Advertisement

Deletion of the Cardiolipin-specific Phospholipase Cld1 Rescues Growth and Life Span Defects in the Tafazzin Mutant

IMPLICATIONS FOR BARTH SYNDROME*
  • Cunqi Ye
    Footnotes
    Affiliations
    Department of Biological Sciences, Wayne State University, Detroit, Michigan 48202
    Search for articles by this author
  • Wenjia Lou
    Footnotes
    Affiliations
    Department of Biological Sciences, Wayne State University, Detroit, Michigan 48202
    Search for articles by this author
  • Yiran Li
    Affiliations
    Department of Biological Sciences, Wayne State University, Detroit, Michigan 48202
    Search for articles by this author
  • Iliana A. Chatzispyrou
    Affiliations
    the Laboratory of Genetic Metabolic Diseases, Academic Medical Center, 1105AZ Amsterdam, The Netherlands
    Search for articles by this author
  • Maik Hüttemann
    Affiliations
    the Center for Molecular Medicine and Genetics, Wayne State University School of Medicine, Detroit, Michigan 48201

    Cardiovascular Research Institute, Wayne State University School of Medicine, Detroit, Michigan 48201
    Search for articles by this author
  • Icksoo Lee
    Affiliations
    the College of Medicine, Dankook University, Cheonan-si, Chungcheongnam-do 330-714, Republic of Korea
    Search for articles by this author
  • Riekelt H. Houtkooper
    Affiliations
    the Laboratory of Genetic Metabolic Diseases, Academic Medical Center, 1105AZ Amsterdam, The Netherlands
    Search for articles by this author
  • Frédéric M. Vaz
    Affiliations
    the Laboratory of Genetic Metabolic Diseases, Academic Medical Center, 1105AZ Amsterdam, The Netherlands
    Search for articles by this author
  • Shuliang Chen
    Footnotes
    Affiliations
    Department of Biological Sciences, Wayne State University, Detroit, Michigan 48202
    Search for articles by this author
  • Miriam L. Greenberg
    Correspondence
    To whom correspondence should be addressed: 5047 Gullen Mall, Dept. of Biological Sciences, Wayne State University, Detroit, MI 48202. Tel.: 313-577-5202Fax: 313-577-6891
    Affiliations
    Department of Biological Sciences, Wayne State University, Detroit, Michigan 48202
    Search for articles by this author
  • Author Footnotes
    * This work was supported by grants from the Barth Syndrome Foundation, Barth Syndrome Foundation of Canada, and Association Barth France (to M. L. G.), Wayne State University Thomas C. Rumble University Fellowship and Summer Dissertation Fellowship (to C. Y.), Wayne State University graduate enhancement research funds (to C. Y., W. L., and Y. L.), Academisch Medisch Centrum Ph.D. fellowship (to I. A. C.), and ZonMw/Veni Grant 91613050 and AMC postdoctoral fellowship (to R. H. H.).
    1 Both authors contributed equally to this work.
    2 Present address: Dept. of Cellular and Molecular Medicine, George Palade Labs, University of California at San Diego, La Jolla, CA 92093-0668.
      Cardiolipin (CL) that is synthesized de novo is deacylated to monolysocardiolipin (MLCL), which is reacylated by tafazzin. Remodeled CL contains mostly unsaturated fatty acids. In eukaryotes, loss of tafazzin leads to growth and respiration defects, and in humans, this results in the life-threatening disorder Barth syndrome. Tafazzin deficiency causes a decrease in the CL/MLCL ratio and decreased unsaturated CL species. Which of these biochemical outcomes contributes to the physiological defects is not known. Yeast cells have a single CL-specific phospholipase, Cld1, that can be exploited to distinguish between these outcomes. The cld1Δ mutant has decreased unsaturated CL, but the CL/MLCL ratio is similar to that of wild type cells. We show that cld1Δ rescues growth, life span, and respiratory defects of the taz1Δ mutant. This suggests that defective growth and respiration in tafazzin-deficient cells are caused by the decreased CL/MLCL ratio and not by a deficiency in unsaturated CL. CLD1 expression is increased during respiratory growth and regulated by the heme activator protein transcriptional activation complex. Overexpression of CLD1 leads to decreased mitochondrial respiration and growth and instability of mitochondrial DNA. However, ATP concentrations are maintained by increasing glycolysis. We conclude that transcriptional regulation of Cld1-mediated deacylation of CL influences energy metabolism by modulating the relative contribution of glycolysis and respiration.

