Advertisement

A Clostridial Endo-β-galactosidase That Cleaves Both Blood Group A and B Glycotopes

THE FIRST MEMBER OF A NEW GLYCOSIDE HYDROLASE FAMILY, GH98*
  • Kimberly M. Anderson
    Footnotes
    Affiliations
    Department of Biochemistry, Tulane University Health Sciences Center School of Medicine, New Orleans, Louisiana 70112
    Search for articles by this author
  • Hisashi Ashida
    Footnotes
    Affiliations
    Department of Biochemistry, Tulane University Health Sciences Center School of Medicine, New Orleans, Louisiana 70112
    Search for articles by this author
  • Karol Maskos
    Footnotes
    Affiliations
    Coordinated Instrumentation Facility, Tulane University, New Orleans, Louisiana 70118
    Search for articles by this author
  • Anne Dell
    Footnotes
    Affiliations
    Department of Biological Sciences, Imperial College London, London SW7 2AZ, United Kingdom
    Search for articles by this author
  • Su-Chen Li
    Affiliations
    Department of Biochemistry, Tulane University Health Sciences Center School of Medicine, New Orleans, Louisiana 70112
    Search for articles by this author
  • Yu-Teh Li
    Correspondence
    To whom correspondence should be addressed: Dept. of Biochemistry, Tulane University Health Sciences Center School of Medicine, 1430 Tulane Ave., New Orleans, LA 70112. Tel.: 504-988-2451; Fax: 504-988-2739
    Affiliations
    Department of Biochemistry, Tulane University Health Sciences Center School of Medicine, New Orleans, Louisiana 70112
    Search for articles by this author
  • Author Footnotes
    * This work was supported in part by National Institutes of Health Grant NS09626 (to Y.-T. L.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.We dedicate this work to the late Dr. Karol Maskos. We will always remember his devotion to research and also his passion and aspiration for scientific excellence.The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EBI Data Bank with accession number(s) AY492085.
    § Supported by National Research Service Award Predoctoral Training Grant 5F31 HL068296-03 from the National Institutes of Health.
    ¶ Present Address: Dept. of Immunoregulation, Research Institute for Microbial Diseases, Osaka University, Osaka 565-0871, Japan.
    † Deceased March 29, 2004.
    ‡‡ Supported by a research professorship from the Biotechnology and Biological Sciences Research Council.
      We have isolated an endo-β-galactosidase designated E-ABase from Clostridium perfringens ATCC 10543 capable of liberating both the A trisaccharide (A-Tri; GalNAcα1→3(Fucα1→2)Gal) and B trisaccharide (B-Tri; Galα1→3(Fucα1→2)Gal) from glycoconjugates containing blood group A and B glycotopes, respectively. We have subsequently cloned the gene (eabC) that encodes E-ABase from this organism. This gene was found to be identical to the CPE0329 gene of C. perfringens strain 13, whose product was labeled as a hypothetical protein (Shimizu, T., Ohtani, K., Hirakawa, H., Ohshima, K., Yamashita, A., Shiba, T., Ogasawara, N., Hattori, M., Kuhara, S., and Hayashi, H. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 996–1001). Since the amino acid sequence of E-ABase does not bear detectable similarity to any of the 97 existing families of glycoside hydrolases, we have proposed to assign this unusual enzyme to a new family, GH98. We also expressed eabC in Escherichia coli BL21(DE3) and obtained 27 mg of fully active recombinant E-ABase from 1 liter of culture. Recombinant E-ABase not only destroyed the blood group A and B antigenicity of human type A and B erythrocytes, but also released A-Tri and B-Tri from blood group A+- and B+- containing glycoconjugates. The structures of A-Tri and B-Tri liberated from A+ porcine gastric mucin and B+ human ovarian cyst glycoprotein were established by NMR spectroscopy. The unique specificity of E-ABase should make it useful for studying the structure and function of blood group A- and B-containing glycoconju-gates as well as for identifying other glycosidases belonging to the new GH98 family.
      Clostridium perfringens, commonly found in sewage, soil, and the gastrointestinal tracts of higher animals, is known to cause gas gangrene (clostridial myonecrosis) and food poisoning in man (
      • Rood J.I.
      • Cole S.T.
      ,
      • Hatheway C.L.
      ). It is also responsible for such animal diseases as lamb dysentery, ovine enterotoxemia, and pulpy kidney disease in sheep (
      • Rood J.I.
      • Cole S.T.
      ,
      • Hatheway C.L.
      ,
      • Smith L.D.
      ,
      • Niilo L.
      ,
      • Sterne M.
      ). The pathogenesis of C. perfringens infection has been attributed, in part, to the large number of extracellular toxins and hydrolytic enzymes (
      • Stevens D.L.
      • Bryant A.E.
      ,
      • Awad M.W.
      • Bryant A.E.
      • Stevens D.L.
      • Rood J.I.
      ,
      • Rood J.
      ) capable of destroying host tissues (
      • Petit L.
      • Gibert M.
      • Popoff M.R.
      ). Among them, sialidase is one of the most extensively studied extracellular enzymes of this organism (
      • Cassidy J.T.
      • Jourdian G.W.
      • Roseman S.
      ,
      • Fraser A.G.
      ,
      • Corfield T.
      ).
      Although commercially available clostridial sialidase preparations have been widely used for studying the structure and function of sialoglycoconjugates (
      • Corfield T.
      ), they have been shown to contain proteolytic (
      • Hatton M.W.C.
      • Regoeczi E.
      ,
      • Chien S.-F.
      • Yevich S.J.
      • Li S.-C.
      • Li Y.-T.
      ,
      • Boyle M.D.P.
      • Ohanian S.H.
      • Borsos T.
      ), glycosidic (
      • Chien S.-F.
      • Yevich S.J.
      • Li S.-C.
      • Li Y.-T.
      ), and cytotoxic/hemolytic (
      • Kraemer P.M.
      ,
      • Den H.
      • Malinzak D.A.
      • Rosenberg A.
      ,
      • Trams E.G.
      • Lauter C.J.
      • Banfield W.G.
      ) activities. We have reported previously that the commercial sialidase prepared from C. perfringens ATCC 10543 is contaminated with an unusual endo-β-galactosidase capable of releasing a specific disaccharide glycotope, GlcNAcα1→4Gal-, from blood group A+ porcine gastric mucin (A+-PGM)
      The abbreviations used are: A+-PGM, blood group A+ porcine gastric mucin; A-Tri, A trisaccharide (GalNAcα1→3(Fucα1→2)Gal); B-Tri, B trisaccharide (Galα1→3(Fucα1→2)Gal); nE-ABase, native E-ABase; ConA, concanavalin A; kbp, kilobase pair; rE-ABase, recombinant E-ABase; B+-HOCG, blood group B+ human ovarian cyst glycoprotein; RBC, red blood cell(s); PBS, phosphate-buffered saline; FITC, fluorescein 5-isothiocyanate; FACS, fluorescence-activated cell sorting; A-Tetra, A tetrasaccharide (GalNAcα1→3(Fucα1→2)Galβ1→4Glc); A-Penta, A pentasaccharide (GalNAcα1→3(Fucα1→2)Galβ1→4(Fucα1→3)Glc); BPenta, B pentasaccharide (Galα1→3(Fucα1→2)Galβ1→4(Fucα1→3)Glc); A-Hexa, A hexasaccharide (GalNAcα1→3(Fucα1→2)Galβ1→ 3GlcNAcβ1→3Galβ1→4Glc); FRP, fucolectin-related protein.
      1The abbreviations used are: A+-PGM, blood group A+ porcine gastric mucin; A-Tri, A trisaccharide (GalNAcα1→3(Fucα1→2)Gal); B-Tri, B trisaccharide (Galα1→3(Fucα1→2)Gal); nE-ABase, native E-ABase; ConA, concanavalin A; kbp, kilobase pair; rE-ABase, recombinant E-ABase; B+-HOCG, blood group B+ human ovarian cyst glycoprotein; RBC, red blood cell(s); PBS, phosphate-buffered saline; FITC, fluorescein 5-isothiocyanate; FACS, fluorescence-activated cell sorting; A-Tetra, A tetrasaccharide (GalNAcα1→3(Fucα1→2)Galβ1→4Glc); A-Penta, A pentasaccharide (GalNAcα1→3(Fucα1→2)Galβ1→4(Fucα1→3)Glc); BPenta, B pentasaccharide (Galα1→3(Fucα1→2)Galβ1→4(Fucα1→3)Glc); A-Hexa, A hexasaccharide (GalNAcα1→3(Fucα1→2)Galβ1→ 3GlcNAcβ1→3Galβ1→4Glc); FRP, fucolectin-related protein.
      (
      • Ashida H.
      • Anderson K.
      • Nakayama J.
      • Maskos K.
      • Chou C.-W.
      • Cole R.
      • Li S.-C.
      • Li Y.-T.
      ). From the same preparation, we have detected another unique endo-β-galactosidase capable of releasing both the blood group A trisaccharide (A-Tri; GalNAcα1→3-(Fucα1→2)Gal) and B trisaccharide (B-Tri; Galα1→3-(Fucα1→2)Gal) glycotopes from blood group A- and B-containing glycoconjugates, respectively. The unique specificity and the potential usefulness of this enzyme for glycoconjugate research prompted us to carry out the isolation of the native enzyme as well as the cloning and characterization of the recombinant enzyme. Based on the substrate specificity, we propose to name this enzyme E-ABase for blood group A- and B-cleaving endo-β-galactosidase. We found that the gene (eabC) that encodes E-ABase is identical to the CPE0329 gene of C. perfringens strain 13, whose product was labeled as a hypothetical protein (
      • Shimizu T.
      • Ohtani K.
      • Hirakawa H.
      • Ohshima K.
      • Yamashita A.
      • Shiba T.
      • Ogasawara N.
      • Hattori M.
      • Kuhara S.
      • Hayashi H.
      ). Sequence comparison of E-ABase with other glycosidases belonging to any of the 97 established families of glycoside hydrolases revealed no significant sequence homology. Thus, we proposed to assign this unusual endo-β-galactosidase to a new glycosidase family, GH98.

