Differentially Spliced Isoforms of FAT1 Are Asymmetrically Distributed within Migrating Cells^*

FAT cadherins are large ∼500-kDa transmembrane proteins with an extracellular domain containing 34 cadherin motifs and a cytoplasmic domain that harbors several protein interaction motifs (1). So far, Ena/VASP, Homer 3, and β-catenin have been reported to interact with the FAT1 cytoplasmic domain (2-5). In Drosophila, the orthologs of mammalian FAT1, dfat (ft) and dfat-like (ftl), have been implicated in the establishment of planar cell polarity and formation of tracheal epithelia, respectively (6, 7). We and others have shown that mammalian FAT1 is localized along the leading edge, filopodial protrusions, and intercellular junctions (2, 4). As demonstrated by knockdown experiments, mammalian FAT1 is essential for cellular polarization and directed cell migration (2, 4, 5). FAT1 regulates actin dynamics at least in part via a direct interaction with Ena/VASP proteins (2). Consistently, genetic inactivation of FAT1 in mice leads to loss of podocyte foot processes in the kidney, which are highly dynamic actin-based structures forming a specialized intercellular junction, termed slit diaphragm (8-11). In this study, several novel splice isoforms of FAT1 were identified and characterized.

EXPERIMENTAL PROCEDURES

Plasmid Constructs—FAT1(WT)mito encoded the fusion protein as follows: N′-3xFLAG-mouse FAT1 cytoplasmic domain (GenBank™ accession number AY256848)-mitochondrial outer membrane targeting sequence from ActA-C′ in the backbone of p3xFLAG-CMV-10 as described (2). FAT1 deletion and point mutants of this plasmid were generated using HindIII/XbaI sites by standard PCR mutagenesis. Constructs FAT1(1-184)mito, FAT1(1-190)mito, and FAT1(1-204)mito contained an additional artificially generated spacer (SYPYDLGTWLNIDGFHMS) between FAT1 and ActA. FAT1(+12)mito was generated using FAT1(WT)mito as template, and the internal primers fwd 5′-gacaacgaaagcttggctgctcctgacttgagcaagccacgcgggtaccactgggataca-3′ and rev 5′-gccaagctttcgttgtcatcacaggactc-3′. FAT1(+32)mito and FAT1(+8TR)mito were generated by shuffling of subcloned RT²-PCR products (see below) into BglII/KpnI-digested FAT1(WT)mito. FAT1(+3)mito contained the peptide insert ¹⁷⁷AAS within the PTB-like motif and was generated using FAT1(WT)mito as template and the internal primers fwd 5′-caatgcagctagcgggtaccactgggata-3′ and rev 5′-acccgctagctgcattgtcatcacaggactc-3′, generating an NheI site. FAT1(+98)mito was obtained by inserting into the NheI site of FAT1(+3)mito a spacer encoding a portion of the phosphatidylinositol 3-kinase homolog FRAP (95 aa; XbaI/SpeI-digested from pC₄-R_HE; Ariad, Cambridge, MA). A similar construct containing FKBP (109 aa, XbaI/SpeI-digested from pC₄EN-F1; Ariad) yielded identical results when expressed in mammalian cells (i.e. no mitochondrial rearrangement; data not shown). FAT1(+12+DDN) was generated using FAT1(+12)mito as template and the internal primers fwd 5′-acgcgatgacaatgggtaccactgggat-3′ and rev 5′-cccattgtcatcgcgtggcttgctcaagtc-3′. The controls Dhs-mito and 2xFKBP-mito were generated by shuffling the cytoplasmic domain of murine Dachsous (∼340 aa, from GenBank™ accession number XM_194371) and of 2xFKBP (∼220 aa, from pC₄M-F2E, Ariad) 5′ of the mitochondrial outer membrane targeting sequence from ActA into p3xFLAG-CMV-10.

For the FAT1(WT)ΔCad encoded, N′-IgG leader sequence (MGWSCIILFLVATATGVHSS)-FLAG-mouse full-length FAT1 aa 3568-4590 (GenBank™ accession number AY598447)-C′ was used. For its generation, FAT1 IMAGE clone IMAGp998D0310967QQ1 nucleotides 3-3074 (GenBank™ accession number BC036134) were PCR-amplified and inserted into SmaI/SalI-digested pEF-DHFR-MT102 (12). FAT1(Δ160-188)ΔCad was generated by PCR mutagenesis.

