Advertisement

The Prosegments of Furin and PC7 as Potent Inhibitors of Proprotein Convertases

IN VITRO AND EX VIVO ASSESSMENT OF THEIR EFFICACY AND SELECTIVITY*
Open AccessPublished:November 26, 1999DOI:https://doi.org/10.1074/jbc.274.48.33913
      All proprotein convertases (PCs) of the subtilisin/kexin family contain an N-terminal prosegment that is presumed to act both as an intramolecular chaperone and an inhibitor of its parent enzyme. In this work, we examined inhibition by purified, recombinant bacterial prosegments of furin and PC7 on the in vitro processing of either the fluorogenic peptide pERTKR-MCA or the human immunodeficiency virus envelope glycoprotein gp160. These propeptides are potent inhibitors that display measurable selectivity toward specific proprotein convertases. Small, synthetic decapeptides derived from the C termini of the prosegments are also potent inhibitors, albeit less so than the full-length proteins, and the C-terminal P1 arginine is essential for inhibition. The bacterial, recombinant prosegments were also used to generate specific antisera, allowing us to study the intracellular metabolic fate of the prosegments of furin and PC7 expressed via vaccinia virus constructs. These vaccinia virus recombinants, along with transient transfectants of the preprosegments of furin and PC7, efficiently inhibited theex vivo processing of the neurotrophins nerve growth factor and brain-derived neurotrophic factor. Thus, we have demonstrated for the first time that PC prosegments, expressed ex vivo as independent domains, can act in trans to inhibit precursor maturation by intracellular PCs.
      PC
      proprotein convertase
      ER
      endoplasmic reticulum
      TGN
      trans-Golgi network
      pFurin
      Furin prosegment
      ppFurin
      furin preprosegment
      pPC7
      PC7 prosegment
      ppPC7
      PC7 preprosegment
      BTMD
      before transmembrane domain
      VV
      vaccinia virus
      BDNF
      brain-derived neurotrophic factor
      NGF
      nerve growth factor
      aa
      amino acid(s)
      bp
      base pair
      gp
      glycoprotein
      MALDI-TOF
      matrix-assisted laser desorption ionization-time of flight
      PAGE
      polyacrylamide gel electrophoresis
      Tricine
      N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine
      pfu
      plaque-forming units
      HIV
      human immunodeficiency virus
      Fmoc
      N-(9-fluorenyl)methoxycarbonyl
      hfurin
      human furin
      POMC
      pro-opiomelanocortin
      AMC
      7-amino-4-methylcoumarin
      MCA
      methylcoumarinamide
      Limited proteolysis of proproteins is an archetypal mechanism responsible for the generation of diverse bioactive peptides and proteins from inactive precursors (
      • Seidah N.G.
      • Day R.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Steiner D.F.
      ,
      • Seidah N.G.
      • Mbikay M.
      • Marcinkiewicz M.
      • Chrétien M.
      ). Within the secretory pathway, these cleavages involve the processing of precursors at either single or paired basic residues (
      • Seidah N.G.
      • Day R.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Steiner D.F.
      ) or at specific hydrophobic and small residues (
      • Seidah N.G.
      • Mbikay M.
      • Marcinkiewicz M.
      • Chrétien M.
      ). The recently characterized enzymes responsible for many of these intracellular conversions are calcium-dependent subtilisin-like serine proteinases related either to the yeast kexin (
      • Seidah N.G.
      • Day R.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Steiner D.F.
      ,
      • Seidah N.G.
      • Mbikay M.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Seidah N.G.
      • Chrétien M.
      ,
      • Nakayama K.
      ) or to the pyrolysin (
      • Seidah N.G.
      • Mowla S.J.
      • Hamelin J.
      • Mamarbachi A.M.
      • Benjannet S.
      • Toure B.B.
      • Basak A.
      • Munzer J.S.
      • Marcinkiewicz J.
      • Zhong M.
      • Barale J.C.
      • Lazure C.
      • Murphy R.A.
      • Chrétien M.
      • Marcinkiewicz M.
      ) subfamilies of subtilases (
      • Siezen R.J.
      • Leunissen J.A. M
      ). The mammalian kexin-like proteinases, known as proprotein convertases (PCs),1 form a family comprising seven members: furin (PACE), PC1 (PC3), PC2, PC4, PACE4, PC5 (PC6), and PC7 (LPC, PC8) (
      • Seidah N.G.
      • Day R.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Steiner D.F.
      ,
      • Seidah N.G.
      • Mbikay M.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Seidah N.G.
      • Chrétien M.
      ,
      • Nakayama K.
      ). These enzymes cleave precursor polypeptides at specific sites within the general motif (R/K) − (X)n − (K/R)↓, where n = 0, 2, 4, or 6, and X is any amino acid (aa) except Cys (
      • Seidah N.G.
      • Day R.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Steiner D.F.
      ,
      • Seidah N.G.
      • Mbikay M.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Seidah N.G.
      • Chrétien M.
      ,
      • Nakayama K.
      ). The only mammalian pyrolysin-like enzyme known to date is SKI-1/S1P, which appears to recognize the motif RXX(L,T)↓ (
      • Seidah N.G.
      • Mowla S.J.
      • Hamelin J.
      • Mamarbachi A.M.
      • Benjannet S.
      • Toure B.B.
      • Basak A.
      • Munzer J.S.
      • Marcinkiewicz J.
      • Zhong M.
      • Barale J.C.
      • Lazure C.
      • Murphy R.A.
      • Chrétien M.
      • Marcinkiewicz M.
      ,
      • Sakai J.
      • Rawson R.B.
      • Espenshade P.J.
      • Cheng D.
      • Seegmiller A.C.
      • Goldstein J.L.
      • Brown M.S.
      ).
      The synthesis of most proteinases as inactive zymogens provides cells with the means to regulate spatially and temporally their proteolytic activities (
      • Khan A.R.
      • James M.N.
      ), thereby minimizing the occurrence of premature enzymatic activity which could lead to inappropriate protein degradation. The inhibitory mechanism often involves the presence of an inactivating (pro)segment at the N terminus of the zymogen. In the case of bacterial subtilases, zymogen activation involves the autocatalytic excision of their prosegments, which are thought to act both as intramolecular chaperones (
      • Shinde U.
      • Li Y.
      • Inouye M.
      ) as well as specific inhibitors of the parent proteinase (
      • Shinde U.
      • Li Y.
      • Inouye M.
      ,
      • Seidah N.G.
      ,
      • Anderson E.D.
      • Van Slyke J.K.
      • Thulin C.D.
      • Jean F.
      • Thomas G.
      ,
      • Boudreault A.
      • Gauthier D.
      • Lazure C.
      ). The prosegments of mammalian PCs, which exhibit 30–67% sequence identity to each other (
      • Seidah N.G.
      • Day R.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Seidah N.G.
      • Mbikay M.
      • Marcinkiewicz M.
      • Chrétien M.
      ) and an absolute conservation of 8 aa (
      • Seidah N.G.
      • Day R.
      • Marcinkiewicz M.
      • Chrétien M.
      ), are autocatalytically processed in the endoplasmic reticulum (ER). With the exception of PC2 (
      • Seidah N.G.
      • Day R.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Steiner D.F.
      ,
      • Seidah N.G.
      • Mbikay M.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Seidah N.G.
      • Chrétien M.
      ), this event is a prerequisite for the efficient egress of PCs from this compartment (
      • Powner D.
      • Davey J.
      ,
      • Creemers J.W.M.
      • Vey M.
      • Schafer W.
      • Ayoubi T.A.Y.
      • Roebroke A.J.M.
      • Klenk H.D.
      • Garten W.
      • Van de Ven W.J.M.
      ,
      • Zhong M.
      • Benjannet S.
      • Lazure C.
      • Munzer S.
      • Seidah N.G.
      ,
      • Zhou A.
      • Paquet L.
      • Mains R.E.
      ). The initial cleavage of the prodomain of PCs does not result in the immediate activation of the enzyme; rather the prosegment appears to remain tightly associated with the convertase until it reaches its final cellular destination. At this point, the increase in H+ and/or Ca2+ concentrations in the TGN or secretory granules triggers a secondary cleavage(s), resulting in the dissociation of the prosegment (