      EXPERIMENTAL PROCEDURES

       Enzyme Assays

      A+-PGM (type II, Sigma) that had been dialyzed exhaustively against distilled water was used as substrate for assaying E-ABase activity by TLC. A 10-μl reaction mixture containing 25 μg of A+-PGM and an appropriate amount of E-ABase in 25 mm sodium acetate buffer (pH 6.0) was incubated at 37 °C for a predetermined time. The reaction was stopped by the addition of 2 μl of glacial acetic acid, and the entire reaction mixture was spotted onto a silica gel-coated TLC plate (EMD Chemicals, Inc.). The plate was developed with 1-butanol/acetic acid/ water (2:1:1, v/v/v), and glycoconjugates were revealed by the diphenylamine/aniline/phosphoric acid reagent (
      • Anderson K.
      • Li S.-C.
      • Li Y.-T.
      ). The intensity of the glycoconjugate bands was quantified by scanning the plates as described previously (
      • Ashida H.
      • Anderson K.
      • Nakayama J.
      • Maskos K.
      • Chou C.-W.
      • Cole R.
      • Li S.-C.
      • Li Y.-T.
      ). One unit of enzyme activity is defined as the amount that releases 1 nmol of A-Tri from A+-PGM/min at 37 °C.

       Purification of Native E-ABase (nE-ABase)

      Unless indicated otherwise, all operations were performed at 0–5 °C, and protein solutions were concentrated by ultrafiltration using an Amicon stirred cell with a PM-10 membrane (Millipore Corp.). Centrifugations were routinely carried out at 8000×g for 20–30 min using a Sorvall RC5C refrigerated centrifuge.
      Step 1: Preparation of the Crude Enzyme—C. perfringens ATCC 10543 was cultured for 20 h at 37 °C in 15 liters of culture medium as described previously (
      • Cassidy J.T.
      • Jourdian G.W.
      • Roseman S.
      ). The culture supernatant was brought to 85% saturation with solid ammonium sulfate and left standing overnight. The precipitate thus formed was collected, dissolved in a small amount of water, and dialyzed exhaustively against water for 48 h. The dialyzed sample was centrifuged, and the supernatant was lyophilized to yield 11.2 g of crude enzyme powder.
      Step 2: Sephacryl S-200 Gel Filtration—The crude enzyme powder from Step 1 was dissolved in 70 ml of 0.1 m ammonium acetate buffer (pH 5.8) and applied to a Sephacryl S-200 HR column (5 × 90 cm; Amersham Biosciences) equilibrated with the same buffer. The column was also eluted with the same buffer at 96 ml/h, and 20-ml fractions were collected. A 10-μl aliquot from every other fraction was assayed for enzyme activity using A+-PGM as substrate. Fractions containing nE-ABase activity were pooled, concentrated, and dialyzed overnight against 10 mm Tris-HCl buffer (pH 7.5) (Buffer A).
      Step 3: Fractogel DEAE Chromatography—The preparation from Step 2 was applied to a Fractogel DEAE-650M column (1.5 × 10.5 cm; EMD Chemicals, Inc.) equilibrated with Buffer A. After removing the unadsorbed proteins with Buffer A, nE-ABase was eluted with 10 mm sodium acetate buffer (pH 4.0) at 1 ml/min. Fractions of 2 ml were collected. The fractions containing nE-ABase were pooled, concentrated, and dialyzed overnight against 10 mm sodium acetate buffer (pH 5.5) (Buffer B).
      Step 4: Fractogel SP Chromatography—The preparation from Step 3 was applied to a Fractogel SP-650M column (1.0 × 7.5 cm; EMD Chemicals, Inc.) equilibrated with Buffer B, and the column was eluted with the same buffer at 1 ml/min. Fractions of 1 ml were collected. The majority of nE-ABase activity was recovered in the unadsorbed fractions, whereas the bulk of the contaminants was eluted with Buffer B containing 0.4 m NaCl. Fractions with the highest nE-ABase activity were pooled and dialyzed overnight against 25 mm sodium phosphate buffer (pH 7.0) (Buffer C).
      Step 5: Concanavalin A (ConA)-Sepharose Chromatography—The preparation from Step 4 was concentrated to 0.3–0.5 ml and applied to a ConA-Sepharose column (1.0 × 48 cm; Amersham Biosciences) equilibrated with Buffer C. nE-ABase was eluted in the early breakthrough fractions with Buffer C. Fractions containing nE-ABase activity were pooled, concentrated, and dialyzed against Buffer A.
      Step 6: Mono Q Chromatography—The enzyme preparation from Step 5 was applied to a Mono Q HR 5/5 column (0.5 × 5.5 cm; Amer-sham Biosciences) equilibrated with Buffer A at 0.5 ml/min using an Amersham Biosciences ▵KTA FPLC™ system. After washing with the same buffer, the column was eluted with Buffer A containing NaCl using the following gradients: 0–0.06 m NaCl for 5 column volumes, 0.06 m NaCl for 5 column volumes, 0.06–0.1 m NaCl for 20 column volumes, 0.1 m NaCl for 20 column volumes, 0.1–0.12 m NaCl for 5 column volumes, 0.12 m NaCl for 5 column volumes, and 0.12–0.3 m NaCl for 5 column volumes. Fractions of 1 ml were collected. Fractions containing nE-ABase activity were eluted as a sharp peak at 0.1 m NaCl. They were pooled, dialyzed against 5 mm sodium phosphate buffer (pH 6.0), and used in subsequent experiments. This final enzyme preparation was >98% pure as judged by SDS-PAGE (see Fig. 1). Table I summarizes the purification of nE-ABase from 15 liters of culture medium.
      Figure thumbnail gr1
      Fig. 1SDS-PAGE analysis of nE-ABase and rE-ABase. Both nE-ABase and rE-ABase were analyzed by SDS-PAGE using a 10% gel. Protein bands were visualized by Coomassie Brilliant Blue staining. Lane 1, molecular mass markers; lane 2, nE-ABase (2 μg); lane 3, rE-ABase (2 μg).
      Table IPurification of nE-ABase from the culture supernatant (15 liters) of C. perfringens
      StepTotal proteinTotal activitySpecific activityYieldPurification
      mgunitsunits/mg%-fold
      1. Crude enzyme10,28211,0771.11001
      2. Sephaeryl S-200279.5908432.58229.5
      3. Fractogel DEAE79.8792099.271.590.2
      4. Fractogel SP56.96885121.062.2110
      5. ConA-Sepharose5.94638786.141.9714
      6. Mono Q0.72026289418.32630

