detection of IL-18 protein level in the aqueous humor (Bender MedSystems, San Bruno, CA) and for the measurement of caspase-3 activity (BioSource International, Inc., Camarillo, CA) according to the manufacturer's instructions. Immediately after the mouse was killed by CO2 inhalation, the aqueous humor was obtained using a 30-gauge needle and 10-μl micropipettes (Fisher Scientific) by capillary attraction and pooled into a siliconized microcentrifuge tube (Fisher Scientific). The aqueous humor sample was dilute 1:10 and centrifuged at 3000 rpm for 3 min. The cell-free supernatant was frozen immediately at -70 °C. The total protein content in aqueous sample was measured using the bicinchoninic acid protein assay reagent kit (Pierce) in reference to a bovine albumin standard.
Gelatin Zymogram—The activities of MMP-2 and MMP-9 of the aqueous humor were measured by gelatin-zymogram protease assays. Samples were prepared with standard SDS-gel-loading buffer containing 0.01% SDS without β-mercaptoethanol and were not boiled before loading. Next, the samples were subjected to electrophoresis with 8% SDS-polyacrylamide gels (0.75-mm thick, acrylamide/bisacrylamide = 30/1.2) containing 0.1% gelatin. Electrophoresis was performed at 150 V for 3 h. After electrophoresis, gels were washed twice with 100 ml of distilled water containing 2% Triton X-100 on a gyratory shaker for 30 min at room temperature to remove SDS. The gels were then incubated in 100 ml of reaction buffer (40 mm Tris-HCl, pH 8.0, 10 mm CaCl2, 0.02% NaN3) for 12 h at 37 °C, stained with Coomassie Brilliant Blue R-250, and destained with methanol-acetic acid-water (50/75/875, v/v/v).
Immunohistochemistry—Immunohistochemistry staining was performed as described previously (25, 26). Briefly, the eye was enucleated then fixed with 4% paraformaldehyde in phosphate-buffered saline for 4 h. The whole eye was cut along the vertical meridian. Rabbit anti-IL-18 polyclonal antibody was purchased from Biovision, Inc. Hamster anti-CD69 antibody was purchased from Biolegend (San Diego, CA). The secondary antibody was labeled with fluorescein isothiocyanate (green). Control sections were treated in the same way with omission of primary antibody or with rabbit IgG. Sections were viewed and photo-graphed with fluorescence microscopy.
RESULTS
Elevated IOP, Iris Atrophy, and Retinal Ganglion Cell and Neurofiber Loss in the DBA/2J Mouse—As shown in Fig. 1, C and F, dramatic iris atrophy in 9-month-old DBA/2J mice was observed in comparison to that of age-matched C57BL/6J mice. Enlarged blood vessels were seen in the iris (as indicated by the black arrow in Fig. 1C) in ∼50% of DBA/6J mice at 9 months. This alteration is a novel observation and has not been reported in previous publications. The iris edge is indicated by the light green arrow in Fig. 1C and the red arrow in Fig. 1F, showing a pseudo-membrane covering the pupil area.
Using the impact tonometer, 578 eyes from 293 C57BL/6J mice and 398 eyes of 201 DBA/2J mice were measured at ages ranging from 1 to 25 months. As shown in Fig. 2A, IOPs of C57BL/6J mice were stable with age, although there was a slight increase after 20 months. There was no significant difference between C57BL/6J and DBA/2J mice in IOP level at ages 1 and 3 months, whereas a significant increase in IOP was seen in some DBA/2J mice at age 4 months. This increase reached its peak at age 6-9 months and slightly declined at 12 months (Fig. 2B).
Measurement of IOP of C57BL/6J and DBA/2J mice using an impact tonometer. A, IOPs measured in 578 eyes from 293 C57BL/6J mice at different ages. B, increase in IOP in DBA/2J mice.
RGC density was determined by counting the 4-di-10-ASP-labeled RGCs in flat-mounted retinas (Fig. 3A). As shown in Fig. 3B, significant loss of ganglion cells was observed in the flat whole-mount retina of DBA/2J mouse in comparison with its age-matched C57BL/6J mouse (Fig. 3A). Red arrows indicate 4-di-10-ASP-labeled neurofiber. Clear reduction of neurofiber was also observed in the retinas of DBA/2J mice. In addition, a large amount of 4-di-10-ASP-labeled ganglion cell debris was seen in the retina of DBA/2J mice (Fig. 3B). The morphological difference between the ganglion cell layer and neurofiber layer in the retina of C57BL/6J control animals and DBA/2J mice at matched age was compared by histology. As shown in the paraffin cross-sections in Fig. 3, C and D, significant loss of ganglion cells in the retina of DBA/2J mice was observed as indicated by white arrows. Again, a dramatic reduction of the neurofiber layer was seen as indicated by black arrows.