      • Anderson E.D.
      • Van Slyke J.K.
      • Thulin C.D.
      • Jean F.
      • Thomas G.
      ,
      • Boudreault A.
      • Gauthier D.
      • Lazure C.
      ,
      • Powner D.
      • Davey J.
      ). Whereas PC1, PC2, furin, PACE4, and PC5 contain a secondary cleavage site KR or RR within their prosegments, PC4 and PC7 have only an RK site. In the latter cases, it is not yet known if cleavage at these sites occurs or is required for the effective activation of these enzymes (
      • Seidah N.G.
      • Day R.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Seidah N.G.
      • Mbikay M.
      • Marcinkiewicz M.
      • Chrétien M.
      ). Moreover, it remains to be determined whether the subsequent trimming of the C-terminal basic residues known to be mediated by specific carboxypeptidases (
      • Lei Y.
      • Xin X.
      • Morgan D.
      • Pintar J.E.
      • Fricker L.D.
      ) is required for full activation of these enzymes.
      Furin and PC7, the major convertases of the constitutive secretory pathway (
      • Seidah N.G.
      • Day R.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Steiner D.F.
      ,
      • Seidah N.G.
      • Mbikay M.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Seidah N.G.
      • Chrétien M.
      ,
      • Nakayama K.
      ,
      • Molloy S.S.
      • Thomas L.
      • Vanslyke J.K.
      • Stenberg P.E.
      • Thomas G.
      ,
      • Seidah N.G.
      • Hamelin J.
      • Mamarbachi M.
      • Dong W.
      • Tardos H.
      • Mbikay M.
      • Chrétien M.
      • Day R.
      ,
      • Munzer J.S.
      • Basak A.
      • Zhong M.
      • Mamarbachi A.
      • Hamelin J.
      • Savaria D.
      • Lazure C.
      • Benjannet S.
      • Chrétien M.
      • Seidah N.G.
      ,
      • van de Loo J.W.
      • Creemers J.W.
      • Bright N.A.
      • Young B.D.
      • Roebroek A.J.
      • Van de Ven W.J.
      ), process precursors either within thetrans-Golgi network (TGN) or at the cell surface. As such, they mediate a wide range of processing events, which, in pathological situations, may exacerbate a disease state (
      • Chrétien M.
      • Mbikay M.
      • Gaspar L.
      • Seidah N.G.
      ). Examples include the participation of furin and possibly PC7 in the processing of the viral surface glycoproteins gp160 of HIV (
      • Decroly E.
      • Wouters S.
      • Dibello C.
      • Lazure C.
      • Ruysschaert J.M.
      • Seidah N.G.
      ,
      • Decroly E.
      • Benjannet S.
      • Savaria D.
      • Seidah N.G.
      ,
      • Hallenberger S.
      • Moulard M.
      • Sordel M.
      • Klenk H.D.
      • Garten W.
      ) and glycoprotein of Ebola virus (
      • Volchkov V.E.
      • Feldmann H.
      • Volchkova V.A.
      • Klenk H.D.
      ). Furthermore, at least furin has been implicated in the processing of toxins such as those of Aeromonas hydrophila(pore-forming proaerolysin) (
      • Abrami L.
      • Fivaz M.
      • Decroly E.
      • Seidah N.G.
      • Jean F.
      • Thomas G.
      • Leppla S.H.
      • Buckley J.T.
      • van der Goot F.G.
      ), anthrax (
      • Klimpel K.R.
      • Molloy S.S.
      • Thomas G.
      • Leppla S.H.
      ), Pseudomonas,and diphtheria (
      • Chiron M.F.
      • Fryling C.M.
      • FitzGerald D.J.
      ). Experiments in which the activation of these proteins has been prevented through the inhibition of furin and possibly other PCs indicate that there is considerable promise in these novel approaches to treating such pathologies.
      Some of the previous attempts to inhibit the substrate processing activity of PCs ex vivo have included the use of irreversible chloromethylketone inhibitors (
      • Hallenberger S.
      • Bosh V.
      • Angliker H.
      • Shaw E.
      • Klenk H.D.
      • Garten W.
      ,
      • Jean F.
      • Boudreault A.
      • Basak A.
      • Seidah N.G.
      • Lazure C.
      ) and reversible peptide inhibitors (
      • Decroly E.
      • Vandenbranden M.
      • Ruysschaert J.M.
      • Cogniaux J.
      • Jacob G.S.
      • Howard S.C.
      • Marshall G.
      • Kompelli A.
      • Basak A.
      • Jean F.
      • Lazure C.
      • Benjannet S.
      • Chrétien M.
      • Day R.
      • Seidah N.G.
      ,
      • Jean F.
      • Basak A.
      • DiMaio J.
      • Seidah N.G.
      • Lazure C.
      ,
      • Apletalina E.
      • Appel J.
      • Lamango N.S.
      • Houghten R.A.
      • Lindberg I.
      ). Major limitations of these agents include either their cytotoxicity (through interfering with the biosynthesis of many important cellular proteins) and/or their relatively poor cellular permeability and targeting (
      • Hallenberger S.
      • Bosh V.
      • Angliker H.
      • Shaw E.
      • Klenk H.D.
      • Garten W.
      ,
      • Jean F.
      • Boudreault A.
      • Basak A.
      • Seidah N.G.
      • Lazure C.
      ). Alternatively, recombinant protein-based inhibitors have been developed (
      • Anderson E.D.
      • Thomas L.
      • Hayflick J.S.
      • Thomas G.
      ,
      • Benjannet S.
      • Savaria D.
      • Laslop A.
      • Munzer J.S.
      • Chrétien M.
      • Marcinkiewicz M.
      • Seidah N.G.
      ,
      • Jean F.
      • Stella K.
      • Thomas L.
      • Liu G.
      • Xiang Y.
      • Reason A.J.
      • Thomas G.
      ,
      • Rompaey L.V.
      • Ayoubi T.
      • Van De Ven W.
      • Marynen P.
      ,
      • Dahlen J.R.
      • Jean F.
      • Thomas G.
      • Foster D.C.
      • Kisiel W.
      ,
      • Lu W.Y.
      • Zhang W.L.
      • Molloy S.S.
      • Thomas G.
      • Ryan K.
      • Chiang Y.W.
      • Anderson S.
      • Laskowski Jr., M.
      ). These strategies are based on the expression of proteins that contain a furin-like recognition sequence (RXXR) within the inhibitor binding region of either human α1-antitrypsin (
      • Anderson E.D.
      • Thomas L.
      • Hayflick J.S.
      • Thomas G.
      ,
      • Benjannet S.
      • Savaria D.
      • Laslop A.
      • Munzer J.S.
      • Chrétien M.
      • Marcinkiewicz M.
      • Seidah N.G.
      ,
      • Jean F.
      • Stella K.
      • Thomas L.
      • Liu G.
      • Xiang Y.
      • Reason A.J.
      • Thomas G.
      ), α2-macroglobulin (
      • Rompaey L.V.
      • Ayoubi T.
      • Van De Ven W.
      • Marynen P.
      ), proteinase-8 (
      • Dahlen J.R.
      • Jean F.
      • Thomas G.
      • Foster D.C.
      • Kisiel W.
      ), or the turkey ovomucoid third domain (
      • Lu W.Y.
      • Zhang W.L.
      • Molloy S.S.
      • Thomas G.
      • Ryan K.
      • Chiang Y.W.
      • Anderson S.
      • Laskowski Jr., M.
      ). Although often reasonably effective, the inability of these recombinant proteins to inhibit selectively furin and not other PCs remains problematic (
      • Benjannet S.
      • Savaria D.
      • Laslop A.
      • Munzer J.S.
      • Chrétien M.
      • Marcinkiewicz M.
      • Seidah N.G.
      ,
      • Jean F.
      • Stella K.
      • Thomas L.
      • Liu G.
      • Xiang Y.
      • Reason A.J.
      • Thomas G.
      ).
      J. S. Munzer and N. G. Seidah, unpublished results.
      2J. S. Munzer and N. G. Seidah, unpublished results.
      In response to these challenges, we have begun exploring the possibility that prosegments of PCs can be employed to inhibit specifically and efficiently the processing of cellular substrate proproteins. Here we examine the in vitro and ex vivo inhibitory characteristics and specificities of the prosegments of furin and PC7. Synthetic peptides derived from these prosegments are used to identify the regions of these molecules that are most important for potent inhibition. We then explored whether cellular overexpression of the preprosegments of furin and PC7 can, acting in trans as independent domains, inhibit the PC-mediated maturation of two neurotrophin precursors ex vivo.

