Advertisement

A Calmodulin-binding/CGCG Box DNA-binding Protein Family Involved in Multiple Signaling Pathways in Plants*

  • Tianbao Yang
    Affiliations
    From the Laboratory of Plant Molecular Biology and Physiology, Department of Horticulture, Washington State University, Pullman, Washington 99164-6414
    Search for articles by this author
  • Author Footnotes
    B.W. Poovaiah
    Correspondence
    To whom correspondence should be addressed: Laboratory of Plant Molecular Biology and Physiology, Dept. of Horticulture, Washington State University, Pullman, WA 99164-6414. Tel.: 509-335-2487; Fax: 509-335-8690
    Affiliations
    From the Laboratory of Plant Molecular Biology and Physiology, Department of Horticulture, Washington State University, Pullman, Washington 99164-6414
    Search for articles by this author
  • Author Footnotes
    * This work was supported by United States Department of Agriculture Grant 2002-00741, National Science Foundation Grant MCB 96-3033, and National Aeronautics and Space Administration Grant NAG-10-0061.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
    The on-line version of this article (available at http://www.jbc.org ) contains Fig. 1.The nucleotide sequence(s) reported in this paper has been submitted to the GenBank™/EBI Data Bank with accession number(s) AF506697.
      We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467–38473). Here we demonstrate that there is oneNtER1 homolog as well as five related genes inArabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H2O2, and salicylic acid. Hence, they were designated as AtSR1–6 (A rabidopsisthaliana signal-responsive genes). Ca2+/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic α-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants.
      Plants are constantly exposed to a variety of adverse environmental conditions such as temperature extremes, UV light, salt, and pathogen attacks. Thus, plants have to endure these stresses by modulating the expression of specific genes. Regulated gene expression is one of the most complex activities in cells. It involves many transcription factors that contribute to the basal transcription machinery or mediate gene regulation in response to developmental, environmental, or metabolic cues. Based on data from theArabidopsis genome project, it was predicted that there would be more than 1709 transcription factor genes (about 6.7% of total 25,498 genes) that encode proteins with significant similarity to known classes of plant transcription factors classified by conserved DNA-binding domains. However, less than 10% of these factors have been genetically characterized (
      • Arabidopsis
      ).
      Accumulating evidence indicates that Ca2+-mediated signaling is involved in the transduction of physical signals such as temperature, wind, touch, light, and gravity; oxidative signals such as those arising from pathogen attacks; and hormone signals such as ethylene, abscisic acid (ABA),
      The abbreviations used are: ABA, abscisic acid; CaM, calmodulin; MCP, 1-methylcyclopropene; SA, salicylic acid; GFP, green fluorescent protein; RT, reverse transcriptase; oligo, oligonucleotide; SF, subfamilies; MJ, methyl jasmonate.
      1The abbreviations used are: ABA, abscisic acid; CaM, calmodulin; MCP, 1-methylcyclopropene; SA, salicylic acid; GFP, green fluorescent protein; RT, reverse transcriptase; oligo, oligonucleotide; SF, subfamilies; MJ, methyl jasmonate.
      gibberellins, and auxin (
      • Bush D.S.
      ,
      • Trewavas A.J.
      • Malho R.
      ,
      • Bowler C.
      • Fluhr R.
      ,
      • Zhu J.K.
      ,
      • Evans N.H.
      • McAinsh M.R.
      • Hetherington A.M.
      ,
      • Poovaiah B.W.
      • Yang T.
      • Reddy A.S.N.
      ). All these signals have been shown to trigger changes in amplitude or oscillation in cytosolic free Ca2+ level. Recently, the signal-induced nuclear free calcium changes were also observed (
      • Pauly N.
      • Knight M.R.
      • Thuleau P.
      • van der Luit A.H.
      • Moreau M.
      • Trewavas A.J.
      • Ranjeva R.
      • Mazars C.
      ). Free Ca2+ changes are sensed by a number of Ca2+-binding proteins that usually contain a common structural motif, the “EF-hand,” a helix-loop-helix structure (
      • Natalie C.
      • Strynadaka J.
      • Jams M.N.G.
      ). One of the best characterized Ca2+-binding proteins is calmodulin (CaM), a highly conserved and multifunctional regulatory protein in eukaryotes. Its regulatory activities are triggered by its ability to modulate the activity of a certain set of CaM-binding proteins after binding to Ca2+, and thereby generating physiological responses to various stimuli (
      • Poovaiah B.W.
      • Reddy A.S.N.
      ,
      • Roberts D.M.
      • Harmon A.C.
      ,
      • Poovaiah B.W.
      • Reddy A.S.N.
      ,
      • Zielinski R.E.
      ,
      • Reddy A.S.
      ,
      • Snedden W.A.
      • Fromm H.
      ).
      The CaM-regulated basic helix-loop-helix family of transcription factors was reported in mammals, where CaM inhibits the protein-DNA interaction by competing with the DNA-binding domain in certain proteins (
      • Corneliussen B.
      • Holm M.
      • Waltersson Y.
      • Onions J.
      • Hallberg B.
      • Thornell A.
      • Grundstrom T.
      ). In plants, TGA3, a member of a family of basic leucine zipper transcription factors, showed the Ca2+/CaM enhanced-binding activities to C/G box (
      • Szymanski D.B.
      • Liao B.
      • Zielinski R.E.
      ). However, the CaM-binding property of TGA3 was not defined. We cloned and characterized an early ethylene-responsive gene (NtER1) in tobacco that encodes for a CaM-binding protein (
      • Yang T.
      • Poovaiah B.W.
      ). Bouche et al. (
      • Bouche N.
      • Scharlat A.
      • Snedden W.
      • Bouchez D.
      • Fromm H.
      ) reported that a Brassica homolog BnCAMTA is a CaM-binding protein with nonspecific DNA-binding activity. They also showed that one of theArabidopsis homologs (AtCAMTA1) encodes a CaM-binding protein with a transcription activation domain.
      The Arabidopsis genome has one NtER1 homolog (AtSR1) and five related genes (AtSR2–6). Here we report that these six genes exhibit rapid and differential response to environmental stimuli such as UV, extreme temperatures, high salt concentration, and physical wounding; hormones such as ethylene and ABA; and signal elicitors such as methyl jasmonate (MJ), H2O2, and salicylic acid (SA). Furthermore, we demonstrate that calcium/CaM binds to a 23-mer peptide in all AtSRs that corresponds to the CaM-binding region of NtER1. We also show that AtSR1 targets the nucleus and has the specific binding activity to a novel DNA element (A/C/G)CGCG(G/T/C), referred to as “CGCG box.”

      EXPERIMENTAL PROCEDURES

       Plant Materials and Treatments

      Arabidopsis thaliana ecotype Columbia were grown in a 1:1 mixture of soil mix and vermiculite under a 14-h photoperiod/10-h dark at 20–22 °C in a greenhouse or growth room. The 3-week-old seedlings were subjected to various treatments. Temperature stress plants were incubated at 4 or 42 °C; physical wounding leaves were crushed using blunt forceps; UVB plants were exposed to two 15-watt UVB (280–320 nm) lamps (F15T8.UVB 15 watts; UVP Inc.) at a dose of 2 kJ/m2 after an irradiation period of 5 min; salt stress 200 mm NaCl was applied to soil; ethylene and MJ plants were placed in 4-liter sealed jars with 100 ppm C2H4 or 0.2 μmMJ, some plants were treated with 50 ppm MCP for 2 h prior to ethylene treatment; ABA, H2O2, and SA plants were sprayed with 100 μm ABA, 10 mmH2O2, or 400 μm SA in buffer (10 mm Tris-HCl, pH 7.2) with 1% Triton X-100, the control plants were sprayed with the buffer alone. All chemicals were purchased from Sigma. All the treatments were performed at room temperature except the temperature stress treatment. After each treatment, whole plants were collected and immediately frozen in liquid nitrogen and stored at −80 °C until RNA extraction.