       Amino Acid Sequences of CNBr Peptides Derived from nE-ABase

      CNBr cleavage products were generated from 200 μg of purified nE-ABase according to Charbonneau (
      • Charbonneau H.
      ). Peptides were separated by 10% SDS-PAGE and blotted onto a polyvinylidene difluoride membrane using a Trans-Blot semidry transfer cell (Bio-Rad) at 20 V for 1.25 h. The membrane was briefly stained with 0.04% Coomassie Brilliant Blue R-250 in 20% methanol, and the most prominent bands were excised. The three CNBr peptides (P1–P3), as well as the N-terminal region of the native enzyme, were sequenced by the Core Facility of the Louisiana State University Health Sciences Center (New Orleans, LA). The sequences of these peptides are shown in Fig. 2.
      Figure thumbnail gr2
      Fig. 2Nucleotide and deduced amino acid sequences of E-ABase. The underlined sequences indicate the N-terminal sequence (24 amino acid residues) of the mature protein and the three CNBr peptides (P1–P3) obtained from nE-ABase.

       Generation of a 1.5-Kilobase Pair (kbp) PCR Product (Probe A)

      Genomic DNA from C. perfringens ATCC 10543 was prepared as described (
      ). We initially designed a sense primer, F1, and an anti-sense primer, R2 (see Table II), based on the N-terminal sequence (LEESRDVYLSDLDWLNATHGDDXK) and the CNBr P2 peptide (MRAKTKSLXYG), respectively. A 1.5-kbp product was generated by PCR using these two primers and the C. perfringens genomic DNA as template. PCR was run with Taq DNA polymerase (Invitrogen) for 30 cycles consisting of 45 s of denaturation at 94 °C, 45 s of annealing at 45 °C, and 2 min of extension at 72 °C. This 1.5-kbp product (Probe A) was sequenced and subcloned into the pGEM-T Easy vector (Promega). Probe A was later used to screen the first genomic DNA library.
      Table IIPrimers used for the cloning and expression of the E-ABase gene (eabC)
      PrimerOligonucleotide sequence (5′ to 3′)Location
      The corresponding nucleotide residues in the cloned sequence are shown in Fig. 2.
      F1GAYYTIGAYTGGYTNAAYGC136-155
      R2YTTNGTYTTNGCYCGCAT1630-1647
      EAB4.1FGCTACCCACGGAGATGATACAA154-175
      EAB4.2FAGTGGAAAGAGGTTCCAGATG773-793
      EAB4.2RCTGCTGCGTTACTTTCTACA1086-1105
      EAB4.5RATCTGACTTCCAGATAAACGACTCTC1795-1820
      EX1AACCATGGGATTGGAAGAAAGCAGA106-120
      EX6AGCCGGATCCGTGATGATGATGATGATGCTTAATTACAATATC2386-2400
      a The corresponding nucleotide residues in the cloned sequence are shown in Fig. 2.

       Cloning of the E-ABase Gene (eabC)

      XL1-Blue MRF′ and SOLR cells (Stratagene) were grown in LB medium supplemented with 0.2% maltose and 10 mm MgSO4. Construction of the first genomic library in the λZAPII vector (Stratagene) and subsequent screenings were performed as described previously (
      • Ashida H.
      • Maskos K.
      • Li S.-C.
      • Li Y.-T.
      ) using primers EAB4.2F and EAB4.2R (see Table II), complementing the sequence of Probe A. Of 10,000 plaques screened, 20 positives were identified, and one positive cloned phage was selected for in vivo excision using the ExAssist helper phage and the SOLR strain. Single colonies of SOLR cells containing the excised phagemid (DNA insert in the pBluescript SK(–) vector) were subsequently used in a third PCR screening under the previous conditions. One clone (pEAB4E) was found to contain two-thirds of the expected gene sequence from the 5′-end.
      To identify the 3′-end of the E-ABase gene, a second genomic library was constructed in Escherichia coli JM109. Genomic DNA (15 μg) from C. perfringens was digested with 100 units of XbaI. Purified DNA fragments between 1.8 and 6 kbp were ligated into a pBluescript SK(–)/ XbaI/calf intestinal alkaline phosphatase-treated vector and transformed into E. coli JM109. One positive clone (pEABX1), identified by PCR using primers EAB4.1F and EAB4.5R (see Table II), was found to contain the full-length open reading frame of eabC as shown in Fig. 2.

       Construction of the Expression Plasmid

      An expression plasmid (pEABHNB3) with a C-terminal His6 tag was constructed in the pET-15b vector. eabC without the sequence for the N-terminal 35-amino acid signal peptide was amplified by PCR using Taq DNA polymerase with pEABX1 as template and primers EX1 and EX6 (see Table II). The 2.3-kbp PCR product was purified, digested with NcoI and BamHI, ligated into the pET-15b vector, sequenced, and given the name pEABHNB3.

       Expression and Purification of Recombinant E-ABase (rE-ABase)

      rE-ABase was expressed in E. coli BL21(DE3) cultured at 37 °C in LB medium containing 100 μg/ml ampicillin. rE-ABase was purified under nondenaturing conditions as described by Hoffmann and Roeder (
      • Hoffmann A.
      • Roeder R.G.
      ), but excluded glycerol, dithiothreitol, and Nonidet P-40. Three 1-liter portions of LB/ampicillin medium were each inoculated with 20–30 ml of an overnight culture, and the cells were harvested 4 h after the absorbance at 600 nm had reached 1.4. The cells were lysed in 60 ml of lysis buffer (10 mm Tris-HCl (pH 7.9), 0.5 m NaCl, 0.5 mm phenylmethylsulfonyl fluoride, and 5 mm imidazole) using a French press. The cell-free extract was heated at 60 °C for 4 min and centrifuged. This heat treatment precipitated ∼30% of nonenzymatic proteins without affecting E-ABase activity. The supernatant was then applied to a nickel-nitrilotriacetic acid column (1.5 × 12.5 cm; QIAGEN Inc.) equilibrated with lysis buffer. After extensively washing the column with the same buffer, the bound proteins were eluted with elution buffer (20 mm Tris-HCl (pH 7.9), 100 mm KCl, 0.5 mm phenylmethylsulfonyl fluoride, and 150 mm imidazole). Fractions containing enzyme activity were concentrated and dialyzed for 18 h against 4 liters of Buffer A. Aliquots (9–12 mg) of protein were then applied to a Mono Q HR 5/5 column previously equilibrated with Buffer A. rE-ABase was eluted with Buffer A containing NaCl using the following gradients: 0–0.1 m NaCl for 5 column volumes, 0.1 m NaCl for 5 column volumes, and 0.1–0.2 m NaCl for 40 column volumes. rE-ABase was eluted as a sharp peak at ∼0.13 m NaCl.