      Introduction

      Cardiolipin (CL)
      The abbreviations used are: CL
      cardiolipin
      MLCL
      monolysocardiolipin
      BTHS
      Barth syndrome
      qPCR
      quantitative PCR
      PGP
      phosphatidylglycerophosphate
      FCCP
      trifluorocarbonylcyanide phenylhydrazone
      HAP
      heme activator protein
      CDP-DAG
      cytidine diphosphate-diacylglycerol.
      is a unique phospholipid that is predominant in mitochondrial membranes (
      • Hostetler K.Y.
      • van den Bosch H.
      • van Deenen L.L.
      The mechanism of cardiolipin biosynthesis in liver mitochondria.
      ,
      • Joshi A.S.
      • Zhou J.
      • Gohil V.M.
      • Chen S.
      • Greenberg M.L.
      Cellular functions of cardiolipin in yeast.
      ). Unlike other membrane phospholipids, it contains two phosphatidyl moieties, four acyl chains, and two negative charges (
      • Pangborn M.C.
      The composition of cardiolipin.
      ,
      • Lecocq J.
      • Ballou C.E.
      On the structure of cardiolipin.
      ). As the signature lipid of mitochondria, it comprises about 15% of total mitochondrial phospholipids (
      • Jakovcic S.
      • Getz G.S.
      • Rabinowitz M.
      • Jakob H.
      • Swift H.
      Cardiolipin content of wild type and mutant yeasts in relation to mitochondrial function and development.
      ) and interacts with a wide range of mitochondrial proteins (
      • Schlame M.
      • Rua D.
      • Greenberg M.L.
      The biosynthesis and functional role of cardiolipin.
      ,
      • Claypool S.M.
      Cardiolipin, a critical determinant of mitochondrial carrier protein assembly and function.
      ,
      • Schlame M.
      • Ren M.
      The role of cardiolipin in the structural organization of mitochondrial membranes.
      ,
      • Klingenberg M.
      Cardiolipin and mitochondrial carriers.
      ), including the ADP/ATP carrier (
      • Beyer K.
      • Klingenberg M.
      ADP/ATP carrier protein from beef heart mitochondria has high amounts of tightly bound cardiolipin, as revealed by 31P nuclear magnetic resonance.
      ,
      • Claypool S.M.
      • Oktay Y.
      • Boontheung P.
      • Loo J.A.
      • Koehler C.M.
      Cardiolipin defines the interactome of the major ADP/ATP carrier protein of the mitochondrial inner membrane.
      ) and respiratory complexes (
      • Lange C.
      • Nett J.H.
      • Trumpower B.L.
      • Hunte C.
      Specific roles of protein-phospholipid interactions in the yeast cytochrome bc1 complex structure.
      ,
      • Palsdottir H.
      • Lojero C.G.
      • Trumpower B.L.
      • Hunte C.
      Structure of the yeast cytochrome bc1 complex with a hydroxyquinone anion Qo site inhibitor bound.
      ,
      • Eble K.S.
      • Coleman W.B.
      • Hantgan R.R.
      • Cunningham C.C.
      Tightly associated cardiolipin in the bovine heart mitochondrial ATP synthase as analyzed by 31P nuclear magnetic resonance spectroscopy.
      ,
      • Shinzawa-Itoh K.
      • Aoyama H.
      • Muramoto K.
      • Terada H.
      • Kurauchi T.
      • Tadehara Y.
      • Yamasaki A.
      • Sugimura T.
      • Kurono S.
      • Tsujimoto K.
      • Mizushima T.
      • Yamashita E.
      • Tsukihara T.
      • Yoshikawa S.
      Structures and physiological roles of 13 integral lipids of bovine heart cytochrome c oxidase.
      ). CL-protein interactions stabilize respiratory chain supercomplexes (
      • Pfeiffer K.
      • Gohil V.
      • Stuart R.A.
      • Hunte C.
      • Brandt U.
      • Greenberg M.L.
      • Schägger H.
      Cardiolipin stabilizes respiratory chain supercomplexes.
      ,
      • Zhang M.
      • Mileykovskaya E.
      • Dowhan W.
      Gluing the respiratory chain together. Cardiolipin is required for supercomplex formation in the inner mitochondrial membrane.
      ) and promote supramolecular associations between the ADP/ATP carrier and respiratory supercomplexes (
      • Claypool S.M.
      • Oktay Y.
      • Boontheung P.
      • Loo J.A.
      • Koehler C.M.
      Cardiolipin defines the interactome of the major ADP/ATP carrier protein of the mitochondrial inner membrane.
      ). Therefore, it is not surprising that mitochondrial respiration and energy production are highly correlated with CL biosynthesis (
      • Claypool S.M.
      • Oktay Y.
      • Boontheung P.
      • Loo J.A.
      • Koehler C.M.
      Cardiolipin defines the interactome of the major ADP/ATP carrier protein of the mitochondrial inner membrane.
      ,
      • Jiang F.
      • Ryan M.T.
      • Schlame M.
      • Zhao M.
      • Gu Z.
      • Klingenberg M.
      • Pfanner N.
      • Greenberg M.L.
      Absence of cardiolipin in the crd1 null mutant results in decreased mitochondrial membrane potential and reduced mitochondrial function.
      ,
      • Gohil V.M.
      • Hayes P.
      • Matsuyama S.
      • Schägger H.
      • Schlame M.
      • Greenberg M.L.
      Cardiolipin biosynthesis and mitochondrial respiratory chain function are interdependent.
      ). Interestingly, CL deficiency also leads to deficiencies in diverse cellular functions other than mitochondrial bioenergetics, including mitochondrial dynamics (
      • DeVay R.M.
      • Dominguez-Ramirez L.
      • Lackner L.L.
      • Hoppins S.
      • Stahlberg H.
      • Nunnari J.
      Coassembly of Mgm1 isoforms requires cardiolipin and mediates mitochondrial inner membrane fusion.
      ,
      • Joshi A.S.
      • Thompson M.N.
      • Fei N.
      • Hüttemann M.
      • Greenberg M.L.
      Cardiolipin and mitochondrial phosphatidylethanolamine have overlapping functions in mitochondrial fusion in Saccharomyces cerevisiae.
      ), mitochondrial protein import (
      • Jiang F.
      • Ryan M.T.
      • Schlame M.
      • Zhao M.
      • Gu Z.
      • Klingenberg M.
      • Pfanner N.
      • Greenberg M.L.
      Absence of cardiolipin in the crd1 null mutant results in decreased mitochondrial membrane potential and reduced mitochondrial function.
      ,
      • Gebert N.
      • Joshi A.S.
      • Kutik S.
      • Becker T.
      • McKenzie M.
      • Guan X.L.
      • Mooga V.P.
      • Stroud D.A.
      • Kulkarni G.
      • Wenk M.R.
      • Rehling P.
      • Meisinger C.
      • Ryan M.T.
      • Wiedemann N.
      • Greenberg M.L.
      • Pfanner N.
      Mitochondrial cardiolipin involved in outer-membrane protein biogenesis: implications for Barth syndrome.
      ), cell wall biogenesis (
      • Zhong Q.
      • Gvozdenovic-Jeremic J.
      • Webster P.
      • Zhou J.
      • Greenberg M.L.
      Loss of function of KRE5 suppresses temperature sensitivity of mutants lacking mitochondrial anionic lipids.
      ,
      • Zhong Q.
      • Li G.
      • Gvozdenovic-Jeremic J.
      • Greenberg M.L.
      Up-regulation of the cell integrity pathway in Saccharomyces cerevisiae suppresses temperature sensitivity of the pgs1Δ mutant.
      ), vacuolar function and morphology (
      • Chen S.
      • Tarsio M.
      • Kane P.M.
      • Greenberg M.L.
      Cardiolipin mediates cross-talk between mitochondria and the vacuole.
      ), cell cycle (
      • Chen S.
      • Liu D.
      • Finley Jr., R.L.
      • Greenberg M.L.
      Loss of mitochondrial DNA in the yeast cardiolipin synthase crd1 mutant leads to up-regulation of the protein kinase Swe1p that regulates the G2/M transition.
      ), aging (
      • Zhou J.
      • Zhong Q.
      • Li G.
      • Greenberg M.L.
      Loss of cardiolipin leads to longevity defects that are alleviated by alterations in stress response signaling.
      ), and apoptosis (
      • Gonzalvez F.
      • Gottlieb E.
      Cardiolipin: setting the beat of apoptosis.
      ,
      • Houtkooper R.H.
      • Vaz F.M.
      Cardiolipin, the heart of mitochondrial metabolism.
      ,
      • Schug Z.T.
      • Gottlieb E.
      Cardiolipin acts as a mitochondrial signalling platform to launch apoptosis.
      ). As CL is engaged in a plethora of cellular activities, the regulation of CL synthesis is crucially important.
      The synthesis of CL is well characterized in Saccharomyces cerevisiae. As seen in Fig. 1, Pgs1 catalyzes the committed step of CL synthesis by converting CDP-DAG and glycerol 3-phosphate to phosphatidylglycerophosphate (PGP) (
      • Chang S.C.
      • Heacock P.N.
      • Clancey C.J.
      • Dowhan W.
      The PEL1 gene (renamed PGS1) encodes the phosphatidylglycero-phosphate synthase of Saccharomyces cerevisiae.
      ), which is dephosphorylated to phosphatidylglycerol by the PGP phosphatase Gep4 (
      • Osman C.
      • Haag M.
      • Wieland F.T.
      • Brügger B.
      • Langer T.
      A mitochondrial phosphatase required for cardiolipin biosynthesis: the PGP phosphatase Gep4.
      ,
      • Kelly B.L.
      • Greenberg M.L.
      Characterization and regulation of phosphatidylglycerol phosphate phosphatase in Saccharomyces cerevisiae.
      ). CL synthase (Crd1) catalyzes the final step of de novo CL synthesis by condensing phosphatidylglycerol and CDP-DAG to form CL with primarily saturated acyl chains (
      • Chang S.C.
      • Heacock P.N.
      • Mileykovskaya E.
      • Voelker D.R.
      • Dowhan W.
      Isolation and characterization of the gene (CLS1) encoding cardiolipin synthase in Saccharomyces cerevisiae.
      ,
      • Tuller G.
      • Hrastnik C.
      • Achleitner G.
      • Schiefthaler U.