       Cloning of AtSR1 cDNA and Gene Construction

      The 5′ end 488 bp of AtSR1 was cloned by PCR from an ArabidopsiscDNA ZAPII expression library using a gene-specific primer (AtSR1-P1, Table I) and T3 primer in the vector. The largest fragment was subcloned into pCR2.1 vector (Invitrogen) and sequenced from both sides. The full coding region ofAtSR1 was cloned by PCR from the library with two gene-specific primers (AtSR1-P2/P3) based on the 5′-cloning results (forward primer) and data base predicted cDNA sequence (reverse primer). The Pfu DNA polymerase (Invitrogen) was used for PCR amplification to maintain a high fidelity of amplification. The amplified fragment was subcloned into pET101 expression vector as described by the manufacturer (Invitrogen) and was sequenced from both sides.
      Table IOligonucleotide sequences
      NameSequences
      AtSR1-P1CCGGTTAAAAGAAGTAGAAACTCTA
      AtSR1-P2ATGGCGGAAGCAAGACGATTCAG
      AtSR1-P3GTGATTTAACTGGTCCACAAAGATGA
      AtSR1-P4ATGCAAAGGACTGAAGACGCGGC
      AtSR1-P5ATGGCGGAAGCAAGACGATTCAG
      AtSR1-P6ACTGGTCCACAAAGATGAGGA
      AtSR1-P7ATCCGGTTAAAAGAAGTAGAAACTC
      AtSR1-P8ATGCAAAGGACTGAAGACGCGGC
      AtSR1-AATGGCGGAAGCAAGACGATTCAG
      AtSR1-BATCAAACATAAAAACAGACCCACTTG
      AtSR2-AGAGTCAGAGAAAGTGATTCCCAGAG
      AtSR2-BATCAGTGTCATCCTGCCAATTAAA
      AtSR3-ACGTCCTTGTACATTACCGTGATACA
      AtSR3-BGCAGATTGGTTATTAAGATCGGTTG
      AtSR4-ACAGACACAGCCTTCTACTTTTGGTT
      AtSR4-BCCAAATAAGGCAAGATCAGTAGCAT
      AtSR5-ACATACTCTTGTAAGCAAGCAACCA
      AtSR5-BGAAGAAACCGAGAATTCAAAAGACA
      AtSR6-AGGAACTCGTACTCAAGTTCGATCA
      AtSR6-BGGTTGGATGAGATTGTTGCTAAT
      AtACT8-AATGAAGATTAAGGTCGTGGC
      AtACT8-BTCCGAGTTTGAAGAGGCTAC
      OS-1CAGGGCTAGTGGATCCC-N30- GGGAGATCTGGAATTCGA
      OS-2TCGAATTCCAGATCTCCC
      OS-3CAGGGCTAGTGGATCCC
      The templates coding the N-terminal and C-terminal deletion mutants ofAtSR1 were produced by PCR amplification from the cDNA with AtSR1-specific primers cloned into the pET101 expression vector (Invitrogen). The primers (Table I) were AtSR1-P2/P1 for C-terminal deletion ΔC-(147–1032), and AtSR1-P4/P3 for ΔN-(1–146). ΔC was fused to the His6 tag in pET101 by C-terminal fusion, and ΔN was inserted to pET101 without fusion with the His6 tag. The nucleotide sequences of the cloned fragments derived by PCR amplification were determined from both sides.

       Preparation of Recombinant Proteins and CaM Binding Assay

      AtSR1 and deletion mutants were expressed inEscherichia coli strain BL21(DE3) pLysS. The recombinant AtSR1 and ΔN were extracted and purified with CaM-Sepharose column (Amersham Biosciences) essentially as described (
      • Yang T.
      • Poovaiah B.W.
      ), and the recombinant ΔC was purified with HisTrap column as described by manufacturer (Amersham Biosciences). The amount of protein was estimated by the method of Bradford using a protein assay kit (Bio-Rad). The proteins were separated by SDS-PAGE, electrotransfered onto polyvinylidene difluoride membrane (Millipore), and incubated with35S-labeled recombinant CaM with 0.1 mmCaCl2 or 0.5 mm EGTA as described (
      • Yang T.
      • Poovaiah B.W.
      ). The membrane was washed with 25 mm Tris-HCl, pH 7.5, and either 0.1 mm CaCl2 or 0.5 mm EGTA, or 0.5 mm MgCl2, and then exposed to x-ray film overnight.

       Gel Mobility Shift Assay

      The synthetic peptides were prepared using an Applied Biosystems peptide synthesizer 431A in the Laboratory of Bioanalysis and Biotechnology, Washington State University. Samples containing 240 pmol (4 μg) of bovine CaM (Sigma) and differing amounts of purified synthetic peptides in 100 mm Tris-HCl, pH 7.2, and either 0.1 mmCaCl2 or 0.5 mm EGTA in a total volume of 30 μl were incubated for 1 h at room temperature. The samples were analyzed by nondenaturing PAGE as described (
      • Yang T.
      • Poovaiah B.W.
      ).

       Transient Transformation Assays with GFP Fusion Constructs

      The full-length AtSR1 or ΔC-(147–1032) or ΔN-(1–146) were amplified by PCR amplification withPfu DNA polymerase using the gene-specific primers listed in Table I. The primers were AtSR1-P5/6 for AtSR1, AtSR1-P5/7for ΔC, and AtSR1-P8/6 for ΔN. In the 5′ of each primer, an adaptor sequence of GTCTAGCGGATCC was added to create an artificialBamHI site. The 3′ was created in-frame fusion with the GFP reading frame. The amplified fragments were subcloned into the pBluescript KS vector, and the DNA was sequenced from both sides for verification. These plasmids were digested with BamHI and ligated with the BamHI-digested psmGFP, which has aBamHI site between cauliflower mosaic virus 35S promoter and GFP (
      • Davis S.J.
      • Vierstra R.D.
      ). psmGFP was used as a control. GFP expression was monitored by a transient assay using leaves of 3-week-oldArabidopsis seedlings. Plasmid DNA was introduced by particle bombardment using the method described by Christou (
      • Christou P.
      ). Seven-μm gold spheres were coated with plasmid DNA and accelerated by a 7-kV discharge toward the leaves placed on agar Petri plates. After bombardment, the leaves were kept in the dark for 24 h prior to confocal microscopic examination. The images were processed using a Bio-Rad MRC 1024 confocal laser scanning system with a Nikon microscope. The leaves were directly examined on a glass slide using argon laser (488 nm) for green fluorescence.

       Preparation of Nuclear Proteins

      Nuclear protein extracts were prepared from 3-week-old Arabidopsis plants after the wounding treatment for 4 h or control plants that grew in normal conditions. Nuclear proteins were extracted from harvested samples (30 g) following protocol described by Green et al. (
      • Green P.J.
      • Kay S.A.
      • Chua N.H.
      ). The nuclear proteins were further purified with CaM-Sepharose column (Amersham Biosciences) according to Yang and Poovaiah (
      • Yang T.
      • Poovaiah B.W.
      ).
      The purified nuclear proteins as well as the recombinant proteins were dialyzed and concentrated with Centricon YM-50 or YM-10 (Millipore) against a nuclear extraction buffer (25 mm HEPES/KOH, pH 7.5, 40 mm KCl, 0.1 mm EDTA, 10% glycerol, 1 mm dithiothreitol, and 30 μg/ml phenylmethylsulfonyl fluoride) at 4 °C before gel retardation assays.

