Advertisement

The endosomal trafficking regulator LITAF controls the cardiac Nav1.5 channel via the ubiquitin ligase NEDD4-2

Open AccessPublished:October 22, 2020DOI:https://doi.org/10.1074/jbc.RA120.015216
      The QT interval is a recording of cardiac electrical activity. Previous genome-wide association studies identified genetic variants that modify the QT interval upstream of LITAF (lipopolysaccharide-induced tumor necrosis factor-α factor), a protein encoding a regulator of endosomal trafficking. However, it was not clear how LITAF might impact cardiac excitation. We investigated the effect of LITAF on the voltage-gated sodium channel Nav1.5, which is critical for cardiac depolarization. We show that overexpressed LITAF resulted in a significant increase in the density of Nav1.5-generated voltage-gated sodium current INa and Nav1.5 surface protein levels in rabbit cardiomyocytes and in HEK cells stably expressing Nav1.5. Proximity ligation assays showed co-localization of endogenous LITAF and Nav1.5 in cardiomyocytes, whereas co-immunoprecipitations confirmed they are in the same complex when overexpressed in HEK cells. In vitro data suggest that LITAF interacts with the ubiquitin ligase NEDD4-2, a regulator of Nav1.5. LITAF overexpression down-regulated NEDD4-2 in cardiomyocytes and HEK cells. In HEK cells, LITAF increased ubiquitination and proteasomal degradation of co-expressed NEDD4-2 and significantly blunted the negative effect of NEDD4-2 on INa. We conclude that LITAF controls cardiac excitability by promoting degradation of NEDD4-2, which is essential for removal of surface Nav1.5. LITAF-knockout zebrafish showed increased variation in and a nonsignificant 15% prolongation of action potential duration. Computer simulations using a rabbit-cardiomyocyte model demonstrated that changes in Ca2+ and Na+ homeostasis are responsible for the surprisingly modest action potential duration shortening. These computational data thus corroborate findings from several genome-wide association studies that associated LITAF with QT interval variation.
      The voltage-gated sodium channel Nav1.5 is responsible for the initial upstroke of cardiac action potential (
      • Rook M.B.
      • Evers M.M.
      • Vos M.A.
      • Bierhuizen M.F.
      Biology of cardiac sodium channel Nav1.5 expression.
      ,
      • Abriel H.
      • Kass R.S.
      Regulation of the voltage-gated cardiac sodium channel Nav1.5 by interacting proteins.
      ). Post-translational modifications such as phosphorylation or ubiquitination are essential for correct expression and function of Nav1.5 (
      • Rook M.B.
      • Evers M.M.
      • Vos M.A.
      • Bierhuizen M.F.
      Biology of cardiac sodium channel Nav1.5 expression.
      ). The activity and density of Nav1.5 channels at the membrane depend on forward trafficking, stability, and domain-targeting mediated by anchoring proteins and retrograde trafficking (
      • Balse E.
      • Boycott H.E.
      Ion channel trafficking: control of ion channel density as a target for arrhythmias?.
      ). Retrograde trafficking of cardiac Nav1.5 depends on the E3 ubiquitin ligase NEDD4-2 (neural precursor cell-expressed developmentally down-regulated 4 type 2), which accelerates the degradation of Nav1.5 by ubiquitination (
      • Abriel H.
      • Kamynina E.
      • Horisberger J.D.
      • Staub O.
      Regulation of the cardiac voltage-gated Na+ channel (H1) by the ubiquitin-protein ligase Nedd4.
      ,
      • van Bemmelen M.X.
      • Rougier J.S.
      • Gavillet B.
      • Apothéloz F.
      • Daidié D.
      • Tateyama M.
      • Rivolta I.
      • Thomas M.A.
      • Kass R.S.
      • Staub O.
      • Abriel H.
      Cardiac voltage-gated sodium channel Nav1.5 is regulated by Nedd4-2 mediated ubiquitination.
      ). NEDD4-2 is highly expressed in the heart (
      • Jespersen T.
      • Membrez M.
      • Nicolas C.S.
      • Pitard B.
      • Staub O.
      • Olesen S.P.
      • Baró I.
      • Abriel H.
      The KCNQ1 potassium channel is down-regulated by ubiquitylating enzymes of the Nedd4/Nedd4-like family.
      ), where it down-regulates Nav1.5 through PXY motif recognition by its WW domains (
      • van Bemmelen M.X.
      • Rougier J.S.
      • Gavillet B.
      • Apothéloz F.
      • Daidié D.
      • Tateyama M.
      • Rivolta I.
      • Thomas M.A.
      • Kass R.S.
      • Staub O.
      • Abriel H.
      Cardiac voltage-gated sodium channel Nav1.5 is regulated by Nedd4-2 mediated ubiquitination.
      ). However, the details of this regulation are not well-understood.
      Genetic modifications in the SCN5A gene, which encodes Nav1.5, cause inherited long QT syndrome 3, Brugada syndrome, atrial fibrillation, sick sinus syndrome, progressive cardiac conduction defect, or dilated cardiomyopathy (reviewed by Li et al. (
      • Li W.
      • Yin L.
      • Shen C.
      • Hu K.
      • Ge J.
      • Sun A.
      Variants: association with cardiac disorders.
      )). Also, dysfunction of Nav1.5 in myocardial ischemia and heart failure is proarrhythmic (
      • Abriel H.
      • Kass R.S.
      Regulation of the voltage-gated cardiac sodium channel Nav1.5 by interacting proteins.
      ,
      • Xi Y.
      • Wu G.
      • Yang L.
      • Han K.
      • Du Y.
      • Wang T.
      • Lei X.
      • Bai X.
      • Ma A.
      Increased late sodium currents are related to transcription of neuronal isoforms in a pressure-overload model.
      ,
      • Baba S.
      • Dun W.
      • Cabo C.
      • Boyden P.A.
      Remodeling in cells from different regions of the reentrant circuit during ventricular tachycardia.
      ,
      • Liu M.
      • Yang K.C.
      • Dudley S.C.
      Cardiac sodium channel mutations: why so many phenotypes?.
      ). Several genome-wide association studies for loci that modify the QT interval and the risk of sudden cardiac death (
      • Newton-Cheh C.
      • Eijgelsheim M.
      • Rice K.M.
      • de Bakker P.I.
      • Yin X.
      • Estrada K.
      • Bis J.C.
      • Marciante K.
      • Rivadeneira F.
      • Noseworthy P.A.
      • Sotoodehnia N.
      • Smith N.L.
      • Rotter J.I.
      • Kors J.A.
      • Witteman J.C.
      • et al.
      Common variants at ten loci influence QT interval duration in the QTGEN Study.
      ,
      • Arking D.E.
      • Pulit S.L.
      • Crotti L.
      • van der Harst P.
      • Munroe P.B.
      • Koopmann T.T.
      • Sotoodehnia N.
      • Rossin E.J.
      • Morley M.
      • Wang X.
      • Johnson A.D.
      • Lundby A.
      • Gudbjartsson D.F.
      • Noseworthy P.A.
      • Eijgelsheim M.
      • et al.
      Genetic association study of QT interval highlights role for calcium signaling pathways in myocardial repolarization.
      ,
      • Pfeufer A.
      • Sanna S.
      • Arking D.E.
      • Müller M.
      • Gateva V.
      • Fuchsberger C.
      • Ehret G.B.
      • Orrú M.
      • Pattaro C.
      • Köttgen A.
      • Perz S.
      • Usala G.
      • Barbalic M.
      • Li M.
      • Pütz B.
      • et al.
      Common variants at ten loci modulate the QT interval duration in the QTSCD Study.
      ) have identified three SNPs located in or near genes encoding proteins involved in ubiquitination (RNF207, RFFL, and LITAF) (
      • Roder K.
      • Werdich A.A.
      • Li W.
      • Liu M.
      • Kim T.Y.
      • Organ-Darling L.E.
      • Moshal K.S.
      • Hwang J.M.
      • Lu Y.
      • Choi B.R.
      • MacRae C.A.
      • Koren G.
      RING finger protein RNF207, a novel regulator of cardiac excitation.
      ,
      • Roder K.
      • Kabakov A.
      • Moshal K.S.
      • Murphy K.R.
      • Xie A.
      • Dudley S.
      • Turan N.N.
      • Lu Y.
      • MacRae C.A.
      • Koren G.
      Trafficking of the human ether-a-go-go-related gene (hERG) potassium channel is regulated by the ubiquitin ligase rififylin (RFFL).
      ). LITAF (lipopolysaccharide-induced tumor necrosis factor-alpha factor) is a regulator of endosomal trafficking (
      • Lee S.M.
      • Chin L.S.
      • Li L.
      Charcot–Marie–Tooth disease-linked protein SIMPLE functions with the ESCRT machinery in endosomal trafficking.
      ,
      • Shirk A.J.
      • Anderson S.K.
      • Hashemi S.H.
      • Chance P.F.
      • Bennett C.L.
      SIMPLE interacts with NEDD4 and TSG101: evidence for a role in lysosomal sorting and implications for Charcot–Marie–Tooth disease.
      ,
      • Zhu H.
      • Guariglia S.
      • Yu R.Y.
      • Li W.
      • Brancho D.
      • Peinado H.
      • Lyden D.
      • Salzer J.
      • Bennett C.
      • Chow C.W.
      Mutation of SIMPLE in Charcot–Marie–Tooth 1C alters production of exosomes.
      ) and inflammatory cytokines (
      • Tang X.
      • Marciano D.L.
      • Leeman S.E.
      • Amar S.
      LPS induces the interaction of a transcription factor, LPS-induced TNF-α factor, and STAT6(B) with effects on multiple cytokines.
      ,
      • Tang X.
      • Metzger D.
      • Leeman S.
      • Amar S.
      LPS-induced TNF-α factor (LITAF)–deficient mice express reduced LPS-induced cytokine: evidence for LITAF-dependent LPS signaling pathways.
      ,
      • Merrill J.C.
      • You J.
      • Constable C.
      • Leeman S.E.
      • Amar S.
      Whole-body deletion of LPS-induced TNF-α factor (LITAF) markedly improves experimental endotoxic shock and inflammatory arthritis.
      ) and an adapter molecule for members of the NEDD4 (neural precursor cell-expressed developmentally down-regulated protein 4)–like family of E3 ubiquitin ligases (
      • Shirk A.J.
      • Anderson S.K.
      • Hashemi S.H.
      • Chance P.F.
      • Bennett C.L.
      SIMPLE interacts with NEDD4 and TSG101: evidence for a role in lysosomal sorting and implications for Charcot–Marie–Tooth disease.
      ,
      • Eaton H.E.
      • Desrochers G.
      • Drory S.B.
      • Metcalf J.
      • Angers A.
      • Brunetti C.R.
      SIMPLE/LITAF expression induces the translocation of the ubiquitin ligase itch towards the lysosomal compartments.
      ). The N terminus of LITAF contains two PXY motifs, which are essential for interacting with members of the NEDD4 family of HECT (homologous to the E6-AP C terminus) domain ubiquitin ligases via their WW domains (
      • Shirk A.J.
      • Anderson S.K.
      • Hashemi S.H.
      • Chance P.F.
      • Bennett C.L.
      SIMPLE interacts with NEDD4 and TSG101: evidence for a role in lysosomal sorting and implications for Charcot–Marie–Tooth disease.
      ,
      • Eaton H.E.
      • Desrochers G.
      • Drory S.B.
      • Metcalf J.
      • Angers A.
      • Brunetti C.R.
      SIMPLE/LITAF expression induces the translocation of the ubiquitin ligase itch towards the lysosomal compartments.
      ,
      • Shearwin-Whyatt L.
      • Dalton H.E.
      • Foot N.
      • Kumar S.
      Regulation of functional diversity within the Nedd4 family by accessory and adaptor proteins.
      ). LITAF also interacts with members of the ESCRT (endosomal sorting complex required for transport) family, including TSG101 (tumor susceptibility gene 101) and STAM1 (signal-transducing adaptor molecule 1), recruiting them to the early endosomal membrane and controlling endosome-to-lysosome trafficking and exosome formation (
      • Lee S.M.
      • Chin L.S.
      • Li L.
      Charcot–Marie–Tooth disease-linked protein SIMPLE functions with the ESCRT machinery in endosomal trafficking.
      ,
      • Shirk A.J.
      • Anderson S.K.
      • Hashemi S.H.
      • Chance P.F.
      • Bennett C.L.
      SIMPLE interacts with NEDD4 and TSG101: evidence for a role in lysosomal sorting and implications for Charcot–Marie–Tooth disease.
      ,
      • Zhu H.
      • Guariglia S.
      • Yu R.Y.
      • Li W.
      • Brancho D.
      • Peinado H.
      • Lyden D.
      • Salzer J.
      • Bennett C.
      • Chow C.W.
      Mutation of SIMPLE in Charcot–Marie–Tooth 1C alters production of exosomes.
      ). Mutations clustered around the hydrophobic region required for membrane localization in LITAF cause Charcot–Marie–Tooth disease, an inherited peripheral neuropathy. They also result in mislocalization and impaired endosome-to-lysosome trafficking of membrane proteins (
      • Lee S.M.
      • Chin L.S.
      • Li L.
      Charcot–Marie–Tooth disease-linked protein SIMPLE functions with the ESCRT machinery in endosomal trafficking.
      ,
      • Lacerda A.F.
      • Hartjes E.
      • Brunetti C.R.
      LITAF mutations associated with Charcot–Marie–Tooth disease 1C show mislocalization from the late endosome/lysosome to the mitochondria.
      ). Importantly, the genetic variant rs8049607 located within an intergenic enhancer region (
      • Tan W.L.W.
      • Anene-Nzelu C.G.
      • Wong E.
      • Lee C.J.M.
      • Tan H.S.
      • Tang S.J.
      • Perrin A.
      • Wu K.X.
      • Zheng W.
      • Ashburn R.J.
      • Pan B.
      • Lee M.Y.
      • Autio M.I.
      • Morley M.P.
      • Tam W.L.
      • et al.
      Epigenomes of human hearts reveal new genetic variants relevant for cardiac disease and phenotype.
      ) is associated with a very modest QT interval prolongation of 1.2 ms (
      • Newton-Cheh C.
      • Eijgelsheim M.
      • Rice K.M.
      • de Bakker P.I.
      • Yin X.
      • Estrada K.
      • Bis J.C.
      • Marciante K.
      • Rivadeneira F.
      • Noseworthy P.A.
      • Sotoodehnia N.
      • Smith N.L.
      • Rotter J.I.
      • Kors J.A.
      • Witteman J.C.
      • et al.
      Common variants at ten loci influence QT interval duration in the QTGEN Study.
      ,
      • Arking D.E.
      • Pulit S.L.
      • Crotti L.
      • van der Harst P.
      • Munroe P.B.
      • Koopmann T.T.
      • Sotoodehnia N.
      • Rossin E.J.
      • Morley M.
      • Wang X.
      • Johnson A.D.
      • Lundby A.
      • Gudbjartsson D.F.
      • Noseworthy P.A.
      • Eijgelsheim M.
      • et al.
      Genetic association study of QT interval highlights role for calcium signaling pathways in myocardial repolarization.
      ,
      • Pfeufer A.
      • Sanna S.
      • Arking D.E.
      • Müller M.
      • Gateva V.
      • Fuchsberger C.
      • Ehret G.B.
      • Orrú M.
      • Pattaro C.
      • Köttgen A.
      • Perz S.
      • Usala G.
      • Barbalic M.
      • Li M.
      • Pütz B.
      • et al.
      Common variants at ten loci modulate the QT interval duration in the QTSCD Study.
      ). This variant (rs8049607) is associated with reduced LITAF mRNA transcript levels in the left ventricle (
      GTEx Consortium
      The Genotype-Tissue Expression (GTEx) project.
      ,
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ). Thus, a reduction in LITAF prolongs the QT interval.
      Based on the genome-wide association studies' findings (
      • Newton-Cheh C.
      • Eijgelsheim M.
      • Rice K.M.
      • de Bakker P.I.
      • Yin X.
      • Estrada K.
      • Bis J.C.
      • Marciante K.
      • Rivadeneira F.
      • Noseworthy P.A.
      • Sotoodehnia N.
      • Smith N.L.
      • Rotter J.I.
      • Kors J.A.
      • Witteman J.C.
      • et al.
      Common variants at ten loci influence QT interval duration in the QTGEN Study.
      ,
      • Arking D.E.
      • Pulit S.L.
      • Crotti L.
      • van der Harst P.
      • Munroe P.B.
      • Koopmann T.T.
      • Sotoodehnia N.
      • Rossin E.J.
      • Morley M.
      • Wang X.
      • Johnson A.D.
      • Lundby A.
      • Gudbjartsson D.F.
      • Noseworthy P.A.
      • Eijgelsheim M.
      • et al.
      Genetic association study of QT interval highlights role for calcium signaling pathways in myocardial repolarization.
      ,
      • Pfeufer A.
      • Sanna S.
      • Arking D.E.
      • Müller M.
      • Gateva V.
      • Fuchsberger C.
      • Ehret G.B.
      • Orrú M.
      • Pattaro C.
      • Köttgen A.
      • Perz S.
      • Usala G.
      • Barbalic M.
      • Li M.
      • Pütz B.
      • et al.
      Common variants at ten loci modulate the QT interval duration in the QTSCD Study.
      ) and LITAF's functional role in endosome-to-lysosome trafficking, we hypothesized that LITAF is a candidate for regulation of cardiac excitation, likely acting as an effector of ion channel complex trafficking or degradation. Indeed, we have recently shown that LITAF acts as an adaptor protein promoting NEDD4-1–mediated ubiquitination and subsequent degradation of L-type calcium channels (LTCCs), and gain of function of LITAF is associated with shortening of action potential duration (APD) (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ). In this study, we present data that support an additional role for LITAF in modulating membrane density and function of cardiac Nav1.5 via the ubiquitin ligase NEDD4-2. Uniquely, gain of function of LITAF increases the expression of sodium channels in the membrane.