RT-PCR from Mouse Tissues and Cultured Cells—Total RNA was isolated from mouse tissues using Tri-Reagent® and from cultured cells using RNeasy mini® columns (Qiagen, Hilden, Germany). Reverse transcription of 2-5 μg of RNA, PCR protocols, and β-actin primers have been described (13). FAT1 primers were directed against mouse nucleotides 370-389 (fwd) and 561-580 (rev) (GenBank™ accession number AY254868), and against corresponding nucleotide stretches of rat and human FAT1 sequences (GenBank™ accession number AF100960 and NM_005245, respectively). Representative FAT1-PCR products were subcloned into pBlunt-PCR® (Invitrogen) and sequenced. For quantitative mRNA expression analysis, PCR bands were recorded using digital imaging (INTAS, Göttingen, Germany) and analyzed using Labimage software (Kapelan, Halle, Germany).

Real Time RT-PCR from Human Biopsies—Glomeruli from human biopsies were collected in the framework of the European Renal cDNA Bank consortium and manually dissected; mRNA was prepared and reverse-transcribed, and real time PCR was performed on a TaqMan ABI 7700 sequence detection system (Applied Biosystems, Weiterstadt, Germany) as described (14). The glyceraldehyde-3-phosphate dehydrogenase PCR product and 18 S RNA served as internal standards, yielding comparable results (not shown). FAT1-specific primers (300 nm) and probes (100 nm) were as follows: fwd 5′-tccctgagctccttcca-3′, rev 5′-cgcttggcatccaatctga-3′, internal probe for FAT1(WT) 5′-cgtgcgatgacaatgggtatcactgg-3′, and internal probe for FAT1(+12) 5′-aatgaatctttggctgctcctgacctca-3′. FAT1(+12)-specific primers for standard PCR detection were as follows: FAT1(+12)-5′, fwd 5′-cagtccctgagctccttcca-3′ and rev 5′-gaggtcaggagcagccaaag-3′; FAT1(+12)-3′,: fwd 5′-ctttggctgctcctgacctc-3′ and rev 5′-cgcttggcatccaatctga-3′.

Antibodies—FAT1(+12)-specific polyclonal antiserum was raised in two rats and one guinea pig against a synthetic peptide “CNKEESLAAPDLSKPRGYH” N′-terminally fused to the antigenic protein keyhole limpet hemocyanin. Antiserum was centrifuged and used in dilutions of 1/50 for IF and of 1/500 for Western blot. Control preadsorption was done overnight at 4 °C (Western blot, 8 μg of peptide/μl of pure serum; IF, 8-800 μg of peptide/μl of pure serum). Other primary antibodies were used at indicated dilutions as follows: previously described mouse α-FAT1(cyto) (2) (IF, 1/300-1/3000; Western blot, 1/5000), mouse α-FLAG (1/2000-3000; M2, Sigma). Secondary antibodies conjugated to fluorescence dyes Cy2 and Cy3 were from Jackson ImmunoResearch; phalloidin-TRITC was from Sigma, and Mitotracker® Red CMXRos was from Molecular Probes.

Cell Culture and IF—The following cell lines were purchased from American Type Culture Collection: NRK-52E (CRL-1571), RAT2 (CRL-1764), COS-7 (CRL-1651), HEK293T (CRL-11268) and cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and 200 units/ml penicillin and streptomycin. A previously described immortalized podocyte cell line was cultured as described (15). Transfection was performed using Lipofectamine 2000™ (Invitrogen) for NRK-52E cells and using FuGENE 6™ (Roche Applied Science) or standard calcium phosphate method for COS-7 cells. IF studies were performed according to standard protocols. Briefly, cells grown on glass coverslips (collagen-coated for COS-7 cells) were fixed in 4% paraformaldehyde for 15 min and permeabilized with 0.2% Triton X-100 for 2 min (permeabilization omitted for experiments shown in Fig. 7, B and C) or in methanol (-20 °C) for 15 min and subsequently blocked with 10% donkey serum. Nuclei were stained with Hoechst 33342 DNA-dye (1/10,000, 10 min). Coverslips were mounted on glass slides with Mowiol® (Calbiochem). Images were acquired with a Leica DM-IRBE inverted microscope connected to a digital camera and Openlab® (Improvision) software or with a Leica DM-IRBE-TSP inverted confocal laser-scanning microscope connected to Leica confocal imaging software. Preparation for publication was done using Image J 1.33U (National Institutes of Health) and Photoshop® (Adobe) software.