      EXPERIMENTAL PROCEDURES

      Expression and Purification of Bacterial Recombinant hFurin and rPC7 Prosegments

      The bacterial expression vector pET24b (+) (Novagen) was cut with 5′ NdeI and 3′ BamHI to remove the N-terminal T7 tag. It was then ligated with a linker composed of pre-annealed sense 5′ TACACATATG 3′ and antisense 5′ GATCCATATGTG 3′ oligonucleotides (the underlined codon represents the initiator Met, which is followed in the recombinant vector by an Asp-Pro sequence). The cDNAs coding for the N-terminal prosegments of human furin (aa 27–107 of hfurin (
      • van den Ouweland A.M.
      • van Duijnhoven H.L.
      • Keizer G.D.
      • Dorssers L.C.
      • Van de Ven W.J.M.
      ), referred to as pFurin) and rat PC7 (aa 37–140 of rPC7 (
      • Seidah N.G.
      • Hamelin J.
      • Mamarbachi M.
      • Dong W.
      • Tardos H.
      • Mbikay M.
      • Chrétien M.
      • Day R.
      ), referred to as pPC7), were isolated by a three-step PCR using Elongase (Life Technologies, Inc.) for 25 cycles, i.e. 94 °C for 25 s, 50 °C for 50 s, and 68 °C for 50 s. The hfurin and rPC7 oligonucleotides used were as follows: sense (5′ GGATCCGCAGAAGGTCTTCACCAACACGT 3′ and 5′ GGATCCGCTAACAGAGGCAGGTGGTCTTG 3′) and antisense, which contains a hexa-His anti-coding sequence (5′ CTCGAGTCAGTGGTGGTGGTGGTGGTGCCGTTTAGTCCG 3′ and 5′ CTCGAGTCAGTGGTGGTGGTGGTGGTGGCGCTTGGCCCT 3′), respectively. These 277- and 346-bp cDNAs were cloned into the PCR 2.1 TA cloning vector for sequencing and then were transferred into theBamHI/XhoI sites of the above modified bacterial expression vector pET 24b. These recombinants were transformed into theEscherichia coli strain BL21 (DE3). Protein expression was induced with 1 mmisopropyl-β-d-thiogalactoside, after which the cultures were grown for 4 h at 37 °C. The cells were harvested by centrifugation at 4,000 × g. Since the prosegments were localized to the inclusion bodies, the cell pellets were sonicated on ice in binding buffer (20 mm Tris-HCl, 0.5 mNaCl, 5 mm imidazole, 6 m guanidine HCl, pH 7.9). The supernatant was applied to a 1-ml column containing a Ni2+-immobilized resin (Novagen), pre-equilibrated at room temperature with binding buffer. The column was washed with binding buffer containing 20 mm imidazole in order to eliminate weakly bound species. Elution was then carried out with the same buffer now containing 1 m imidazole. The eluant was dialyzed against 50 mm sodium acetate, pH 5.5, at 4 °C overnight. The prosegments were further purified with a Varian 9050/9010 instrument by reverse-phase high performance liquid chromatography using a 5-μm C4 column (0.94 × 25 cm; Vydac). After binding in an aqueous phase containing 0.1% trifluoroacetic acid, proteins were eluted at 2 ml/min with a 1%/min linear gradient (10–70%) of 0.1% aqueous trifluoroacetic acid/CH3CN (monitored at 210 nm). The purity, concentrations, and masses of the prosegments were determined by Coomassie staining of 15% Tricine/SDS-PAGE gels (Fig.1), quantitative amino acid analysis, and matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry.
      Figure thumbnail gr1
      Figure 1Expression, purification, and characterization of the prosegments of hfurin and rPC7 from BL21 cells. A, Coomassie staining of proteins resolved by SDS-PAGE on 15% polyacrylamide gels. The pFurin and pPC7 samples represent bacterial extracts following 4-h induction with isopropyl-1-thio-β-d-galactopyranoside and Ni2+ affinity purification. B, MALDI-TOF analysis of the purified pFurin (molecular mass of 10,735) and pPC7 (molecular mass of 12,348).

      Synthesis of Prosegment-derived Peptide Derivatives

      All Fmoc protected amino acid derivatives (l-configuration), the coupling reagents, and the solvents were purchased from PE Biosystems Inc. (Framingham, MA), Calbiochem, and Richelieu Biotechnologies (Montréal, Québec, Canada). The furin-derived synthetic peptides are as follows: Fur-M15,62GDYYHFWHRGVTKRS76; Fur-C24,84HSRLQREPQVQWLEQQVAKRRTKR107; Fur-C10,98QQVAKRRTKR107; and Fur-C10A,98QQVAKRRTKA107. The rPC7-derived synthetic peptides are as follows: PC7-N20,39EAGGLDTLGAGGLSWAVHLD58; PC7-M18,86GRIGELQGHYLFVQPAGH103; PC7-C24,117EAVLAKHEAVRWHSEQRLLKRAKR140; PC7-C18, 123HEAVRWHSEQRLLKRAKR140; PC7-C10,131EQRLLKRAKR140; and PC7-C18A,123HEAVRWHSEQRLLKRAKA140. The PC7 N-20, M-18, C-24, and C-18 as well as the furin M-15, and C-24 peptides were kindly provided by Dr. Feng Ni (the Biotechnology Research Institute, Montréal, Canada), all other peptides were synthesized with the C terminus in the amide form (CONH2), on a solid phase automated peptide synthesizer instrument (Pioneer), PE Biosystems, following theO-hexafluorophospho-[7-azabenzotriazol-1-yl]-N,N,N′,N′-tetramethyluronium)/diisopropyl ethyl amine-mediated Fmoc chemistry. All syntheses were accomplished using an unloaded polyamino linker-polyethylene glycol resin. The following side chain-protecting groups were used: 2,2,4,6,7-pentamethyldihydrobenzofuran 5-sulfonyl for Arg;t-butyl for Ser, Thr, Asp, and Tyr, and trityl for His, Asn, and Gln, respectively. The crude peptides were cleaved from the resin and fully deprotected by 3 h treatment with reagent B (trifluoroacetic acid/phenol/water/triisopropyl silane = 88:5:5:2). The peptides were purified by reverse-phase high performance liquid chromatography using a semi-preparative CSC-Exsil C18 column (0.94 × 25 cm, Chromatography Specialty Co.), followed by further purification on a ultrasphere C18 analytical column (0.46 × 25 cm, Beckman) following the conditions as described above.