      Results

      The voltage-gated sodium current INa is regulated by LITAF in 3-week-old rabbit cardiomyocytes

      To investigate any possible effect of LITAF on the Nav1.5 channel and its generated voltage-gated sodium current INa, we used cultured 3-week-old rabbit cardiomyocytes (3wRbCM). We developed and used this model to study various ion channels underlying action potential duration (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ,
      • Kabakov A.Y.
      • Moshal K.
      • Lu Y.
      • Roder K.
      • Nilufer T.
      • Li W.
      • Murphy K.
      • Terentyev D.
      • Koren G.
      Week-old rabbit cardiomyocytes (3wRbCM): a novel cellular model for studying cardiac excitation.
      ). For example, 3-week-old rabbit cardiomyocytes cultured for 48 h display a stable INa current (Fig. 1A). The cells were transduced with adenovirus encoding GFP and hemagglutinin (HA)–tagged LITAF. Overexpression of LITAF caused a significant increase (27.4%) in peak INa density (from −19.3 ± 2.2 pA/pF to −24.6 ± 2.21 pA/pF; p = 0.0073; Fig. 1B), yet there were no changes in voltage-dependent activation and inactivation kinetics (Fig. 1C). Western blotting results show that total Nav1.5 protein levels were significantly up-regulated (76.7%) in LITAF-overexpressing 3wRbCM (p < 0.05; Fig. 1D).
      Figure thumbnail gr1
      Figure 1LITAF increases INa and Nav1.5 levels in 3wRbCM. Cardiomyocytes were transduced with adenovirus encoding GFP or LITAF-HA (MOI of 10, 48 h). A, left panel, representative traces of INa in control, GFP-expressing 3wRbCM. INa was activated with depolarizing membrane potentials between −80 and +40 mV from −100 mV holding potential. Right panel, typical INa traces in GFP- and LITAF-expressing 3wRbCM. B, voltage dependence of INa current in transduced cardiomyocytes. The currents were normalized to cell capacitance (means ± S.E.; p < 0.01, 3wRbCM from three rabbits were used for both LITAF and GFP experiments). C, activation curves of INa were obtained from data shown in B, whereas inactivation curves were obtained as described under “Experimental procedures.” D, left panel, protein expression levels of Nav1.5, LITAF-HA, and tubulin. Right panel, respective changes of Nav1.5 protein levels normalized to tubulin. Although the theoretical molecular mass of the HA-tagged human LITAF is 20.6 kDa, our Western blotting data show a specific band at ∼28 kDa, which is likely due to post-translational modification (all values are means ± S.E., Student's t test, n = 11 each). *, p < 0.05.

      LITAF controls Nav1.5 channel expression on the cell surface in HEK cells

      Next, we switched to HEK cells as they are frequently used to study Nav1.5 in vitro (
      • van Bemmelen M.X.
      • Rougier J.S.
      • Gavillet B.
      • Apothéloz F.
      • Daidié D.
      • Tateyama M.
      • Rivolta I.
      • Thomas M.A.
      • Kass R.S.
      • Staub O.
      • Abriel H.
      Cardiac voltage-gated sodium channel Nav1.5 is regulated by Nedd4-2 mediated ubiquitination.
      ,
      • Liu M.
      • Shi G.
      • Yang K.C.
      • Gu L.
      • Kanthasamy A.G.
      • Anantharam V.
      • Dudley S.C.
      Role of protein kinase C in metabolic regulation of the cardiac Na.
      ,
      • Ponce-Balbuena D.
      • Guerrero-Serna G.
      • Valdivia C.R.
      • Caballero R.
      • Diez-Guerra F.J.
      • Jiménez-Vázquez E.N.
      • Ramírez R.J.
      • Monteiro da Rocha A.
      • Herron T.J.
      • Campbell K.F.
      • Willis B.C.
      • Alvarado F.J.
      • Zarzoso M.
      • Kaur K.
      • Pérez-Hernández M.
      • et al.
      Cardiac Kir2.1 and Na.
      ). We used HEK cells that stably co-express Nav1.5 and GFP, to confirm our data obtained with 3wRbCM. HEK cells were co-transfected with expression plasmids for LITAF and red fluorescent protein (DsRed) or GFP and DsRed (control). Patch clamp results show that LITAF increased (20.1%) Nav1.5 current density from −80.6 ± 12.9 pA/pF to −96.8 ± 13.5 pA/pF; p < 0.05; Fig. 2B). Importantly, a significant concomitant increase in total Nav1.5 channel expression was noted (Fig. 2C). Surface biotinylation experiments were carried out to confirm that membrane expression of Nav1.5 was also significantly elevated upon LITAF overexpression (Fig. 2D), which is consistent with higher INa peak density in the presence of exogenous LITAF (Fig. 2C).
      Figure thumbnail gr2
      Figure 2LITAF increases INa as well as surface expression of Nav1.5 in stable HEK cells. The cells stably co-expressing Nav1.5 and GFP were co-transfected with LITAF- and DsRed-expressing plasmids or control (GFP and DsRed). A, typical Na+ traces in GFP- and LITAF-expressing HEK cells. B, current–voltage relationship for INa. INa was activated from −100 mV holding potential by depolarizing steps up to +40 mV in 10-mV increments. C, top panel, total expression of Nav1.5 and LITAF-HA. Bottom panel, respective change in Nav1.5 expression, normalized to tubulin (all values are means ± S.E.; Student's t test; n = 10). The uncropped probed membrane is shown in . D, total and surface protein expression of Nav1.5 and LITAF. Stable HEK cells were transfected with LITAF or GFP (control) expression plasmids. Cell-surface protein was biotinylated using sulfo-NHS-S-biotin, purified with NeutrAvidin beads from total cell lysates, subjected to SDS-PAGE, and blotted onto a polyvinylidene difluoride membrane. A representative immunoblot shows cell-surface and total lysate expression of Nav1.5, LITAF-HA, and tubulin (top panel) (the asterisk indicates an unspecific band). Respective changes in Nav1.5 expression, normalized to tubulin. All values are means ± S.E. (n = 5) (bottom).