       Isolation of Enzymatically Released A-Tri from A+-PGM and BTri from Blood Group B+ Human Ovarian Cyst Glycoprotein (B+-HOCG)

      A+-PGM (1 g) was dissolved in 80 ml of 50 mm sodium acetate buffer (pH 5.5) and incubated with 4000 units of rE-ABase at 37 °C for 48 h with shaking (100 rpm). The reaction mixture was then filtered through a PM-10 membrane using an Amicon stirred cell, and the filtrate (70 ml) containing A-Tri was lyophilized to obtain 0.35 g of dried residue. This residue was dissolved in 6 ml of acetonitrile/methanol/water (1:3:1, v/v/v) and applied to a Bio-Sil A column (1.5 × 95 cm; Bio-Rad) previously equilibrated with acetonitrile. A-Tri was eluted with acetonitrile/ methanol/water (1:3:1, v/v/v) at a flow rate of 1.6 ml/min. Fractions containing A-Tri were collected, pooled, and evaporated to dryness. The resulting partially purified A-Tri was dissolved in 2–3 ml of water, desalted using a Sephadex G-10 column (1.5 × 93 cm), and applied to a second Bio-Sil A column (1.5 × 96 cm) equilibrated with acetonitrile to remove minor contaminants. This column was eluted with a less polar solvent, acetonitrile/water (3:1, v/v), and fractions containing pure ATri were pooled and lyophilized. The yield of A-Tri was 11.4 mg/g of A+-PGM. An identical scheme was used for the preparation of 8.6 mg of B-Tri from 260 mg of B+-HOCG. The structures of A-Tri and B-Tri were subsequently established by NMR spectroscopy.

       NMR Spectroscopy

      For NMR measurements, each trisaccharide (8–10 mg) was repeatedly exchanged with D2O with intermediate lyophilization and then dissolved in 0.6 ml of D2O. The one-dimensional 1H and 13C and two-dimensional 1H-1H (double quantum-filtered COSY, total correlation spectroscopy, and rotating frame Overhauser effect spectroscopy) and 13C-1H (heteronuclear single quantum correlation spectroscopy and heteronuclear multiple bond correlation spectroscopy) spectra (Bruker pulse program library) were recorded at 25 °C using a Bruker Avance DRX 500 spectrometer at frequencies of 500.13 MHz (1H) and 125.75 MHz (13C). The spectrometer was equipped with a 5-mm Bruker inverse triple resonance probe with an xyz gradient coil and a broadband observe double resonance probe with a z axis gradient coil. The methyl resonance of an external 1% acetone in D2O measured separately under identical conditions was set at 2.225 ppm (1H) and 31.07 ppm (13C) and used as the reference. 1H-1H coupling constants (3JH-1,H-2) were measured in one-dimensional spectra and from the double quantum-filtered COSY cross-peaks using the FELIX 98 DQF macro (Accelrys Inc., San Diego, CA). 13C-1H coupling constants (1JC-1,H-1) were extracted from the 13C-1H heteronuclear single quantum correlation spectra recorded without decoupling.

       Flow Cytometric Analysis of Blood Group A and B Antigens

      Analysis of antigen expression in human red blood cells (RBC) was performed by flow cytometry with a BD Biosciences FACSCalibur cytometer at a low speed flow rate. Data from 30,000 events were collected and analyzed using CellQuest software (BD Biosciences). To prepare RBC for enzyme treatment, 400 μl of type A or B RBC (2–4% cell suspension; Immucor Inc., Norcross, GA) was centrifuged at 1250 × g for 4 min. The packed RBC were then washed with autoclaved phosphate-buffered saline (PBS; pH 7.4), centrifuged, and resuspended in PBS to give a hematocrit of 8–16%. A 50-μl aliquot of each type of RBC was then treated with 50 μl (533 units) of rE-ABase, and the mixture was rotated end-over-end on a 5.5-cm diameter wheel at 8 rpm for 18 h at 23 °C. After incubation, RBC were washed with 2.0 ml of PBS and resuspended in 20 μl of PBS. A 5-μl aliquot of packed RBC was then added to 100 μl of PBS wash buffer (PBS containing 1% fetal bovine serum). The indirect immunofluorescence method was used to label 1 × 107 RBC (from the control and enzyme-treated RBC samples) with murine anti-A or anti-B monoclonal antibody (Immucor Inc.) as the primary antibody at a dilution of 1:1000 in PBS wash buffer, followed by the addition of fluorescein 5-isothiocyanate (FITC)-labeled goat anti-mouse IgG (Fab-specific; Sigma) as the secondary antibody. The secondary antibody was used at a dilution of 1:200 in PBS wash buffer. All incubations were performed for 15–20 min at room temperature under rotation. The labeled RBC were washed with PBS wash buffer, resus-pended in 1 ml of PBS, and then analyzed by fluorescence-activated cell sorting (FACS).

       Other Methods

      Exoglycosidases were assayed using p-nitrophenyl glycosides in 20 mm sodium citrate buffer (pH 6.0) as described previously (
      • Li Y.-T.
      • Li S.-C.
      ). Protease activity was determined using Azocoll as substrate (
      • Moore G.L.
      ). Protein concentrations were determined by the method of Lowry et al. (
      • Lowry O.H.
      • Rosebrough N.J.
      • Farr A.L.
      • Randall R.J.
      ) using bovine serum albumin as a standard. SDS-PAGE was performed on a 10% polyacrylamide gel (
      • Laemmli U.K.
      ). Protein bands were visualized with Coomassie Brilliant Blue R-250.