Increase in IL-18 Expression in the Eye of the DBA/2J Mouse—IL-18 gene expression was examined by quantitative Real-Time PCR and semiquantitative reverse transcription-PCR using following primers: for IL-18, AGAAACCACCGGAAGGAACCATCT (forward primer) and CGGCCAGCTTGGAAGTCATGTTTA (reverse primer); for GAPDH, CATGTTCGTCATGGGTGTGAACCA (forward primer) and AGTGATGGCATGGACTGTGGTCAT (reverse primer). Electrophoresis of semiquantitative RT-PCR showed 57-bp products for IL-18 and 160-bp products for GAPDH control. Our results showed that IL-18 gene expression significantly increased with age in the iris/ciliary body of DBA/2J mice (Fig. 4, A and B). Immunohistochemistry studies showed that IL-18 is heavily expressed in the anterior chamber side of the iris at 6 months (Fig. 4D) when compared with expression 1 month (Fig. 4C). Western blot analysis also shows an increase in IL-18 protein expression in the iris/ciliary body with age (Fig. 4, E and F). The protein level of IL-18 in the aqueous humor of DBA/2J mice was also increased with age (Fig. 4G). These significant increases in IL-18 expression and secretion start as early as 3 months of age, which is prior to the development of elevated IOP, and reach a peak at 6 months of age.
To correlate the IOP alteration to IL-18 level in the eyes of single individual DBA/2J mice, we examined nine DBA/2J mice (18 eyes) at the age of 6-9 months. As shown in Table I, only three eyes from two animals have “normal” range IOP, whereas the IL-18 levels in the aqueous humor of these eyes were 798, 864, and 917 pg/ml, which are still significantly higher than that of normal control (300-500 pg/ml, C57BL/6J) at the same age range. Correlation analysis was performed using the data listed in the Table I showing a significant correlation between IOP and IL-18 concentration in the aqueous humor in the DBA/2J mouse (p < 0.017) (Fig. 4H).
Correlation between IOP and aqueous humor IL-18 concentration in DBA/2J mouse
RGC degeneration in DBA/2J mouse. A, RGCs labeled by neurotracer in flat-mounted retina of C57BL/6J mouse. B, significant loss of ganglion cells in the flat whole-mount retina of DBA/2J mouse. C, normal RGC density and neurofiber layer thickness in the paraffin cross-section of the retina of C57BL/6J mouse. D, significant loss of RGCs and neurofibers in the retina of a DBA/2J mouse at the age of 9 months.
Increased MMP-2 Expression in the Eye of the DBA/2J Mouse—MMP-2 protein expression in the iris/ciliary body of DBA mice at ages of 3 and 6 months was clearly increased compared with age-matched C57BL/6J mice (Fig. 5, A and C). In addition, gelatin zymogram analysis also demonstrated that the MMP-2 activity was dramatically increased in the aqueous humor of DBA/2J mice at the age of 6 months (Fig. 5, B and D). Furthermore, the gene and protein expression of TIMP-1 were decreased in DBA/2J mice at ages of 3 and 6 months as detected by Western blots and RT-PCR analysis using forward primer (TIMP-1): CAGCCTTGTGCAACTCCCAAATC and reverse primer (TIMP-1): CAAGGCGCTGAAACCCTTGAACAT (Fig. 6).
Activation of MAPK and NF-κB Signaling in the Eye of the DBA/2J Mouse—As shown in Fig. 7A, phosphor-MAPK was increased, whereas total MAPK protein level in the iris/ciliary body was not altered. In addition, the increase in translocalization of NF-κB from cytoplasm to nuclei in the iris/ciliary body tissue was observed by an electrophoretic mobility shift assay (Fig. 7B).