      Close-proximity interaction between LITAF and Nav1.5 channels

      Because our data suggested a functional interaction between LITAF and Nav1.5, we performed co-immunoprecipitation experiments on HEK cells stably expressing V5-tagged Nav1.5. The cells were co-transfected with plasmid encoding HA-tagged LITAF or empty control vector. Cell extracts were incubated with V5 antiserum, immunoprecipitated, separated by SDS-PAGE, transferred to membrane, and probed with anti-Nav1.5 antibody. Western blotting analyses suggest that LITAF is found in a protein complex with Nav1.5 (Fig. 3A). Additionally, we performed in situ PLA to look for any co-localization between these two molecules in 3wRbCM (Fig. 3B). The specificity of the assay was shown by the lack of staining using mouse anti-LITAF or rabbit anti-Nav1.5 as negative controls. The appearance of puncta with the combination of mouse anti-LITAF and rabbit anti-Nav1.5 supports proximity between LITAF and Nav1.5 in cardiomyocytes.
      Figure thumbnail gr3
      Figure 3Physical interaction between LITAF and Nav1.5 in HEK cells and 3wRbCM. A, V5 IP of lysates from HEK cells stably expressing V5-tagged Nav1.5 and transfected with plasmids for HA-tagged LITAF or empty expression plasmid (control) (n = 3). The right panel shows immunoprecipitated Nav1.5 and co-precipitated LITAF-HA and thus an interaction between LITAF and Nav1.5 (the asterisk indicates the light chain of the IP capture antibody). Input levels of Nav1.5 and LITAF-HA are shown in the left panel. B, Duolink in situ proximity ligation assay using mouse anti-LITAF and rabbit anti-Nav1.5 antibodies in 3wRbCM. The co-localization between molecules is indicated by red puncta (left panel). Virtually no puncta were detected in negative controls in which only one antibody was used, i.e. rabbit anti-Nav1.5 (middle panel) or mouse anti-LITAF antibodies (right panel). The nuclei were stained with DAPI (blue). Depicted merged confocal images (bright field, DAPI, and Texas Red) are representative of each condition. Scale bar, 50 μm.

      LITAF blunts the NEDD4-2–dependent down-regulation of INa in HEK cells

      NEDD4-2–dependent ubiquitination is a prerequisite for the degradation of surface Nav1.5 (
      • Abriel H.
      • Kamynina E.
      • Horisberger J.D.
      • Staub O.
      Regulation of the cardiac voltage-gated Na+ channel (H1) by the ubiquitin-protein ligase Nedd4.
      ,
      • van Bemmelen M.X.
      • Rougier J.S.
      • Gavillet B.
      • Apothéloz F.
      • Daidié D.
      • Tateyama M.
      • Rivolta I.
      • Thomas M.A.
      • Kass R.S.
      • Staub O.
      • Abriel H.
      Cardiac voltage-gated sodium channel Nav1.5 is regulated by Nedd4-2 mediated ubiquitination.
      ). Because we have previously established physical and functional interactions between LITAF and the ubiquitin ligase NEDD4-1 (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ), we entertained the possibility LITAF may also regulate NEDD4-2 with respect to Nav1.5. Therefore, we first looked for any physical interaction between NEDD4-2 and LITAF, which could be mediated by four WW domains of NEDD4-2 and two PXY motifs of LITAF (
      • Shirk A.J.
      • Anderson S.K.
      • Hashemi S.H.
      • Chance P.F.
      • Bennett C.L.
      SIMPLE interacts with NEDD4 and TSG101: evidence for a role in lysosomal sorting and implications for Charcot–Marie–Tooth disease.
      ,
      • Boase N.A.
      • Kumar S.
      NEDD4: The founding member of a family of ubiquitin-protein ligases.
      ). Total lysates of stable HEK cells transiently expressing HA-tagged LITAF and FLAG-tagged NEDD4-2 or FLAG-tagged NEDD4-2 were immunoprecipitated with FLAG antibody. The resulting immunoprecipitates were subjected to Western blotting. Fig. 4A shows co-precipitated LITAF indicating that LITAF and NEDD4-2 are found in the same protein complex. We also noticed that LITAF significantly reduced levels of co-expressed NEDD4-2 by 39% (Fig. 4A). Next, we wanted to assess the possible role of LITAF and NEDD4-2 in the homeostasis of Nav1.5. To this end, we transiently transfected HEK cells stably expressing Nav1.5 and GFP. Not surprisingly, co-expressed NEDD4-2 significantly decreased peak INa density (e.g. by 68%, viz. from −71.1 ± 12.7 pA/pF to −22.5 ± 3.8 pA/pF; −10 mV; p < 0.01; Fig. 4B), which is in agreement with a previous study by van Bemmelen et al. (
      • van Bemmelen M.X.
      • Rougier J.S.
      • Gavillet B.
      • Apothéloz F.
      • Daidié D.
      • Tateyama M.
      • Rivolta I.
      • Thomas M.A.
      • Kass R.S.
      • Staub O.
      • Abriel H.
      Cardiac voltage-gated sodium channel Nav1.5 is regulated by Nedd4-2 mediated ubiquitination.
      ). Co-expressed LITAF, however, partially reversed the negative effect of NEDD4-2 on INa density (from −22.5 ± 3.8 pA/pF to −37.6 ± 13.0 pA/pF; −10mV; p < 0.01; Fig. 4B). Thus, this 52% recovery of INa in the presence of co-expressed LITAF is in line with the aforementioned 39% LITAF-dependent drop in NEDD4-2 levels. In summary, these functional data corroborate a role for LITAF modulating membrane expression of Nav1.5 by regulating NEDD4-2 ubiquitination-mediated degradation.
      Figure thumbnail gr4
      Figure 4LITAF partially abolishes NEDD4-2–dependent down-regulation of INa in HEK cells. A, co-immunoprecipitation of cell lysates from HEK cells transfected with plasmids for NEDD4-2–FLAG and LITAF-HA or just NEDD4-2–FLAG for 48h (n = 3). Top panel, the top part shows an interaction between immunoprecipitated NEDD4-2–FLAG and co-precipitated LITAF-HA (the asterisk indicates the light chain of the IP capture antibody), whereas the bottom part displays input levels of NEDD4-2–FLAG and LITAF-HA. Bottom panel, respective changes in input NEDD4-2 expression, normalized to tubulin. All values are means ± S.E. (n = 3). B, current–voltage relationships of INa peak currents for baseline conditions from cells expressing. GFP (control), NEDD4-2, or NEDD4-2 and LITAF (means ± S.E.). Two-way analysis of variance for repeated measures revealed significant differences in INa between all groups: GFP versus NEDD4-2: F = 80.05, p < 0.0001. NEDD4-2 versus NEDD4-2 + LITAF: F = 11.42, p = 0.0008. GFP versus NEDD4-2 + LITAF: F = 15.28, p = 0.0001.

      Overexpression of LITAF results in ubiquitination and proteasomal degradation of NEDD4-2 in HEK cells

      Because the data presented in Fig. 4 suggest a functional interaction between LITAF and NEDD4-2 regulating Nav1.5 expression on the membrane, we wanted to investigate the possible role of LITAF in the regulation of NEDD4-2. To this end, we measured endogenous NEDD4-2 levels in 3-week-old and neonatal rabbit cardiomyocytes (NRbCM) overexpressing LITAF. We noted that LITAF overexpression reduced total levels of NEDD4-2 by ∼30% (3wRbCM) and 50% (NRbCM), respectively (Fig. 5, A, B, and E). Similarly, LITAF overexpression down-regulated endogenous NEDD4-2 levels by ∼60% in HEK cells (Fig. 5, C and E). Lastly, co-expression of LITAF and FLAG-tagged NEDD4-2 in HEK cells resulted in an ∼90% down-regulation of NEDD4-2–FLAG (Fig. 5, D and E).
      Figure thumbnail gr5
      Figure 5LITAF down-regulates total NEDD4-2 expression. Adenovirus for expression of GFP (control) or LITAF-HA was incubated with 3wRbCM (10 MOI) (A) or NRbCM (2 MOI) (B) for 48 h. HEK cells were transfected with plasmid encoding GFP (control) or HA-tagged LITAF (C) for 48 h. Representative Western blotting data from respective extracts to measure expression of NEDD4-2, tubulin, and LITAF-HA. D, NEDD4-2–FLAG, LITAF-HA, and tubulin expression in HEK cells transfected with expression plasmids for NEDD4-2–FLAG, LITAF-HA, or control plasmid for 48 h. E, Respective relative LITAF-dependent NEDD4-2 expression levels normalized to tubulin expression from four independent experiments performed in duplicate (Student's t test; p < 0.05). In the scatter plot, averaged values for the four independent experiments together with the means and S.E. values are shown.
      We reasoned that LITAF overexpression likely caused ubiquitin-mediated degradation of NEDD4-2 in the various cell types tested. To test this hypothesis, we co-transfected expression plasmids for HA-tagged ubiquitin, FLAG-tagged NEDD4-2, FLAG-tagged LITAF, or control plasmid into HEK cells. Total cell extracts prepared 2 days later were immunoprecipitated with an anti-HA antibody to enrich for HA-ubiquitinated protein. The ubiquitinated protein fraction was separated by size using SDS-PAGE, transferred to a membrane, and probed against NEDD4-2. Western blotting data depicted in Fig. 6A indicate a significant, severalfold, LITAF-dependent increase in a single NEDD4-2 band implying likely monoubiquitination of the ubiquitin ligase. Next, we tested the pathways potentially responsible for LITAF-dependent NEDD4-2 degradation. We treated HEK cells expressing NEDD4-2, LITAF, or control plasmid with the selective proteasome inhibitor MG132 (
      • Tsubuki S.
      • Saito Y.
      • Tomioka M.
      • Ito H.
      • Kawashima S.
      Differential inhibition of calpain and proteasome activities by peptidyl aldehydes of di-leucine and tri-leucine.
      ) or the lysosomal inhibitor chloroquine (
      • Homewood C.A.
      • Warhurst D.C.
      • Peters W.
      • Baggaley V.C.
      Lysosomes, pH and the anti-malarial action of chloroquine.
      ) for 24 h. Treatment of cells with MG132, but not treatment with chloroquine, partially prevented the LITAF-mediated down-regulation of NEDD4-2 (Fig. 6B). In summary, our data suggest that LITAF overexpression causes NEDD4-2 monoubiquitination and its subsequent degradation, in part through proteasomes. This, in turn, could account for the LITAF-mediated up-regulation of Nav1.5 expression and INa in cardiomyocytes.
      Figure thumbnail gr6
      Figure 6LITAF causes ubiquitination and subsequent proteasomal degradation of NEDD4-2 in HEK cells. A, IP of lysates from HEK cells transfected with plasmids for FLAG-tagged NEDD4-2, HA-tagged ubiquitin, FLAG-tagged LITAF, or control plasmid for 48 h was performed with anti-HA antiserum. A representative immunoblot shows levels of ubiquitinated NEDD4-2–FLAG and tubulin and input levels of NEDD4-2–FLAG, LITAF-FLAG, or tubulin. Relative NEDD4-2–FLAG ubiquitination levels as calculated by the ratio of ubiquitinated NEDD4-2 normalized to ubiquitinated tubulin and total NEDD4-2 normalized to total ubiquitin levels (n = 5; means ± S.E.). In the scatter plot, averaged values for the five independent experiments together with the means and S.E. values are shown. Bottom panel, Student's t test, p < 0.01. B, LITAF-mediated degradation of NEDD4-2 through proteasomes. HEK cells were transfected with plasmids for NEDD4-2–FLAG, LITAF-HA or control plasmid for 24 h and then treated with vehicle (▿), 5 μm MG132 (), or 10 μm chloroquine () for 24 h. Top panel, representative Western blots show total expression of NEDD4-2–FLAG, LITAF-HA, and tubulin of treated cells. Bottom panel, respective relative expression levels (means ± S.E.) of total NEDD4-2 normalized to tubulin levels (n = 4, n = 2, p < 0.05).