       Gel Retardation Assays

      The oligo selection procedure was performed as described by Wang et al. (
      • Wang Z.
      • Yang P.
      • Fan B.
      • Chen Z.
      ). Briefly, a pool of double-stranded random oligo molecules was labeled by primed synthesis of the random oligo OS-1 using the OS-2 primer (Table I). The labeled probe was purified by 8% non-denaturing PAGE. After gel retardation assays, the retarded DNA was eluted and labeled by PCR amplification using the OS-3 primer (Table I). The amplified probe was purified by electrophoresis and used as a probe for the next round of selection with gel retardation assays. All other probes were labeled by primed synthesis of the synthesized oligos (containing an OS-2 complementary adaptor sequence in 3′) using the OS-2 primer. The labeled probes were purified by electrophoresis.
      DNA binding assays were performed in a 20-μl reaction mixture containing 25 mm HEPES/KOH, pH 7.5, 40 mm KCl, 0.1 mm EDTA, 10% glycerol, 1 mmdithiothreitol, 5 μg/ml antipain, and 5 μg/ml leupeptin, 5 μg of poly(dI-dC), 3 μg of recombinant proteins or 20 μg of nuclear proteins or 2 μg of CaM-binding nuclear proteins and 1–2 ng of labeled double-stranded DNA fragments (
      • Wang Z.
      • Yang P.
      • Fan B.
      • Chen Z.
      ). DNA-protein complexes were allowed to form at room temperature for 20 min and were separated on a 10% PAGE gel in 0.5× TBE at 4 °C.

       RNA Extraction and RT-PCR

      RNA isolation was performed as described previously by Yang and Poovaiah (
      • Yang T.
      • Poovaiah B.W.
      ). RT-PCR analysis was performed using gene-specific primers, which were designed from the least conserved regions in the central portion of each of theAtSR genes except AtSR1. Instead, the gene-specific primers for AtSR1 were designed from the 5′-region where the differences were observed between this study and the GenBankTM prediction. The forward/reverse primers are as follows: AtSR1-A/B, AtSR2-A/B, AtSR-3A/B, AtSR4-A/B, AtSR5-A/B, and AtSR6-A/B. The actin 8 gene (AtACT8) was used as a positive internal control. The PCR primers for detection of AtACT8mRNAs were AtACT8-A/B. All primers are listed in Table I. Two μg of total RNA were treated with 1 unit of RNase-free DNase (Invitrogen) for 10 min at 37 °C followed by 5 min at 90 °C to inactivate the DNase. The reverse transcription was carried out using 0.5 μg of oligo(dT)15 as a primer in a 20-μl reaction mixture as described by the manufacturer (Invitrogen). The PCR was performed in a 25-μl reaction mixture containing 1 μl of reverse-transcribed cDNA as the template, two gene-specific primers (0.5 μm each), and 1.5 mm MgCl2. To maintain the amplification of the internal control and AtSRs within the exponential phase, the number of PCR cycles was adjusted to 25 cycles for AtACT8 and 34 cycles for all AtSR genes or otherwise indicated. The PCR products for each pair of primers were subcloned into pCR2.1 (Invitrogen) and sequenced first time to confirm the specificity of PCR amplification. The experiments were repeated three times. The amplified PCR products (9 μl) were electrophoresed on a 1.5% (w/v) agarose gel, stained with ethidium bromide, and scanned using an image analyzer.

       Real Time PCR

      The Real Time quantitative PCR was performed in the PE Biosystems GeneAmp 5700 sequence detection system using the SYBR green detection as recommended by the manufacturer. Each reaction (25 μl) contained 2.5 μl of the 10× SYBR green buffer; 200 nm dATP, dGTP, and dCTP; 400 nmdUTP; 2 mm MgCl2; 0.625 units of Amplitaq Gold DNA polymerase; 250 nm forward and reverse primers (listed in Table I), and 1 μl of the cDNA from reverse transcription.AtACT8 was used as an internal control. The reactions were performed in a MicroAmp 96-well plate capped with MicroAmp optical caps. The reaction mixtures were incubated at 95 °C for 5 min, and followed by 40 cycles of 15 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C. The data generated from the SYBR green detection were analyzed as described by Schmittgen et al. (
      • Schmittgen T.D.
      • Zakrajsek B.A.
      • Mills A.G.
      • Gorn V.
      • Singer M.J.
      • Reed M.W.
      ). Briefly, we used ΔΔC t method, in which the end point C t is defined as the PCR cycle number that crosses an arbitrarily placed signal threshold. The fold change of the gene expression was calculated by 2−(ΔΔCt), where ΔΔC t = (C tAtSRs −C tAtACT8)timeX − (C tAtSRs −C tAtACT8)time0.

       Accession Numbers

      GenBankTM accession numbers for the genes are as follows: AF506697 (AtSR1), AF253511(NtER1), AF096260 (LeER66), AF303397(EICBP), S48041 (parsley CG-1), AU174776 (rice EST), BF278589 (cotton EST), AV835190 (barley EST), BE341351 (Sorghum EST), BE341351 (potato EST), BAA74856 (human1, KIAA0833),BAA74932 (human2, KIAA0909), and AAM10969 (Brassica BnCAMTA).

      RESULTS

       Structure of AtSRs

      The Arabidopsis data base was searched using NtER1 amino acid sequences. One NtER1 homolog (AtSR1) and five related proteins (AtSR2–6) were found in theArabidopsis genome, with gene identification numbers At2g22300, At5g09410, At3g16940, At5g64220, At1g67310, At4g16150, respectively. Based on the alignment of the amino acid sequences of AtSR1–6, some variations were observed in the N-terminal portions of AtSR1 and AtSR6, whereas AtSR2–5 showed higher similarity to each other (see Fig. 1 in the Supplemental Material). To verify the cDNA sequence of AtSR1, a gene-specific primer (AtSR1-P1) and T3 primer in the vector were used to clone the 5′ region of AtSR1. The longest DNA fragment (∼490 bp) was subcloned, and DNA sequencing revealed that the first 54 amino acids in AtSR1 were different from the prediction in GenBankTM but showed a linear similarity with other AtSRs N-terminal regions (see Fig. 1 in the Supplemental Material). Comparison of AtSR1 cDNA sequences with the genomic sequence indicated the differences resulted from the different RNA splicing sites in introns 1 and 2 (data not shown). Further cloning of the full cDNA showed that sequences in other region were the same as predicted. Reddy et al. (
      • Reddy A.S.
      • Reddy V.S.
      • Golovkin M.
      ) reported the isolation of a clone (EICBP, a partial cDNA sequence was reported in GenBankTM) which had the same cDNA sequence as the GenBankTM prediction, suggesting this gene could have two types of transcripts. AtSR1 has 3302 nucleotides, and its largest open reading frame encodes a protein composed of 1032 amino acids with a predicted molecular mass of approximately 116 kDa. The predicted AtSR1 is an acidic and hydrophilic protein (pI 5.3) with no obvious membrane-spanning domains, and an overall secondary structure of α-helices. AtSR1 contains several noteworthy structural features as follows: 1) N-terminal 62–79 has a typical bipartite nuclear targeting signal (
      • Schwechheimer C.
      • Zourelidou M.
      • Bevan M.W.
      ); 2) C-terminal 900–922 has an almost identical amino acid sequence as the characterized CaM-binding region in NtER1 (
      • Yang T.
      • Poovaiah B.W.
      ); 3) the central portion 661–726 has two ankyrin-like repeats which is a motif known to be responsible for mediating protein-protein interactions (
      • Sedgwick S.G.
      • Smerdon S.J.
      ); 4) the C-terminal 853–896 has two IQ motifs, which is a CaM-binding motif in many proteins (
      • Bahler M.
      • Rhoads A.
      ); and 5) the C-terminal 1003–1019 has an acidic domain with 11 acidic amino acids.
      The amino acid sequences of AtSR6 were corrected based on the reported EST (GenBankTM accession number T04795) (see Fig. 1 in the Supplemental Material). AtSR2–6 had predicted lengths ranging from 852 (AtSR3) to 1035 amino acids (AtSR5) with pI values of 5.2–8. Overall similarity among six homologs ranges between 43 and 78%. They shared very high similarity in the N-terminal portion and in the C-terminal portions but not in the central portions (see Fig. 1 in the Supplemental Material). In the C terminus, all six AtSRs and NtER1 showed over 75% similarity and 65% identity, especially in the CaM-binding region with greater than 90% similarity and 79% identity. In the N-terminal portions, AtSR1–6 had over 66% similarity and 50% identity. Similar to AtSR1, AtSR2–5 have a predicted nuclear targeting signal sequence in the N terminus, one or two ankyrin repeat(s) in the center portion (except AtSR6), and more than two IQ motifs around the CaM-binding region.
      All six AtSRs have just one copy each in theArabidopsis genome. Five Arabidopsis chromosomes have one AtSR gene each, except chromosome 5 which has two, separated by about 20,000 kb. Phylogenetic analysis revealed that AtSR1–6 could be grouped into four subfamilies (SF); SF1 (AtSR1), SF2 (AtSR2, 4), SF3 (AtSR 3, 6), and SF4 (AtSR5) (data not shown). The overall conserved structure of all the AtSRs suggests that they may diverge from a single ancestral origin. AtSR2 and -4 share the highest similarity and are both located on chromosome 5, which suggests that they evolved by gene duplication most recently.