Western Blot—For Western blot of recombinant FAT1-mito, COS-7 cell lysates were processed by 10% SDS-PAGE (10 μg/lane) and transferred on nitrocellulose membranes, and bands were visualized using standard ECL (Western Lightning Plus, catalog number NEL105, PerkinElmer Life Sciences). For detection of endogenous FAT1, NRK-52E cells were grown on 15-cm diameter dishes and processed by 5% SDS-PAGE, (50-100 μg of lysate/lane; in equal amounts for each group in an experimental series). Experiments were performed at least three times, and representative immunoblots are shown.

Time-lapse Microscopy—COS-7 cells grown on round coverslips were transfected with FAT1(WT)mito for 36 h, stained with Mitotracker® red (1/500, 30 min), mounted on an air-tight inverted chamber containing preconditioned medium, and filmed at 37 °C.

Mapping of the PTB-like Motif—FAT1-mito constructs were transfected into mammalian cells and assessed for the presence of mitochondrial redistribution into the cell periphery. For each construct at least 100 cells from three independent experiments were examined and classified.

RNA Interference—Knockdown of specific endogenous FAT1 isoforms using lentiviral transduction of small interfering hairpin RNA (shRNA) was performed as described previously (2). Two alternative FAT1(+12)-specific shRNA sequences were cloned into pLL3.7 (16) as follows: 12KD1, 5′P-tgaatctttggctgctcctgattcgttcaggagcagccaaagattcattttttc3′, or 12KD2, 5′-P-tggctgctcctgacctcagcaattcgtttgctgaggtcaggagcagccattttttc3′, with identical results. All experiments were performed with 12KD1, now termed KD(+12). As control, two point mutations were introduced into the shRNA hairpin sequence of 12KD1 (tggcagctcctgacgtcagcaa) (termed KD control). KD(FAT1) lentivirus was described previously (2). Lentivirus was packaged in HEK-293T cells using a four-plasmid system (16) and used to transduce subconfluent NRK-52E cells with 90% transduction efficiency, as described (2).

Statistical Analysis—Quantitative data from standard RT-PCR band analysis, real time-PCR quantification, and morphometric cell evaluation were statistically analyzed using Prism software (GranPad™, San Diego, CA).

RESULTS

Alternative Splicing of the FAT1 Cytoplasmic Domain—A comparison of the published mouse FAT1 mRNA sequences (GenBank™ accession number AY256848 versus AJ250768) indicated the presence of a putative alternative splice site located at cytoplasmic nucleotide 529/530 (Fig. 1C, gray shaded sequences). Using RT-PCR, three splice inserts from mouse tissues or rat cell lines were cloned and sequenced. The corresponding exon-intron properties were established by comparative genomic sequence analysis (NC_000074.2). The mouse gene locus, mouse mRNA structure, and mouse mRNA/predicted protein sequences of the splice variants are shown in Fig. 1, A-C, respectively. Three exons (cy1-3) encoded the previously described wild-type FAT1 cytoplasmic domain, FAT1(WT) (GenBank™ accession number AY256848). Three alternatively spliced exons (A-C) were identified (Fig. 1A), which were invariantly directly flanked by introns carrying the splice-donor-acceptor consensus sequence 5′-ag...... gt-3′ (not shown). These exons were also present in the rat genome with 100% nucleotide conservation (NC_005115) (not shown).

Cloned mRNA variant FAT1(+12) contained exon C alone (36 nt, Fig. 1B), encoding 12 additional amino acids (aa) in frame (Fig. 1C; deposited under GenBank™ accession number DQ320124 (mouse) and DQ320127 (rat)). Cloned mRNA variant FAT1(+32) contained exons B and C (96 nt, Fig. 1B) encoding 32 additional amino acids in-frame (Fig. 1C, DQ320125). Cloned mRNA variant FAT1(+8TR) contained exons A-C (149 nt, Fig. 1B), which led to the premature termination of the predicted protein after just 8 aa resulting in a truncation of the FAT1 cytoplasmic domain immediately after the splice site (Fig. 1C, DQ320126).