      MALDI-TOF Mass Spectrometry

      High performance liquid chromatography fractions were mixed with one of two matrix solutions as follows: 3,5-dimethoxy-4-hydroxycinnamic acid (Aldrich) for prosegments, and α-cyano-4-hydroxycinnamic acid (Aldrich) for synthetic peptides. Spectra were obtained on a Voyageur DE-Pro MALDI-TOF instrument (PE PerSeptive Biosystems).

      In Vitro Inhibition of gp160 Processing by Furin

      HIV-1 [35S]Met gp160 was affinity purified from CV-1 cells overexpressing VV:gp160 as described (
      • Decroly E.
      • Vandenbranden M.
      • Ruysschaert J.M.
      • Cogniaux J.
      • Jacob G.S.
      • Howard S.C.
      • Marshall G.
      • Kompelli A.
      • Basak A.
      • Jean F.
      • Lazure C.
      • Benjannet S.
      • Chrétien M.
      • Day R.
      • Seidah N.G.
      ). For the inhibition assay, furin was first preincubated with increasing concentrations of pFurin or pPC7 for 10 min at 25 °C according to Decroly et al. (
      • Decroly E.
      • Vandenbranden M.
      • Ruysschaert J.M.
      • Cogniaux J.
      • Jacob G.S.
      • Howard S.C.
      • Marshall G.
      • Kompelli A.
      • Basak A.
      • Jean F.
      • Lazure C.
      • Benjannet S.
      • Chrétien M.
      • Day R.
      • Seidah N.G.
      ), followed by the addition of 10,000 cpm of [35S]Met gp160 and an overnight incubation at 25 °C. The products were analyzed by SDS-PAGE as described (
      • Decroly E.
      • Wouters S.
      • Dibello C.
      • Lazure C.
      • Ruysschaert J.M.
      • Seidah N.G.
      ,
      • Decroly E.
      • Vandenbranden M.
      • Ruysschaert J.M.
      • Cogniaux J.
      • Jacob G.S.
      • Howard S.C.
      • Marshall G.
      • Kompelli A.
      • Basak A.
      • Jean F.
      • Lazure C.
      • Benjannet S.
      • Chrétien M.
      • Day R.
      • Seidah N.G.
      ).

      Enzymatic Activity Determination

      Media of BSC40 cells infected with vaccinia virus recombinants of soluble PC7 (VV:rPC7-BTMD (
      • Munzer J.S.
      • Basak A.
      • Zhong M.
      • Mamarbachi A.
      • Hamelin J.
      • Savaria D.
      • Lazure C.
      • Benjannet S.
      • Chrétien M.
      • Seidah N.G.
      )), furin (VV:hfurin-BTMD (
      • Decroly E.
      • Wouters S.
      • Dibello C.
      • Lazure C.
      • Ruysschaert J.M.
      • Seidah N.G.
      )) (a generous gift from G. Thomas, Vollum Institute, Portland, OR), PC5 (VV:mPC5A), PACE4 (VV:hPACE4A), and the shed form of yeast kexin (VV:ykexin) (
      • Munzer J.S.
      • Basak A.
      • Zhong M.
      • Mamarbachi A.
      • Hamelin J.
      • Savaria D.
      • Lazure C.
      • Benjannet S.
      • Chrétien M.
      • Seidah N.G.
      ,
      • Decroly E.
      • Wouters S.
      • Dibello C.
      • Lazure C.
      • Ruysschaert J.M.
      • Seidah N.G.
      ) were concentrated 50-fold and kept in 40% glycerol at −20 °C. Enzymatic activity was determined by the cleavage of the fluorogenic substrate pERTKR-MCA (Peptides International) (
      • Decroly E.
      • Wouters S.
      • Dibello C.
      • Lazure C.
      • Ruysschaert J.M.
      • Seidah N.G.
      ). For each assay, 5–10 μl of enzyme that will cleave an equal amount of substrate was added to a solution containing 50 mm Tris-HCl, pH 7.0, 2 mm Ca2+, and 100 μm pERTKR-MCA in a final volume of 100 μl. Fluorescence was measured at 0, 30, 60, and 90 min using a model LS 50B (Perkin-Elmer) spectrofluorimeter (
      • Munzer J.S.
      • Basak A.
      • Zhong M.
      • Mamarbachi A.
      • Hamelin J.
      • Savaria D.
      • Lazure C.
      • Benjannet S.
      • Chrétien M.
      • Seidah N.G.
      ).

      Inhibition Studies

      Stop-time Assay

      Enzymes were preincubated for 15 min at room temperature with various concentrations of the prosegments (mixed with 0.1% BSA to avoid nonspecific binding of the dilute prosegments to the microtiter plate) or synthetic peptides. The fluorogenic pERTKR-MCA substrate was then added, and the released AMC was measured as above. K i values were derived from Dixon (
      • Dixon M.
      ) and Cornish-Bowden (
      • Cornish-Bowden A.
      ) plots using substrate concentrations of 75, 100, and 200 μm for PC7, and 5, 25, and 50 μmfor furin.

      On-line Assay

      Here we sequentially added to the microtiter plate the prosegment (at various concentrations), 100 μmpERTKR-MCA, and finally the buffered enzyme mixture (see above). Fluorescence was continually recorded over a 5-min period to follow the progress of inhibition (
      • Boudreault A.
      • Gauthier D.
      • Lazure C.
      ).

      Cellular Expression of Preprofurin (ppFurin) and Prepro-PC7 (ppPC7)

      The preprosegments of rPC7 (ppPC7, 450-bp coding for aa 1–142) and furin (ppFurin, 351-bp coding for aa 1–109) were amplified for 25 cycles by PCR (94 °C for 25 s, 50 °C for 50 s, and 68 °C for 50 s using Elongase). The sense and antisense pairs of oligonucleotides for PC7 and furin that contain 5′HindIII and 3′ BamHI sites were as follows: 5′ AAGCTTGTTGTGATGCCGAAAGGGAG 3′, 5′ GGATCCTCATTAGATGCTGCGCTTGGCCCTCTT 3′, and 5′ AAGCTTGAAGCCATGGAGCTGAGGCCCTGG 3′, 5′ GGATCCTCATTACACGTCCCGTTTAGTCCG 3′. Note that in both sense oligonucleotides the initiator methionine codon is underlined and that in both antisense oligonucleotides we have introduced two tandem stop codons (underlined). The PCR products were cloned into the PCR 2.1 TA cloning vector for sequencing and then ligated into theBamHI/HindIII sites of the pcDNA3 vector (Invitrogen) for transient transfection and the PMJ602 vaccinia virus transfer vector (
      • Davison A.J.
      • Moss B.
      ) which led to the isolation of the recombinant VV:ppFurin and VV:ppPC7 virus stocks.