Increase in the Gene Expression and the Activity of Apoptotic Signaling Elements in the Eye of the DBA/2J Mouse—We used multiprobe RNase protection assay to detect the altered gene expression of intrinsic and extrinsic apoptotic signaling components in the iris/ciliary body of DBA/2J mice. The results show that the gene expressions of caspase-8, Fas, FADD, FAP, and FAF and TNFRα were increased in the iris/ciliary body of DBA/2J mice at the age of 6 months (Fig. 8B). Measurements of caspase-3 activities were performed using commercially available kits according to manufacturer's manuals (BioSource International, Inc.), showing that the activity of caspases-3 in the iris/ciliary body of DBA/2J mice was significantly increased at the age of 5 months, and this increase reached a peak at the age of 6 months, then slightly declined at the age of 9 months (Fig. 8A).
Increase in IL-18 expression in the iris/ciliary body of DBA/2J mice. A, quantitative real-time PCR analysis shows a significant increase in IL-18 gene expression at age 3 months (2.68-fold ± 0.98, mean ± S.D., p < 0.042, n = 3). The fold change peaks at age 6 months (3.81 ± 1.24, mean ± S.D., p < 0.018, n = 3), then slightly declines at age of 9 months (2.76 ± 1.33, mean ± S.D., p < 0.043, n = 3). B, semiquantitative reverse transcription-PCR also demonstrates an increase in IL-18 gene expression in the iris/ciliary body of DBA/2J mice at age 6 months. C, localization of IL-18 protein in the iris of 1-month-old DBA/2J mouse. D, heavily expressed IL-18 in the anterior chamber side of iris in a 6-month-old DBA/2J mouse was observed. E, Western blot analysis shows increases in IL-18 protein expression in the iris/ciliary body of DBA/2J mice at the ages of 3 and 6 months. F, the data were normalized with loading controls, which show a 2.03-fold increase at the age of 3 months (n = 3) and a 3.17-fold increase at the age of 6 months (n = 3). G, ELISA analysis shows elevation of IL-18 protein concentration in the aqueous humor in DBA/2J mice with age. A significant increase starts at the age of 3 months (827 pg/ml ± 247, mean ± S.D., p < 0.012, n = 5) and reaches a plateau at 6 months (1159 pg/ml ± 332, mean ± S.D., p < 0.002, n = 5). The increase is maintained at similar levels at the age of 9 months (1230 pg/ml ± 403, mean ± S.D., p < 0.002, n = 5) and at the age of 12 months (1232 pg/ml ± 289, mean ± S.D., p < 0.001, n = 5). H, correlation between IOP and aqueous humor IL-18 concentration (ELISA data) in 18 eyes from the DBA/2J mice data presented in Table I. Correlation analysis, performed using the ELISA data listed in the Table I, shows a significant correlation between IOP and IL-18 concentration in the aqueous humor of the DBA/2J mouse (p < 0.017).
Detection of CD69-positive Cells in the Iris and the Anterior Chamber of the DBA/2J Mouse—It has been reported that the eyes of DBA/2J mice exhibit defects of the normally immunosuppressive ocular microenvironment including inability of aqueous humor to inhibit T cell activation (12). Histological analysis showed significant infiltration of inflammatory leukocytes within the iris and into aqueous humor and their accumulation in the inferior angle of the anterior chamber (Fig. 9, A and B). CD69 is rapidly induced on activated T and B cells, NK cells, and granulocytes and can be used as a marker for activated T cells to indicate an inflammatory response. Immunofluorescent staining using anti-CD69 antibody (Biolegend) shows CD69-positive cells in the iris and anterior chamber (Fig. 9, C and D).
DISCUSSION
We have found in this study that: 1) IL-18 expression in the iris/ciliary body and the level of IL-18 protein level in the aqueous humor of DBA/2J mice are significantly increased and these increases are prior to the development of elevated IOP and ganglion cell loss; 2) MMP-2 expression in the iris/ciliary body and the activity of MMP-2 in the aqueous humor are increased whereas TIMP-1 expression in the iris/ciliary body is decreased; 3) activated NF-κB and phosphorylated MAPK are increased in the iris/ciliary body of DBA/2J mice; 4) the gene expression of caspase-8, Fas, FADD, FAP, FAF, and TNFRαSS and the activity of caspase-3 are increased in the iris/ciliary body of DBA/2J mice. These findings indicate that the events of inflammation, degradation, and apoptosis are involved in the pathogenesis of pigmentary glaucoma of DBA/2J mice.