      Computer modeling of LITAF overexpression

      Several genome-wide association studies (
      • Newton-Cheh C.
      • Eijgelsheim M.
      • Rice K.M.
      • de Bakker P.I.
      • Yin X.
      • Estrada K.
      • Bis J.C.
      • Marciante K.
      • Rivadeneira F.
      • Noseworthy P.A.
      • Sotoodehnia N.
      • Smith N.L.
      • Rotter J.I.
      • Kors J.A.
      • Witteman J.C.
      • et al.
      Common variants at ten loci influence QT interval duration in the QTGEN Study.
      ,
      • Arking D.E.
      • Pulit S.L.
      • Crotti L.
      • van der Harst P.
      • Munroe P.B.
      • Koopmann T.T.
      • Sotoodehnia N.
      • Rossin E.J.
      • Morley M.
      • Wang X.
      • Johnson A.D.
      • Lundby A.
      • Gudbjartsson D.F.
      • Noseworthy P.A.
      • Eijgelsheim M.
      • et al.
      Genetic association study of QT interval highlights role for calcium signaling pathways in myocardial repolarization.
      ,
      • Pfeufer A.
      • Sanna S.
      • Arking D.E.
      • Müller M.
      • Gateva V.
      • Fuchsberger C.
      • Ehret G.B.
      • Orrú M.
      • Pattaro C.
      • Köttgen A.
      • Perz S.
      • Usala G.
      • Barbalic M.
      • Li M.
      • Pütz B.
      • et al.
      Common variants at ten loci modulate the QT interval duration in the QTSCD Study.
      ) have implied a role for LITAF in QT interval and, therefore, in action potential regulation. Hence, we were interested in whether the LITAF-dependent effects on INa (in this study) and L-type calcium current ICa,L (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ) could account for any changes in APD. To this end, we used a physiologically detailed model of rabbit ventricular myocyte with membrane voltage coupled to spatially distributed subcellular calcium dynamics. This model is im-proved from Moshal et al. (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ) through several modifications. First, we included the late sodium current (INaL) from Hwang et al. (
      • Hwang J.
      • Kim T.Y.
      • Terentyev D.
      • Mingwang Z.
      • Kabakov A.Y.
      • Karma A.
      • Koren G.
      • Bum-Rak C.
      Late INa blocker GS967 suppresses polymorphic VT in a transgenic rabbit model of long QT type 2.
      ). Second, based on the voltage-clamp experiments, we modeled the effects of LITAF overexpression by increasing the conductance of both INa and INaL by 35% and reducing the number of LTCCs by 50% as in our previous study (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ). We modeled the myocyte in current-clamp mode at 2.5 Hz (400-ms pacing cyclic length) and recorded the transmembrane voltage (V), the calcium transient, and several sarcolemmal currents after the intracellular sodium concentration [Na+]i reached steady state. We investigated three different conditions: control GFP with intracellular sodium concentration ([Na+]i) unclamped, LITAF overexpression with [Na+]i unclamped, and LITAF overexpression with [Na+]i clamped at a value of 11 mm corresponding to the average steady-state [Na+]i value under GFP; the latter condition was studied to dissect the effect of a change of steady-state [Na+]i on action potential duration. The comparison of GFP and LITAF simulations with unclamped [Na+]i (red and blue traces in Fig. 7) demonstrate that the 50% decrease of LTCC number (Fig. 7D) together with the 35% increase of sodium channel conductance (INa and INaL in Fig. 7, I and J) shortens the APD from 218 ms with GFP to 196 ms with LITAF (Fig. 7A). The results further show that this modest change of APD can be attributed to the subtle knock-on effect of ICa,L on other currents mediated by the changes in [Ca2+]i transient and [Na+]i, preliminarily explored in Moshal et al. (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ). More specifically, the decrease in the [Ca2+]i transient amplitude (Fig. 7B) caused by the reduction of ICa,L (Fig. 7D) decreases the amplitude of both the forward and reverse modes of the Na+/Ca2+ exchanger current (INCX), thereby causing a net decrease in [Na+]i caused by reduction of the net forward mode of INCX averaged over one pacing cyclic length. This decrease in [Na+]i in turn decreases the repolarizing Na,K-ATPase current (INaK) (Fig. 7F), thereby partially counterbalancing the effect of ICa,L reduction on APD shortening. The results also show that although the magnitude of the rapid component of the delayed rectifier potassium current (IKr) remains largely unchanged (Fig. 7H), the lowered action potential plateau significantly suppresses the fast component of the delayed rectifier potassium current (IKs) (Fig. 7G), despite a modest APD shortening, thereby further contributing to counterbalancing APD shortening. Although both hyperpolarizing INaK and IKs are reduced under LITAF compared with GFP, the simulation results with [Na+]i clamped at the higher 11 mm steady-state value corresponding to GFP (green traces in Fig. 7) clearly show that the reduction of steady-state [Na+]i is the main causal mechanism underlying the smaller than expected APD shortening in the presence of significant ICa,L reduction. In particular, without this decrease, when [Na+]i is clamped at its higher GFP value, INaK is only slightly lower under LITAF than GFP (red and green traces in Fig. 7F), thereby yielding a more significant APD shortening (Fig. 7A). Importantly, APD is significantly shortened despite further reduction of IKs as a direct effect of membrane voltage (Fig. 7G), and peak INaL is only slightly reduced. An additional simulation carried out with unclamped [Na+]i and modeling only the effect of LITAF overexpression on ICa,L, but not that on INa and INaL, confirmed that INa and INaL increase has a minor effect on both APD and [Na+]i (results not shown). This is because, with LITAF overexpression, the reductions in INaK and IKs contribute more than the modest increase in INaL to counterbalancing the decrease of APD. Moreover, the fast component of INa makes a negligible contribution to [Na+]i because of its short ∼1-ms duration (red and blue traces in Fig. 7I), and the modest increase of INaL (Fig. 7J) is insufficient to counterbalance the decrease of [Na+]i caused by reduced INCX with LITAF overexpression. In summary, the computer modeling results demonstrate that changes in Ca2+ and Na+ homeostasis are primarily responsible for the more modest than expected APD shortening in the presence of LITAF overexpression. The decrease of functional ICa,L current density causes a decrease of Ca2+ transient amplitude that in turn decreases INCX and thus [Na+]i and INaK. The decrease in ICa,L lowers the action potential plateau that in turn reduces the IKs. Reduction of hyperpolarizing INaK and IKs then jointly contribute to counterbalancing the APD shortening because of decreased ICa,L with sodium current enhancement having a relatively small effect.
      Figure thumbnail gr7
      Figure 7Computer simulations of rabbit ventricular myocytes. Cardiomyocytes were paced at 2.5 Hz under three different conditions: transduced with adenovirus encoding GFP with intracellular sodium concentration [Na+]i unclamped (red traces); adenovirally transduced causing LITAF overexpression with [Na+]i unclamped (blue traces); and adenoviral overexpression of LITAF with [Na+]i clamped to the same average steady-state 11 mm value reached under GFP (green traces). Transmembrane voltage V (A), cytosolic calcium concentration [Ca2+]i(B), [Na+]i (C), L-type calcium current ICa,L (D), Na+/Ca2+ exchanger current INCX (E), Na+/K+-pump current INaK (F), slowly activating delayed rectifier K+ current IKs (G), rapidly activating delayed rectifier K+ current IKr (H), fast sodium current INa (I), and late sodium current INaL (J).
      To investigate the role for LITAF on APD in vivo, we created a LITAF KO zebrafish line (c.45_55del), using Crispr/Cas9. Compared with WT fish, we observed a nonsignificant modest 14.4% increase in APD in homozygous KO zebrafish (mean ventricular APD80 ± S.E.: homozygous 301 ± 18.7 ms (n = 21) versus WT 263 ± 13 ms (n = 13); p = 0.16). Notably, there is a significant increase in the variations of the APD of the KO zebrafish as compared with WT fish (p < 0.05). Of note, we previously observed insignificant shortening of APD in 3-week-old rabbit cardiomyocytes overexpressing LITAF in agreement with computer modeling results (data not shown), whereas morpholino-mediated down-regulation of LITAF in zebrafish embryos resulted in prolongation of APD that did not reach statistical significance (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ). This suggests that decreased [Na+]i and INaK as a knock-on effect of decreased ICa,L current density may be a common mechanism for the modest change of APD in both rabbit and zebrafish cardiomyocytes. Even though IKs assists INaK in counterbalancing the effect of decreased ICa,L on APD in rabbit cardiomyocytes, decreased [Na+]i and INaK still play a dominant role in keeping APD almost constant. Hence, even though IKs is not significantly expressed in zebrafish (
      • Vornanen M.
      • Hassinen M.
      Zebrafish heart as a model for human cardiac electrophysiology.
      ), decreased [Na+]i and INaK may suffice to counterbalance the effect of LITAF on ICa,L current density in zebrafish.