       AtSRs Are CaM-binding Proteins

      Fig. 1 A shows the alignment of the CaM-binding region of AtSR1 with other AtSRs, tobacco NtER1 and tomato LeER66. The predicted CaM-binding domains (23 amino acids) corresponding to the NtER1 CaM-binding region are highly conserved. For example, AtSR1 has only two conserved amino acid sequence substitutions as compared with the counterpart of NtER1 in this portion (amino acids 900–922). Helical wheel projection in GCG 10 (version 10 of the GCG program) revealed that AtSR1–6 had the basic amphiphilic α-helix structure (data not shown), a typical secondary structure for most characterized CaM-binding proteins (
      • Yang T.
      • Poovaiah B.W.
      ,
      • O'Neil K.T.
      • DeGrado W.F.
      ,
      • Yang T.
      • Poovaiah B.W.
      ). To determine that the AtSRs are CaM-binding proteins, the full-length AtSR1 and two truncated constructs were expressed inE. coli. The ΔC-(147–1032) was fused to a His tag in the C terminus and was purified by His-Trap column chromatography. The full-length and ΔN-(1–147) recombinant proteins were purified by a CaM-Sepharose column. The recombinant proteins were then subjected to a CaM binding assay. The results revealed that CaM binds to both AtSR1 and ΔN, but not ΔC, in the presence of 0.1 mmCaCl2 (Fig. 1 B). No CaM binding was observed for all proteins when 0.1 mm CaCl2 was replaced by either 0.5 mm calcium chelator EGTA (Fig. 1 B) or other divalent ions such as 0.5 mm MgCl2 (data not shown). Therefore, CaM binding to AtSR1 was Ca2+-dependent, and the CaM-binding region was within the C-terminal residues 147–1032. Furthermore, four peptides (representing four SFs) corresponding to the putative CaM-binding domains of AtSR1,2,3,5 were synthesized. Gel mobility shift assays revealed that CaM bound to all of them in a Ca2+-dependent manner. Two examples (AtSR1 and AtSR3) are shown in Fig. 1 C. These results indicated that AtSR1–6 were all Ca2+-dependent CaM-binding proteins. Because many IQ motifs were CaM-binding domains, the peptides corresponding to the two IQ motifs of AtSR1 were used for the mobility shift assay. CaM did not bind to these two peptides, either in the presence of CaCl2 or EGTA (data not shown).
      Figure thumbnail gr1
      Figure 1AtSRs are calcium-dependent CaM-binding proteins. A, alignment of amino acid sequences of AtSR1–6 and tobacco NtER1 and tomato LeER66 in the C-terminal portion. The putative CaM-binding domain isunderlined by a thick solid line, and the acidic domain is underlined by a dashed line. The predicted IQ motifs are underlined by dotted lines, and the ankyrin repeats are underlined bysolid lines. B, the recombinant wild type AtSR1 (WT), and two deletion mutants ΔN-(1–146) and ΔC-(147–1032) were subjected to a CaM binding assay. C, gel mobility shift assay showing CaM binding to two 23-mer peptides corresponding to amino acids 900–922 of AtSR1 and 755–777 of AtSR3, respectively.

       AtSR1 Targets the Nucleus

      A search of GenBankTM revealed that several partial clones from both dicots and monocots had over 66% similarity and 50% identity with AtSRs N-terminal portion (AtSR1, amino acids 13–134). These plants included parsley, potato, cotton, rice, barley and sorghum. This portion also showed over 56.6% similarity and 42.4% identity with two predicted proteins, KIAA0833 and KIAA0909, based on cDNA isolated from adult human brains. Alignment of these sequences indicated that they had the similar secondary structure with several predicated α-helices and two β-sheets, as well as several positive charged amino acids (more than 10 net positive charges) in this portion. In particular, they all have conserved bipartite nuclear localization signals (AtSR1, amino acids 62–79).
      We further selected AtSR1 for detailed studies on its subcellular localization by making the full-length of AtSR1, ΔN-(1–146) and ΔC-(147–1032) with GFP fusion constructs. Transient transformation into Arabidopsis leaves was performed by DNA bombardment, and the image was analyzed 24 h after transformation using a confocal microscope. The green fluorescence was throughout the cytoplasm for the GFP control construct. However, both AtSR1:GFP fusion and ΔC:GFP fusion predominantly were localized to the nucleus. In contrast, the ΔN:GFP fusion was visualized as patches in the cytoplasm (Fig. 2). Thus AtSR1 targets nuclei, and the nuclear localization signals are within N-terminal 146 amino acids. Furthermore, the fact that all other AtSRs and related proteins have conserved bipartite nuclear localization signals suggests that they all are nuclear proteins.
      Figure thumbnail gr2
      Figure 2Subcellular distribution of green fluorescence within transformed Arabidopsisleaves. GFP fluorescence was visualized using a confocal microscope, as described under “Experimental Procedures.”