      Prosegment Antibodies and Vaccinia Virus Expression

      The purified, bacterially produced prosegments pFurin and pPC7 were treated with carboxypeptidase B to remove the C-terminal dibasic and hexa-his tag and then used to raise specific antisera in rabbits. For the cellular expression of the preprosegments, 5 × 106 BSC40 or AtT20 cells were infected for 2 h with 2 plaque-forming units (pfu)/cell of either VV:ppFurin or VV:ppPC7. Following overnight incubation in minimal essential medium without serum, the cells were extracted in 5 m acetic acid, sonicated, and then applied to a SepPak (Waters) C18 cartridge. The retained peptides and proteins were eluted using 60% CH3CN, 0.1% trifluoroacetic acid. The samples were then resolved by SDS-PAGE on a 14% Tricine gel, and the proteins were analyzed by Western blotting with pFurin (dilution 1:1,000) and pPC7 (dilution 1:2,500) antisera. For inhibition studies, 5 × 106 rat Schwann cells (
      • Marcinkiewicz M.
      • Savaria D.
      • Marcinkiewicz J.
      ) were infected with 1 pfu/cell of VV:NGF (
      • Seidah N.G.
      • Benjannet S.
      • Pareek S.
      • Savaria D.
      • Hamelin J.
      • Goulet B.
      • Laliberte J.
      • Lazure C.
      • Chrétien M.
      • Murphy R.A.
      ) and 3 pfu/cell of either VV:ppFurin, VV:ppPC7, VV:PDX (kindly supplied by Gary Thomas, Vollum Institute, Portland, OR), or the control VV:POMC. Following overnight incubation, the cells were washed and then pulse-labeled with [35S]Met for 3 h. The media were immunoprecipitated with an anti-NGF antibody and analyzed by SDS-PAGE and autoradiography (
      • Seidah N.G.
      • Benjannet S.
      • Pareek S.
      • Savaria D.
      • Hamelin J.
      • Goulet B.
      • Laliberte J.
      • Lazure C.
      • Chrétien M.
      • Murphy R.A.
      ).

      Transient Transfection in COS-1 Cells

      By using LipofectAMINE (Life Technologies, Inc.), 60–70% confluent COS-1 cells were co-transfected with pcDNA3 recombinants of pro-BDNF (
      • Mowla S.J.
      • Pareek S.
      • Farhadi H.F.
      • Petrecca K.
      • Fawcett J.P.
      • Seidah N.G.
      • Morris S.J.
      • Sossin W.S.
      • Murphy R.A.
      ) plus either ppFurin, ppPC7, or an empty pcDNA3 plasmid. After a 5-h incubation in serum- and antibiotic-free Dulbecco's modified Eagle's medium (Life Technologies, Inc.), the cells were incubated for another 48 h in Dulbecco's modified Eagle's medium plus 10% fetal calf serum. Concentrated media were run on a 13–22% gradient SDS-PAGE, and the separated proteins were analyzed by Western blotting using a commercial BDNF antibody (Santa Cruz Biotechnology).