The data were corroborated by the mRNA sequence submitted to the data base (17) and by the genomic sequence-derived exon prediction (all numbers are GenBank™ accession numbers) as follows: mouse FAT1(+12) (AJ250768, AY598446, XM_885736); mouse FAT1(+32) (AY598445, XM_896394); mouse FAT1(+8TR) (AY598444, XM_ 896357); and rat FAT1(+12) (L41684). Data base analysis for human alternative splice isoforms revealed an ortholog of mouse FAT1(+12) (AY598439) showing 100% nucleotide insert identity with the mouse and rat sequences and of a truncated form similar to mouse FAT1(+8TR) (AY598440). The Zebrafish genome contained a sequence corresponding to mouse FAT1 exon B that was also flanked by the intron splice consensus sequence 5′-ag...... gt-3′ (data not shown).

FAT1 isoform expression was investigated in various mouse tissues (Fig. 1D). FAT1(WT) mRNA was detected in all tissues. FAT1(+32) and -(+8TR) were expressed specifically within the central nervous system where they predominated over FAT1(WT). FAT1(+12) was detected in highest amounts in lung and in trace amounts in all other tissues except brain (Fig. 1D′, brighter exposure of D).

Generation of an Antiserum Specific for Alternatively Spliced FAT1 Isoforms—A splice insert-specific antiserum α-FAT1(+12) was raised in rats and guinea pigs against the common additional 12-aa splice insert present in variants FAT1(+12) and FAT1(+32) (Fig. 2A, red). Both α-FAT1(+12) antisera derived from rat or guinea pig yielded identical results with immunoblotting or immunofluorescence (Fig. 2, B-F′). For all experiments the guinea pig antiserum was used except for Fig. 3, A-A″, where the rat antiserum was used. The novel antiserum was compared against a previously described antiserum α-FAT1(cyto) (2) that is directed against the entire FAT1 cytoplasmic domain and detects all FAT1 isoforms (Fig. 2A′, green). To characterize the antiserum, the cytoplasmic domain of either wild-type or spliced FAT1 (termed FAT1(WT)mito and FAT1(+12)mito, respectively; see schematic in Fig. 5A) was targeted ectopically to the mitochondrial outer leaflets in COS-7 cells (2). Double immunofluorescent staining using both antisera showed that α-FAT1(cyto) recognized both FAT1mito isoforms, as predicted (Fig. 2, B and C, green fluorescence), whereas α-FAT1(+12) recognized exclusively FAT1(+12)mito-transfected cells (Fig. 2, B′ and C′, red fluorescence), indicating the specificity of the antibody for the splice insert. Of note, FAT1(WT)mito-transfected mitochondria were displaced toward the cellular leading edges, as described previously (2), but FAT1(+12)mito-expressing mitochondria remained in a perinuclear position (see below). Immunoblotting of lysates from FAT1mito-transfected cells confirmed the specificity of α-FAT1(+12) antisera. Pre-adsorption of α-FAT1(+12) with the immunizing peptide abolished the signal (Fig. 2D).

The capacity of antisera to detect endogenous full-length FAT1 was assessed. Lysates from nontransfected NRK-52E cells were immunoblotted with either α-FAT1(cyto) or α-FAT1(+12), each yielding a band of the predicted size of ∼500 kDa (2) (Fig. 2E).

Differential Subcellular Localization of Endogenous FAT1 Isoforms—To investigate the potential functional characteristics of FAT1 isoforms, immunofluorescent double stainings of various cell lines were performed. Immunofluorescent staining of early confluent native NRK-52E cells with α-FAT1(+12) revealed a signal at intercellular junctions and the nucleus (Fig. 2F), which could be abolished by antigen-preadsorption (Fig. 2F′).

A striking differential subcellular distribution of FAT1 isoforms was observed in subconfluent migrating NRK-52E cells; α-FAT1(cyto) staining was observed along cellular leading edges as well as along intercellular junctions, and in a proportion of nuclei (Fig. 3A, green fluorescence), as described previously (2, 4). By contrast, α-FAT1(+12) staining was completely absent at leading edges. α-FAT1(+12) staining was only detected along intercellular contacts and within the nuclei (Fig. 3A′, red fluorescence). A similar subcellular distribution of FAT1 isoforms could be observed in RAT2 and COS-7 cells (not shown).