      Discussion

      Previously, several genome-wide association studies have identified SNPs located upstream of the LITAF gene, encoding a regulator of endosomal trafficking (
      • Lee S.M.
      • Chin L.S.
      • Li L.
      Charcot–Marie–Tooth disease-linked protein SIMPLE functions with the ESCRT machinery in endosomal trafficking.
      ,
      • Shirk A.J.
      • Anderson S.K.
      • Hashemi S.H.
      • Chance P.F.
      • Bennett C.L.
      SIMPLE interacts with NEDD4 and TSG101: evidence for a role in lysosomal sorting and implications for Charcot–Marie–Tooth disease.
      ,
      • Chin L.S.
      • Lee S.M.
      • Li L.
      SIMPLE: A new regulator of endosomal trafficking and signaling in health and disease.
      ), associated with QT interval (
      • Newton-Cheh C.
      • Eijgelsheim M.
      • Rice K.M.
      • de Bakker P.I.
      • Yin X.
      • Estrada K.
      • Bis J.C.
      • Marciante K.
      • Rivadeneira F.
      • Noseworthy P.A.
      • Sotoodehnia N.
      • Smith N.L.
      • Rotter J.I.
      • Kors J.A.
      • Witteman J.C.
      • et al.
      Common variants at ten loci influence QT interval duration in the QTGEN Study.
      ,
      • Arking D.E.
      • Pulit S.L.
      • Crotti L.
      • van der Harst P.
      • Munroe P.B.
      • Koopmann T.T.
      • Sotoodehnia N.
      • Rossin E.J.
      • Morley M.
      • Wang X.
      • Johnson A.D.
      • Lundby A.
      • Gudbjartsson D.F.
      • Noseworthy P.A.
      • Eijgelsheim M.
      • et al.
      Genetic association study of QT interval highlights role for calcium signaling pathways in myocardial repolarization.
      ,
      • Pfeufer A.
      • Sanna S.
      • Arking D.E.
      • Müller M.
      • Gateva V.
      • Fuchsberger C.
      • Ehret G.B.
      • Orrú M.
      • Pattaro C.
      • Köttgen A.
      • Perz S.
      • Usala G.
      • Barbalic M.
      • Li M.
      • Pütz B.
      • et al.
      Common variants at ten loci modulate the QT interval duration in the QTSCD Study.
      ). In the present study, we provide evidence that LITAF controls the voltage-gated sodium current INa in rabbit cardiomyocytes. The main finding of this study is that LITAF increases INa and expression of Nav1.5 channel on the membrane by promoting ubiquitination and degradation of the ubiquitin ligase NEDD4-2, which is indispensable for Nav1.5 turnover (
      • Abriel H.
      • Kamynina E.
      • Horisberger J.D.
      • Staub O.
      Regulation of the cardiac voltage-gated Na+ channel (H1) by the ubiquitin-protein ligase Nedd4.
      ,
      • van Bemmelen M.X.
      • Rougier J.S.
      • Gavillet B.
      • Apothéloz F.
      • Daidié D.
      • Tateyama M.
      • Rivolta I.
      • Thomas M.A.
      • Kass R.S.
      • Staub O.
      • Abriel H.
      Cardiac voltage-gated sodium channel Nav1.5 is regulated by Nedd4-2 mediated ubiquitination.
      ). The voltage-gated sodium channel Nav1.5 is critical for the generation and conduction of cardiac action potentials. Mutations and changes in the expression level of Nav1.5 are associated with cardiac arrhythmias and sudden cardiac death as reviewed by Song et al. (
      • Song W.
      • Shou W.
      Cardiac sodium channel Nav1.5 mutations and cardiac arrhythmia.
      ).
      Because forward and retrograde trafficking of ion channels affect their overall function under physiological as well as pathological conditions, a large number of studies identified molecular factors involved in Nav1.5 trafficking and degradation (reviewed by Rook et al. (
      • Rook M.B.
      • Evers M.M.
      • Vos M.A.
      • Bierhuizen M.F.
      Biology of cardiac sodium channel Nav1.5 expression.
      )). For example, van Bemmelen et al. (
      • van Bemmelen M.X.
      • Rougier J.S.
      • Gavillet B.
      • Apothéloz F.
      • Daidié D.
      • Tateyama M.
      • Rivolta I.
      • Thomas M.A.
      • Kass R.S.
      • Staub O.
      • Abriel H.
      Cardiac voltage-gated sodium channel Nav1.5 is regulated by Nedd4-2 mediated ubiquitination.
      ) showed that the HECT ubiquitin ligase NEDD4-2 could bind through its WW domains to the PXY motif found at the C terminus of Nav1.5. Overexpression of NEDD4-2, but not the closely related NEDD4-1, increased Nav1.5 ubiquitination and subsequent degradation in HEK cells. Follow-up studies identified the ubiquitin-activating enzymes UBE1 and UBA6 (
      • Hu Y.
      • Bai X.
      • Zhang C.
      • Chakrabarti S.
      • Tang B.
      • Xiong H.
      • Wang Z.
      • Yu G.
      • Xu C.
      • Chen Q.
      • Wang Q.K.
      Ubiquitination-activating enzymes UBE1 and UBA6 regulate ubiquitination and expression of cardiac sodium channel Nav1.5.
      ), as well as the ubiquitin-conjugating enzyme UBC9 (
      • Tang B.
      • Hu Y.
      • Wang Z.
      • Cheng C.
      • Wang P.
      • Liang L.
      • Xiong H.
      • Luo C.
      • Xu C.
      • Chen Q.
      • Wang Q.K.
      UBC9 regulates cardiac sodium channel Na.
      ), to be required for NEDD4-2–dependent ubiquitination of Nav1.5 in neonatal rat cardiomyocytes and HEK cells. Our data suggest that this NEDD4-2–dependent control of Nav1.5 turnover is regulated by LITAF, previously identified as a protein involved in endosomal trafficking and inflammation (
      • Lee S.M.
      • Chin L.S.
      • Li L.
      Charcot–Marie–Tooth disease-linked protein SIMPLE functions with the ESCRT machinery in endosomal trafficking.
      ,
      • Shirk A.J.
      • Anderson S.K.
      • Hashemi S.H.
      • Chance P.F.
      • Bennett C.L.
      SIMPLE interacts with NEDD4 and TSG101: evidence for a role in lysosomal sorting and implications for Charcot–Marie–Tooth disease.
      ,
      • Zhu H.
      • Guariglia S.
      • Yu R.Y.
      • Li W.
      • Brancho D.
      • Peinado H.
      • Lyden D.
      • Salzer J.
      • Bennett C.
      • Chow C.W.
      Mutation of SIMPLE in Charcot–Marie–Tooth 1C alters production of exosomes.
      ,
      • Tang X.
      • Marciano D.L.
      • Leeman S.E.
      • Amar S.
      LPS induces the interaction of a transcription factor, LPS-induced TNF-α factor, and STAT6(B) with effects on multiple cytokines.
      ,
      • Tang X.
      • Metzger D.
      • Leeman S.
      • Amar S.
      LPS-induced TNF-α factor (LITAF)–deficient mice express reduced LPS-induced cytokine: evidence for LITAF-dependent LPS signaling pathways.
      ,
      • Merrill J.C.
      • You J.
      • Constable C.
      • Leeman S.E.
      • Amar S.
      Whole-body deletion of LPS-induced TNF-α factor (LITAF) markedly improves experimental endotoxic shock and inflammatory arthritis.
      ).
      We provide evidence that 1) LITAF is found in protein complexes with Nav1.5 and NEDD4-2 in HEK cells and in 3wRbCM; 2) LITAF overexpression resulted in higher INa and total Nav1.5; 3) LITAF co-expression blunted the negative effect of NEDD4-2 on INa; and 4) LITAF lowered exogenous and endogenous NEDD4-2 levels by promoting its ubiquitination and degradation. Thus, it is possible that LITAF and the small NEDD4 family-interacting proteins (NDFIPs), NDFIP1 and NDFIP2 (
      • Yang B.
      • Kumar S.
      Nedd4 and Nedd4-2: closely related ubiquitin-protein ligases with distinct physiological functions.
      ) may share common mechanisms in regulating members of the NEDD4 family.
      Interestingly, we have recently published that LITAF is also a regulator of L-type calcium channels in zebrafish and rabbit cardiomyocytes (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ). Here, LITAF acts as an adaptor protein and activator of the HECT ubiquitin ligase NEDD4-1. This led to subsequent degradation of L-type calcium channel, thereby controlling its membrane levels, ICa,L, and thus cardiac excitation. Currently, we can only speculate as to why LITAF regulates NEDD4-1 and NEDD4-2 differently with respect to their target molecules LTCC and Nav1.5 in cardiomyocytes. Similar to NDFIPs, we noted that LITAF overexpression lowered the amount of both NEDD4-2 (Fig. 5) and NEDD4-1,5 which was accompanied by increased ubiquitination (Fig. 6A).
      N. N. Turan, K. S. Moshal, K. Roder, B. C. Baggett, A. Y. Kabakov, S. Dhakal, R. Teramoto, D. Y.-E. Chiang, M. Zhong, A. Xie, Y. Lu, S. C. Dudley, Jr., C. A. MacRae, A. Karma, and G. Koren, unpublished data.
      Importantly, LITAF also enhanced NEDD4-1-dependent ubiquitination of LTCC (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ). It is conceivable that LITAF may act similarly to NDFIPs (
      • Yang B.
      • Kumar S.
      Nedd4 and Nedd4-2: closely related ubiquitin-protein ligases with distinct physiological functions.
      ), possibly redirecting NEDD4-2 from the surface, where it would ubiquitinate Nav1.5, to another cellular location for sequestration or to target other substrates. Nevertheless, the net effect is to set a ratiometric relationship between LTCC and Nav1.5 at the membrane, thus regulating repolarization and its dynamics.
      Although we have recapitulated LITAF's positive effect on INa in stable HEK cells (Fig. 2, A and B) and provided a molecular explanation for this phenomenon, viz. down-regulation of NEDD4-2 required for Nav1.5 degradation (Fig. 5), other mechanisms may contribute to the LITAF-dependent increase in INa in cardiomyocytes. For example, Luo et al. (
      • Luo L.
      • Ning F.
      • Du Y.
      • Song B.
      • Yang D.
      • Salvage S.C.
      • Wang Y.
      • Fraser J.A.
      • Zhang S.
      • Ma A.
      • Wang T.
      Calcium-dependent Nedd4-2 upregulation mediates degradation of the cardiac sodium channel Nav1.5: implications for heart failure.
      ) have shown that elevated intracellular calcium levels increase NEDD4-2 mRNA expression in neonatal rat cardiomyocytes. Higher NEDD4-2 protein levels, in turn, reduced Nav1.5 and INa. Because LITAF overexpression in rabbit cardiomyocytes resulted in lower ICa,L and calcium transients (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ) but increased INa (Fig. 1), it is possible that resulting lower intracellular calcium levels could reduce NEDD4-2 mRNA expression, diminishing the negative impact NEDD4-2 has on surface Nav1.5 protein levels and INa. Several studies reported lower Nav1.5 protein levels and INa in ischemia and heart failure (
      • Zicha S.
      • Maltsev V.A.
      • Nattel S.
      • Sabbah H.N.
      • Undrovinas A.I.
      Post-transcriptional alterations in the expression of cardiac Na+ channel subunits in chronic heart failure.
      ,
      • Dun W.
      • Lowe J.S.
      • Wright P.
      • Hund T.J.
      • Mohler P.J.
      • Boyden P.A.
      Ankyrin-G participates in INa remodeling in myocytes from the border zones of infarcted canine heart.
      ), likely increasing the risk for arrhythmias. In ischemia, no changes in Nav1.5 transcript levels were detected, implying accelerated degradation of Nav1.5 protein. At least one ubiquitin-dependent mechanism may account for the decrease in Nav1.5 levels in cardiac disease. Increased calcium concentrations in the cytosol caused by malfunctioning RYR2 increased NEDD4-2 expression lowering Nav1.5 levels, as data from volume-overload heart failure rat hearts suggested (
      • Luo L.
      • Ning F.
      • Du Y.
      • Song B.
      • Yang D.
      • Salvage S.C.
      • Wang Y.
      • Fraser J.A.
      • Zhang S.
      • Ma A.
      • Wang T.
      Calcium-dependent Nedd4-2 upregulation mediates degradation of the cardiac sodium channel Nav1.5: implications for heart failure.
      ).
      In agreement with the experiments associated with LITAF overexpression in 3-week-old rabbit cardiomyocytes and with LITAF KO in zebrafish (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ), the computational simulation shows that LITAF overexpression shortens APD (Fig. 7). This effect takes place via the decrease in ICa,L resulting from the activation of HECT ubiquitin ligase NEDD4-1 (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ). The consequence of decreased ICa,L is to reduce the Ca2+ transient amplitude that in turn reduces [Na+]i. Together with the lowered APD plateau caused by decreased ICa,L, the decrease in [Na+]i reduces INaK. Another effect of the lowered AP plateau is the decrease of IKs. Reduction of hyperpolarizing INaK and IKs then jointly contribute to counterbalancing the APD shortening. The simulation also shows that the increase in sodium currents (INa and INaL) caused by LITAF overexpression has a minor effect on [Na+]i and APD. The overall effect of LITAF overexpression on INa and ICa,L would lead to shorter APD and QT interval.
      In summary, we conclude that LITAF is a novel regulator of Nav1.5 and INa. The data provided in this study and the evidence of its complex role in regulating multiple ion currents make LITAF an interesting target for innovative strategies in the prevention and treatment of ventricular arrhythmias, not least those associated with reduced Nav1.5 function and INa.