      • Klein F.
      • Daum G.
      YDL142c encodes cardiolipin synthase (Cls1p) and is non-essential for aerobic growth of Saccharomyces cerevisiae.
      ,
      • Tamai K.T.
      • Greenberg M.L.
      Biochemical characterization and regulation of cardiolipin synthase in Saccharomyces cerevisiae.
      ,
      • Jiang F.
      • Rizavi H.S.
      • Greenberg M.L.
      Cardiolipin is not essential for the growth of Saccharomyces cerevisiae on fermentable or non-fermentable carbon sources.
      ). Following the de novo synthesis of CL on the matrix side of the inner mitochondrial membrane, CL undergoes remodeling in which acyl chains are exchanged. In this process, CL is deacylated to monolysocardiolipin (MLCL) by the CL-specific lipase Cld1 on the matrix side of the inner mitochondrial membrane (
      • Beranek A.
      • Rechberger G.
      • Knauer H.
      • Wolinski H.
      • Kohlwein S.D.
      • Leber R.
      Identification of a cardiolipin-specific phospholipase encoded by the gene CLD1 (YGR110W) in yeast.
      ,
      • Baile M.G.
      • Whited K.
      • Claypool S.M.
      Deacylation on the matrix side of the mitochondrial inner membrane regulates cardiolipin remodeling.
      ). MLCL is reacylated by the transacylase Taz1 in the mitochondrial periphery (
      • Testet E.
      • Laroche-Traineau J.
      • Noubhani A.
      • Coulon D.
      • Bunoust O.
      • Camougrand N.
      • Manon S.
      • Lessire R.
      • Bessoule J.J.
      Ypr140wp, ‘the yeast tafazzin’, displays a mitochondrial lysophosphatidylcholine (lyso-PC) acyltransferase activity related to triacylglycerol and mitochondrial lipid synthesis.
      ,
      • Gu Z.
      • Valianpour F.
      • Chen S.
      • Vaz F.M.
      • Hakkaart G.A.
      • Wanders R.J.
      • Greenberg M.L.
      Aberrant cardiolipin metabolism in the yeast taz1 mutant: a model for Barth syndrome.
      ,
      • Brandner K.
      • Mick D.U.
      • Frazier A.E.
      • Taylor R.D.
      • Meisinger C.
      • Rehling P.
      Taz1, an outer mitochondrial membrane protein, affects stability and assembly of inner membrane protein complexes: implications for Barth syndrome.
      ,
      • Claypool S.M.
      • Boontheung P.
      • McCaffery J.M.
      • Loo J.A.
      • Koehler C.M.
      The cardiolipin transacylase, tafazzin, associates with two distinct respiratory components providing insight into Barth syndrome.
      ). Remodeled CL has more unsaturated acyl chains than CL synthesized de novo (
      • Beranek A.
      • Rechberger G.
      • Knauer H.
      • Wolinski H.
      • Kohlwein S.D.
      • Leber R.
      Identification of a cardiolipin-specific phospholipase encoded by the gene CLD1 (YGR110W) in yeast.
      ,
      • Gu Z.
      • Valianpour F.
      • Chen S.
      • Vaz F.M.
      • Hakkaart G.A.
      • Wanders R.J.
      • Greenberg M.L.
      Aberrant cardiolipin metabolism in the yeast taz1 mutant: a model for Barth syndrome.
      ,
      • Vaz F.M.
      • Houtkooper R.H.
      • Valianpour F.
      • Barth P.G.
      • Wanders R.J.
      Only one splice variant of the human TAZ gene encodes a functional protein with a role in cardiolipin metabolism.
      ,
      • Xu Y.
      • Kelley R.I.
      • Blanck T.J.
      • Schlame M.
      Remodeling of cardiolipin by phospholipid transacylation.
      ). Although the CL remodeling genes and enzymes have been identified in yeast, the function of CL remodeling and the mechanisms underlying its regulation are not understood.
      Figure thumbnail gr1
      FIGURE 1CL de novo synthesis and remodeling in S. cerevisiae. Pgs1 catalyzes the committed step of CL synthesis by converting CDP-DAG to PGP, which is dephosphorylated to phosphatidylglycerol (PG) by the GEP4-encoded PGP phosphatase. CL synthase, encoded by CRD1, condenses phosphatidylglycerol and CDP-DAG to form CL. CL synthesized de novo has primarily saturated acyl chains (CLsat). CLsat is deacylated by the CL-specific phospholipase Cld1 to MLCL, which is reacylated by tafazzin (the TAZ1 gene product) to CL containing more unsaturated acyl chains (CLunsat).
      The importance of CL remodeling is underscored by the X-linked mitochondrial disorder Barth syndrome (BTHS), a cardioskeletal myopathy that results from mutations in the tafazzin gene (the homologue of yeast TAZ1) (
      • Barth P.G.
      • Scholte H.R.
      • Berden J.A.
      • Van der Klei-Van Moorsel J.M.
      • Luyt-Houwen I.E.
      • Van 't Veer-Korthof E.T.
      • Van der Harten J.J.
      • Sobotka-Plojhar M.A.
      An X-linked mitochondrial disease affecting cardiac muscle, skeletal muscle and neutrophil leucocytes.
      ,
      • Barth P.G.
      • Wanders R.J.
      • Vreken P.
      • Janssen E.A.
      • Lam J.
      • Baas F.
      X-linked cardioskeletal myopathy and neutropenia (Barth syndrome) (MIM 302060).
      ,
      • Barth P.G.
      • Valianpour F.
      • Bowen V.M.
      • Lam J.
      • Duran M.
      • Vaz F.M.
      • Wanders R.J.
      X-linked cardioskeletal myopathy and neutropenia (Barth syndrome): an update.
      ). Tafazzin deficiency leads to a decrease in the CL/MLCL ratio and a decrease in CL species containing unsaturated fatty acids (
      • Gu Z.
      • Valianpour F.
      • Chen S.
      • Vaz F.M.
      • Hakkaart G.A.
      • Wanders R.J.
      • Greenberg M.L.
      Aberrant cardiolipin metabolism in the yeast taz1 mutant: a model for Barth syndrome.
      ,
      • Schlame M.
      • Kelley R.I.
      • Feigenbaum A.
      • Towbin J.A.
      • Heerdt P.M.
      • Schieble T.
      • Wanders R.J.
      • DiMauro S.
      • Blanck T.J.
      Phospholipid abnormalities in children with Barth syndrome.
      ,
      • Valianpour F.
      • Wanders R.J.
      • Barth P.G.
      • Overmars H.
      • van Gennip A.H.
      Quantitative and compositional study of cardiolipin in platelets by electrospray ionization mass spectrometry: application for the identification of Barth syndrome patients.
      ,
      • Vreken P.
      • Valianpour F.
      • Nijtmans L.G.
      • Grivell L.A.
      • Plecko B.
      • Wanders R.J.
      • Barth P.G.
      Defective remodeling of cardiolipin and phosphatidylglycerol in Barth syndrome.
      ,
      • Xu Y.
      • Condell M.
      • Plesken H.
      • Edelman-Novemsky I.
      • Ma J.
      • Ren M.
      • Schlame M.
      A Drosophila model of Barth syndrome.
      ,
      • Acehan D.
      • Vaz F.
      • Houtkooper R.H.
      • James J.
      • Moore V.
      • Tokunaga C.
      • Kulik W.
      • Wansapura J.
      • Toth M.J.
      • Strauss A.
      • Khuchua Z.
      Cardiac and skeletal muscle defects in a mouse model of human Barth syndrome.
      ,
      • Houtkooper R.H.
      • Rodenburg R.J.
      • Thiels C.
      • van Lenthe H.
      • Stet F.
      • Poll-The B.T.
      • Stone J.E.
      • Steward C.G.
      • Wanders R.J.
      • Smeitink J.
      • Kulik W.
      • Vaz F.M.
      Cardiolipin and monolysocardiolipin analysis in fibroblasts, lymphocytes, and tissues using high-performance liquid chromatography-mass spectrometry as a diagnostic test for Barth syndrome.
      ). Which of these biochemical outcomes leads to the pathology in BTHS is not understood. Genetic inactivation of the CL-specific phospholipase calcium-independent PLA2-GVIA rescued sterility defects associated with tafazzin deficiency in Drosophila (
      • Malhotra A.
      • Edelman-Novemsky I.
      • Xu Y.
      • Plesken H.
      • Ma J.
      • Schlame M.
      • Ren M.
      Role of calcium-independent phospholipase A2 in the pathogenesis of Barth syndrome.
      ). The mechanism underlying this rescue is not known. In mammals, CL-specific phospholipases have not been identified, and multiple phospholipases supposedly catalyze the deacylation of CL (
      • Hsu Y.H.
      • Dumlao D.S.
      • Cao J.
      • Dennis E.A.
      Assessing phospholipase A2 activity toward cardiolipin by mass spectrometry.
      ), complicating experiments to elucidate the role of deacylation in mammalian cells. In contrast, CLD1 is the only CL-specific phospholipase in S. cerevisiae (
      • Beranek A.
      • Rechberger G.
      • Knauer H.
      • Wolinski H.
      • Kohlwein S.D.
      • Leber R.
      Identification of a cardiolipin-specific phospholipase encoded by the gene CLD1 (YGR110W) in yeast.
      ). The yeast cld1Δ mutant has decreased unsaturated CL compared with wild type cells, but the CL/MLCL ratio is not altered. In this study, we demonstrate for the first time that deletion of CLD1 rescued both respiratory and fermentative growth defects as well as decreased chronological life span in yeast taz1Δ cells. This suggests that deacylation of CL in the absence of tafazzin is deleterious because it leads to a decrease in the CL/MLCL ratio. These findings argue against the current thought that defects in tafazzin-deficient cells result from decreased unsaturated CL. We further show that expression of CLD1 is regulated in response to conditions affecting mitochondrial respiration and controlled by the HAP transcriptional activator. Overexpression of CLD1 leads to decreased ATP production from mitochondrial respiration that is compensated by increased glycolysis. Based on these findings, we proposed that transcriptional regulation of CLD1 controls deacylation of CL, and the regulation of this process modulates cellular energy production.