      DISCUSSION

      The ability of prosegments to inhibit their parent enzymes is a well established phenomenon (
      • Khan A.R.
      • James M.N.
      ,
      • Shinde U.
      • Li Y.
      • Inouye M.
      ). Among the best studied prosegments of serine proteinases are those of the bacterial subtilases, in particular those of subtilisin E (
      • Shinde U.
      • Li Y.
      • Inouye M.
      ,
      • Power S.D.
      • Adams R.M.
      • Wells J.A.
      ) and α-lytic protease (
      • Sohl J.L.
      • Agard D.A.
      ). In addition to being essential for the proper folding of these enzymes during synthesis, the prosegments are powerful, specific inhibitors with K i values typically in the nanomolar range (
      • Shinde U.
      • Li Y.
      • Inouye M.
      ,
      • Strausberg S.
      • Alexander P.
      • Wang L.
      • Schwarz F.
      • Bryan P.
      ). These observations appear to hold true also for members of the eukaryotic kexin family of subtilases. Studies of the prosegment of yeast kexin-like krp1 from Schizosaccharomyces pombe (
      • Powner D.
      • Davey J.
      ) confirm that it plays a critical role in the folding of the nascent zymogen during synthesis. Subsequent to an autocatalytic intramolecular cleavage at the prosegment-catalytic domain junction, the prosegment remains noncovalently attached to the enzyme, serving as a potent autoinhibitor of its activity (
      • Khan A.R.
      • James M.N.
      ,
      • Shinde U.
      • Li Y.
      • Inouye M.
      ,
      • Powner D.
      • Davey J.
      ). In eukaryotes, as this complex progresses along the secretory pathway, additional events mediate the degradation and dissociation of the prosegment, leading to a fully activated enzyme (
      • Seidah N.G.
      ). For kexin, both prosegment cleavage and enzyme activation occur within the ER (
      • Chaudhuri B.
      • Latham S.E.
      • Helliwell S.B.
      • Seeboth P.
      ). Except in the case of PC2, prosegment cleavage of all other members of the mammalian PC family occurs within the ER. Enzyme activation, however, occurs later in the secretory pathway, typically in the TGN or in immature secretory granules (
      • Seidah N.G.
      • Day R.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Steiner D.F.
      ,
      • Seidah N.G.
      • Mbikay M.
      • Marcinkiewicz M.
      • Chrétien M.
      ,
      • Seidah N.G.
      • Chrétien M.
      ,
      • Nakayama K.
      ,
      • Anderson E.D.
      • Van Slyke J.K.
      • Thulin C.D.
      • Jean F.
      • Thomas G.
      ).
      Other studies (
      • Khan A.R.
      • James M.N.
      ) have characterized the nature of prosegment inhibition in vitro. With respect to the mammalian PCs, there have been several studies involving prosegment inhibitionin vitro. Anderson et al. (
      • Anderson E.D.
      • Van Slyke J.K.
      • Thulin C.D.
      • Jean F.
      • Thomas G.
      ) showed that a bacterially expressed furin prosegment potently (K i∼14 nm) inhibited this enzyme in trans at an equimolar ratio. A more detailed kinetic study (
      • Boudreault A.
      • Gauthier D.
      • Lazure C.
      ) confirmed that, similar to subtilisins, an extended prosegment of PC1 purified from Sf9 insect cells acted as a slow, tight-binding inhibitor of both PC1 and furin but not of PC2. In a preliminary study, Basaket al. (
      • Basak A.
      • Gauthier D.
      • Seidah N.G.
      • Lazure C.
      ), using synthetic peptides based on the prosegment of PC1, observed differential inhibition of PC1 and furin. Moreover, the authors established that the region most effective for inhibition resides within the C-terminal 34 amino acids of the PC1-prosegment, with the C-terminal dibasic Lys-Arg residues being critical.
      The data presented here on the inhibition of PCs by prosegmentsin vitro confirm and extend previous observations. Using full-length prosegments of furin (pFurin) and PC7 (pPC7) purified from bacterial lysates, we demonstrate differential inhibition of the activity (hydrolysis of the synthetic fluorogenic peptide pERTKR-MCA) of five distinct soluble PC preparations (Fig. 3). As expected, pPC7 is most inhibitory toward its parent enzyme (Table I). These findings suggest that the structural conformation of pPC7 imparts considerable specificity to this polypeptide as a PC inhibitor. As seen in Fig. 3, this selectivity is powerful enough to inhibit ∼90% of the activity of PC7 but only 10% of the activity of furin, laying the foundation for the possibility of developing even more specific inhibitors.
      Identical experiments using pFurin reveal that it is less effective against PC7, PACE4, and kexin than against its parent enzyme. This selectivity also holds true for a large, biological substrate. Thus, the processing in vitro of HIV gp160 by furin (Fig. 2) is only partially inhibited by 300 nm pPC7, whereas 25 nm pFurin causes full inhibition (a difference of at least 10-fold). Surprisingly, pFurin inhibits PC5 approximately 10-fold better (IC50 value) than furin (Table I). Previous cellular expression studies have demonstrated that both furin and PC5 can effect similar processing of the precursors of Mullerian inhibiting substance in testicular Sertoli cells (
      • Nachtigal M.W.
      • Ingraham H.A.
      ), the receptor PTPμ in endothelial cells (
      • Campan M.
      • Yoshizumi M.
      • Seidah N.G.
      • Lee M.E.
      • Bianchi C.
      • Haber E.
      ), and gp160 in LoVo cells (
      • Vollenweider F.
      • Benjannet S.
      • Decroly E.
      • Savaria D.
      • Lazure C.
      • Thomas G.
      • Chrétien M.
      • Seidah N.G.
      ). Also, in vitrodata regarding the processing of gp160 (
      • Decroly E.
      • Wouters S.
      • Dibello C.
      • Lazure C.
      • Ruysschaert J.M.
      • Seidah N.G.
      ), the α5, αv, and α6 integrin chains
      J.-C. Lissitzky, J. Luis, J. S. Munzer, S. Benjannet, F. Parat, M. Chrétien, J. Marraldi, and N. G. Seidah, submitted for publication.
      inhibition by the serpin α1-PDX (
      • Jean F.
      • Stella K.
      • Thomas L.
      • Liu G.
      • Xiang Y.
      • Reason A.J.
      • Thomas G.
      ), and K m values for the fluorogenic peptide substrate pERTKR-MCA
      S. Munzer and N. G. Seidah, unpublished results.
      all suggest similar and probably overlapping substrate cleavage abilities of furin and PC5. Moreover, homology alignments of the prosegment of furin with that of other PCs show that it is 58% identical to that of PC5 (
      • Seidah N.G.
      • Mbikay M.
      • Marcinkiewicz M.
      • Chrétien M.
      ). Taken together, these findings argue considerable functional and probably structural similarity (within the catalytic subsites) between furin and PC5. Since specific active site titrants for PCs are not available, assays were carried out with equal amounts of pERTKR-AMC-hydrolyzing activities. Thus, we cannot rule out variations in IC50 values caused by differences in the amounts of active enzyme in these experiments. We also point out, however, that the rank order of inhibition using synthetic peptides derived from pPC7 (Fig. 4) and pFurin (not shown) is different from that of the full-length prosegments (Table I), suggesting that the latter contain additional structural determinants modulating PC inhibition.
      The peptide truncation series (Table II) shows clearly that most of the inhibitory potency of pFurin and pPC7 resides in the 10 aa preceding the prosegment primary cleavage site. According to NMR analyses of pPC7 peptides
      S. Bhattacharjya, P. Xu, M. Zhong, M. Chrétien, N. G. Seidah, and F. Ni, in preparation.
      and secondary structure predictions of pFurin (
      • Siezen R.J.
      • Leunissen J.A.M.
      • Shinde U.