We used the TonoVet (Colonial Medical Supply) to measure the IOP of DBA/2J and C57BL/6J mice. This impact (rebound) tonometer has clinically been used by veterinary ophthalmologists (Jeff Bowersox, Veterinary Specialty Center, Wilmington, DE; Margi Gilmour, Oklahoma State University; Marta Leiva, University of Georgia; Ron Ofri, Koret School of Veterinary Medicine; personal communications) as a noninvasive tool for measuring rat and mouse IOP. A strong correlation between the true IOP and the impact tonometer in measuring mouse IOP has been reported in several publications (28-30). Using the impact tonometer, we were able to measure IOP in awake and nonsedated mice at various ages. The IOP alteration pattern we have observed is consistent with observations reported by other groups (4, 28-30) indicating that this tonometer system is a reliable tool to measure small animal IOP.
Increase in MMP-2 expression and activity in the eyes of DBA/2J mice. A, increase in MMP-2 protein expression in the iris/ciliary body of DBA mice compared with age-matched C57BL/6J mice. B, the blots were reprobed with anti-β-actin antibody severing as a control for protein loading. The data were normalized with loading controls which show a 1.87-fold increase at the age of 3 months (n = 5) and a 3.69-fold increase at the age of 6 months (n = 5). C, gelatin zymograph analysis shows that the MMP-2 activity was dramatically increased in the aqueous humor of DBA/2J mice at the age of 6 months. D, data from five independent experiments were averaged and compared with age-matched C57BL/6J mice (mean ± S.D., n = 5). Significant difference is indicated by asterisks, and p values are also indicated.
Reduction of TIMP-1 gene and protein expression in the iris/ciliary body of DBA/2J mice. A, Western blot analysis shows a clear decrease of TIMP-1 protein expression in the iris/ciliary body of DBA/2J mice. B, the blots were reprobed with anti-β-actin antibody serving as a control for protein loading. Data from three independent experiments were normalized, averaged, and compared with age-matched C57BL/6J mice (mean ± S.D., n = 3). Significant difference is indicated by asterisks, and p values are also indicated. C, clear reduction of TIMP-1 gene expression in the iris/ciliary body of DBA/2J mice detected by RT-PCR. D, data from three independent experiments were averaged, normalized with GAPDH, and compared with age-matched C57BL/6J mice (mean ± S.D., n = 3). Significant difference is indicated by asterisks, and p values are also indicated.
It has been demonstrated that the aqueous humor from eyes of affected DBA/2J mice lacks the capacity to suppress T cell activation, and this abnormality precedes the onset of clinical evidence of pigment dispersion (12). This implies a possible pathogenic role for inflammation/autoimmunity in this disease. TYRP1 and melanin have been identified as antigens relevant to inflammatory eye disease (9, 10), and melanin can also exhibit adjuvant-like properties (9, 11). GPNMB is reported to be expressed in some types of dendritic cells (8), a potent professional APC normally resident in the iris (31, 32). CD69, known as antigen-presenting cells (AIM), EA1, MLR3 and gp34/28, is a C-type lectin, closely related to the NKR-P1 and Ly-49 NK cell activation molecule. CD69 is rapidly induced on activated T and B cells, NK cells, and granulocytes and is a marker for activated T cells. In this study, we clearly observed that CD69-positive cells are present in the iris and anterior chamber of the DBA/2J mouse indicating an inflammatory response in the iris/ciliary body. IL-18 is a proinflammatory cytokine that belongs to the IL-1 family of ligands (13, 17) and is an important regulator of innate and acquired immune responses. The role of IL-18 has been described in many autoimmune and inflammatory diseases such as rheumatoid arthritis, ischemic renal and heart diseases, as well as atherosclerosis and multiple sclerosis (33-36). We have demonstrated in the present study that IL-18 gene and protein expression was significantly increased with age in the iris/ciliary body of DBA/2J mice, and the protein level of IL-18 in the aqueous humor of DBA/2J mice also increased with age. These findings are novel observations suggesting a role of IL-18 in the pathogenesis of pigmentary glaucoma in this animal model.
Activation of MARP and NF-κB in the eyes of DBA/2J mice. A, Western blot analysis shows an increase in the phosphorylation of MAPK in the iris/ciliary bodies of DBA/2J mice at the age of 6 months. B, increased translocalization of NF-κB in the iris/ciliary bodies of DBA/2J mice.