      RESULTS AND DISCUSSION

      Purification of nE-ABase—Table I summarizes the results of a typical purification of nE-ABase from 15 liters of C. perfringens culture supernatant. We chose Sephacryl S-200 HR gel filtration as the first step in the purification of nE-ABase because this step could process a large amount of crude enzyme as well as remove >90% of the contaminating proteins. After gel filtration, the enzyme preparation was further subjected to Fractogel DEAE and Fractogel SP chromatographies. The final two steps in the purification scheme involved ConA-Sepharose and fast protein liquid chromatographies using a Mono Q column. Although ConA-Sepharose chromatography separated a large molecular mass (96 kDa) contaminant from nE-ABase, Mono Q/fast protein liquid chromatography was effective in resolving nE-ABase from smaller contaminating proteins. By these steps, nE-ABase was purified by >2600-fold with a recovery of ∼18%. As shown in Fig. 1, the purified nE-ABase migrated as one major protein band of ∼88 kDa upon SDS-PAGE. nE-ABase was found to be free of protease activity using Azocoll as substrate. It was also free of the following exoglycosidase activities using p-nitrophenyl glycosides as substrates: α-l-fucosidase, α- and β-glucosidases, α- and β-galactosidases, α- and β-mannosidases, α-N-acetylglucosaminidase, α-arabinosidase, β-xylosidase, and β-hexosaminidase.
      Cloning of the E-ABase Gene (eabC)—We initiated the cloning of eabC by generating a DNA fragment (Probe A) using genomic DNA from C. perfringens ATCC 10543 as template and the degenerate primers F1 and R2 (Table II), designed from the N-terminal peptide (LEESRDVYLSDLDWLNATHGDDXK) and the CNBr P2 peptide (MRAKTKSLXYG), respectively (see Fig. 2). The deduced amino acid sequence of Probe A contains the N-terminal sequence of nE-ABase and the two CNBr peptides P1 (MLNEAQSYXNPK) and P2 (MRAKTKSLXYG), indicating that this DNA fragment is part of the gene encoding E-ABase. After screening the first genomic library (EcoRI-digested) with Probe A, we selected one positive cloned phage for in vivo excision to generate a phagemid, pEAB4E. Although this clone contains the third CNBr peptide, P3 (MSQSPAYTXGRYXNIPAV), it still lacks an estimated one-third of the E-ABase gene sequence at the 3′-end. Therefore, a second genomic library (XbaI-digested) was constructed in the pBluescript SK(–) vector. Several colonies were examined by PCR, and one positive clone (pEABX1) was found to contain the entire sequence of eabC.
      The open reading frame of the eabC gene and its deduced amino acid sequence are shown in Fig. 2. The eabC gene consists of 2400 bp that encode 800 amino acid residues. As shown in Fig. 2, the N-terminal 24-amino acid peptide of the native enzyme is found in residues 36–59. Residues 10–35 at the N terminus show an extended region of hydrophobicity as well as a predicted cleavage site after residue 35 as determined by the PSORT program, indicating a signal sequence for secretion into the culture medium. The mature protein consists of 765 amino acid residues with a calculated molecular mass of 87 kDa, which is very close to the value of 88 kDa estimated by SDS-PAGE for nE-ABase (Fig. 1).
      Relationship between the E-ABase Gene (eabC) and the CPE0329 Gene of C. perfringens Strain 13—A BLASTN search of eabC against the genome of C. perfringens strain 13 deposited in the GenBank™/EBI Data Bank revealed a 100% match with the CPE0329 gene, whose product was labeled as a hypothetical protein (
      • Shimizu T.
      • Ohtani K.
      • Hirakawa H.
      • Ohshima K.
      • Yamashita A.
      • Shiba T.
      • Ogasawara N.
      • Hattori M.
      • Kuhara S.
      • Hayashi H.
      ). This finding validated the results of our cloning work and also established the product of the CPE0329 gene of C. perfringens strain 13 as E-ABase.
      Assignment of E-ABase to a New Glycoside Hydrolase Family, GH98 —To identify proteins with amino acid sequences related to E-ABase, the DNA and protein sequences of E-ABase were used as a query against the FASTA and BLAST Databases. The results of bioinformatics analysis revealed that the amino acid sequence of E-ABase does not bear any detectable similarity to any of the established glycoside hydrolase families. There are 97 public families of carbohydrate-active enzymes (CAZy Database) to date (available at afmb.cnrs-mrs.fr/CAZY). Since the E-ABase sequence is distinct from the established glycoside hydrolase sequences, it would define a novel CAZy family. In consultation with Dr. Bernard Henrissat (Universités d'Aix-Marseille I and II, Marseille, France), who has established a classification system for glycosidases, we have assigned E-ABase to a new glycoside hydrolase family designated as GH98.
      It is noteworthy that E-ABase does not share significant sequence homology with other endo-β-galactosidases cloned from Flavobacterium keratolyticus (DDBJ/GenBank™/EBI accession number AF083896) (
      • Leng L.
      • Zhu A.
      • Zhang Z.
      • Hurst R.
      • Goldstein J.
      ) and C. perfringens (accession numbers AB038772 and AB059351) (
      • Ashida H.
      • Maskos K.
      • Li S.-C.
      • Li Y.-T.
      ,
      • Ogawa H.
      • Muramatsu H.
      • Kobayashi T.
      • Morozumi K.
      • Yokoyama I.
      • Kurosawa N.
      • Nakao A.
      • Muramatsu T.
      ). The fact that the primary sequence of E-ABase does not contain an EXDX(X)E motif as found in other endo-β-galactosidases (
      • Ashida H.
      • Maskos K.
      • Li S.-C.
      • Li Y.-T.
      ,
      • Leng L.
      • Zhu A.
      • Zhang Z.
      • Hurst R.
      • Goldstein J.
      ,
      • Ogawa H.
      • Muramatsu H.
      • Kobayashi T.
      • Morozumi K.
      • Yokoyama I.
      • Kurosawa N.
      • Nakao A.
      • Muramatsu T.
      ) indicates that E-ABase may have evolved along a separate evolutionary line.
      Expression of rE-ABase—Using the expression plasmid pEABHNB3, we expressed rE-ABase as a soluble protein in E. coli BL21(DE3) at a level of ∼34 mg/liter of culture without isopropyl β-D-thiogalactopyranoside induction. We were able to purify 27 mg of rE-ABase from 1 liter of culture with the recovery of ∼80%. Similar to nE-ABase, the purified rE-ABase moved as a sharp protein band of ∼88 kDa upon SDS-PAGE with a very minor contaminant of 67 kDa (Fig. 1). No exoglycosidase or protease activity was detected in the purified rE-ABase preparation. The specific activity of 2667 units/mg of protein for rE-ABase was very close to that of 2894 units/mg of protein for nE-ABase (Table I), indicating that rE-ABase was fully active.
      General Properties of E-ABase—The following buffers were used at a final concentration of 20 mm to study the effect of pH on E-ABase activity: sodium citrate/citric acid (pH 4.0–6.0), sodium acetate/acetic acid (pH 4.0–6.0), sodium phosphate/ NaOH (pH 6.0–8.0), Tris-HCl (pH 7.5–8.9), and glycine/NaOH (pH 9.6–10.0). Using A+-PGM or B+-HOCG as substrate, the maximal activity of both rE-ABase and nE-ABase was found to be between pH 5.5 and 6.0, and each enzyme maintained >75% of its activity between pH 5.5 and 8.5. Furthermore, both enzymes were very stable, with little or no loss of activity upon storage at –20 °C for 2 years.
      At 10 mm,Ca2+,Co2+,Mg2+, and Mn2+ had little or no effect on E-ABase activity with either A+-PGM or B+-HOCG as substrate. Also, β-mercaptoethanol (up to 100 mm) and various sugars (Gal, Glc, Fuc, and GalNAc at 0.15 mm) had little or no effect on the activity of E-ABase.
      Destruction of the Blood Group Antigenicity of Type A and B RBC by rE-ABase—We have used FACS to analyze the effect of rE-ABase on the antigenicity of type A and B RBC. Under the conditions described under “Experimental Procedures,” rE-ABase reduced the blood group A antigen expression of type A RBC by 92% (Fig. 3B) and completely removed the blood group B antigen from type B RBC (Fig. 3D). The incomplete destruction of the blood group A antigenicity of type A RBC by rE-ABase is consistent with the heterogeneous nature of the blood group A immunodeterminants on type A RBC (
      • Clausen H.
      • Hakomori S.-I.
      ). It has also been shown that various blood group A glycotopes on type A RBC differ in their susceptibility to α-N-acetylgalactosaminidase (