       AtSR1 Recognizes Specific DNA Elements

      Parsley CG-1 (147 amino acids) is a partial clone with high similarity with N-terminal portion of AtSRs. da Costa e Silva (
      • da Costa e Silva O.
      ) reported that parsley CG-1 bound to a DNA fragment CGCGTTTAATCTCCAACAAACCCCTTCTAG in which CGCG was crucial for DNA binding. The gel retardation assay showed that neither full-length AtSR1 nor deletion mutants bound to this DNA fragment (data not shown). In order to test whether the nuclear protein AtSR1 had specific interacting DNA elements, an oligo selection procedure was used with a pool of 30 completely random sequences of oligonucleotides. Because the putative DNA-binding domain was located in the N terminus, the recombinant AtSR1ΔC-(147–1032) was used for gel retardation assays to avoid the potential negative effects of other domains on DNA binding. The poly(dI-dC) was used as a nonspecific competitor. After three rounds of selection, gel-retarded oligo DNA molecules were amplified, and then a library enriched in DNA inserts containing specific sequences recognized by ΔC was established.
      The DNA sequencing revealed that half of the positive clones had a common DNA element of 6-bp ACGCGG (or CCGCGT). However, AtSR1 also bound to other fragments with ACGCGT (30%), CCGCGG (10%), ACGCGC (or GCGCGT) (5%), CCGCGC (or GCGCGG) (5%). They share a consensus sequence CGCG in the middle. Mutations of any nucleotide of CGCG abolished the DNA binding (Fig.3 A). Nonetheless, CGCG alone is not sufficient for DNA binding. The minimum DNA-binding elements are 6-bp CGCG box, (A/C/G)CGCG(C/G/T). Some variations were observed in 1st and 6th nucleotides of CGCG boxes. No T was observed in position 1, and no A was observed in position 6. Substitutions with T in position 1 or with A in position 6 abolished the DNA binding (Fig. 3 A). Note that a faint band with a faster mobility was visualized besides a strong protein-DNA complex band with a slower mobility (Fig.3 A). One possible explanation is that AtSR1ΔC binds to the target DNA fragment with both monomer and dimer (or oligomer) but mainly with dimer (or oligomer).
      Figure thumbnail gr3
      Figure 3AtSR1 recognizes specific DNA elements by a gel retardation assay. A, AtSR1ΔC specifically binds to a novel CGCG box. All probes are listed below. The CGCG box isunderlined, and the mutated nucleotides are inlowercase letters. B, AtSR1 has the specific binding activity similar to ΔC. + indicates that the recombinant protein was added in DNA binding assay; − indicates that no protein was added. C, AtSR1 binds to DNA in a dose-dependent manner. The intensity of the DNA-protein complex correlated with increasing ΔC protein amounts.D, competitive gel retardation assays to detect the binding activities specific to a CGCG box (probe 1). Binding reactions contained a molar excess (10- and 100-fold) of competitor DNA: 1, CGCG fragment (unlabeled probe 1); 6, CGCG mutant (unlabeled probe 6); −, no competitor. E, recognition of CGCG cis-elements of phytochrome A (phyA), ethylene-insensitive gene 3 (EIN3), and calmodulin 2 (CaM2). The probes corresponding to three promoters are listed at right. The CGCG boxes areunderlined. The mutated nucleotides are in lowercase letters. The dashes indicate sequences identical to the wild type.
      To determine whether full-length AtSR1 had the same binding specificity as ΔC, the recombinant AtSR1 and ΔN-(1–146) were subjected to gel retardation assays. The results show that AtSR1 had a DNA binding activity to probe 1 similar to ΔC. However, ΔN did not interact with probe 1 (Fig. 3 B), indicating that AtSR1 had only one specific DNA-binding region that was within the N-terminal 146 amino acids. To demonstrate that AtSR1 was in fact the protein present in the mobility-shifted band, the different amounts of ΔC protein were added in reactions with the same amount of probe 1 for gel retardation assay. The DNA-protein complex intensity was correlated with the increasing protein amount. No DNA-protein complex was observed without addition of the protein, confirming the presence of ΔC protein in the complex (Fig. 3 C). The ΔC binding activity to the CGCG box was further demonstrated in competitive gel retardation assays (Fig.3 D). Formation of the DNA-protein complexes between labeled probe 1 and ΔC was subjected to specific competition by wild type CGCG fragments (unlabeled probe 1). However, the mutated CGCG fragments (unlabeled probe 6) were not capable of competing for binding to ΔC (Fig. 3 D). To examine the effect of CaM binding on DNA binding activity, CaCl2, EGTA, CaCl2/CaM, and EGTA/CaM was added in the reactions with full-length AtSR1 and probe 1, respectively. No obvious effect was observed on DNA binding activity by any of them, which suggested that CaM binding had no effect on DNA binding (data not shown).

       Genes with CGCG cis-Elements

      A search of the data base revealed that cis-acting elements ACGCGG/CCGCGT were present in the promoter regions of about 130 genes (more than two copies) in Arabidopsis genome. Some of these genes are listed in Table II. The promoter regions are assumed to be within ∼1 kb upstream of the starting transcription site (for the known genes) or the first ATG (for the predicted genes). These genes are related to ethylene signaling (EIN3) and ABA signaling (a putative ABA responsive protein), light perception (phytochrome A, phyA), stress responsive such as the DNA repairing protein, heat shock protein, touch protein (TCH 4), and CaM-regulated ion channel. CaM genes (CaM2 andCaM3) and AtSR6 also contains CGCGcis-elements in their promoter regions.
      Table IICGCG cis-elements in selected Arabidopsis genes
      GenesGene IDCopies
      Signal perception
      Phytochrome AAt1g095704
      Phospholipase DAt2g420103
      Hormone signaling
      ABA-responsive protein-likeAt5g352503
      Ethylene-insensitive 3 (EIN3)At3g207702
      Protein phosphorylation and dephosphorylation
      Protein kinaseAt2g303602
      Protein phosphatase 2CAt1g091602
      Heat shock protein
      Chaperonin subunitAt3g181902
      Heat shock proteinAt3g323832
      DNA damage and repairing
      DNA repair protein RAD23At1g796502
      Ion channel
      Cyclic nucleotide and CaM-regulated ion  channel proteinAt1g159902
      Calcium-binding proteins
      Calcium-binding proteinAt1g199402
      Calmodulin-related proteinAt1g664002
      Calmodulin 2At2g411102
      Calmodulin 3At3g568002
      Touch gene
      TCH4 proteinAt5g575602
      Transcription factors
      Leucine zipper proteinAt1g070002
      Zinc finger proteinAt3g460702
      AP2 domain transcription factorAt5g670002
      AtSR6At4g161502
      In order to confirm that AtSR1 bound to those promoters in vitro, we selected the promoter regions of EIN3 (from −330 to −295), CaM2 (from −221 to −199), andphyA (from −162 to −104) for gel retardation assays (Fig.3 E). The results revealed that AtSR1 had the specific binding activity to these DNA fragments. However, no binding activities were detected in all CGCG mutants (Fig. 3 E).

       Expression Patterns of AtSRs

      The expression level ofAtSR1–6 is relatively low in plants. By using RT-PCR, the signal was detected around 42 cycles under normal growth conditions, whereas the exponential stage for internal control AtACT8was detected around 25 cycles (Fig. 4). All AtSRs had higher expression in stem and flowers, as well as siliques (except AtSR6) at 6-week stages. This was consistent with the expression pattern of tobacco NtER1 and tomato LeER66. NtER1 was highly expressed in senescent leaves and flowers (
      • Yang T.
      • Poovaiah B.W.
      ), and LeER66 had more expression during fruit ripening (
      • Zegzouti H.
      • Jones B.
      • Frasse P.
      • Marty C.
      • Maitre B.
      • Latch A.
      • Pech J.C.
      • Bouzayen M.
      ). Several AtSRs(AtSR1,3,4) also had a relatively higher expression in 4-day- and 7-day-old seedlings, which suggested that they had some role in early stages of development. However, the expression patterns ofAtSR1–6 differed between other tissues and developmental stages. Generally the roots exhibited a higher expression ofAtSRs than leaves both at the 2-week stage and the 6-week stage, suggesting an important role for AtSRs in root growth and development. AtSR1,2,5,6 were highly expressed in roots at both the 2-week stage and the 6-week stage, whereas theAtSR4 expression was higher at the 6-week stage than the 2-week stage. AtSR5 exhibited the highest expression level in leaves, whereas AtSR6 showed very little expression at both the 2-week stage and the 6-week stage. AtSR4 was barely detected in 2-week-old leaves, but it was highly expressed in leaves at the 6-week stage.
      Figure thumbnail gr4
      Figure 4RT-PCR showing expression pattern ofAtSRs in plant tissues. The PCR cycle is 25 forAtACT8 and 42 for AtSRs.