It was verified by RT-PCR that cultured NRK-52E cells expressed both FAT1(WT) and -(+12) mRNAs (Fig. 3B). Because FAT1 is essential for glomerular epithelial cells of the kidney in vivo (8), the expression of FAT1(WT) and -(+12) mRNAs was evaluated in a murine conditionally immortalized podocyte cell line (15) (Fig. 3, C). The subcellular localization of FAT1 isoforms in this podocyte cell line and in NRK-52E cells was identical (Fig. 3, D-E″). These data indicate that FAT1(WT) was the only isoform localized along the leading edge of lamellipodial protrusions, whereas spliced FAT1(+12) was confined to intercellular junctions.

Splicing of Endogenous FAT1 Is Regulated—Because alternative splicing occurred in a tissue-specific fashion in the mouse (Fig. 1, D and D′), it was investigated if the expression of FAT1 isoforms was differentially regulated under different culture conditions in NRK-52E cells. RT-PCR showed that proliferating subconfluent NRK-52E cells expressed predominantly FAT1(WT) mRNA, whereas quiescent cultures grown to confluence for 72 h predominantly expressed FAT1(+12) (Fig. 4A). Quantitative analysis of digitally analyzed band intensities revealed a statistically significant shift by a factor of 2.2 from a relative predominance of FAT1(WT) to a relative predominance of FAT1(+12) between proliferating and quiescent cells (p < 0.002; see Fig. 4A). These data were corroborated at the protein level by immunoblotting of cellular lysates derived from subconfluent, early confluent, or quiescent NRK-52E cells. Again, a significant shift toward the expression FAT1(+12) was observed (n = 3; Fig. 4B). In addition, down-regulation of total FAT1 protein in confluent cells was observed as reported previously (4). Subcellular FAT1 isoform expression was analyzed by immunofluorescence. Consistent with the above described data, early confluent cultures expressed both FAT1(WT) and -(+12) at intercellular junctions (Fig. 4, C-C″), whereas in quiescent cells a down-regulation of FAT1(WT) was observed. After prolonged culture, both isoforms were eventually down-regulated (Fig. 4, D-D″).

To test if splicing of FAT1 is also regulated in vivo, FAT1 isoform expression was investigated by quantitative real time RT-PCR in dissected glomeruli from human kidney biopsies. Within the glomerulus, FAT1 is predominantly expressed by podocytes (18). Similar to cultured podocytes, both FAT1(WT) and -(+12) isoforms were detected in vivo (Fig. 4, E and F). In normal glomeruli, a relative predominance of FAT1(WT) over FAT1(+12) was observed (Fig. 4G). This ratio was changed by a factor of 1.9 ± 0.1 to a relative predominance of FAT1(+12) in minimal change disease, membranous glomerulonephritis, and focal segmental glomerulosclerosis (p < 0.05 for each group; see Fig. 4G).

A PTB-like Motif Targets FAT1(WT) toward the Leading Edge and Can Be Inactivated by Alternative Splicing—The differential subcellular distribution of FAT1 splice isoforms indicated that this effect was mediated by a specific protein-protein interaction that was regulated by alternative splicing. Similar to endogenous FAT1(WT), ectopic expression of the FAT1(WT) cytoplasmic domain on mitochondrial outer leaflets (schematic in Fig. 5A) resulted in polarized mitochondrial redistribution toward the cellular leading edge (Fig. 2, B-B″; Fig. 5, B-B″ and H), as described previously (2). Mitochondria are normally distributed in a perinuclear fashion close to the Golgi apparatus, as shown in untransfected cells in Fig. 5B′, cell 1. Mitochondrial targeting of control proteins (i.e. the cytoplasmic domain of protocadherin Dachsous (Fig. 5C) or two repeats of the FK506-binding protein (Fig. 5D)) did not result in mitochondrial redistribution, indicating that mitochondrial redistribution was a characteristic intrinsic to the wild-type FAT1 cytoplasmic domain. Thus, mitochondrial redistribution was a useful assay to map the domain that mediates the unique subcellular distribution of FAT1(WT) toward the leading edge. Various mutants of FAT1-mito, including all splice variants +12, +32, and +8TR were tested (Fig. 6A, splice site indicated by vertical bar). A quantitative grading system for the extent of distribution toward the leading edge was established, and transfected cells were scored into one of three classes of either perinuclear (0%), incomplete (<50%), or complete (>50%) mitochondrial redistribution toward the leading edge, respectively (exemplary cells are shown in Fig. 5, E-L). Equal protein expression of each mutant was verified by immunoblotting (Fig. 5M). The statistical analysis for each mutant is shown in Fig. 6B (n = 100 cells; three independent experiments each). FAT1(WT)mito mediated complete mitochondrial redistribution toward the leading edge in 90% of the cells, whereas mitochondrial distribution remained unchanged in cells transfected with any of the splice variants +12 and +32 similar to controls (Dhs and 2xFKBP). As predicted, FAT1(+8TR)mito was not targeted to mitochondria because of the premature stop codon, resulting in its diffuse cytoplasmic distribution (Fig. 5K). These data show that polarized redistribution of FAT1 was abolished in all spliced FAT1 isoforms.