      • Hoskins L.C.
      • Larson G.
      • Naff G.B.
      ). Since both A-Tri and B-Tri glycotopes are linked through an endo-β-galactosyl linkage, the ability of rE-ABase to abolish both blood group A and B antigenicity of RBC established this enzyme as a blood group A- and B-cleaving endo-β-galactosidase.
      Figure thumbnail gr3
      Fig. 3FACS analysis showing the effect of E-ABase on the blood group A and B antigenicity of human type A and B RBC, respectively. Shown are the histograms of blood group A FITC fluorescence of type A RBC stained in the absence (A) or presence (B) of rE-ABase and the histograms of blood group B FITC fluorescence of type B RBC stained in the absence (C) or presence (D) of rE-ABase. The results are depicted as overlays in which the shaded histograms represent the negative control RBC and the open histograms represent the FITC-labeled RBC. Mean fluorescence intensity in log scale is shown on the x axes, and the relative number of cells is represented on the y axes. anti-A ab and anti-B ab are murine anti-A and anti-B monoclonal antibodies, respectively. 2° ab indicates FITC-labeled goat anti-mouse IgG. FACS analysis was carried out as described under “Experi-mental Procedures.”
      Substrate Specificity of rE-ABase—Like nE-ABase, rE-ABase was able to liberate A-Tri from A+-PGM and B-Tri from B+-HOCG (Fig. 4A, lanes 3 and 5). rE-ABase also effectively liberated A-Tri or B-Tri from the following blood group-carrying oligosaccharides: A tetrasaccharide (A-Tetra; GalNAc-α1→3(Fucα1→2)Galβ1→4Glc); A pentasaccharide (A-Penta; GalNAcα1→3(Fucα1→2)Galβ1→4(Fucα1→3)Glc; and B pentasaccharide (B-Penta; Galα1→3(Fucα1→2)Galβ1→4(Fucα1→3)-Glc) (Fig. 4 B). In these oligosaccharides, both blood group A and B glycotopes are linked β1→4 to Glc. As shown in Fig. 5, rE-ABase hydrolyzed A-Penta only slightly faster than B-Penta, indicating that the enzyme does not show a particular preference for the blood group A or B glycotope.
      Figure thumbnail gr4
      Fig. 4TLC analysis showing the hydrolysis of A+-PGM andB+-HOCG (A) and oligosaccharides containing blood group A and B glycotopes (B) by rE-ABase. A: lane 1, A+-PGM; lane 2, standard A-Tri; lane 3, A+-PGM + rE-ABase; lane 4, standard B-Tri; lane 5, B+-HOCG + rE-ABase; lane 6, B+-HOCG; lane 7, rE-ABase only. Lanes 3 and 5 show the release of A-Tri and B-Tri, respectively. A+-PGM or B+-HOCG (25 μg) was incubated with 25 milliunits of rE-ABase in 25 mm sodium acetate buffer (pH 6.0) at 37 °C for 20 min. B: lane 1, standard A-Tri; lane 2, A-Tetra; lane 3, A-Tetra + rE-ABase; lane 4, A-Penta; lane 5, A-Penta + rE-ABase; lane 6, B-Penta; lane 7, B-Penta + rE-ABase; lane 8, A-Hexa; lane 9, A-Hexa + rE-ABase; lane 10, A+-PGM; lane 11, A+-PGM + rE-ABase; lane 12, rE-ABase only. Each oligosaccharide substrate (2 μg) was incubated with 2 units of rE-ABase in 25 mm sodium acetate buffer (pH 6.0) for 18 h at 37 °C. Detailed conditions are given under “Experimental Procedures.”
      Figure thumbnail gr5
      Fig. 5Comparison of the rates of hydrolysis of A-Penta and B-Penta by rE-ABase. The incubation mixture (70 μl) contained 7 μg of A-Penta (▵) or B-Penta (□) and 3.5 units of rE-ABase in 25 mm sodium acetate buffer (pH 6.0). Incubations were carried out at 37 °C. Aliquots of 10 μl were taken at 0, 5, 10, 20, 40, 80, and 160 min for analysis by the TLC method as described under “Experimental Procedures.” Each time point represents the average of duplicate experiments.
      Although the commercial A-Tetra substrate contains a small oligosaccharide contaminant (Fig. 4B, lane 2), this contaminant did not interfere with the analysis of the hydrolysis of A-Tetra by rE-ABase (lane 3). Unlike the above-mentioned blood group-carrying oligosaccharides, A hexasaccharide (A-Hexa; GalNAcα1→3(Fucα1→2)Galβ1→3GlcNAcβ1→3Galβ1→4Glc), which carries the blood group A glycotope on a type 1 chain, was only slowly hydrolyzed (Fig. 4B, lane 9). These results suggest that, although rE-ABase does not have a strict preference for either the blood group A or B glycotope, it does recognize the specific core chain by preferentially cleaving the endo-β-galactosyl linkage of the type 2 core chain (-Galβ1→4GlcNAc/ Glc) over the type 1 core chain (-Galβ1→3GlcNAc). rE-ABase also slowly released A-Tri from GalNAcα1→3(Fucα1→2)-Galβ1→3GalNAcα1→ Ser/Thr in the glycopeptides prepared from porcine submaxillary mucin (data not shown). The Galili pentasaccharide (Galα1→3Galβ1→4GlcNAcβ1→3Galβ-1→4Glc), which is devoid of an L-fucose linked α1,2 to the penultimate β-galactosyl residue in the type 2 core structure, was not hydrolyzed. Thus, the presence of an L-fucose residue on the substrate is essential for E-ABase to carry out its action. Furthermore, rE-ABase did not hydrolyze the Lea+ or H+-HOCG blood group substances. Also, glycosaminoglycans such as heparin, heparan sulfate, dermatan sulfate, chondroitin 4-sulfate, chondroitin 6-sulfate, and keratan sulfate were not susceptible to rE-ABase. The substrate specificity of the native enzyme (E-ABase) preparation was found to be identical to that of rE-ABase.
      Characterization of the Two Trisaccharides Released from A+-PGM and B+-HOCG by rE-ABase Using NMR Spectroscopy—To establish the specificity of E-ABase, we used NMR spectroscopy to characterize the trisaccharides (A-Tri and BTri) released by rE-ABase from A+-PGM and B+-HOCG, respectively. The 1H and 13C chemical shifts for the sugar residues in A-Tri and B-Tri are given in Tables III and IV, respectively. It is well known that aldohexoses generate complex tautomeric equilibria in aqueous solution involving cyclic pyranoses and furanoses as well as trace amounts of acyclic hydrates and aldehydes (
      • Angyal S.J.
      ,
      • Angyal S.J.
      ,
      • Angyal S.J.
      ,
      • Zhu Y.
      • Zajicek J.
      • Serianni A.S.
      ). Thus, it is not surprising that the terminal galactose of both trisaccharides was found to exist in four cyclic forms: α- and β-galactopyranoses and α- and β-galactofuranoses. Forms I and II, with terminal α- and β-galactopyranoses, respectively, can be easily distinguished on the basis of the 3JH-1,H-2and 1JC-1,H-1 coupling constants (Tables III and IV). In the case of forms III and IV, with terminal galactofuranose, the 1JC-1,H-1 coupling constants were similar for both forms and could not be used for evaluation of the anomeric configuration at C-1 of the terminal galactofuranose. However, the small 3JH-1,H-2 coupling constant (2.1 Hz) measured for the terminal galactofuranose of form III rules out α-galactofuranose since the smaller H-1/H-2 dihedral angle would be expected to yield a larger coupling constant. For example, 3JH-1,H-2 for methyl α-galactofuranoside has been measured at 4.0 Hz and for methyl β-galactofuranoside at 2.0 Hz (
      • Gerwig G.J.
      • de Waard P.
      • Kamerling J.P.
      • Vliegenthart J.F.G.
      • Morgen-stern E.
      • Lamed R.
      • Bayer E.A.
      ,
      • Angyal S.J.
      ). Quantitation of cyclic forms of trisaccharide present in the solution was obtained from the integration of signals of the well resolved anomeric resonances. In D2O, the proportions of the four forms of A-Tri and B-Tri are similar. Among them, the trisaccharide with the terminal α-galactopyranose predominates (∼55%), whereas the trisaccharide with the terminal α-galactofuranose is the least abundant (4%). Our 1H and 13C assignments for the dominant forms of A-Tri and B-Tri are in excellent agreement with those reported by other investigators for GalNAcα1→3(Fucα1→2)Gal and Galα1→3-(Fucα1→2)Gal, respectively (
      • Azurmendi H.F.
      • Bush C.A.
      ,
      • Strecker G.
      • Wieruszeski J.-M.
      • Michalski J.-C.
      • Montreuil J.
      ). Thus, we have unambiguously established the cleavage sites for E-ABase on both A+-PGM and B+-HOCG.
      Table III1H and 13C chemical shifts of the four tautomeric forms of A-Tri released from A+-PGM by rE-ABase
      AtomForm I (54%)Form II (23%)Form III (19%)Form IV (4%)
      1H13C1H13C1H13C1H13C
      1a5.136 (3.7)93.14 (171.8)5.171 (3.8)92.71 (172.6)5.073 (3.9)99.64 (171.9)5.104(4.0)
      Values are from double quantum-filtered COSY.
      98.13 (171.1)
      2a4.22950.924.24050.854.18651.084.16251.21