      EXPERIMENTAL PROCEDURES

       Yeast Strains, Plasmids, and Growth Media

      The yeast S. cerevisiae strains and plasmids used in this study are listed in TABLE 1, TABLE 2. Single deletion mutants were obtained from the yeast knock-out deletion collection (Invitrogen). Double mutants were obtained by tetrad dissection. Parental ρ+ cells were used to generate ρ0 derivatives by growing in yeast extract peptone dextrose (YPD) medium containing 20 μg/ml ethidium bromide to the early stationary phase. ρ0 strains were confirmed by the inability to grow on yeast extract peptone glycerol ethanol (YPGE) medium, the absence of mitochondrial DNA by DAPI staining, and the failure to complement ρ tester strains for growth on YPGE medium.
      TABLE 1Strains and plasmids used in this study
      BY4741MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0Invitrogen
      BY4742MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0Invitrogen
      crd1ΔMATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 crd1Δ::KanMX6Invitrogen
      cld1ΔMATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 cld1Δ::KanMX6Invitrogen
      taz1ΔMATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 taz1Δ::KanMX6this study
      cld1Δtaz1ΔMATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 cld1Δ::KanMX6 taz1Δ::KanMX6this study
      mig1ΔMATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 mig1Δ::KanMX6Invitrogen
      hap2ΔMATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 hap2Δ::KanMX6Invitrogen
      hap3ΔMATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 hap3Δ::KanMX6Invitrogen
      hap4ΔMATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 hap4Δ::KanMX6Invitrogen
      hap5ΔMATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 hap5Δ::KanMX6Invitrogen
      BY4741 ρ0ρ0 mutant derived from BY4741This study
      crd1Δ ρ0ρ0 mutant derived from BY4741 crd1ΔThis study
      cld1Δ ρ0ρ0 mutant derived from BY4741 cld1ΔThis study
      taz1Δ ρ0ρ0 mutant derived from BY4741 taz1ΔThis study
      cld1Δtaz1Δ ρ0ρ0 mutant derived from BY4741 cld1Δtaz1ΔThis study
      pYPGK182 μm, LEU2
      • Vaz F.M.
      • Houtkooper R.H.
      • Valianpour F.
      • Barth P.G.
      • Wanders R.J.
      Only one splice variant of the human TAZ gene encodes a functional protein with a role in cardiolipin metabolism.
      pYPGK18CLD1Derived from pYPGK18, expression CLD1 from PGK1 promoterThis study
      TABLE 2Real time PCR primers used in this study
      GenePrimersSequence (5′ to 3′)
      ACT1ForwardTCCGGTGATGGTGTTACTCAThis study
      ReverseGGCCAAATCGATTCTCAAAA
      PGS1ForwardTTTGCTCCAACTCACTCGTCCTCAThis study
      ReverseATTGCCAAATGGAGAAGGGTTCGC
      GEP4ForwardAAAGGCCGTGGTCTTGGATAAGGAThis study
      ReverseATTGGAACCGGCGGTATTGCTAA
      CRD1ForwardTGCGGCGATAATTCTGGGTAGAGAThis study
      ReverseATTCCATGCCACACGACCAGGATA
      CLD1ForwardACTGGCTTTGGCTTTATGGCGATThis study
      ReverseTCCAGGTACAAGTGATGCCCTGA
      TAZ1ForwardCGAAGCCATCTTGGGTCCATGTTThis study
      ReverseCAATGGGCGGCTTTGTTGCTTCT
      ADH1ForwardGGTCTAGGTTCTTTGGCTGTTThis study
      ReverseCACCACCGATGGATCTGAATAA
      ADH2ForwardGTACTGTTGTCTTGGTTGGTTTGThis study
      ReverseGTAAGAGCCGACAATGGAGATAG
      PGK1ForwardAGGCTTCTGCCCCAGGTTC
      • Szijgyarto Z.
      • Garedew A.
      • Azevedo C.
      • Saiardi A.
      Influence of inositol pyrophosphates on cellular energy dynamics.
      ReverseCAGCACGTTGTGGCAAGTC
      GAPDHForwardAGTCTTTTGGGTGGCGGTCA
      • Szijgyarto Z.
      • Garedew A.
      • Azevedo C.
      • Saiardi A.
      Influence of inositol pyrophosphates on cellular energy dynamics.
      ReverseACATTGACGCTGGTGCCAAG
      To construct a CLD1 overexpression plasmid, a 1338-bp sequence containing the entire open reading frame of CLD1 was amplified from yeast genomic DNA using an EcoRI-tagged forward primer CLD1_EcoRI_F (5′-TATAGAACATGAATTCAAAAGTGAGCTGCAATGAGCA) and an XbaI-tagged reverse primer CLD1_XbaI_R (5′-ATTTTGAGATTCTAGAAAGAAGAAAAATAGCGGCGA-3′). The PCR products were purified using the Wizard SV gel and PCR clean-up system (Promega). The purified DNA fragments were ligated into pYPGK18 cut with EcoRI and XbaI, downstream of the PGK1 promoter. All the plasmids were amplified and extracted using standard protocols. The plasmids were transformed into yeast strains using a one-step transformation protocol.
      Synthetic complete (SC) medium contained adenine (20.25 mg/liter), arginine (20 mg/liter), histidine (20 mg/liter), leucine (60 mg/liter), lysine (200 mg/liter), methionine (20 mg/liter), threonine (300 mg/liter), tryptophan (20 mg/liter), uracil (20 mg/liter), yeast nitrogen base without amino acids (Difco), all the essential components of Difco vitamin (inositol-free), 0.2% ammonium sulfate, and glucose (2%). Inositol (75 μm) was supplemented in all media used in this study. Synthetic dropout media contained all ingredients mentioned above, except for the amino acid used as a selectable marker, and were used to culture strains containing a plasmid.