      Experimental procedures

      DNA

      An expression cassette consisting of the cardiac CMV-enhanced 0.26-kb rat myosin late chain promoter (
      • Geisler A.
      • Jungmann A.
      • Kurreck J.
      • Poller W.
      • Katus H.A.
      • Vetter R.
      • Fechner H.
      • Müller O.J.
      microRNA122-regulated transgene expression increases specificity of cardiac gene transfer upon intravenous delivery of AAV9 vectors.
      ), human β-globin intron, a fusion between the human LITAF ORF and three hemagglutinin (HA) tags, an internal ribosome entry site, the humanized Renilla reniformis GFP (hrGFP) ORF, and the human growth hormone polyadenylation signal (hGH1polyA) was cloned into pENTR 1A Dual (Thermo Fisher). The expression cassette was then transferred to the vector pAd/PL-DEST (Thermo Fisher) using the Gateway cloning system (Thermo Fisher). 293A cells (Thermo Fisher) were transfected with PacI-digested pAd/PL-DEST-CMV-MLC-LITAF-HA-hrGFP, and adenoviral stocks were prepared according to the manufacturer. As control, we created the vector pAd/PL-DEST-CMV-MLC-hrGFP that allows the expression of hrGFP in adenovirus. An expression cassette consisting of the CMV promoter, human β-globin intron, 3×HA LITAF, an internal ribosome entry site, hrGFP, and hGH1polyA was cloned into pENTR 1A Dual to obtain the mammalian expression vector pENTR-CMV-LITAF-HA-hrGFP. Similarly, the FLAG-tagged LITAF expression plasmid was created: pENTR-CMV-LITAF-FLAG-hrGFP. As control vector, pENTR-CMV-hrGFP–expressing hrGFP was created. The plasmid pcDNA3-Nedd4-2-FLAG was obtained from Dr. Sharad Kumar (Centre for Cancer Biology, University of South Australia and SA Pathology). pRK5-HA-ubiquitin-WT expressing HA-tagged ubiquitin (
      • Lim K.L.
      • Chew K.C.
      • Tan J.M.
      • Wang C.
      • Chung K.K.
      • Zhang Y.
      • Tanaka Y.
      • Smith W.
      • Engelender S.
      • Ross C.A.
      • Dawson V.L.
      • Dawson T.M.
      Parkin mediates nonclassical, proteasomal-independent ubiquitination of synphilin-1: implications for Lewy body formation.
      ) was purchased from Addgene (Addgene ID 17608). pDsRed-C1 vector was originally obtained from Clontech.

      Transfections

      HEK cells and HEK cells stably co-expressing Nav1.5 and GFP were cultured in DMEM (Thermo Fisher) supplemented with 10% FBS. Transient transfections of HEK cells were performed for 48 h using Lipofectamine 2000 (Thermo Fisher) and following the manufacturer's instructions. Typically, we transfected 200 ng of pENTR-CMV-LITAF-HA-hrGFP (or pENTR-CMV-hrGFP), 200 ng of pcDNA3-NEDD4-2–FLAG, 200 ng of pcDNA3, and 1.8 µl of Lipofectamine 2000 per 12-well (Figs. 5, C and D, and 6B) or 500 ng of pRK5-HA-Ubiquitin-WT, 500 ng of pENTR-CMV-LITAF-FLAG-hrGFP (or pENTR-CMV-hrGFP), 500 ng of pcDNA3-Nedd4-2-FLAG, 1.5 µg of pcDNA3 (Invitrogen), and 7.2 µl of Lipofectamine 2000 per 6-cm dish (Fig. 6A). For transient transfections of HEK cells stably expressing Nav1.5, we generally used 1600 ng of pENTR-CMV-LITAF-HA-hrGFP (or pENTR-CMV-hrGFP), 1600 ng of pcDNA3-NEDD4-2–FLAG (or pcDNA3), 800 ng of pENTR-CMV-hrGFP, 270 ng of pDsRed-C1, and 10 µl of Lipofectamine 2000 (Figs. 2, B–D; 3A; and 4, A and B).

      Preparation of rabbit cardiomyocytes

      All animal experiments and procedures were approved by the Rhode Island Hospital Institutional Animal Care and Use Committee (reference nos. 0188-14 and 5013-17). 3-week-old ventricular cardiomyocytes were isolated from the hearts of 3-week-old NZW rabbits (both sexes) with standard enzymatic techniques using a Langendorff system. NZW rabbits were administered pentobarbital sodium (65 mg/kg IP) and heparin (1,000 units/kg IP). The filtered cells were maintained in 45 mm KCl, 65 mm potassium glutamate, 3 mm MgSO4, 15 mm KH2PO4, 16 mm taurine, 10 mm HEPES, 0.5 mm EGTA, and 10 mm glucose (pH 7.3) for half an hour. In five subsequent steps, the Ca2+ concentration was increased to 1.8 mm. The cells were centrifuged, resuspended in DMEM supplemented with 7% FBS and antibiotics, plated on laminin-coated cover glasses or tissue culture dishes. After 2–3 h, the medium was replaced and adenovirus (50 MOI) added to the cells. The cells were maintained at 37 °C with 5% CO2, and ∼48 h later, the cells were used for patch clamping and biochemistry. The isolation of neonatal rabbit cardiomyocytes was exactly performed as described (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ).

      Electrophysiological recordings

      3-week-old rabbit cardiomyocytes were transduced with adenovirus ∼48 h before INa recording. The experiments were conducted at 34–36°C with an Axopatch-200B amplifier, Digidata 1440A, and pClamp 10 software (Axon Instruments). The signal was acquired at 20 kHz and filtered at 10 kHz. The whole-cell configuration was obtained in standard Tyrode solution containing 140 mm NaCl, 5.4 mm KCl, 0.33 mm NaH2PO4, 1.8 mm CaCl2, 1 mm MgCl2, 10 mm HEPES, 5.5 mm d-glucose, and pH 7.4 was adjusted with NaOH. The pipette solution contained 80 mm CsCl, 80 mm Cs aspartate, 1 mm MgCl2, 1 mm CaCl2, 11 mm EGTA, 10 mm HEPES, 5 mm Na2ATP, and pH 7.3 was adjusted with CsOH. The pipette resistance was 1–2 MΩ. After obtaining the whole-cell configuration and compensation of the capacitive artifact and access resistance by 80%, we replaced the Tyrode solution with low sodium solution containing 100 mm N-methyl-d-glucamine, 20 mm tetraethylammonium chloride, 10 mm NaCl, 5 mm CsCl, 2 mm CaCl2, 1.2 mm MgCl2, 10 mm HEPES, 5 mm d-glucose, 0.01 mm nifedipine, and pH 7.4 was adjusted with HCl. To obtain IV curves for INa, the cells were depolarized from −100 mV holding potential to +60 mV by 200-ms depolarizing steps in 10-mV increments. The IV curve in Fig. 1B was fitted with OriginPro 2019 Boltzmann IV function, and the obtained Erev values have been used to calculate conductance as g = INa/(VErev) at different potentials for the activation curve in Fig. 1C. To study inactivation of INa, the 200-ms depolarizing steps were followed by a 220-ms step to −20 mV. The INa peak values were always measured relatively to the tail current at the end of the corresponding voltage pulse. To study effects of LITAF and NEDD4-2 on INa in stable HEK cells, we used the same solutions and voltage protocols as described above for 3-week-old rabbit cardiomyocytes.

      Immunoblot analysis

      Surface biotinylations, co-IP, and immunoblots were exactly carried out as in previous studies (
      • Roder K.
      • Werdich A.A.
      • Li W.
      • Liu M.
      • Kim T.Y.
      • Organ-Darling L.E.
      • Moshal K.S.
      • Hwang J.M.
      • Lu Y.
      • Choi B.R.
      • MacRae C.A.
      • Koren G.
      RING finger protein RNF207, a novel regulator of cardiac excitation.
      ,
      • Roder K.
      • Kabakov A.
      • Moshal K.S.
      • Murphy K.R.
      • Xie A.
      • Dudley S.
      • Turan N.N.
      • Lu Y.
      • MacRae C.A.
      • Koren G.
      Trafficking of the human ether-a-go-go-related gene (hERG) potassium channel is regulated by the ubiquitin ligase rififylin (RFFL).
      ,
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ).

      In situ proximity ligation assay

      For PLA, 3wRbCM were plated on 12-mm laminin-coated circular glass coverslips and cultured for 3–5 h in 24-well plates. The cells were fixed with 4% paraformaldehyde at room temperature for 15 min followed by permeabilization at room temperature with 0.1% Triton X-100 for 10 min prior to the assay. PLA was performed according to the manufacturer's instructions (Sigma: Duolink® in situ Red starter kit mouse/rabbit). After five washes with PBS, the cells were blocked for 30 min at 37 °C. Antibodies used for PLA were as follows: rabbit anti-Nav1.5 (Alomone; ASC-005; 1:100) and mouse anti-LITAF (Abnova; H00009516-B01P; 1:100). The images were captured using a Nikon A1R laser scanning confocal microscope, DAPI (excitation, 359; emission, 461), Texas Red (excitation, 595; emission, 612) filters for detection purposes at 60× zoom, and Elements software (Nikon).