      3a3.97668.963.94569.073.93968.53
      Resonance cannot be unambiguously assigned.
      Resonance cannot be unambiguously assigned.
      4a3.98069.993.99569.954.01969.72
      Resonance cannot be unambiguously assigned.
      69.82
      5a4.40272.134.25772.354.05072.94
      Resonance cannot be unambiguously assigned.
      72.83
      6a3.76862.743.75862.643.82762.40
      Resonance cannot be unambiguously assigned.
      62.74
      NHAc2.04323.272.04723.152.04723.272.04723.27
      NHCO176.02176.10175.86175.86
      1b5.120 (4.0)101.84 (171.1)5.278 (4.0)100.17 (172.5)5.093 (3.9)99.15 (170.7)5.134(4.0)
      Values are from double quantum-filtered COSY.
      101.09 (171.1)
      2b3.80069.293.78169.183.76369.183.77769.18
      3b3.91370.743.85170.953.82870.74
      Resonance cannot be unambiguously assigned.
      70.57
      4b3.81573.103.82073.283.80873.10
      Resonance cannot be unambiguously assigned.
      72.94
      5b4.15868.594.43468.324.07368.484.22668.70
      6b1.22116.571.20116.471.21116.571.18516.57
      1c5.368 (3.8)93.08 (171.2)4.707 (7.7)96.47 (162.5)5.439 (2.1)101.89 (174.7)5.365 (4.3)
      Values are from double quantum-filtered COSY.
      96.63 (174.6)
      2c3.97375.143.75375.894.25386.534.22583.41
      3c4.13272.083.93776.914.20784.004.40280.67
      4c4.24665.694.20764.344.22284.383.98781.59
      5c4.07071.383.65576.224.14072.833.75773.21
      6c3.72562.493.77062.403.66763.813.67263.55
      3.6283.618
      a Values are from double quantum-filtered COSY.
      b Resonance cannot be unambiguously assigned.
      Table IV1H and 13C chemical shifts of the four tautomeric forms of the B-Tri released from B+-HOCG by rE-ABase
      AtomForm I (55%)Form II (23%)Form III (18%)Form IV (4%)
      1H13C1H13C1H13C1H13C
      1a5.207 (3.8)94.61 (170.2)5.240 (3.8)94.34 (170.9)5.112 (4.0)
      Values are from double quantum-filtered COSY.
      100.52 (170.2)5.140 (3.8)99.22 (170.2)
      2a3.8586.9423.86869.423.82169.50
      Resonance cannot be unambiguously assigned.
      69.43
      3a3.94570.553.92570.71
      Resonance cannot be unambiguously assigned.
      70.42
      Resonance cannot be unambiguously assigned.
      70.48
      4a3.96870.663.97570.55
      Resonance cannot be unambiguously assigned.
      70.55
      Resonance cannot be unambiguously assigned.
      70.50
      5a4.38772.004.23972.324.03272.804.13072.75
      6a3.74362.653.74862.543.78062.42
      Resonance cannot be unambiguously assigned.
      62.65
      1b5.108 (4.0)101.81 (171.0)5.255 (4.0)100.20 (173.1)5.108 (4.0)
      Values are from double quantum-filtered COSY.
      99.07 (170.2)5.143 (3.8)101.19 (170.9)
      2b3.79369.293.77869.183.79369.23
      Resonance cannot be unambiguously assigned.
      69.36
      3b3.90870.753.83871.05
      Resonance cannot be unambiguously assigned.
      70.74
      Resonance cannot be unambiguously assigned.
      70.63
      4b3.81473.073.79773.293.81373.07
      Resonance cannot be unambiguously assigned.
      73.24
      5b4.16268.454.42868.134.08368.404.22868.56
      6b1.21616.591.18916.481.21516.641.19116.75
      1c5.368 (3.8)93.11 (171.6)4.714 (7.7)96.44 (162.1)5.432 (2.1)101.92 (173.8)5.368 (4.3)
      Values are from double quantum-filtered COSY.
      96.49 (174.9)
      2c3.99575.173.77575.974.26686.564.23983.44
      3c4.16372.483.95477.424.29083.224.47480.11
      4c4.30765.874.26364.694.30284.194.06781.40
      5c4.10271.193.68875.873.90772.593.84473.07
      6c3.75462.383.70662.223.70863.893.72763.81
      3.6633.644
      a Values are from double quantum-filtered COSY.
      b Resonance cannot be unambiguously assigned.
      Comparison of E-ABase with the Fucolectin-related Protein (FRP) Encoded by the SP2159 Gene of Streptococcus pneumoniae—When FAST and BLAST searches were performed using E-ABase as the query protein sequence, no significant sequence identity to any other non-glycosidase was revealed, except for a modest sequence identity (34% identity to 550 amino acid residues at the C terminus of the E-ABase sequence) to a protein (NCBI accession number NP_346573) identified as a “fucolectin-related protein of unknown function” of S. pneumoniae (
      • Tettelin H.
      • Nelson K.E.
      • Paulsen I.T.
      • Eisen J.A.
      • Read T.D.
      • Peterson S.
      • Heidelberg J.
      • DeBoy R.T.
      • Haft D.H.
      • Dodson R.J.
      • Durkin A.S.
      • Gwinn M.
      • Kolonay J.F.
      • Nelson W.C.
      • Peterson J.D.
      • Umayam L.A.
      • White O.
      • Salzberg S.L.
      • Lewis M.R.
      • Radune D.
      • Holtzapple E.
      • Khouri H.
      • Wolf A.M.
      • Utterback T.R.
      • Hansen C.L.
      • McDonald L.A.
      • Feldblyum T.V.
      • Angiuoli S.
      • Dickinson T.
      • Hickey E.K.
      • Holt I.E.
      • Loftus B.J.
      • Yang F.
      • Smith H.O.
      • Venter J.C.
      • Dougherty B.A.
      • Morrison D.A.
      • Hollingshead S.K.
      • Fraser C.M.
      ). Since an enzyme of similar specificity to E-ABase had been detected in Diplococcus pneumoniae (
      • Takasaki S.
      • Kobata A.
      ), the cloning of the FRP gene was undertaken to verify the relationship between E-ABase and FRP. The gene encoding FRP (SP2159) (
      • Tettelin H.
      • Nelson K.E.
      • Paulsen I.T.
      • Eisen J.A.
      • Read T.D.
      • Peterson S.
      • Heidelberg J.
      • DeBoy R.T.
      • Haft D.H.
      • Dodson R.J.
      • Durkin A.S.
      • Gwinn M.
      • Kolonay J.F.
      • Nelson W.C.
      • Peterson J.D.
      • Umayam L.A.
      • White O.
      • Salzberg S.L.
      • Lewis M.R.
      • Radune D.
      • Holtzapple E.
      • Khouri H.
      • Wolf A.M.
      • Utterback T.R.
      • Hansen C.L.
      • McDonald L.A.
      • Feldblyum T.V.
      • Angiuoli S.
      • Dickinson T.
      • Hickey E.K.
      • Holt I.E.
      • Loftus B.J.
      • Yang F.
      • Smith H.O.
      • Venter J.C.
      • Dougherty B.A.
      • Morrison D.A.
      • Hollingshead S.K.
      • Fraser C.M.
      ) was isolated from the genomic DNA of S. pneumoniae ATCC BAA-334, and recombinant FRP was expressed in E. coli. BL21(DE3). Although the purified recombinant FRP showed a strong affinity for an L-fucose-conjugated agarose column, this protein was unable to cleave substrates containing the blood group A or B determinant (data not shown). The ability of FRP to bind to the L-fucose-conjugated agarose column supports the initial identification of the SP2159 gene product as a fucolectin-related protein by Tettelin et al. (
      • Tettelin H.
      • Nelson K.E.
      • Paulsen I.T.
      • Eisen J.A.
      • Read T.D.
      • Peterson S.
      • Heidelberg J.
      • DeBoy R.T.
      • Haft D.H.
      • Dodson R.J.
      • Durkin A.S.
      • Gwinn M.
      • Kolonay J.F.
      • Nelson W.C.
      • Peterson J.D.
      • Umayam L.A.
      • White O.
      • Salzberg S.L.
      • Lewis M.R.
      • Radune D.
      • Holtzapple E.
      • Khouri H.
      • Wolf A.M.
      • Utterback T.R.
      • Hansen C.L.
      • McDonald L.A.
      • Feldblyum T.V.
      • Angiuoli S.
      • Dickinson T.
      • Hickey E.K.
      • Holt I.E.
      • Loftus B.J.
      • Yang F.
      • Smith H.O.
      • Venter J.C.
      • Dougherty B.A.
      • Morrison D.A.
      • Hollingshead S.K.
      • Fraser C.M.
      ). E-ABase was found to hydrolyze only the L-fucose-containing blood group A and B trisaccharide glycotopes (GalNAc/Galα1→3(Fucα1→2)Gal-), but not substrates devoid of an L-fucose residue. Thus, the slight sequence identity of E-ABase to FRP indicates that the L-fucose recognition site for E-ABase may reside in the C-terminal half of the peptide sequence.
      Conclusion—It is well known that blood group antigens coat the surface of cells exposed to the external environment, including the mouth, lung, urogenital tract, and gastrointestinal tract (
      • Clausen H.
      • Hakomori S.-I.
      ,
      • Greenwell P.
      ). Through the degradation of blood group A and B antigens of cell-surface glycoconjugates, E-ABase may enhance the infectivity and virulence of C. perfringens. This unique endo-β-galactosidase should become useful for studying the structure and function of glycoconjugates as well as for identifying other glycosidases belonging to the new GH98 family.