       Expressions of AtSRs Are Differentially Regulated by Multiple Signals

      Tobacco NtER1 and tomato LeER66were ethylene-responsive genes. To study the effects of ethylene on the expression of AtSRs, 3-week-old seedlings were either treated with ethylene or with 1-methylcyclopropene (MCP) for 2 h prior to ethylene treatment which is known to block ethylene action. Only AtSR1,2,5 responded to ethylene treatment. Treatment with MCP for 2 h prior to ethylene treatment blocked their induction (data not shown), indicating that AtSR1,2,5 were ethylene-responsive genes. The time course of the induction showed that all three AtSRs were induced within 15 min after treatment and reached their peaks after 30 min of treatment. Among these genes,AtSR1 was highly induced as compared withAtSR2,5. Application of MJ showed a similar effect on AtSR induction as ethylene (Fig.5 A).
      Figure thumbnail gr5
      Figure 5The signal-induced expression ofAtSRs. A, expression pattern ofAtSRs in response to ethylene (ET), MJ; ABA, H2O2 and SA; heat, cold, UVB, and a high concentration of NaCl. The PCR cycle for AtACT8 is 25 cycles and others 34 cycles except AtSR2 under ethylene and methyl jasmonate treatment (37 cycles). The duration and concentration of each treatment are indicated at the top. B, real time RT-PCR analysis showing the time course of AtSR1–6expression patterns following wounding. These experiments were repeated three times, and the results are presented with the mean ± S.E.
      To investigate whether AtSRs responded to other signals, plants were subjected to abiotic stresses such as heat, cold, high NaCl concentration, UVB, and wounding, hormone ABA, as well as the signal elicitors H2O2 and SA. In these experiments, plants were exposed to stress conditions for short periods of time (4 h) to avoid possible secondary effects. These stimuli differentially induced the expression of AtSR genes. ABA, H2O2, and SA showed similar patterns by inducing the expression of AtSR3,4,5,6 with no effect onAtSR1,2. Heat shock, cold, and UVB showed a separate pattern of expression by inducing AtSR1,2,3,5,6. However, none of these treatments showed any effect on the expression ofAtSR4. Salt stress also had a similar effect but did not induce the expression of AtSR6 (Fig. 5 A). No amplification were observed for AtSRs in all controls (data not shown)
      Furthermore, the physical wounding induced the expression of all sixAtSRs. The quantitative expression profiles ofAtSR1–6 following wounding were studied using real time RT-PCR. The results showed that the induction level varied among genes significantly. AtSR1,2 showed the fastest and highest induction. Their expression levels were increased by over 80-fold within 2 h. However, the induction of AtSR3,4 were just around 12-fold (Fig. 5 B).

       CaM-binding Nuclear Proteins Bind to CGCG cis-Elements

      To confirm the presence of CGCG box-binding proteins in vivo, nuclear proteins were isolated from wounded leaves. The specific DNA binding activity to the DNA fragment −330 to −295 of EIN3promoter was detected in the total nuclear proteins from wounded plants, but the nuclear proteins from untreated plants showed almost no DNA binding activity (data not shown). No protein-DNA complex was observed when the CGCG mutant was used as a probe. These results indicated that plant leaves contained nuclear CGCG-binding proteins which were induced by wounding. These are consistent with real time RT-PCR analysis which showed that wounding induced the expression of all AtSRs. To investigate whether the CGCG box-binding proteins were CaM-binding proteins, the total nuclear extract from wounded plants was further purified by CaM-Sepharose column. Out of 110 μg of nuclear proteins, about 4 μg of CaM-binding nuclear proteins were purified. The fraction of CaM-binding nuclear proteins was subjected to gel retardation assay. The specific DNA binding activities were dramatically increased for CaM-binding nuclear proteins (data not shown), indicating that CGCG box-binding nuclear proteins in vivo are CaM-binding proteins.