       Chronological Life Span

      Yeast chronological life span is determined by survival of nondividing cells in a prolonged stationary culture (
      • Fabrizio P.
      • Longo V.D.
      The chronological life span of Saccharomyces cerevisiae.
      ). A standard protocol previously described was followed (
      • Hu J.
      • Wei M.
      • Mirisola M.G.
      • Longo V.D.
      Assessing chronological aging in Saccharomyces cerevisiae.
      ) to assess chronological life span. In brief, individual colonies were inoculated in 10 ml of SC glucose medium and incubated overnight. The cultures were then diluted in 50 ml of SC medium, and cells were allowed to grow until saturation. Viable cells were measured every 2 or 3 days by counting colonies that were serially diluted and plated on YPD plates and represented as percentage of cells at day 2. The viability is considered to be 100% at or before day 2.

       Spotting Assay

      Cells were pre-cultured in SC medium to the early stationary growth phase at 30 °C and washed with sterile water. Three-μl aliquots of a series of 10-fold dilutions of 0.5 units of A550 cells were spotted onto the indicated plates and incubated at 30 °C.

       Real Time Quantitative PCR (RT-qPCR) Analysis

      Cells were grown to the indicated growth phase and harvested at 4 °C. Total RNA was extracted using hot phenol (
      • Köhrer K.
      • Domdey H.
      Preparation of high molecular weight RNA.
      ) and purified using the RNeasy Mini Plus kit (Qiagen, Valencia, CA). Complementary DNA (cDNA) was synthesized using the first strand cDNA synthesis kit (Roche Applied Science) according to the manufacturer's manuals. RT-qPCRs were performed in a 20-μl volume using Brilliant III Ultra-Faster SYBR Green qPCR Master Mix (Agilent Technologies, Santa Clara, CA). Triplicates were included for each reaction. The primers for RT-qPCR are listed in Table 2. RNA levels were normalized to ACT1. Relative values of mRNA transcripts are shown as fold change relative to indicated controls. Primer sets were validated according to Methods and Applications Guide from Agilent Technologies. Optimal primer concentrations were determined, and primer specificity of a single product was monitored by a melt curve following the amplification reaction. All the primers were validated by measurement of PCR efficiency and have calculated reaction efficiencies between 95 and 105%.

       Measurement of Respiration

      Cell respiration was analyzed in a closed 500-μl chamber equipped with a micro Clark-type oxygen electrode (Oxygraph Plus System, Hansatech Instruments) at 30 °C. Cells grown to the logarithmic phase were mixed in fresh growing media using a protein concentration of 2 mg/ml following measurements of basal respiration. State 4 and state 3 respiration was determined in the presence of 4 μm oligomycin and 5 μm FCCP, respectively. KCN (0.2 mm) was added at the end of the experiment to inhibit cytochrome c oxidase to normalize for (subtract) cytochrome c oxidase-independent oxygen consumption. Oxygen consumption was recorded on a computer and analyzed with the Oxygraph plus software. Respiration rates are defined as consumed O2 (nmol)/min·total protein (mg).

       Determination of ATP Concentrations

      Yeast cells were cultured to the logarithmic phase and flash-frozen with liquid nitrogen. ATP levels were determined by the bioluminescence method described previously (
      • Lee I.
      • Pecinova A.
      • Pecina P.
      • Neel B.G.
      • Araki T.
      • Kucherlapati R.
      • Roberts A.E.
      • Hüttemann M.
      A suggested role for mitochondria in Noonan syndrome.
      ).

       Determination of Ethanol Concentrations

      Yeast cells were cultured in 10 ml of growth medium for the indicated times to the logarithmic phase after inoculation at A550 of 0.05, and cells were pelleted by a 5-min centrifugation at 3000 rpm. Supernatants were used to determine ethanol concentrations in the media. An ethanol colorimetric assay kit from BioVision was used to assay ethanol concentrations according to the manufacturer's manual.

       Mitochondrial Aconitase Activity

      Cultures (2 liters) of yeast cells in the mid-logarithmic phase were harvested for isolation of mitochondria. Mitochondria were isolated as described previously (
      • Diekert K.
      • de Kroon A.I.
      • Kispal G.
      • Lill R.
      Isolation and subfractionation of mitochondria from the yeast Saccharomyces cerevisiae.
      ). Briefly, spheroplasts generated by zymolyase treatment were ruptured by Dounce homogenization, and mitochondria were obtained by differential centrifugation. Total mitochondrial protein concentration was determined using the BCA protein assay (Pierce Protein). Mitochondrial aconitase activity was determined in mitochondrial extracts (50 μg of protein) using an aconitase-isocitrate dehydrogenase-coupled assay, in which NADPH formation was monitored at A340 for 1 h (
      • Gardner P.R.
      Aconitase: sensitive target and measure of superoxide.
      ).