Increase in the gene expression and the activity of apoptotic signaling elements in the eyes of DBA/2J mice. A, increases in activity of caspase-3 in the iris/ciliary body of DBA/2J mice. Caspase-3 activity assays were performed using commercially available kits showing significant increase in caspase-3 activity in the iris/ciliary body of DBA/2J mice at 5 months of age (p < 0.016, n = 8). This increase was also evident at 6 months (p < 0.006, n = 10) and at 9 months (p < 0.022, n = 6). B, increase in gene expression of extrinsic apoptotic signaling elements in the eyes of DBA/2J mice. Multiprobe RNase protection assay was used to detect the differential gene expression of apoptotic signaling components in the iris/ciliary bodies of tested animals with mouse multiprobe template set mAPO-3. The mAPO-3 set contains templates of caspase-8, FASL, FAS, FADD, FAP, FAF, TRAIL, TNFR, TRADD, and RIP. Clear increases of caspase-8, Fas, FADD, FAP, FAF, and TNFRαSS gene expression were observed.
Detection of activated T cells in the iris and anterior chamber of DBA/2J mice. A and B, histological analysis showed significant infiltration of inflammatory leukocytes within the iris and into aqueous humor and their accumulation in the inferior angle of the anterior chamber. C, Nomaski image. D, immunofluorescent staining using anti-CD69 antibody (Biolegend) shows CD69-positive cells in the iris and anterior chamber.
It has been reported that dysregulated NF-κB signaling in lymphocytes contributes to diseases ranging from chronic inflammation and autoimmunity to lymphoma (37). IL-18 shares signaling pathways with other IL-1R family members (17). It is known that IL-18 is able to phosphorylate NF-κB-inducing kinase and IkBα degradation, which allows NF-κB nuclear translocation (13, 19). MAPK signaling plays an important role in inflammatory processes (38). MAPK is activated and involved in the pathogenesis of human autoimmune diseases, including the sialoadenitis of Sjögren syndrome (39) and rheumatoid arthritis (40). A role for MAPK in IL-18 signaling has recently been suggested (16, 41). Activation of the MAPK p38 and extracellular signal-regulated kinases p44 and p42 by IL-18 was detected in a human NK cell line (42). Our data showed that the phosphor-MAPK was increased, whereas total MAPK protein level in the iris/ciliary body was not altered, suggesting that the MAPK signaling pathway may be activated in the iris/ciliary body tissue of DBA/2J mice. In addition, the increase in translocalization of NF-κB from cytoplasm to nuclei in iris/ciliary body tissue was observed using the electrophoretic mobility shift assay. This indicates that the activation of the NF-κB signaling cascade in the iris/ciliary body was increased. Therefore, both MAPK and NF-κB signaling pathways may be involved in IL-18 mediated pathogenesis of pigmentary glaucoma in the eyes of DBA/2J mice.
MMPs are a family of zinc endoproteinases that are a secreted or membrane-bound form of protein. They play important roles in many biological processes including angiogenesis, inflammation, and cancer metastasis (43-45). Many cells can secrete the gelatinases MMP-2 and MMP-9 to degrade the extracellular matrix in response to cytokines and inflammatory mediators (46, 47). MMPs are being increasingly implicated in the pathogenesis of eye diseases (48). Elevated amounts of MMP-2 and -9 were found in necrotizing scleritis (49), pterygial tissue (50), in the aqueous humor and in infiltrating cells (macrophages, T lymphocytes, and neutrophils) of both patients and animal models with uveal inflammation (51). The expressions of MMPs have been localized in the iris and ciliary body with staining mainly in the cytoplasm of both the nonpigmented and pigmented epithelial cells (52). It has been reported that in patients with primary open angle glaucoma total MMP-2 protein concentration doubled, and MMP-2 activity increased by 3.9 times compared with patients with a cataract, suggesting that the development of primary open angle glaucoma may be associated with the abnormal expression of MMP-2 in the aqueous humor (53). MMP-9 has also been suggested to play a role in retinal ganglion cell death and degradation of laminin (54-56). Our data demonstrated that MMP-2 protein expression in the iris/ciliary body of DBA mice was clearly increased when compared with age-matched C57BL/6J mice. In addition, our gelatin zymograph analysis also demonstrated that the MMP-2 activity was dramatically increased in the aqueous humor of DBA/2J mice at the age of 6 months. Furthermore, the gene and protein expression of TIMP-1 was decreased with age in DBA/2J mice as detected by Western blots and RT-PCR analysis. This suggests that a degradation process regulated by MMPs and TIMPs may be involved in the pigment dispersion of the iris and subsequent pathogenesis in the mouse model of pigmentary glaucoma.