      ), these residues, with the exception of the last pair of basic residues, are part of an amphiphilic α-helix. This combination of a common structure and conserved aa within this C-terminal region of the prosegments probably explains their similar nanomolar inhibitory potencies. Although these observations may explain minor discrepancies in the selectivity of inhibition, major ones (e.g. pPC7 inhibition of kexin) presumably must take into account differences in enzyme structure. Finally, P1 Arg to Ala mutants demonstrated that this C-terminal residue is crucial for the inhibitory potency of these peptides (TableII). A similar finding was also confirmed using carboxypeptidase B-digested peptides (not shown). These effects of carboxypeptidases are reminiscent of the overall decrease in endopeptidase activity infat/fat mice lacking carboxypeptidase E (
      • Fricker L.D.
      • Berman Y.L.
      • Leiter E.H.
      • Devi L.A.
      ), suggesting that the removal of C-terminal basic residues is essential for maximal convertase activity.
      Although peptides derived from other regions of pFurin or pPC7 were ineffective as inhibitors, they nonetheless appear to play some role in the inhibitory potency of the full-length prosegment. For example, comparing the IC50 values of the full-length prosegments with those of the C-24 peptides reveals a difference of 40–70-fold. Also, removal of the N-terminal 17 aa of pPC7 resulted in a substantial decrease in the inhibitory potency of this polypeptide (not shown). These findings argue that regions of multiple interfacial contacts between the full-length prosegment and proteinase domains are involved in the inhibitory process. Interestingly, we found no convincing evidence that Fur-M15, the pFurin peptide encompassing the secondary processing site, plays a significant role in inhibition (Table II). Moreover, mixing the furin M-15 and C-24 peptides did not change the inhibitory nature of the latter (not shown). Hence, although cleavage at this secondary site occurs in cells, the exact nature of its pH-dependent interaction with furin (
      • Anderson E.D.
      • Van Slyke J.K.
      • Thulin C.D.
      • Jean F.
      • Thomas G.
      ) remains to be determined.
      We next turned our attention to the question of whether the prosegments, expressed as independent domains, can act intrans to inhibit intracellular furin and PC7. Successful inhibition would require not only that these polypeptides enter the secretory pathway but also that they remain there long enough to interact with the mature target PC (i.e. most likely within the TGN). Current evidence suggests that a polypeptide must have a minimum size of at least 50 aa in order to be recognized by the signal recognition particle and threaded through the membrane of the ER (
      • Ibrahimi I.M.
      • Cutler D.
      • Stueber D.
      • Bujard H.
      ,
      • Okun M.M.
      • Eskridge E.M.
      • Shields D.
      ). In agreement with this hypothesis, a 64-aa long prepropeptide derived from frog skin is the smallest known to date (
      • Hoffmann W.
      • Richter K.
      • Kreil G.
      ). Including their signal peptides, the preprosegments of furin (ppFurin) and PC7 (ppPC7) contain 107 and 140 aa, respectively (
      • Seidah N.G.
      • Day R.
      • Marcinkiewicz M.
      • Chrétien M.
      ). To test whether these prosegments can independently enter the secretory pathway, we produced antisera specific for each of the prosegments (Fig. 5). Overexpression of either ppFurin or ppPC7 using vaccinia virus infection of BSC40 or AtT20 cells revealed that the former loses its signal peptide very slowly (Fig. 5) and that only pPC7 is secreted into the medium (not shown). We interpreted these data to mean that the independently expressed prosegments were reasonably stable within the secretory pathway and, at least in the case of PC7, were able to pass through it intact. In order to test the ex vivo inhibitory function of these polypeptides, we examined the processing of pro-NGF to NGF in Schwann cells infected with wild-type or prosegments vaccinia virus constructs. As seen in Fig. 6, ppFurin significantly inhibits the maturation of this neurotrophin, which is known to occur in the TGN and be best carried out by furin (
      • Seidah N.G.
      • Benjannet S.
      • Pareek S.
      • Savaria D.
      • Hamelin J.
      • Goulet B.
      • Laliberte J.
      • Lazure C.
      • Chrétien M.
      • Murphy R.A.
      ). In fact, it is nearly as effective as the serpin α1-PDX, which was included as a positive control, having been shown previously to be a potent inhibitor of the pro-NGF to NGF conversion (
      • Anderson E.D.
      • Thomas L.
      • Hayflick J.S.
      • Thomas G.
      ). In contrast, ppPC7 has only a slight inhibitory effect (Fig. 6). Although PC7 is expressed in Schwann cells (
      • Marcinkiewicz M.
      • Savaria D.
      • Marcinkiewicz J.
      ), it is a poor effector of pro-NGF maturation.5 Thus, the mild inhibition seen in this experiment is most likely due to cross-reactivity between pPC7 and furin (see Table I).
      The processing of pro-BDNF to BDNF represents another well characterized neurotrophin maturation event on which to test the inhibitory potency of our preprosegment constructs (
      • Basak A.
      • Ernst B.
      • Brewer D.
      • Seidah N.G.
      • Munzer J.S.
      • Lazure C.
      • Lajoie G.A.
      ). In these experiments, cellular co-expression of ppFurin and pro-BDNF via transient transfection in COS-1 cells completely inhibits the production of the 14-kDa BDNF (Fig. 7). Transfection with the ppPC7 polypeptide was noticeably less effective, again demonstrating the selective nature of these preprosegments as ex vivoinhibitors. Even though PC7 is expressed in COS-1 cells (
      • Seidah N.G.
      • Hamelin J.
      • Mamarbachi M.
      • Dong W.
      • Tardos H.
      • Mbikay M.
      • Chrétien M.
      • Day R.
      ), it is a poor effector of pro-BDNF maturation in this system.5 Thus, we presume that the inhibition seen in this experiment is also due to cross-reactivity between pPC7 and furin. Interestingly, the antisense preprosegment constructs employed as controls in this experiment were not significantly inhibitory. This is of interest in view of the reported use of antisense full-length furin for the down-regulation of its expression (
      • Liu B.
      • Amizuka N.
      • Goltzman D.
      • Rabbani S.A.
      ). We conclude from these data that the PC preprosegments tested here selectively inhibit the maturation of pro-BDNF by furin-like enzymes. These events likely occur in the TGN, where the processing of neurotrophins in constitutively secreting cells has been localized (
      • Seidah N.G.
      • Benjannet S.
      • Pareek S.
      • Savaria D.
      • Hamelin J.
      • Goulet B.
      • Laliberte J.
      • Lazure C.
      • Chrétien M.
      • Murphy R.A.
      ,
      • Seidah N.G.
      • Benjannet S.
      • Pareek S.
      • Chrétien M.
      • Murphy R.A.
      ).
      In conclusion, this work on the inhibitory properties of PC prosegments provides the first evidence that these polypeptides can be used to inhibit the cellular processing of precursors ex vivo. This technology represents a novel enzyme silencing strategy that will enhance our understanding of the basic cellular functions of these proteinases. Future work will involve improving the performance of these prosegments using site-directed mutagenesis, leading to the design of more selective and powerful convertase inhibitors that may provide novel approaches to the treatment of a variety of pathologies including proliferative, microbial, and viral diseases (
      • Chrétien M.
      • Mbikay M.
      • Gaspar L.
      • Seidah N.G.
      ).