To map the essential amino acids mediating redistribution of FAT1(WT), C-terminal and N-terminal deletion constructs of FAT1(WT)mito were analyzed (Fig. 6, A and B) as follows: 1-220, 1-204, and 1-190 (Fig. 5G); 1-184 (Fig. 5E); 1-176, 202-385, 177-385, 174-385, 139-285, and Δ160-188 (Fig. 5L). The minimal sequence necessary for redistribution of FAT1(WT) was mapped to cytoplasmic aa 174-190 (DDNGYHWDTSDWMPSVP) as indicated by a black horizontal bar in Fig. 6C. Alignment for consensus sequence homology of mouse, chicken, and Zebrafish FAT1 together with mammalian FAT3 identified a conserved domain at aa 158-204, as indicated by a box in Fig. 6A and a gray bar in C. Of note, the identified motif was the only motif of vertebrate FAT1 that was conserved in its Drosophila homolog ftl, suggesting an important evolutionary conserved function (Fig. 6D).

The alternative splice site was located immediately within the identified minimal motif separating four highly conserved amino acids ¹⁷⁵DNXYH¹⁷⁹ similar to a PTB motif (Fig. 6C, black vertical line indicating the splice site). Indeed, when Tyr¹⁷⁸ was mutated to glutamic acid (Y178E) mitochondrial redistribution was totally abolished (Fig. 6, A and B). Substitution of Tyr¹⁷⁸ phenylalanine, a residue resembling a tyrosine residue that cannot be phosphorylated, had no effect (Y178F, Fig. 6, A and B). In agreement with this, no evidence for tyrosine phosphorylation of the wild-type FAT1 cytoplasmic domain was observed (not shown). Mutation of a second conserved tyrosine residue Tyr²⁰⁰ (to both Glu and Phe) had no effect (not shown). These findings support the notion that ¹⁷⁵DNXYH¹⁷⁹ represents a minimal protein-protein interaction core motif that is not regulated by tyrosine phosphorylation. Indeed, the identified motif shared characteristics with the Disabled1 (Dab1)-PTB-binding motif of Caenorhabditis elegans protein kinase C 3 (PKC3) (XXDNXXFHXX), which does not require phosphorylation of the essential tyrosine residue (19, 20).

To investigate if the motif is inactivated by insertion of an irrelevant sequence or by insertion of a specific inactivating sequence, three additional FAT1-mito constructs were generated. Insertion of only three irrelevant amino acids (AAS) at the splice site (FAT1(+3)mito) significantly reduced mitochondrial redistribution, whereas insertion of longer irrelevant fragments, e.g. of 98 aa (FAT1(+98)mito) totally abolished redistribution (Fig. 6, A and B). Furthermore, the functionality of the splice isoform FAT1(+12)mito could be rescued by insertion of the last three aa (DDN) derived from the N′-terminal half of the FAT1 cytoplasmic domain (see Fig. 6C) next to the essential tyrosine 178 reconstituting the essential core sequence of the PTB-like motif (sequence ¹⁷⁴DDNeslaapdlskprDDNGYHWD..; Fig. 6, A and B). These experiments show that the splice site was located at a functionally critical position. It was concluded that splice inserts +12 and +32 sterically disrupted a PTB-like motif.