       Determination of CL by Mass Spectrometry

      Total lipid extracts from 10 mg of cells (dry weight) were analyzed by HPLC-MS as described previously (
      • Houtkooper R.H.
      • Akbari H.
      • van Lenthe H.
      • Kulik W.
      • Wanders R.J.
      • Frentzen M.
      • Vaz F.M.
      Identification and characterization of human cardiolipin synthase.
      ).

      RESULTS

       Deletion of CLD1 Rescues Growth and Life Span Defects of the Taz1Δ Mutant

      Deacylation of CL in the absence of tafazzin leads to a decreased ratio of CL/MLCL and decreased unsaturated CL (
      • Gu Z.
      • Valianpour F.
      • Chen S.
      • Vaz F.M.
      • Hakkaart G.A.
      • Wanders R.J.
      • Greenberg M.L.
      Aberrant cardiolipin metabolism in the yeast taz1 mutant: a model for Barth syndrome.
      ,
      • Valianpour F.
      • Wanders R.J.
      • Barth P.G.
      • Overmars H.
      • van Gennip A.H.
      Quantitative and compositional study of cardiolipin in platelets by electrospray ionization mass spectrometry: application for the identification of Barth syndrome patients.
      ,
      • Xu Y.
      • Condell M.
      • Plesken H.
      • Edelman-Novemsky I.
      • Ma J.
      • Ren M.
      • Schlame M.
      A Drosophila model of Barth syndrome.
      ,
      • Acehan D.
      • Vaz F.
      • Houtkooper R.H.
      • James J.
      • Moore V.
      • Tokunaga C.
      • Kulik W.
      • Wansapura J.
      • Toth M.J.
      • Strauss A.
      • Khuchua Z.
      Cardiac and skeletal muscle defects in a mouse model of human Barth syndrome.
      ), either of which may be responsible for cellular defects in tafazzin-deficient cells. We wished to distinguish between decreased CL/MLCL ratio versus decreased unsaturated CL as the mechanism underlying the defects in the taz1Δ mutant. Blocking CL deacylation by deletion of CLD1 prevents the decrease in the CL/MLCL ratio (
      • Beranek A.
      • Rechberger G.
      • Knauer H.
      • Wolinski H.
      • Kohlwein S.D.
      • Leber R.
      Identification of a cardiolipin-specific phospholipase encoded by the gene CLD1 (YGR110W) in yeast.
      ). However, the CL that is synthesized de novo but not remodeled is mostly saturated, in contrast to remodeled CL in wild type (WT) cells, which is mostly unsaturated (
      • Beranek A.
      • Rechberger G.
      • Knauer H.
      • Wolinski H.
      • Kohlwein S.D.
      • Leber R.
      Identification of a cardiolipin-specific phospholipase encoded by the gene CLD1 (YGR110W) in yeast.
      ). To determine whether the decreased CL/MLCL ratio is responsible for taz1Δ defects, we determined the effects of CLD1 deletion in taz1Δ mutants. Interestingly, deletion of CLD1 rescued the respiratory growth defect of the taz1Δ mutant (Fig. 2A). Because mitochondrial respiration varies in strains with different genetic backgrounds (
      • Ocampo A.
      • Liu J.
      • Schroeder E.A.
      • Shadel G.S.
      • Barrientos A.
      Mitochondrial respiratory thresholds regulate yeast chronological life span and its extension by caloric restriction.
      ) and the presence of polymorphic mitochondrial DNA can contribute to differences in mitochondrial respiration (
      • Dimitrov L.N.
      • Brem R.B.
      • Kruglyak L.
      • Gottschling D.E.
      Polymorphisms in multiple genes contribute to the spontaneous mitochondrial genome instability of Saccharomyces cerevisiae S288C strains.
      ), we assayed the effects of CLD1 deletion independent of mitochondrial respiration. To do so, we constructed ρ0 strains (which lack mitochondrial DNA) of the WT and CL mutants. Although CL-deficient cells grow normally on glucose (Fig. 2A), which can be fermented, growth on glucose is compromised in the mutants if they lack mitochondrial DNA (Fig. 2B). Deletion of CLD1 rescued this growth defect (Fig. 2B). We predicted that CL-deficient cells would exhibit a decreased chronological life span similar to the decreased replicative life span observed in these cells (
      • Zhou J.
      • Zhong Q.
      • Li G.
      • Greenberg M.L.
      Loss of cardiolipin leads to longevity defects that are alleviated by alterations in stress response signaling.
      ). As shown in Fig. 2C, both crd1Δ and taz1Δ mutants exhibited a dramatic decrease in chronological life span. Deletion of CLD1 partially rescued the decrease in taz1Δ life span, as the life span of taz1Δcld1Δ was almost similar to that of WT (Fig. 2C). The observation that deletion of CLD1 suppresses the defects in taz1Δ indicates that deacylation of CL is deleterious in the absence of tafazzin and that the decreased CL/MLCL ratio but not decreased CL unsaturation is likely the primary cause of taz1Δ defects.
      Figure thumbnail gr2
      FIGURE 2Deletion of CLD1 rescues growth and chronological life span defects in taz1Δ. A, serial 10-fold dilutions of WT, crd1Δ, cld1Δ, taz1Δ, and crd1Δtaz1Δ cells were spotted on synthetic complete medium with 2% glucose or 2% ethanol as carbon sources. Plates were incubated at 30 °C for 3 days. B, serial 10-fold dilutions of respiration-incompetent (ρ0) cells of the above mutants were spotted on synthetic complete medium with 2% glucose. C, chronological life span of WT, crd1Δ, cld1Δ, taz1Δ, and crd1Δtaz1Δ cells was determined as described under “Experimental Procedures.” The data depicted in the figure are representative of three experiments.

       CLD1 Expression Is Highly Regulated in Response to Growth Phase, Glucose Availability, and Respiratory Activity