      DISCUSSION

      Earlier we reported that an early ethylene-responsive geneNtER1 in tobacco encodes a CaM-binding protein and suggested that this type of gene exists in other plants, such asArabidopsis and tomato (
      • Yang T.
      • Poovaiah B.W.
      ). Later, anArabidopsis homolog (EICBP) was identified as an ethylene-responsive gene, and calcium/CaM was shown to bind to the recombinant protein (
      • Reddy A.S.
      • Reddy V.S.
      • Golovkin M.
      ). Also, a Brassica homolog BnCAMTA and one of the Arabidopsis homologs (AtCAMTA1) were classified as CaM-binding proteins with nonspecific DNA binding activity (
      • Bouche N.
      • Scharlat A.
      • Snedden W.
      • Bouchez D.
      • Fromm H.
      ). The results described herein show that the sixNtER1 homologs in Arabidopsis (AtSR1–6) are responsive to a variety of stimuli (Fig. 5). Each AtSR has a conserved structural feature with a DNA-binding region (CGCG domain) in the N terminus and a CaM-binding domain in the C terminus. The detailed study of AtSR1 revealed that the CGCG domain (amino acids 1–146 in AtSR1) targets the nucleus and specifically interacts with a novel CGCG box, a 6-bp double-strand DNA element (A/C/G)CGCG(G/T/C) (Figs. 2 and 3). The optimal target sequence for AtSR1 is an ACGCGG (or CCGCGT) element. Further comparisons revealed that the CGCG domain protein is present in other plants, both dicots and monocots. They all have conserved CGCG domains similar to AtSR1, suggesting that they all bind to the CGCG box. However, they may have different target sequence preferences on the nucleotides of positions 1 and 6 in the 6-bp DNA element. For example, the five members of AtERF proteins (Arabidopsisethylene-responsive binding factors) have distinct DNA-binding preferences on the GCC box (
      • Fujimoto S.Y.
      • Ohta M.
      • Usui A.
      • Shinshi H.
      • Ohme-Takagi M.
      ). AtERF1, -2, and -5 appear to be most sensitive to the single-nucleotide substitutions within the GCC box sequence. By contrast, AtERF3 and -4 appear to be more flexible than others with respect to their target sequence preference.
      The DNA-binding domain of AtSR1 does not exhibit similarity with any previously known DNA-binding motifs. However, this CGCG domain is highly conserved among all six members of AtSRs and related proteins in other plants, even sharing some similarity with two human proteins. The structural prediction suggests that this region possesses several α-helices and several basic amino acids (more than 10 net positive charges), which may be good candidates to form a DNA-interaction face. Therefore, the CGCG domain with a specific recognition of the novel CGCG box may represent a novel type of DNA-binding domain present not only in plants but also in humans. However, defining this DNA-binding domain will require further structural analysis of these proteins and DNA-protein interactions.
      Ethylene and ABA are two major plant hormones that affect almost all stages of plant development, such as seed germination, cell fate, fruit ripening, senescence, and abscission. They are also key regulators that mediate the response of a plant to biotic and abiotic stresses (
      • Giraudat J.
      ,
      • Bleecker A.B.
      • Kende H.
      ,
      • Stepanova A.N.
      • Ecker J.R.
      ). Recently, it has been documented that MJ, H2O2, and SA play a role as defense signal molecules. The responses of plants to the environmental stresses such as heat shock, cold, UV, wounding, and high salt or pathogen and insect attacks are often mediated by these hormones and/or signal elicitors (
      • Zhu J.K.
      ,
      • Levine A.
      • Tenhaken R.
      • Dixon R.
      • Lamb C.
      ,
      • Reinbothe S.
      • Mollenhauer B.
      • Reinbothe C.
      ,
      • Green R.
      • Fluhr R.
      ,
      • O'Donnell P.J.
      • Calvert C.
      • Atzorn R.
      • Wasternack C.
      • Leyser H.M.O.
      • Bowles D.J.
      ,
      • Klessig D.F.
      • Durner J.
      • Noad R.
      • Navarre D.A.
      • Wendehenne D.
      • Kumar D.
      • Zhou J.M.
      • Shah J.
      • Zhang S.
      • Kachroo P.
      • Trifa Y.
      • Pontier D.
      • Lam E.
      • Silva H.
      ,
      • Leon J.
      • Rojo E.
      • Sanchez-Serrano J.J.
      ,
      • Larkindale J.
      • Knight M.R.
      ). Ca2+ and Ca2+-binding proteins such as CaM are important in plant defense response. The biotic and abiotic stresses trigger free calcium changes and CaM gene expression (
      • Bush D.S.
      ,
      • Trewavas A.J.
      • Malho R.
      ,
      • Jena P.K.
      • Reddy A.S.N.
      • Poovaiah B.W.
      ,
      • Braam J.
      • Davis R.W.
      ,
      • Bergey D.R.
      • Ryan C.A.
      ,
      • van Der Luit A.H.
      • Olivari C.
      • Haley A.
      • Knight M.R.
      • Trewavas A.J.
      ). The cross-talks between Ca2+/CaM and other signaling pathways such as oxidative signaling, auxin, ABA, ethylene action, and environmental stresses have been reported in recent years (
      • Bowler C.
      • Fluhr R.
      ,
      • Zhu J.K.
      ,
      • Yang T.
      • Poovaiah B.W.
      ,
      • Yang T.
      • Poovaiah B.W.
      ,
      • Yang T.
      • Poovaiah B.W.
      ,
      • Larkindale J.
      • Knight M.R.
      ,
      • Pei Z.M.
      • Murata Y.
      • Benning G.
      • Thomine S.
      • Klusener B.
      • Allen G.J.
      • Grill E.
      • Schroeder J.I.
      ). However, our understanding of the complex signaling cascade is in its infancy.
      In this study, we demonstrate that a CaM-regulated AtSR gene family responds differentially to multiple physical and chemical stimuli (Fig. 5). Each gene was induced by at least five different signals, and each signal triggered more than one gene expression (Fig.5 A). All of the genes were induced by physical wounding (Fig. 5 B). It is well established that jasmonic acid plays a central role in plant responses to wounding. Hormones such as ABA and ethylene have also been proposed to play a role in wound signaling (
      • Leon J.
      • Rojo E.
      • Sanchez-Serrano J.J.
      ). Our results support that both jasmonic acid-dependent and -independent wound signaling pathways were rapidly activated to regulate AtSR expression following wounding. Furthermore, these genes respond to signals very rapidly (within minutes), which indicates that they are all early signal responsive genes. Early signal responsive genes are believed to play a prominent role in regulating late-responsive genes (
      • Zegzouti H.
      • Jones B.
      • Frasse P.
      • Marty C.
      • Maitre B.
      • Latch A.
      • Pech J.C.
      • Bouzayen M.
      ,
      • Abel S.
      • Theologis A.
      ). These results indicate that the multiple signal transduction pathways regulate the expression of the Ca2+/CaM-binding AtSR gene family, suggesting that AtSR is one of the early hubs for cross-talk among signaling pathways in plants.
      Identification of the AtSR1-specific DNA-binding elements led us to investigate further the potential downstream regulatory genes. Several of these genes are involved in ethylene and ABA signaling, DNA repairs (UV damage), signal perception, and stress response (Table II), which is consistent with the AtSR gene expression profiles in response to signals (Fig. 5). For example, EIN3 is an ethylene-responsive transcription factor, that functions downstream of CTR1 and EIN2 (
      • Chao Q.
      • Rothenberg M.
      • Solano R.
      • Roman G.
      • Terzaghi W.
      • Ecker J.R.
      ). Three CGCG cis-elements are present in its promoter region. Phytochrome A is one of the best characterized photoreceptors, and the regulation of phyA expression has been intensively studied by characterizing several cis-acting elements, such as GT, PE3, and RE1 elements (
      • Bruce W.B.
      • Deng X.W.
      • Quail P.H.
      ). Four CGCGcis-elements appear in Arabidopsis phyA. A CGCG cis-element was found inside the positive element (PE3) of phyA from monocots oat, rice, and maize, and another CGCG element also appeared in a negative element (RE1) in oat (
      • Bruce W.B.
      • Deng X.W.
      • Quail P.H.
      ). It has been suggested that calcium/CaM may be one of signaling intermediates in phototransduction (
      • Quail P.H.
      ). Our data provide additional clues for a role of calcium/CaM in phototransduction. Coincidentally, several light-responsive cis-elements, such as I boxes (GATAA), CCAAT elements, and GT-1 sites (
      • Terzaghi W.B.
      • Cashmore A.R.
      ), were found in the promoters of AtSR1,4,5,6 (data not shown). Gel retardation assays show that the recombinant AtSR1 specifically recognizes the wild type EIN3 and phyA promoter fragments but not the CGCG mutants (Fig. 3 E). Furthermore, CaM-binding nuclear proteins purified from wounded plants had the specific DNA-binding activity to CGCG boxes. In contrast, DNA binding activities were barely detected for the nuclear proteins from control plants that were grown under normal conditions. Our data suggest that AtSR1 may regulate the expression of these genes in vivo. Isolation and characterization of the knockout mutants of AtSRs will provide direct evidence of downstream regulatory genes.
      All AtSRs are shown to be calcium-dependent CaM-binding proteins (Fig. 1). However, the specific role of CaM-binding to AtSRs is not yet clear. It has been reported that Ca2+/CaM inhibits the protein-DNA binding by competing with the basic helix-loop-helix DNA-binding domain in certain transcription factors (
      • Corneliussen B.
      • Holm M.
      • Waltersson Y.
      • Onions J.
      • Hallberg B.
      • Thornell A.
      • Grundstrom T.
      ). The DNA-binding protein TAG3 also shows Ca2+/CaM enhanced-binding activities to C/G box (
      • Szymanski D.B.
      • Liao B.
      • Zielinski R.E.
      ). However, its CaM-binding domain has not been identified. In this study, we found that the CaM-binding region is far away from the DNA-binding region in all AtSRs. The possible role of Ca2+/CaM may be manifested in the control of interactions with other proteins or altering transcription activation of others. Recently, a transcription activation domain was mapped to a region just upstream of ankyrin repeats in AtCAMTA1 by fusing with the DNA-binding domain of LexA transcription factor and testing in a yeast system (
      • Bouche N.
      • Scharlat A.
      • Snedden W.
      • Bouchez D.
      • Fromm H.
      ). Identification of the AtSR1 recognition sequence as a CGCG box should help to define the importance of Ca2+/CaM-binding in transcription activation in plants.
      In conclusion, multiple signals rapidly and differentially induceAtSR expression; AtSR-encoded proteins are Ca2+-dependent CaM-binding proteins; AtSR1 shows specific DNA binding activity to the CGCG box; and the CaM-binding nuclear proteins are able to specifically interact with the CGCG cis-elements. Based on these results and other studies, we propose that CaM-regulated AtSRs may serve as one of the early hubs in multiple signal transduction cascades by differentially responding to the multiple upstream signals. Furthermore, AtSRs recognize CGCGcis-elements and may regulate the downstream gene expression, which ultimately leads to the physiological responses to varieties of stresses (Fig. 6). Further characterization of the functional significance of AtSRs should provide a better understanding of the mechanisms of plant defense to biotic and abiotic stresses.
      Figure thumbnail gr6
      Figure 6The schematic illustration of the proposed model for the involvement of Ca2+/CaM/AtSR in multiple signal transduction pathways. The environmental signals are mediated by hormones such as ethylene and ABA, signal elicitors such as MJ, H2O2, SA, Ca2+, and CaM. These signals are interacted each other and form a complex signal network.AtSRs differentially perceive and respond to a variety of signals and regulate the downstream genes by recognizing the CGCGcis-elements. The ankyrin repeats and the acidic domain may interact with transcription factors or others. In the end, the downstream gene expression is up-regulated or down-regulated. The question marks indicate some open questions. ET, ethylene;DNABD, DNA-binding domain; AR, ankyrin repeats;CaMBD, CaM-binding domain; AD, acidic domain;TF, transcription factors.