Association of Cellular Process Formation and FAT1(WT)—As shown in Fig. 5, B and H, the identified PTB-like motif mediated redistribution of recombinant FAT1(WT) in a polarized fashion toward the cellular leading edge. To verify this finding, movements of FAT1(WT)mito-decorated mitochondria were observed for 12 h using time-lapse video microscopy in transiently transfected COS-7 cells (supplemental movie S1; green cell, transfected with FAT1(WT)mito; red cell, nontransfected control). FAT1(WT)mito-decorated mitochondria were rearranged in a highly dynamic fashion into cellular processes toward the leading edge of migrating cells. The majority of FAT1-decorated mitochondria were redistributed into the direction of the overall cellular movement. Redistribution of FAT1(WT)mito-decorated mitochondria was closely associated with polarized process formation.

To test if FAT1 was also quantitatively associated with the formation of cellular processes, a partial full-length clone of wild-type FAT1 lacking the N-terminal 34 cadherin repeats was expressed within the cellular plasma membrane (FAT1(WT)ΔCadh) (Fig. 7A). As a control, a clone lacking the identified PTB-like motif was generated (FAT1(Δ160-188)ΔCadh; see Fig. 6, A and C, for sequence). Both constructs efficiently localized to the plasma membrane as shown by indirect immunofluorescence staining of transiently transfected COS-7 cells omitting the permeabilization step. Staining for the extracellular FLAG-epitope yielded a signal (green), whereas co-staining for the intracellular FAT1-cytoplasmic domain by α-FAT1(cyto) (red) was negative (Fig. 7, B and C). Importantly, FAT1(WT)ΔCadh was localized toward the cellular leading edge and into cellular processes similar to FAT1(WT)mito (Fig. 7B). This polarized redistribution was clearly abolished in the mutated clone, FAT1(Δ160-188)ΔCadh (Fig. 7C) indicating that FAT1(WT)ΔCadh was not enriched as a result of cellular artifacts.

A quantitative analysis of the number of cell protrusions per cell transfected with either FAT1(WT)ΔCadh or FAT1(Δ160-188)ΔCadh was performed. Strikingly, the majority of FAT1(WT)ΔCadh-transfected cells displayed numerous cellular protrusions that were enriched with FAT1(WT)ΔCadh at their tips (representative cells are shown in Fig. 7, D and E). In contrast, cells transfected with FAT1(Δ160-188)ΔCadh consistently exhibited a rounded phenotype (Fig. 7F). Statistical analysis revealed that 95% of cells transfected with FAT1(Δ160-188)ΔCadh lacked protrusions, whereas 40% of FAT1(WT)ΔCadh-transfected cells exhibited one to two protrusions, and another 35% exhibited three or more protrusions (p < 0.001; Fig. 7G). On average, cells transfected with FAT1(WT)ΔCadh exhibited two long protrusions per cell, whereas cells transfected with FAT1(Δ160-188)ΔCadh exhibited none (p < 0.001; Fig. 7H).

The FAT1(WT) Isoform Is Sufficient for Directed Cell Migration—The increased number of cellular protrusions in FAT1(WT)ΔCadh-transfected cells suggested a differential role of the FAT1 splice isoforms in cell migration. To test this hypothesis, the expression of FAT1 splice isoforms was selectively silenced using RNA interference (16). NRK-52E cells were transduced with a lentivirus (KD(+12)) expressing an shRNA sequence specific for the splice inserts common only to the FAT1(+12) and -(+32) isoforms. Expression of FAT1 isoforms was selectively silenced as demonstrated by immunoblotting of cellular lysates and by RT-PCR of total RNA extracts (Fig. 8, A and B). Splice-specific knockdown did not affect expression of wild-type FAT1. Knockdown of all FAT1 isoforms was achieved using a previously described lentivirus (KD(FAT1)) (2). These results also confirmed the specificity of the α-FAT1(+12) antiserum.