IL-18 increases the production of activated forms of MMP-2 as well as the production of pro-MMP-2 (46). In the human myeloid leukemia cell line HL-60, IL-18 stimulates the MMP-9 gene and protein expression, which in turn degrades ECM (47). In the U937 cell line, IL-18 enhanced MMP-2 expression, while TNF-α led to the elevation of MMP-9 (57). Exogenous addition of IL-18 induced macrophages to express MMPs, whereas neutralization of IL-18 to a lesser extent reduced MMP production (58). In ocular disease, cytokines can alter the activity of MMPs or lead to an imbalance between MMPs and TIMPs (59-61). However, the role of IL-18 in the regulation of MMPs expression in the eye remains unknown. Since IL-18 can up-regulate MMPs expression in many cell and tissue types (46, 62, 57), the possibility that the increased expression of MMPs may be initiated by IL-18 in the iris/ciliary body in the eye of DBA/2J mice requires further clarification.
We used a multiprobe RNase protection assay to detect the gene expression of apoptotic signaling components in the iris/ciliary body of DBA/2J mice. We found that the gene expressions of extrinsic apoptotic signaling components were increased in the iris/ciliary bodies of DBA/2J mice at the age of 6 months. These components are caspase-8, Fas, FADD, FAP, FAF, and TNFRαSS. We also found that caspase-3 activity was significantly increased in the iris/ciliary bodies of DBA/2J mice. It is known that IL-18 is able to repress anti-apoptotic Bcl-2 and Bcl-XL gene expression, activate caspases-8, -3, and -9, and promote Fas-FasL-mediated cytotoxicity in many cell and tissue types (17-19). Our data indicate that IL-18 may play a role in the degeneration of the iris/ciliary body through a Fas/caspase-mediated mechanism in this mouse model of pigmentary glaucoma.
In summary, we have made novel observations showing that the IL-18, NF-κB, MAPK, MMP-2, TIMP-1, and apoptotic signaling components were altered in a mouse model of human pigmentary glaucoma. These indicate that the events of inflammation, degradation, and apoptosis could be involved in the pathogenesis of pigmentary glaucoma. Our demonstration that elevated expression of Il-18 is correlated with the increased IOP and the death of retinal ganglion cells supports our strategy to prevent ganglion cell death by either knocking down Il-18, transferring the AAV-IL-18-binding protein gene to the iris/ciliary body or by backcrossing DBA/2J mice with IL-18 knock-out mice. Understanding the molecular mechanisms of altered IL-18 in this mouse model will provide a foundation for developing improved and targeted treatments to ameliorate this blinding disease.
Acknowledgments
We thank Drs. Dan Carr, James Chodosh, Jody Rada, James F. McGinnis, and Robert Floyd; Mark Dittmar; and Sheng Li, Xiaorong Yan, and Matthew M. Ramsey for their support.
Footnotes
-
↵1 The abbreviations used are: IOP, intraocular pressure; TYRP1, tyrosinase-related protein 1; GP, glycoprotein; IL, interleukin; TNF, tumor necrosis factor; IFN, interferon; MAPK, mitogen-activated protein kinase; MMP, matrix metalloproteinase; TIMP, tissue inhibitor of matrix metalloproteinase; 4-di-10-ASP, 4-(4-(didecylamino)styryl)-N-methylpyridinium iodide; RGC, retinal ganglion cell; GAPDH, glycer-aldehyde-3-phosphate dehydrogenase; RT, reverse transcription; EMSA, electrophoretic mobility shift assay; BSA, bovine serum albumin; NK, natural killer.
-
↵* This work was supported by National Institutes of Health (NIH) Grant P20 RR17703 from the Centers of Biomedical Research Excellence program of the National Center for Research Sources, NIH/NEI Grants EY014427 and EY12190, and an unrestricted grant from Research to Prevent Blindness to the Department of Ophthalmology. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
-
↵♦ This article was selected as a Paper of the Week.
-
- Received March 10, 2005.
- Revision received June 13, 2005.
- The American Society for Biochemistry and Molecular Biology, Inc.




