      Acknowledgments

      We thank Dr. Philip Berger, Margaret Dibble, Christina Moore, and Jenny Hansen for help with the bombardment experiment; Dr. Liqun Du for help with the gel retardation assays; Yanping Chen and J. Kandakumar for technical support; Dr. Thomas D. Schmittgen for help with the real time PCR; and Dr. John Fellman and D. Scott Mattinson for help with the ethylene and MCP treatment experiments.

      Supplementary Material

      REFERENCES

        • Arabidopsis
        Nature. 2000; 408: 823-826
        • Bush D.S.
        Annu. Rev. Plant Physiol. Plant Mol. Biol. 1995; 46: 95-122
        • Trewavas A.J.
        • Malho R.
        Plant Cell. 1997; 9: 1181-1195
        • Bowler C.
        • Fluhr R.
        Trends Plant Sci. 2000; 5: 241-246
        • Zhu J.K.
        Curr. Opin. Plant Biol. 2001; 4: 401-406
        • Evans N.H.
        • McAinsh M.R.
        • Hetherington A.M.
        Curr. Opin. Plant Biol. 2001; 4: 415-420
        • Poovaiah B.W.
        • Yang T.
        • Reddy A.S.N.
        Waisel Y. Kafkafi U. Eshel A. Plant Roots: The Hidden Half. 3rd Ed. Marcel Dekker Inc., New York2002: 505-520
        • Pauly N.
        • Knight M.R.
        • Thuleau P.
        • van der Luit A.H.
        • Moreau M.
        • Trewavas A.J.
        • Ranjeva R.
        • Mazars C.
        Nature. 2000; 405: 754-755
        • Natalie C.
        • Strynadaka J.
        • Jams M.N.G.
        Annu. Rev. Biochem. 1989; 58: 951-958
        • Poovaiah B.W.
        • Reddy A.S.N.
        CRC Crit. Rev. Plant Sci. 1987; 6: 47-103
        • Roberts D.M.
        • Harmon A.C.
        Annu. Rev. Plant Physiol. Plant Mol. Biol. 1992; 43: 375-414
        • Poovaiah B.W.
        • Reddy A.S.N.
        CRC Crit. Rev. Plant Sci. 1993; 12: 185-211
        • Zielinski R.E.
        Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998; 49: 697-725
        • Reddy A.S.
        Plant Sci. 2001; 160: 381-404
        • Snedden W.A.
        • Fromm H.
        New Phytol. 2001; 151: 35-66
        • Corneliussen B.
        • Holm M.
        • Waltersson Y.
        • Onions J.
        • Hallberg B.
        • Thornell A.
        • Grundstrom T.
        Nature. 1994; 368: 760-764
        • Szymanski D.B.
        • Liao B.
        • Zielinski R.E.
        Plant Cell. 1996; 8: 1069-1077
        • Yang T.
        • Poovaiah B.W.
        J. Biol. Chem. 2000; 275: 38467-38473
        • Bouche N.
        • Scharlat A.
        • Snedden W.
        • Bouchez D.
        • Fromm H.
        J. Biol. Chem. 2002; 277: 21851-21861
        • Davis S.J.
        • Vierstra R.D.
        Plant Mol. Biol. 1998; 36: 521-528
        • Christou P.
        Methods Cell Biol. 1995; 50: 375-382
        • Green P.J.
        • Kay S.A.
        • Chua N.H.
        EMBO J. 1987; 18: 4689-4699
        • Yang T.
        • Poovaiah B.W.
        Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 4097-4102
        • Wang Z.
        • Yang P.
        • Fan B.
        • Chen Z.
        Plant J. 1998; 16: 515-522
        • Schmittgen T.D.
        • Zakrajsek B.A.
        • Mills A.G.
        • Gorn V.
        • Singer M.J.
        • Reed M.W.
        Anal. Biochem. 2000; 285: 194-204
        • Reddy A.S.
        • Reddy V.S.
        • Golovkin M.
        Biochem. Biophys. Res. Commun. 2000; 279: 762-769
        • Schwechheimer C.
        • Zourelidou M.
        • Bevan M.W.
        Annu. Rev. Plant Mol. Biol. 1998; 49: 127-150
        • Sedgwick S.G.
        • Smerdon S.J.
        Trends Biochem. Sci. 1999; 24: 311-316
        • Bahler M.
        • Rhoads A.
        FEBS Lett. 2002; 513: 107-113
        • O'Neil K.T.
        • DeGrado W.F.
        Trends Biochem. Sci. 1990; 15: 59-64
        • Yang T.
        • Poovaiah B.W.
        J. Biol. Chem. 2000; 275: 3137-3143
        • da Costa e Silva O.
        Plant Mol. Biol. 1994; 25: 921-924
        • Zegzouti H.
        • Jones B.
        • Frasse P.
        • Marty C.
        • Maitre B.
        • Latch A.
        • Pech J.C.
        • Bouzayen M.
        Plant J. 1999; 18: 589-600
        • Fujimoto S.Y.
        • Ohta M.
        • Usui A.
        • Shinshi H.
        • Ohme-Takagi M.
        Plant Cell. 2000; 12: 393-404
        • Giraudat J.
        Curr. Opin. Cell Biol. 1995; 7: 232-238
        • Bleecker A.B.
        • Kende H.
        Annu. Rev. Cell Dev. Biol. 2000; 16: 1-18
        • Stepanova A.N.
        • Ecker J.R.
        Curr. Opin. Plant Biol. 2000; 3: 353-360
        • Levine A.
        • Tenhaken R.
        • Dixon R.
        • Lamb C.
        Cell. 1994; 79: 583-593
        • Reinbothe S.
        • Mollenhauer B.
        • Reinbothe C.
        Plant Cell. 1994; 6: 1197-1209
        • Green R.
        • Fluhr R.
        Plant Cell. 1995; 7: 203-212
        • O'Donnell P.J.
        • Calvert C.
        • Atzorn R.
        • Wasternack C.
        • Leyser H.M.O.
        • Bowles D.J.
        Science. 1996; 274: 1914-1917
        • Klessig D.F.
        • Durner J.
        • Noad R.
        • Navarre D.A.
        • Wendehenne D.
        • Kumar D.
        • Zhou J.M.
        • Shah J.
        • Zhang S.
        • Kachroo P.
        • Trifa Y.
        • Pontier D.
        • Lam E.
        • Silva H.
        Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8849-8855
        • Leon J.
        • Rojo E.
        • Sanchez-Serrano J.J.
        J. Exp. Bot. 2001; 52: 1-9
        • Larkindale J.
        • Knight M.R.
        Plant Physiol. 2002; 128: 682-695
        • Jena P.K.
        • Reddy A.S.N.
        • Poovaiah B.W.
        Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 3644-3648
        • Braam J.
        • Davis R.W.
        Cell. 1990; 60: 357-364
        • Bergey D.R.
        • Ryan C.A.
        Plant Mol. Biol. 1999; 40: 815-823
        • van Der Luit A.H.
        • Olivari C.
        • Haley A.
        • Knight M.R.
        • Trewavas A.J.
        Plant Physiol. 1999; 121: 705-714
        • Pei Z.M.
        • Murata Y.
        • Benning G.
        • Thomine S.
        • Klusener B.
        • Allen G.J.
        • Grill E.
        • Schroeder J.I.
        Nature. 2000; 406: 731-734
        • Abel S.
        • Theologis A.
        Plant Physiol. 1996; 111: 9-17
        • Chao Q.
        • Rothenberg M.
        • Solano R.
        • Roman G.
        • Terzaghi W.
        • Ecker J.R.
        Cell. 1997; 89: 1133-1144
        • Bruce W.B.
        • Deng X.W.
        • Quail P.H.
        EMBO J. 1991; 10: 3015-3024
        • Quail P.H.
        Curr. Opin. Genet. & Dev. 1994; 4: 652-661
        • Terzaghi W.B.
        • Cashmore A.R.
        Annu. Rev. Plant Mol. Biol. 1995; 46: 61445-61474