NRK-52E cell monolayers were transduced with control virus (KD control) or virus specific for FAT1 splice isoforms (KD(+12)) or for total FAT1 (KD(FAT1)) and subjected to a wound assay. Lentiviral transduction efficiency was adjusted to 90% transduced cells, verified by co-expression of a viral enhanced green fluorescent protein reporter gene (2). Ten hours after wounding, wound closure was significantly impaired in FAT1-deficient cells (KD(FAT1)) compared with controls (KD control), as described previously (2, 4). In contrast, wound closure was improved in cells that only expressed wild-type FAT1 (KD(+12)) compared with controls by a factor of 1.7 (mean remaining wound diameter of 106 μm versus 180 μm). These results confirm that only the wild-type FAT1 isoform at the cellular leading edge is essential for directed cell migration.

DISCUSSION

In this study, three alternative splice isoforms of FAT1 with important functional differences from wild-type FAT1 were identified. The data show that endogenous FAT1(WT) represents the isoform through which FAT1 mediates functions of directed cell migration at the leading edge that have been described previously (2). This notion is supported by the fact that only FAT1(WT) was associated with cellular process formation and was essential for directed cell migration in a wound healing assay. In addition, FAT1(WT) was the predominant isoform in migrating cells in vitro and in healthy glomeruli with intact podocyte foot processes in vivo. Furthermore, cells are able to modulate their FAT1(WT) to FAT1(+12) expression ratios in response to extracellular signals (quiescent versus migratory). The isoform-specific antisera described in this work will therefore be an important tool to study specific FAT1 functions.

The association of endogenous FAT1(WT) with cellular leading edges was mapped to a novel PTB-like motif (¹⁷⁵DNXYH¹⁷⁹). This motif was functionally inactivated in alternatively spliced FAT1 isoforms. As shown by insertion of irrelevant sequences into the splice site, this mechanism was sterical in nature rather than dependent on a specific additional sequence. Consequently, FAT1(+12) and -(+32) are predicted to be identical in function, although it cannot be ruled out that the sequence exerts other functions not detected in our analysis. Of note, the PTB-like motif and its surrounding region was highly conserved from Drosophila ftl to mammals, suggesting its importance for FAT1 function and supporting the notion that ftl is the true ortholog of mammalian FAT1 (6).

It remains to be determined whether the PTB-like motif directly mediates targeting of FAT1(WT) to the leading edge, e.g. by vesicle transport. Alternatively, the identified PTB motif may be implicated in the transduction of cellular polarization signals via asymmetrical enrichment of wild-type FAT1 along the cellular leading edge. Indeed, asymmetrical enrichment in “cortical platforms” (21) as seen with FAT1(WT) is an established mode of transducing polarity signals in directed cell migration (22-27). Major events regulating directed cell migration are actin reorganization and polarized capture of microtubuli (21). Recombinant FAT1 was redistributed into similar locations as the cytosolic microtubular bridging protein or kinesin-transported cargoes suggesting that the PTB-like motif interacts at the leading edge with the microtubular system (25, 28-31).

At the nucleotide level, a striking evolutionary sequence conservation of the splice inserts, including their surrounding introns, was observed. This suggests the presence of important regulatory sequences for the splicing machinery. In a recent study in human patients, the C terminus of the FAT1 gene has been shown to harbor alleles linked to bipolar disease (32). In this study, mRNAs encoding spliced isoforms FAT1(+32) and -(+8TR) were expressed exclusively within the central nervous system. One of the single nucleotide polymorphism associated with bipolar disease lies within the PTB-like motif at Ser¹⁶⁷ but does not result in a change of the protein sequence (TCC to TCT; rs1298865) (32). However, such silent point mutations may influence mRNA processing (33). Susceptibility to bipolar disease may be conferred by noncoding mutations that change the ratio between the FAT1 splice isoforms.

Within the renal glomerulus, up-regulation of the FAT1(+12) splice isoform was associated with diseases that go along with heavy protein loss into the urine, namely minimal change disease, membranous glomerulonephritis, and focal segmental glomerulosclerosis. These glomerulopathies are associated with loss of the complicated structure of the actin cytoskeleton (termed foot process effacement) and formation of adherens junctions. No glomerular leukocyte infiltration or other glomerular cell proliferation occurs in minimal change disease and membranous glomerulonephritis, excluding artifacts from other cell types. Our data therefore suggest that FAT1 isoform expression is also regulated in vivo and that loss of podocyte foot processes is associated with a relative increase in expression of the junction-associated isoform FAT1(+12). These observations are of potential diagnostic or even therapeutic value.