      The finding that cld1Δ rescued respiratory defects in taz1Δ suggested that CLD1 expression plays a role in respiration. We first compared expression of CL biosynthetic genes, including PGS1, GEP4, CRD1, CLD1, and TAZ1, in logarithmically growing cells (in which energy is generated primarily from glycolysis) and in cells in the stationary phase (during which energy is generated from respiration). Expression of all the CL biosynthetic genes was increased in the stationary phase (Fig. 3A). However, although PGS1, GEP4, CRD1, and TAZ1 were increased about 3–5-fold, CLD1 was increased by about 10-fold in the early stationary phase and more than 30-fold in the later stationary phase (Fig. 3A). The large increase in CLD1 expression suggests that levels of unsaturated CL may be increased during the stationary phase. This was in fact observed (Fig. 3B). Specifically, in the C68 cluster, the most unsaturated CL (C68:4, m/z 699.5) was abundant, whereas a more saturated species (C68:2, m/z 701.5) was less abundant in stationary phase cells. Conversely, the C68:4 CL was much less abundant than C68:2 in logarithmically growing cells. This is also evident in the C60 cluster as the most saturated CL (C60:0, m/z 647.4) was absent from stationary cells but was clearly present in logarithmically growing cells. Deletion of CLD1 prevents CL remodeling and leads to decreased unsaturated CL (
      • Beranek A.
      • Rechberger G.
      • Knauer H.
      • Wolinski H.
      • Kohlwein S.D.
      • Leber R.
      Identification of a cardiolipin-specific phospholipase encoded by the gene CLD1 (YGR110W) in yeast.
      ). As expected, cld1Δ exhibited a decreased degree of unsaturated CL compared with WT regardless of growth phase (Fig. 3C). Interestingly, unsaturated CL levels were greater in stationary phase than in log phase cld1Δ cells. This finding suggests that an as yet unidentified mechanism regulates CL saturation in the absence of Cld1.
      Figure thumbnail gr3a
      FIGURE 3Increased CLD1 expression in the stationary phase is concomitant with increased CL unsaturation. A, WT cells were grown in SC medium to the early logarithmic (EL), mid-logarithmic (ML), early stationary (ES), and stationary (S) growth phases, and PGS1, GEP4, CRD1, CLD1, and TAZ1 expression was quantified by RT-PCR as described under “Experimental Procedures.” Values of each gene were normalized to the internal control ACT1 and are represented as fold change relative to those in early logarithmic phase. Data shown are mean ± S.E. (n = 3). B, cells grown in YPD in the logarithmic and stationary phases were extracted for CL acyl composition analysis by HPLC-mass spectrometry, as described under “Experimental Procedures.” C, WT and cld1Δ cells grown in SC media in the logarithmic and stationary phases were extracted for CL acyl composition analysis by HPLC-mass spectrometry, as described under “Experimental Procedures.”
      Figure thumbnail gr3b
      FIGURE 3Increased CLD1 expression in the stationary phase is concomitant with increased CL unsaturation. A, WT cells were grown in SC medium to the early logarithmic (EL), mid-logarithmic (ML), early stationary (ES), and stationary (S) growth phases, and PGS1, GEP4, CRD1, CLD1, and TAZ1 expression was quantified by RT-PCR as described under “Experimental Procedures.” Values of each gene were normalized to the internal control ACT1 and are represented as fold change relative to those in early logarithmic phase. Data shown are mean ± S.E. (n = 3). B, cells grown in YPD in the logarithmic and stationary phases were extracted for CL acyl composition analysis by HPLC-mass spectrometry, as described under “Experimental Procedures.” C, WT and cld1Δ cells grown in SC media in the logarithmic and stationary phases were extracted for CL acyl composition analysis by HPLC-mass spectrometry, as described under “Experimental Procedures.”
      Increased CLD1 expression in the stationary phase, during which glucose is exhausted and cells shift from fermentation to oxidative phosphorylation, suggested that CLD1 may be transcriptionally regulated in response to glucose availability and the need to respire. To test this prediction, we examined the expression of CLD1 in response to acute removal of glucose and in respiration-deficient cells (ρ0 cells). As expected, expression of CLD1 but not the other CL biosynthetic genes was greatly increased in response to glucose starvation, by 6- and 10-fold, during the 30- and 60-min starvation, respectively (Fig. 4A). Furthermore, CLD1 transcription was increased in the stationary phase in ρ+ cells but not in respiration-incompetent ρ0 cells (Fig. 4B). These findings indicate that CLD1 expression is up-regulated during respiratory conditions and in response to glucose deprivation.
      Figure thumbnail gr4
      FIGURE 4CLD1 expression is increased in response to respiration and activated by HAP. A, glucose limitation. WT cells harvested in the mid-logarithmic phase were washed with pre-warmed media with or without glucose and resuspended in fresh media with or without glucose for 30 and 60 min. Analyses of PGS1, GEP4, CRD1, CLD1, and TAZ1 expression were determined using RT-qPCR and normalized to ACT1, as described under “Experimental Procedures.” The data represent fold change relative to expression in media containing glucose and include the mean ± S.E. (n = 6). B, respiratory competency. ρ+ and ρ0 cells were grown to the mid-logarithmic (ML) and early stationary (ES) phases. The values shown represent the fold change relative to expression of WT ρ+ cells in mid-logarithmic phase and include mean ± S.E. (n = 6). C, sequence alignment depicting consensus sequences for Mig1 and Hap2 in the upstream region of the CLD1 gene using the promoter database of S. cerevisiae. 1 indicates a 100% match with putative consensus sequences, and 0.88 and 0.82 indicate one mismatch. D, effect of the HAP complex. Expression was determined in hap2Δ, hap3Δ, hap4Δ, and hap5Δ cells grown to the mid-logarithmic phase. Data shown are mean ± S.E. (n = 6). E, effect of MIG1. Expression was determined in WT and mig1Δ cells grown to the mid-logarithmic phase. Data shown are mean ± S.E. (n = 3).
      Using the promoter database of S. cerevisiae to search for putative regulatory elements in the upstream region of the CLD1 gene, we identified consensus sequences for Hap2 and Mig1 (Fig. 4C), transcription factors that mediate activation of respiratory gene expression and glucose repression, respectively (
      • Nehlin J.O.
      • Ronne H.
      Yeast MIG1 repressor is related to the mammalian early growth response and Wilms' tumour finger proteins.
      ,
      • Pfeifer K.
      • Kim K.S.
      • Kogan S.
      • Guarente L.
      Functional dissection and sequence of yeast HAP1 activator.
      ,
      • Santangelo G.M.
      Glucose signaling in Saccharomyces cerevisiae.
      ). Consistent with this observation, the HAP complex regulates CLD1. As seen in Fig. 4D, CLD1 expression in the stationary phase was greatly reduced in hap2Δ, hap3Δ, hap4Δ, and hap5Δ mutants, indicating that the HAP complex up-regulates CLD1 transcription. Mig1 has been shown to repress gene expression in the presence of glucose (
      • Santangelo G.M.
      Glucose signaling in Saccharomyces cerevisiae.
      ,
      • Schüller H.J.
      Transcriptional control of nonfermentative metabolism in the yeast Saccharomyces cerevisiae.
      ). If Mig1 repressed CLD1 transcription in the presence of glucose, CLD1 transcription would be increased in mig1Δ cells. However, CLD1 transcription in mig1Δ cells was decreased in these conditions (Fig. 4E). Thus, Mig1 appears to be a positive regulator of CLD1 expression. This is consistent with reported activator activity of Mig1 (
      • Bu Y.
      • Schmidt M.C.
      Identification of cis-acting elements in the SUC2 promoter of Saccharomyces cerevisiae required for activation of transcription.
      ,
      • Wu J.
      • Trumbly R.J.
      Multiple regulatory proteins mediate repression and activation by interaction with the yeast Mig1 binding site.
      ). Taken together, these findings indicate that expression of CLD1 is increased in response to respiration conditions, and this increase is mediated by the HAP and Mig1 transcriptional factors.