      Rabbit ventricular myocyte model

      To study the effect of LITAF in myocytes, we used a physiologically detailed rabbit ventricular myocyte model of Moshal et al. (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ). This model is based on earlier models developed by Restrepo et al. (
      • Restrepo J.G.
      • Weiss J.N.
      • Karma A.
      Calsequestrin-mediated mechanism for cellular calcium transient alternans.
      ) and further improved by both Terentyev et al. (
      • Terentyev D.
      • Rees C.M.
      • Li W.
      • Cooper L.L.
      • Jindal H.K.
      • Peng X.
      • Lu Y.
      • Terentyeva R.
      • Odening K.E.
      • Daley J.
      • Bist K.
      • Choi B.R.
      • Karma A.
      • Koren G.
      Hyperphosphorylation of RyRs underlies triggered activity in transgenic rabbit model of LQT2 syndrome.
      ) and Zhong et al. (
      • Zhong M.
      • Rees C.M.
      • Terentyev D.
      • Choi B.R.
      • Koren G.
      • Karma A.
      NCX-mediated subcellular Ca.
      ). Combining together a large number of ∼16,000 diffusively coupled Ca2+ release units, this multiscale model successfully links the whole-cell level Ca2+ dynamics to the local subcellular Ca2+ dynamics in each Ca2+ release unit, which incorporates four LTCC and 100 ryanodine receptors, both implemented by Markov models. By including the Ca2+-dependent channels LTCC and Na+-Ca2+ exchanger and other sarcolemmal currents, this detailed model describes the bidirectional coupling of Ca2+-Vm dynamics, which is essential in cardiac electrophysiological behavior. The details of LTCC model and ryanodine receptor model are shown by Zhong et al. (
      • Zhong M.
      • Rees C.M.
      • Terentyev D.
      • Choi B.R.
      • Koren G.
      • Karma A.
      NCX-mediated subcellular Ca.
      ).
      We carried out the current clamp simulations by pacing the myocytes at 2.5 Hz (400 ms) for three different conditions: control GFP with Na+]i unclamped, LITAF overexpression with [Na+]i unclamped, and LITAF overexpression with [Na+]i clamped at a value of 11 mm corresponding to the average steady-state [Na+]i value under GFP. For the [Na+]i unclamped simulations, we collected the data after the7 intracellular sodium concentration reached the steady state.
      Based on Moshal et al. (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ), we applied the modifications described by the following paragraphs. All the modified parameters are listed in Table 1.
      Table 1Modified parameters in the rabbit ventricular myocyte model
      ParameterDefinitionValue
      mSF
      gNaLINaL conductance (GFP)0.01
      gNaLINaL conductance (LITAF)0.0135
      gNaINa conductance (GFP)12.0
      gNaINa conductance (LITAF)16.2
      Following Hwang et al. (
      • Hwang J.
      • Kim T.Y.
      • Terentyev D.
      • Mingwang Z.
      • Kabakov A.Y.
      • Karma A.
      • Koren G.
      • Bum-Rak C.
      Late INa blocker GS967 suppresses polymorphic VT in a transgenic rabbit model of long QT type 2.
      ), we included the late sodium current (INaL). The model is described by the following set of equations.
      ENa=RTFlogNaoNai
      (Eq. 1)


      ml,=11+exp-V+52.72824.327
      (Eq. 2)


      hl,=11+exp-V-9.271519.913
      (Eq. 3)


      INaL=gNaLml,3hl,2(V-ENa)
      (Eq. 4)


      Based on the voltage-clamp experiments, we modeled the effects of LITAF overexpression by increasing the conductance of both INa and INaL by 35% in addition to reducing the number of LTCCs by 50% as in the work of Moshal et al. (
      • Moshal K.S.
      • Roder K.
      • Kabakov A.Y.
      • Werdich A.A.
      • Chiang D.Y.-E.
      • Turan N.N.
      • Xie A.
      • Kim T.Y.
      • Cooper L.L.
      • Lu Y.
      • Zhong M.
      • Li W.
      • Terentyev D.
      • Choi B.-R.
      • Karma A.
      • et al.
      LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
      ).

      Aquaculture

      The experiments were performed on zebrafish (Danio rerio) on the AB/Tuebingen (AB/Tu) background in accordance with animal protocols approved by the Harvard Medical School Institutional Animal Care and Use Committee. Care and breeding of zebrafish were performed as described previously at 28.5 °C, and embryos were maintained in standard E3 medium (
      • Panáková D.
      • Werdich A.A.
      • Macrae C.A.
      Wnt11 patterns a myocardial electrical gradient through regulation of the L-type Ca2+ channel.
      ).

      Generation of LITAF knockout in zebrafish

      WT AB/Tu zebrafish were crossed, and the resultant embryos were injected with a solution containing crRNA targeting LITAF (ATGGAGAACACGACCCTTGTGGG), Alt-R® tracrRNA, and Alt-R® S.p. HiFi Cas9 Nuclease V3 (all from Integrated DNA Technologies), according to the manufacturer's instructions. These F0 embryos were raised up and outcrossed individually to WT AB/Tu fish. Resultant F1 embryos were sequenced to identify clutches with frameshift mutations that are predicted to be loss-of-function mutations. Selected F1 clutches were raised, fin-clipped, and sequenced to confirm the mutation in each individual fish. Adult fish heterozygous for an 11-bp deletion in exon 2 of LITAF (c.45_55del), which is predicted to result in a severely truncated protein of 22 amino acids (p.L16PfsX8), were in-crossed. The resultant F2 embryos were WT, heterozygous, and homozygous for the 11-bp deletion in expected Mendelian ratios and were used for downstream experiments.

      Optical mapping of isolated zebrafish hearts

      Optical mapping and signal processing were performed as previously described (
      • Panáková D.
      • Werdich A.A.
      • Macrae C.A.
      Wnt11 patterns a myocardial electrical gradient through regulation of the L-type Ca2+ channel.
      ). Briefly, the hearts were isolated from zebrafish embryos at 72 h postfertilization and stained with the transmembrane potential–sensitive dye in the FluoVoltTM membrane potential kit (Thermo Fisher). The resultant fluorescence intensities were recorded with a high-speed CCD camera (RedShirtImaging), and images were analyzed using custom scripts in MATLAB.

      Statistical analysis and curve fitting

      Statistical analysis and curve fitting were performed with GraphPad Prism 8 and OriginPro 2019. The data are presented as means ± S.E. A difference was considered significant at p < 0.05.

      Replicates

      Throughout the study, we used biological replicates, i.e. different animals or different frozen HEK cell stocks (as indicated by N), and technical replicates (as indicated by n).

      Data availability

      All of the data are contained within the article.

      Acknowledgments

      We are indebted to Dr. Sharad Kumar (Centre for Cancer Biology, University of South Australia and SA Pathology) for providing pcDNA3–Nedd4-2–FLAG. We also thank Dr. Xiaofei Li (Rhode Island Hospital, Cardiovascular Research Center) for help with confocal microscopy.