      Acknowledgments

      We thank the late Professor Winifred M. Watkins for the generous gift of the human ovarian cyst glycoprotein samples used in this work. We also thank Dr. Bernard Henrissat for invaluable advice on the classification of glycoside hydrolases.

      References

        • Rood J.I.
        • Cole S.T.
        Microbiol. Rev. 1991; 55: 621-648
        • Hatheway C.L.
        Clin. Microbiol. Rev. 1990; 3: 66-98
        • Smith L.D.
        Rev. Infect. Dis. 1979; 1: 254-262
        • Niilo L.
        Can. Vet. J. 1980; 21: 141-148
        • Sterne M.
        Br. Vet. J. 1981; 137: 443-454
        • Stevens D.L.
        • Bryant A.E.
        Clin. Infect. Dis. 2002; 35: S93-S100
        • Awad M.W.
        • Bryant A.E.
        • Stevens D.L.
        • Rood J.I.
        Mol. Microbiol. 1995; 15: 191-202
        • Rood J.
        Annu. Rev. Microbiol. 1998; 52: 333-360
        • Petit L.
        • Gibert M.
        • Popoff M.R.
        Trends Microbiol. 1999; 7: 104-110
        • Cassidy J.T.
        • Jourdian G.W.
        • Roseman S.
        J. Biol. Chem. 1965; 240: 3501-3506
        • Fraser A.G.
        J. Med. Microbiol. 1978; 11: 269-280
        • Corfield T.
        Glycobiology. 1992; 2: 509-521
        • Hatton M.W.C.
        • Regoeczi E.
        Biochim. Biophys. Acta. 1973; 327: 114-120
        • Chien S.-F.
        • Yevich S.J.
        • Li S.-C.
        • Li Y.-T.
        Biochem. Biophys. Res. Commun. 1975; 65: 683-691
        • Boyle M.D.P.
        • Ohanian S.H.
        • Borsos T.
        J. Immunol. 1976; 116: 661-668
        • Kraemer P.M.
        Biochim. Biophys. Acta. 1968; 167: 205-208
        • Den H.
        • Malinzak D.A.
        • Rosenberg A.
        J. Chromatogr. 1975; 111: 217-222
        • Trams E.G.
        • Lauter C.J.
        • Banfield W.G.
        J. Neurochem. 1976; 27: 1035-1042
        • Ashida H.
        • Anderson K.
        • Nakayama J.
        • Maskos K.
        • Chou C.-W.
        • Cole R.
        • Li S.-C.
        • Li Y.-T.
        J. Biol. Chem. 2001; 276: 28226-28232
        • Shimizu T.
        • Ohtani K.
        • Hirakawa H.
        • Ohshima K.
        • Yamashita A.
        • Shiba T.
        • Ogasawara N.
        • Hattori M.
        • Kuhara S.
        • Hayashi H.
        Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 996-1001
        • Anderson K.
        • Li S.-C.
        • Li Y.-T.
        Anal. Biochem. 2000; 287: 337-339
        • Cassidy J.T.
        • Jourdian G.W.
        • Roseman S.
        Methods Enzymol. 1966; 8: 680-685
        • Charbonneau H.
        Matsudaira P.T. A Practical Guide to Protein and Peptide Purification for Microsequencing. Academic Press, Inc., San Diego, CA1989: 29
      1. Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1991: 2.0.1-2.12.5 (Section 2)
        • Ashida H.
        • Maskos K.
        • Li S.-C.
        • Li Y.-T.
        Biochemistry. 2002; 41: 2388-2395
        • Hoffmann A.
        • Roeder R.G.
        Nucleic Acids Res. 1991; 19: 6337-6338
        • Li Y.-T.
        • Li S.-C.
        Methods Enzymol. 1972; 28: 702-713
        • Moore G.L.
        Anal. Biochem. 1969; 32: 122-127
        • Lowry O.H.
        • Rosebrough N.J.
        • Farr A.L.
        • Randall R.J.
        J. Biol. Chem. 1951; 193: 265-275
        • Laemmli U.K.
        Nature. 1970; 227: 680-685
        • Leng L.
        • Zhu A.
        • Zhang Z.
        • Hurst R.
        • Goldstein J.
        Gene (Amst.). 1998; 222: 187-194
        • Ogawa H.
        • Muramatsu H.
        • Kobayashi T.
        • Morozumi K.
        • Yokoyama I.
        • Kurosawa N.
        • Nakao A.
        • Muramatsu T.
        J. Biol. Chem. 2000; 275: 19368-19374
        • Clausen H.
        • Hakomori S.-I.
        Vox. Sang. 1989; 56: 1-20
        • Hoskins L.C.
        • Larson G.
        • Naff G.B.
        Transfusion (Bethesda). 1995; 35: 813-821
        • Angyal S.J.
        Angew. Chem. Int. Ed. Engl. 1969; 8: 157-166
        • Angyal S.J.
        Adv. Carbohydr. Chem. Biochem. 1984; 42: 15-68
        • Angyal S.J.
        Adv. Carbohydr. Chem. Biochem. 1991; 49: 19-35
        • Zhu Y.
        • Zajicek J.
        • Serianni A.S.
        J. Org. Chem. 2001; 66: 6244-6251
        • Gerwig G.J.
        • de Waard P.
        • Kamerling J.P.
        • Vliegenthart J.F.G.
        • Morgen-stern E.
        • Lamed R.
        • Bayer E.A.
        J. Biol. Chem. 1989; 264: 1027-1035
        • Angyal S.J.
        Carbohydr. Res. 1979; 77: 37-50
        • Azurmendi H.F.
        • Bush C.A.
        Carbohydr. Res. 2002; 337: 905-915
        • Strecker G.
        • Wieruszeski J.-M.
        • Michalski J.-C.
        • Montreuil J.
        Glycoconj. J. 1989; 6: 271-284
        • Tettelin H.
        • Nelson K.E.
        • Paulsen I.T.
        • Eisen J.A.
        • Read T.D.
        • Peterson S.
        • Heidelberg J.
        • DeBoy R.T.
        • Haft D.H.
        • Dodson R.J.
        • Durkin A.S.
        • Gwinn M.
        • Kolonay J.F.
        • Nelson W.C.
        • Peterson J.D.
        • Umayam L.A.
        • White O.
        • Salzberg S.L.
        • Lewis M.R.
        • Radune D.
        • Holtzapple E.
        • Khouri H.
        • Wolf A.M.
        • Utterback T.R.
        • Hansen C.L.
        • McDonald L.A.
        • Feldblyum T.V.
        • Angiuoli S.
        • Dickinson T.
        • Hickey E.K.
        • Holt I.E.
        • Loftus B.J.
        • Yang F.
        • Smith H.O.
        • Venter J.C.
        • Dougherty B.A.
        • Morrison D.A.
        • Hollingshead S.K.
        • Fraser C.M.
        Science. 2001; 293: 498-506
        • Takasaki S.
        • Kobata A.
        J. Biol. Chem. 1976; 251: 3603-3609
        • Greenwell P.
        Glycoconj. J. 1997; 14: 159-173