      Acknowledgments

      We thank J. Rochemont, A. M. Mamarbachi, J. Hamelin, A. Lemieux, D. Gauthier, and A. Chen for their technical help throughout this study. We also thank Dr. F. Ni for providing the PC7 N-20, M-18, C-18, and C-24 peptides and furin M-15, C-24 peptides, and Dr. Claude Lazure for help throughout this work including protein sequencing and amino acid analysis. The secretarial assistance of S. Emond and the help of Dr. J. Cromlish for critical reading of the manuscript are greatly appreciated.

      REFERENCES

        • Seidah N.G.
        • Day R.
        • Marcinkiewicz M.
        • Chrétien M.
        Ann. N. Y. Acad. Sci. 1998; 839: 9-24
        • Steiner D.F.
        Curr. Opin. Chem. Biol. 1998; 2: 31-39
        • Seidah N.G.
        • Mbikay M.
        • Marcinkiewicz M.
        • Chrétien M.
        Hook V.Y.H. Proteolytic and Cellular Mechanisms in Prohormone and Neuropeptide Precursor Processing. R. G. Landes Co., Georgetown, TX1998: 49-76
        • Seidah N.G.
        • Chrétien M.
        Curr. Opin. Biotechnol. 1997; 8: 602-607
        • Nakayama K.
        Biochem. J. 1997; 327: 625-635
        • Seidah N.G.
        • Mowla S.J.
        • Hamelin J.
        • Mamarbachi A.M.
        • Benjannet S.
        • Toure B.B.
        • Basak A.
        • Munzer J.S.
        • Marcinkiewicz J.
        • Zhong M.
        • Barale J.C.
        • Lazure C.
        • Murphy R.A.
        • Chrétien M.
        • Marcinkiewicz M.
        Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1321-1326
        • Siezen R.J.
        • Leunissen J.A. M
        Protein Sci. 1997; 6: 501-523
        • Sakai J.
        • Rawson R.B.
        • Espenshade P.J.
        • Cheng D.
        • Seegmiller A.C.
        • Goldstein J.L.
        • Brown M.S.
        Mol. Cell. 1998; 2: 505-514
        • Khan A.R.
        • James M.N.
        Protein Sci. 1998; 7: 815-836
        • Shinde U.
        • Li Y.
        • Inouye M.
        Shinde U. Inouye M. Intramolecular Chaperones and Protein Folding. R. G. Landes Co., Austin, TX1995: 1-34
        • Seidah N.G.
        Shinde U. Inouye M. Intramolecular Chaperones and Protein Folding. R. G. Landes Co., Austin, TX1995: 181-203
        • Anderson E.D.
        • Van Slyke J.K.
        • Thulin C.D.
        • Jean F.
        • Thomas G.
        EMBO J. 1997; 16: 1508-1518
        • Boudreault A.
        • Gauthier D.
        • Lazure C.
        J. Biol. Chem. 1998; 273: 31574-31580
        • Powner D.
        • Davey J.
        Mol. Cell. Biol. 1998; 18: 400-408
        • Creemers J.W.M.
        • Vey M.
        • Schafer W.
        • Ayoubi T.A.Y.
        • Roebroke A.J.M.
        • Klenk H.D.
        • Garten W.
        • Van de Ven W.J.M.
        J. Biol. Chem. 1995; 270: 2695-2702
        • Zhong M.
        • Benjannet S.
        • Lazure C.
        • Munzer S.
        • Seidah N.G.
        FEBS Lett. 1996; 396: 31-36
        • Zhou A.
        • Paquet L.
        • Mains R.E.
        J. Biol. Chem. 1995; 270: 21509-21516
        • Lei Y.
        • Xin X.
        • Morgan D.
        • Pintar J.E.
        • Fricker L.D.
        DNA Cell Biol. 1999; 18: 175-185
        • Molloy S.S.
        • Thomas L.
        • Vanslyke J.K.
        • Stenberg P.E.
        • Thomas G.
        EMBO J. 1994; 13: 18-33
        • Seidah N.G.
        • Hamelin J.
        • Mamarbachi M.
        • Dong W.
        • Tardos H.
        • Mbikay M.
        • Chrétien M.
        • Day R.
        Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 3388-3393
        • Munzer J.S.
        • Basak A.
        • Zhong M.
        • Mamarbachi A.
        • Hamelin J.
        • Savaria D.
        • Lazure C.
        • Benjannet S.
        • Chrétien M.
        • Seidah N.G.
        J. Biol. Chem. 1997; 272: 19672-19681
        • van de Loo J.W.
        • Creemers J.W.
        • Bright N.A.
        • Young B.D.
        • Roebroek A.J.
        • Van de Ven W.J.
        J. Biol. Chem. 1997; 272: 27116-27123
        • Chrétien M.
        • Mbikay M.
        • Gaspar L.
        • Seidah N.G.
        Proc. Assoc. Am. Physicians. 1995; 107: 47-66
        • Decroly E.
        • Wouters S.
        • Dibello C.
        • Lazure C.
        • Ruysschaert J.M.
        • Seidah N.G.
        J. Biol. Chem. 1996; 271: 30442-30450
        • Decroly E.
        • Benjannet S.
        • Savaria D.
        • Seidah N.G.
        FEBS Lett. 1997; 405: 68-72
        • Hallenberger S.
        • Moulard M.
        • Sordel M.
        • Klenk H.D.
        • Garten W.
        J. Virol. 1997; 71: 1036-1045
        • Volchkov V.E.
        • Feldmann H.
        • Volchkova V.A.
        • Klenk H.D.
        Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5762-5767
        • Abrami L.
        • Fivaz M.
        • Decroly E.
        • Seidah N.G.
        • Jean F.
        • Thomas G.
        • Leppla S.H.
        • Buckley J.T.
        • van der Goot F.G.
        J. Biol. Chem. 1998; 273: 32656-32661
        • Klimpel K.R.
        • Molloy S.S.
        • Thomas G.
        • Leppla S.H.
        Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 10277-10281
        • Chiron M.F.
        • Fryling C.M.
        • FitzGerald D.J.
        J. Biol. Chem. 1994; 269: 18167-18176
        • Hallenberger S.
        • Bosh V.
        • Angliker H.
        • Shaw E.
        • Klenk H.D.
        • Garten W.
        Nature. 1992; 360: 358-361
        • Jean F.
        • Boudreault A.
        • Basak A.
        • Seidah N.G.
        • Lazure C.
        J. Biol. Chem. 1995; 270: 19225-19231
        • Decroly E.
        • Vandenbranden M.
        • Ruysschaert J.M.
        • Cogniaux J.
        • Jacob G.S.
        • Howard S.C.
        • Marshall G.
        • Kompelli A.
        • Basak A.
        • Jean F.
        • Lazure C.
        • Benjannet S.
        • Chrétien M.
        • Day R.
        • Seidah N.G.
        J. Biol. Chem. 1994; 269: 12240-12247
        • Jean F.
        • Basak A.
        • DiMaio J.
        • Seidah N.G.
        • Lazure C.
        Biochem. J. 1995; 307: 689-695
        • Apletalina E.
        • Appel J.
        • Lamango N.S.
        • Houghten R.A.
        • Lindberg I.
        J. Biol. Chem. 1998; 273: 26589-26595
        • Anderson E.D.
        • Thomas L.
        • Hayflick J.S.
        • Thomas G.
        J. Biol. Chem. 1993; 268: 24887-24891
        • Benjannet S.
        • Savaria D.
        • Laslop A.
        • Munzer J.S.
        • Chrétien M.
        • Marcinkiewicz M.
        • Seidah N.G.
        J. Biol. Chem. 1997; 272: 26210-26218
        • Jean F.
        • Stella K.
        • Thomas L.
        • Liu G.
        • Xiang Y.
        • Reason A.J.
        • Thomas G.
        Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 7293-7298
        • Rompaey L.V.
        • Ayoubi T.
        • Van De Ven W.
        • Marynen P.
        Biochem. J. 1997; 326: 507-514
        • Dahlen J.R.
        • Jean F.
        • Thomas G.
        • Foster D.C.
        • Kisiel W.
        J. Biol. Chem. 1998; 273: 1851-1854
        • Lu W.Y.
        • Zhang W.L.
        • Molloy S.S.
        • Thomas G.
        • Ryan K.
        • Chiang Y.W.
        • Anderson S.
        • Laskowski Jr., M.
        J. Biol. Chem. 1993; 268: 14583-14585
        • van den Ouweland A.M.
        • van Duijnhoven H.L.
        • Keizer G.D.
        • Dorssers L.C.
        • Van de Ven W.J.M.
        Nucleic Acids Res. 1990; 18: 664
        • Dixon M.
        Biochem. J. 1953; 55: 161-170
        • Cornish-Bowden A.
        Biochem. J. 1974; 137: 143-144
        • Davison A.J.
        • Moss B.
        Nucleic Acids Res. 1990; 18: 4285-4286
        • Marcinkiewicz M.
        • Savaria D.
        • Marcinkiewicz J.
        Mol. Brain Res. 1998; 59: 229-246
        • Seidah N.G.
        • Benjannet S.
        • Pareek S.
        • Savaria D.
        • Hamelin J.
        • Goulet B.
        • Laliberte J.
        • Lazure C.
        • Chrétien M.
        • Murphy R.A.
        Biochem. J. 1996; 314: 951-960
        • Mowla S.J.
        • Pareek S.
        • Farhadi H.F.
        • Petrecca K.
        • Fawcett J.P.
        • Seidah N.G.
        • Morris S.J.
        • Sossin W.S.
        • Murphy R.A.
        J. Neurosci. 1999; 19: 2069-2080
        • Vollenweider F.
        • Benjannet S.
        • Decroly E.
        • Savaria D.
        • Lazure C.
        • Thomas G.
        • Chrétien M.
        • Seidah N.G.
        Biochem. J. 1996; 314: 521-532
        • Basak A.
        • Ernst B.
        • Brewer D.
        • Seidah N.G.
        • Munzer J.S.
        • Lazure C.
        • Lajoie G.A.
        J. Pept. Res. 1997; 49: 596-603
        • Boudreault A.
        • Gauthier D.
        • Rondeau N.
        • Savaria D.
        • Seidah N.G.
        • Chrétien M.
        • Lazure C.
        Protein Expression Purif. 1998; 14: 353-366
        • Seidah N.G.
        • Benjannet S.
        • Pareek S.
        • Chrétien M.
        • Murphy R.A.
        FEBS Lett. 1996; 379: 247-250
        • Power S.D.
        • Adams R.M.
        • Wells J.A.
        Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 3096-3100
        • Sohl J.L.
        • Agard D.A.
        Shinde U. Inouye M. Intramolecular Chaperones and Protein Folding. R. G. Landes Co., Austin, TX1995: 61-83
        • Strausberg S.
        • Alexander P.
        • Wang L.
        • Schwarz F.
        • Bryan P.
        Biochemistry. 1993; 32: 8112-8119
        • Chaudhuri B.
        • Latham S.E.
        • Helliwell S.B.
        • Seeboth P.
        Biochem. Biophys. Res. Commun. 1992; 183: 212-219
        • Basak A.
        • Gauthier D.
        • Seidah N.G.
        • Lazure C.
        Tam J.P. Kaumaya P.T.P. Proceedings of the 15th American Peptide Symposium, June 14–19, 1997, Nashville, TN. Kluwer Academic Publishers, Dordrecht, The Netherlands1999: 676-677
        • Nachtigal M.W.
        • Ingraham H.A.
        Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7711-7716
        • Campan M.
        • Yoshizumi M.
        • Seidah N.G.
        • Lee M.E.
        • Bianchi C.
        • Haber E.
        Biochemistry. 1996; 35: 3797-3802
        • Siezen R.J.
        • Leunissen J.A.M.
        • Shinde U.
        Shinde U. Inouye M. Intramolecular Chaperones and Protein Folding. R. G. Landes Co., Austin, TX1995: 233-256
        • Fricker L.D.
        • Berman Y.L.
        • Leiter E.H.
        • Devi L.A.
        J. Biol. Chem. 1996; 271: 30619-30624
        • Ibrahimi I.M.
        • Cutler D.
        • Stueber D.
        • Bujard H.
        Eur. J. Biochem. 1986; 155: 571-576
        • Okun M.M.
        • Eskridge E.M.
        • Shields D.
        J. Biol. Chem. 1990; 265: 7478-7484
        • Hoffmann W.
        • Richter K.
        • Kreil G.
        EMBO J. 1983; 2: 711-714
        • Liu B.
        • Amizuka N.
        • Goltzman D.
        • Rabbani S.A.
        Int. J. Cancer. 1995; 63: 276-281