      References

        • Rook M.B.
        • Evers M.M.
        • Vos M.A.
        • Bierhuizen M.F.
        Biology of cardiac sodium channel Nav1.5 expression.
        Cardiovasc. Res. 2012; 93 (21937582): 12-23
        • Abriel H.
        • Kass R.S.
        Regulation of the voltage-gated cardiac sodium channel Nav1.5 by interacting proteins.
        Trends Cardiovasc. Med. 2005; 15 (15795161): 35-40
        • Balse E.
        • Boycott H.E.
        Ion channel trafficking: control of ion channel density as a target for arrhythmias?.
        Front. Physiol. 2017; 8 (29089904): 808
        • Abriel H.
        • Kamynina E.
        • Horisberger J.D.
        • Staub O.
        Regulation of the cardiac voltage-gated Na+ channel (H1) by the ubiquitin-protein ligase Nedd4.
        FEBS Lett. 2000; 466 (10682864): 377-380
        • van Bemmelen M.X.
        • Rougier J.S.
        • Gavillet B.
        • Apothéloz F.
        • Daidié D.
        • Tateyama M.
        • Rivolta I.
        • Thomas M.A.
        • Kass R.S.
        • Staub O.
        • Abriel H.
        Cardiac voltage-gated sodium channel Nav1.5 is regulated by Nedd4-2 mediated ubiquitination.
        Circ. Res. 2004; 95 (15217910): 284-291
        • Jespersen T.
        • Membrez M.
        • Nicolas C.S.
        • Pitard B.
        • Staub O.
        • Olesen S.P.
        • Baró I.
        • Abriel H.
        The KCNQ1 potassium channel is down-regulated by ubiquitylating enzymes of the Nedd4/Nedd4-like family.
        Cardiovasc. Res. 2007; 74 (17289006): 64-74
        • Li W.
        • Yin L.
        • Shen C.
        • Hu K.
        • Ge J.
        • Sun A.
        Variants: association with cardiac disorders.
        Front. Physiol. 2018; 9 (30364184)1372
        • Xi Y.
        • Wu G.
        • Yang L.
        • Han K.
        • Du Y.
        • Wang T.
        • Lei X.
        • Bai X.
        • Ma A.
        Increased late sodium currents are related to transcription of neuronal isoforms in a pressure-overload model.
        Eur. J. Heart Fail. 2009; 11 (19584134): 749-757
        • Baba S.
        • Dun W.
        • Cabo C.
        • Boyden P.A.
        Remodeling in cells from different regions of the reentrant circuit during ventricular tachycardia.
        Circulation. 2005; 112 (16203911): 2386-2396
        • Liu M.
        • Yang K.C.
        • Dudley S.C.
        Cardiac sodium channel mutations: why so many phenotypes?.
        Nat. Rev. Cardiol. 2014; 11 (24958080): 607-615
        • Newton-Cheh C.
        • Eijgelsheim M.
        • Rice K.M.
        • de Bakker P.I.
        • Yin X.
        • Estrada K.
        • Bis J.C.
        • Marciante K.
        • Rivadeneira F.
        • Noseworthy P.A.
        • Sotoodehnia N.
        • Smith N.L.
        • Rotter J.I.
        • Kors J.A.
        • Witteman J.C.
        • et al.
        Common variants at ten loci influence QT interval duration in the QTGEN Study.
        Nat. Genet. 2009; 41 (19305408): 399-406
        • Arking D.E.
        • Pulit S.L.
        • Crotti L.
        • van der Harst P.
        • Munroe P.B.
        • Koopmann T.T.
        • Sotoodehnia N.
        • Rossin E.J.
        • Morley M.
        • Wang X.
        • Johnson A.D.
        • Lundby A.
        • Gudbjartsson D.F.
        • Noseworthy P.A.
        • Eijgelsheim M.
        • et al.
        Genetic association study of QT interval highlights role for calcium signaling pathways in myocardial repolarization.
        Nat. Genet. 2014; 46 (24952745): 826-836
        • Pfeufer A.
        • Sanna S.
        • Arking D.E.
        • Müller M.
        • Gateva V.
        • Fuchsberger C.
        • Ehret G.B.
        • Orrú M.
        • Pattaro C.
        • Köttgen A.
        • Perz S.
        • Usala G.
        • Barbalic M.
        • Li M.
        • Pütz B.
        • et al.
        Common variants at ten loci modulate the QT interval duration in the QTSCD Study.
        Nat. Genet. 2009; 41 (19305409): 407-414
        • Roder K.
        • Werdich A.A.
        • Li W.
        • Liu M.
        • Kim T.Y.
        • Organ-Darling L.E.
        • Moshal K.S.
        • Hwang J.M.
        • Lu Y.
        • Choi B.R.
        • MacRae C.A.
        • Koren G.
        RING finger protein RNF207, a novel regulator of cardiac excitation.
        J. Biol. Chem. 2014; 289 (25281747): 33730-33740
        • Roder K.
        • Kabakov A.
        • Moshal K.S.
        • Murphy K.R.
        • Xie A.
        • Dudley S.
        • Turan N.N.
        • Lu Y.
        • MacRae C.A.
        • Koren G.
        Trafficking of the human ether-a-go-go-related gene (hERG) potassium channel is regulated by the ubiquitin ligase rififylin (RFFL).
        J. Biol. Chem. 2019; 294 (30401747): 351-360
        • Lee S.M.
        • Chin L.S.
        • Li L.
        Charcot–Marie–Tooth disease-linked protein SIMPLE functions with the ESCRT machinery in endosomal trafficking.
        J. Cell Biol. 2012; 199 (23166352): 799-816
        • Shirk A.J.
        • Anderson S.K.
        • Hashemi S.H.
        • Chance P.F.
        • Bennett C.L.
        SIMPLE interacts with NEDD4 and TSG101: evidence for a role in lysosomal sorting and implications for Charcot–Marie–Tooth disease.
        J. Neurosci. Res. 2005; 82 (16118794): 43-50
        • Zhu H.
        • Guariglia S.
        • Yu R.Y.
        • Li W.
        • Brancho D.
        • Peinado H.
        • Lyden D.
        • Salzer J.
        • Bennett C.
        • Chow C.W.
        Mutation of SIMPLE in Charcot–Marie–Tooth 1C alters production of exosomes.
        Mol. Biol. Cell. 2013; 24 (23576546): 1619-1637
        • Tang X.
        • Marciano D.L.
        • Leeman S.E.
        • Amar S.
        LPS induces the interaction of a transcription factor, LPS-induced TNF-α factor, and STAT6(B) with effects on multiple cytokines.
        Proc. Natl. Acad. Sci. U.S.A. 2005; 102 (15793005): 5132-5137
        • Tang X.
        • Metzger D.
        • Leeman S.
        • Amar S.
        LPS-induced TNF-α factor (LITAF)–deficient mice express reduced LPS-induced cytokine: evidence for LITAF-dependent LPS signaling pathways.
        Proc. Natl. Acad. Sci. U.S.A. 2006; 103 (16954198): 13777-13782
        • Merrill J.C.
        • You J.
        • Constable C.
        • Leeman S.E.
        • Amar S.
        Whole-body deletion of LPS-induced TNF-α factor (LITAF) markedly improves experimental endotoxic shock and inflammatory arthritis.
        Proc. Natl. Acad. Sci. U.S.A. 2011; 108 (22160695): 21247-21252
        • Eaton H.E.
        • Desrochers G.
        • Drory S.B.
        • Metcalf J.
        • Angers A.
        • Brunetti C.R.
        SIMPLE/LITAF expression induces the translocation of the ubiquitin ligase itch towards the lysosomal compartments.
        PLoS One. 2011; 6 (21326863)e16873
        • Shearwin-Whyatt L.
        • Dalton H.E.
        • Foot N.
        • Kumar S.
        Regulation of functional diversity within the Nedd4 family by accessory and adaptor proteins.
        Bioessays. 2006; 28 (16700065): 617-628
        • Lacerda A.F.
        • Hartjes E.
        • Brunetti C.R.
        LITAF mutations associated with Charcot–Marie–Tooth disease 1C show mislocalization from the late endosome/lysosome to the mitochondria.
        PLoS One. 2014; 9 (25058650)e103454
        • Tan W.L.W.
        • Anene-Nzelu C.G.
        • Wong E.
        • Lee C.J.M.
        • Tan H.S.
        • Tang S.J.
        • Perrin A.
        • Wu K.X.
        • Zheng W.
        • Ashburn R.J.
        • Pan B.
        • Lee M.Y.
        • Autio M.I.
        • Morley M.P.
        • Tam W.L.
        • et al.
        Epigenomes of human hearts reveal new genetic variants relevant for cardiac disease and phenotype.
        Circ. Res. 2020; 127 (32529949): 761-777
        • GTEx Consortium
        The Genotype-Tissue Expression (GTEx) project.
        Nat. Genet. 2013; 45 (23715323): 580-585
        • Moshal K.S.
        • Roder K.
        • Kabakov A.Y.
        • Werdich A.A.
        • Chiang D.Y.-E.
        • Turan N.N.
        • Xie A.
        • Kim T.Y.
        • Cooper L.L.
        • Lu Y.
        • Zhong M.
        • Li W.
        • Terentyev D.
        • Choi B.-R.
        • Karma A.
        • et al.
        LITAF (lipopolysaccharide-induced tumor necrosis factor) regulates cardiac L-type calcium channels by modulating NEDD (neural precursor cell expressed developmentally downregulated protein) 4-1 ubiquitin ligase.
        Circ. Genom. Precis. Med. 2019; 12 (31462068): 407-420
        • Kabakov A.Y.
        • Moshal K.
        • Lu Y.
        • Roder K.
        • Nilufer T.
        • Li W.
        • Murphy K.
        • Terentyev D.
        • Koren G.
        Week-old rabbit cardiomyocytes (3wRbCM): a novel cellular model for studying cardiac excitation.
        Biophys. J. 2019; 116: 230a
        • Liu M.
        • Shi G.
        • Yang K.C.
        • Gu L.
        • Kanthasamy A.G.
        • Anantharam V.
        • Dudley S.C.
        Role of protein kinase C in metabolic regulation of the cardiac Na.
        Heart Rhythm. 2017; 14: 440-447
        • Ponce-Balbuena D.
        • Guerrero-Serna G.
        • Valdivia C.R.
        • Caballero R.
        • Diez-Guerra F.J.
        • Jiménez-Vázquez E.N.
        • Ramírez R.J.
        • Monteiro da Rocha A.
        • Herron T.J.
        • Campbell K.F.
        • Willis B.C.
        • Alvarado F.J.
        • Zarzoso M.
        • Kaur K.
        • Pérez-Hernández M.
        • et al.
        Cardiac Kir2.1 and Na.
        Circ. Res. 2018; 122 (29514831): 1501-1516
        • Boase N.A.
        • Kumar S.
        NEDD4: The founding member of a family of ubiquitin-protein ligases.
        Gene. 2015; 557 (25527121): 113-122
        • Tsubuki S.
        • Saito Y.
        • Tomioka M.
        • Ito H.
        • Kawashima S.
        Differential inhibition of calpain and proteasome activities by peptidyl aldehydes of di-leucine and tri-leucine.
        J. Biochem. 1996; 119 (8830056): 572-576
        • Homewood C.A.
        • Warhurst D.C.
        • Peters W.
        • Baggaley V.C.
        Lysosomes, pH and the anti-malarial action of chloroquine.
        Nature. 1972; 235 (4550396): 50-52
        • Hwang J.
        • Kim T.Y.
        • Terentyev D.
        • Mingwang Z.
        • Kabakov A.Y.
        • Karma A.
        • Koren G.
        • Bum-Rak C.
        Late INa blocker GS967 suppresses polymorphic VT in a transgenic rabbit model of long QT type 2.
        Circulation: Arrhythmia and Electrophysiology. 2020; 13 (32628505)5e006875
        • Vornanen M.
        • Hassinen M.
        Zebrafish heart as a model for human cardiac electrophysiology.
        Channels (Austin). 2016; 10 (26671745): 101-110
        • Chin L.S.
        • Lee S.M.
        • Li L.
        SIMPLE: A new regulator of endosomal trafficking and signaling in health and disease.
        Commun. Integr. Biol. 2013; 6 (23713142)e24214
        • Song W.
        • Shou W.
        Cardiac sodium channel Nav1.5 mutations and cardiac arrhythmia.
        Pediatr. Cardiol. 2012; 33 (22460359): 943-949
        • Hu Y.
        • Bai X.
        • Zhang C.
        • Chakrabarti S.
        • Tang B.
        • Xiong H.
        • Wang Z.
        • Yu G.
        • Xu C.
        • Chen Q.
        • Wang Q.K.
        Ubiquitination-activating enzymes UBE1 and UBA6 regulate ubiquitination and expression of cardiac sodium channel Nav1.5.
        Biochem. J. 2020; 477 (32315024): 1683-1700
        • Tang B.
        • Hu Y.
        • Wang Z.
        • Cheng C.
        • Wang P.
        • Liang L.
        • Xiong H.
        • Luo C.
        • Xu C.
        • Chen Q.
        • Wang Q.K.
        UBC9 regulates cardiac sodium channel Na.
        J. Mol. Cell. Cardiol. 2019; 129 (30772377): 79-91
        • Yang B.
        • Kumar S.
        Nedd4 and Nedd4-2: closely related ubiquitin-protein ligases with distinct physiological functions.
        Cell Death Differ. 2010; 17 (19557014): 68-77
        • Luo L.
        • Ning F.
        • Du Y.
        • Song B.
        • Yang D.
        • Salvage S.C.
        • Wang Y.
        • Fraser J.A.
        • Zhang S.
        • Ma A.
        • Wang T.
        Calcium-dependent Nedd4-2 upregulation mediates degradation of the cardiac sodium channel Nav1.5: implications for heart failure.
        Acta Physiol. (Oxf.). 2017; 221 (28296171): 44-58
        • Zicha S.
        • Maltsev V.A.
        • Nattel S.
        • Sabbah H.N.
        • Undrovinas A.I.
        Post-transcriptional alterations in the expression of cardiac Na+ channel subunits in chronic heart failure.
        J. Mol. Cell. Cardiol. 2004; 37 (15242739): 91-100
        • Dun W.
        • Lowe J.S.
        • Wright P.
        • Hund T.J.
        • Mohler P.J.
        • Boyden P.A.
        Ankyrin-G participates in INa remodeling in myocytes from the border zones of infarcted canine heart.
        PLoS One. 2013; 8 (24155982)e78087
        • Geisler A.
        • Jungmann A.
        • Kurreck J.
        • Poller W.
        • Katus H.A.
        • Vetter R.
        • Fechner H.
        • Müller O.J.
        microRNA122-regulated transgene expression increases specificity of cardiac gene transfer upon intravenous delivery of AAV9 vectors.
        Gene Ther. 2011; 18 (21048795): 199-209
        • Lim K.L.
        • Chew K.C.
        • Tan J.M.
        • Wang C.
        • Chung K.K.
        • Zhang Y.
        • Tanaka Y.
        • Smith W.
        • Engelender S.
        • Ross C.A.
        • Dawson V.L.
        • Dawson T.M.
        Parkin mediates nonclassical, proteasomal-independent ubiquitination of synphilin-1: implications for Lewy body formation.
        J. Neurosci. 2005; 25 (15728840): 2002-2009
        • Restrepo J.G.
        • Weiss J.N.
        • Karma A.
        Calsequestrin-mediated mechanism for cellular calcium transient alternans.
        Biophys. J. 2018; 114 (29694878): 2024-2025
        • Terentyev D.
        • Rees C.M.
        • Li W.
        • Cooper L.L.
        • Jindal H.K.
        • Peng X.
        • Lu Y.
        • Terentyeva R.
        • Odening K.E.
        • Daley J.
        • Bist K.
        • Choi B.R.
        • Karma A.
        • Koren G.
        Hyperphosphorylation of RyRs underlies triggered activity in transgenic rabbit model of LQT2 syndrome.
        Circ. Res. 2014; 115 (25249569): 919-928
        • Zhong M.
        • Rees C.M.
        • Terentyev D.
        • Choi B.R.
        • Koren G.
        • Karma A.
        NCX-mediated subcellular Ca.
        Biophys. J. 2018; 115 (30173888): 1019-1032
        • Panáková D.
        • Werdich A.A.
        • Macrae C.A.
        Wnt11 patterns a myocardial electrical gradient through regulation of the L-type Ca2+ channel.
        Nature. 2010; 466 (20657579): 874-878