       Constitutive Overexpression of CLD1 Leads to Decreases in Respiration and Mitochondrial Aconitase Activity and Instability of Mitochondrial DNA

      As expression of CLD1 is deleterious to tafazzin-deficient cells, we predicted that increased CLD1 expression alters metabolism and perturbs cell growth. Consistent with this, cell growth was decreased when CLD1 was overexpressed (Fig. 5A). One possible explanation for this is that increased CLD1 expression perturbs respiration. In support of this, basal respiration in mitochondria from cells that overexpressed CLD1 was about half that of control cells (Fig. 5B). This difference was even more pronounced comparing the maximum respiratory capacity that was achieved by uncoupling the respiratory chain with FCCP. Therefore, constitutive overexpression of CLD1 decreases mitochondrial respiration.
      Figure thumbnail gr5
      FIGURE 5Overexpression of CLD1 decreases cell growth, respiration, and mitochondrial aconitase activity. A, growth of WT cells in SC media overexpressing CLD1 or empty vector (EV). Cells were inoculated at an initial A550 of 0.05, and A550 was measured at the indicated times. The growth curves shown in the figure are representative of three experiments. B, oxygen consumption was measured in logarithmically growing cells using a Clark-type electrode as described under “Experimental Procedures.” Data shown are mean ± S.E. (n = 3–6). C, kinetics of aconitase enzymatic activity in mitochondria from control and CLD1-overexpressing cells grown to the logarithmic phase were determined as described under “Experimental Procedures.” Data shown are mean ± S.E. (n = 3).
      A possible mechanism to account for decreased respiration in CLD1-overexpressing cells is suggested by the observation that over 60% of cells became cytoplasmic petites. The respiratory growth deficiency of the petites was not complemented by crossing to ρ tester strains, and mitochondrial DNA was not observed in the petite cells stained with DAPI. As aconitase is required for mitochondrial genome maintenance (
      • Chen X.J.
      • Wang X.
      • Kaufman B.A.
      • Butow R.A.
      Aconitase couples metabolic regulation to mitochondrial DNA maintenance.
      ), we tested the possibility that aconitase activity might be decreased in cells overexpressing CLD1. In fact, the kinetics of aconitase enzymatic activity in mitochondria from CLD1-overexpressing cells exhibited a 60% decrease compared with cells overexpressing empty vector (Fig. 5C). Taken together, these studies indicate that increasing CL deacylation by constitutive overexpression of CLD1 impairs cell growth and respiration and decreases mitochondrial DNA stability, suggesting that deacylation of CL is an important control point for mitochondrial function.

       Increased Fermentation Compensates for Decreased Respiration in Cells Overexpressing CLD1

      As respiration was decreased in cells overexpressing CLD1, we expected to see a concomitant decrease in ATP synthesis. The contribution of mitochondria to cellular ATP production can be estimated by the decrease in oxygen consumption resulting from the addition of oligomycin, an inhibitor of ATP synthesis. Under basal conditions, the decrease in respiration caused by oligomycin was significantly less in mitochondria from CLD1-overexpressing cells than in controls (Fig. 5B), suggesting that mitochondrial ATP synthesis was decreased. Interestingly, however, total ATP levels were actually higher in CLD1-overexpressing cells (Fig. 6A). This suggested that cells may compensate for the respiratory loss by increasing ATP generation from fermentation. Consistent with this, ethanol production was significantly higher in CLD1-overexpressing cells than in controls (Fig. 6B). To determine whether up-regulation of genes in glycolysis/fermentation could account for increased ethanol production, we analyzed expression of GAPDH and PGK1, which encode enzymes that catalyze key steps in glycolysis (glyceraldehyde-3-P dehydrogenase and phosphoglycerate kinase, respectively), as well as ADH1 and ADH2, which encode the fermentation enzyme alcohol dehydrogenase. As seen in Fig. 6C, expression of ADH1 and ADH2 was increased 2-fold, which most likely accounts for the increase in ethanol production. Expression of GAPDH and PGK1 was not altered. These findings indicate that overexpression of CLD1 leads to decreased mitochondrial respiration and ATP synthesis, which is compensated by increasing glycolysis.
      Figure thumbnail gr6
      FIGURE 6Overexpression of CLD1 leads to increased ATP and ethanol. A, ATP levels in logarithmically growing cells overexpressing CLD1 or empty vector (EV) were determined as described under “Experimental Procedures.” Data shown are mean ± S.E. (n = 3). B, ethanol concentrations were determined as described under “Experimental Procedures.” Data shown are mean ± S.E. (n = 6) (*, p < 0.05; **, p < 0.01). C, WT cells overexpressing CLD1 or empty vector grown to the logarithmic phase were harvested for mRNA extraction. Expression of ADH1, ADH2, GAPDH, and PGK1 was determined using RT-qPCR as described under “Experimental Procedures.” Values of each gene were normalized to the internal control ACT1. Transcripts normalized to ACT1 are represented as fold change relative to those in control cells. Data shown are mean ± S.E. (n = 3).

      DISCUSSION

      A deficiency in CL reacylation catalyzed by tafazzin is deleterious in eukaryotes (
      • Gu Z.
      • Valianpour F.
      • Chen S.
      • Vaz F.M.
      • Hakkaart G.A.
      • Wanders R.J.
      • Greenberg M.L.
      Aberrant cardiolipin metabolism in the yeast taz1 mutant: a model for Barth syndrome.
      ,
      • Schlame M.
      • Kelley R.I.
      • Feigenbaum A.
      • Towbin J.A.
      • Heerdt P.M.
      • Schieble T.
      • Wanders R.J.
      • DiMauro S.
      • Blanck T.J.
      Phospholipid abnormalities in children with Barth syndrome.
      ,
      • Valianpour F.
      • Wanders R.J.
      • Barth P.G.
      • Overmars H.
      • van Gennip A.H.
      Quantitative and compositional study of cardiolipin in platelets by electrospray ionization mass spectrometry: application for the identification of Barth syndrome patients.
      ,
      • Vreken P.
      • Valianpour F.
      • Nijtmans L.G.
      • Grivell L.A.
      • Plecko B.
      • Wanders R.J.
      • Barth P.G.
      Defective remodeling of cardiolipin and phosphatidylglycerol in Barth syndrome.
      ,
      • Xu Y.
      • Condell M.
      • Plesken H.
      • Edelman-Novemsky I.
      • Ma J.
      • Ren M.
      • Schlame M.
      A Drosophila model of Barth syndrome.
      ,
      • Acehan D.
      • Vaz F.
      • Houtkooper R.H.
      • James J.
      • Moore V.
      • Tokunaga C.
      • Kulik W.
      • Wansapura J.
      • Toth M.J.
      • Strauss A.
      • Khuchua Z.
      Cardiac and skeletal muscle defects in a mouse model of human Barth syndrome.
      ), most notably in humans where it leads to the life-threatening disorder BTHS (
      • Barth P.G.
      • Scholte H.R.
      • Berden J.A.
      • Van der Klei-Van Moorsel J.M.
      • Luyt-Houwen I.E.
      • Van 't Veer-Korthof E.T.
      • Van der Harten J.J.
      • Sobotka-Plojhar M.A.
      An X-linked mitochondrial disease affecting cardiac muscle, skeletal muscle and neutrophil leucocytes.
      ,
      • Barth P.G.
      • Wanders R.J.
      • Vreken P.
      • Janssen E.A.
      • Lam J.
      • Baas F.
      X-linked cardioskeletal myopathy and neutropenia (Barth syndrome) (MIM 302060).
      ,
      • Barth P.G.
      • Valianpour F.
      • Bowen V.M.
      • Lam J.
      • Duran M.
      • Vaz F.M.
      • Wanders R.J.
      X-linked cardioskeletal myopathy and neutropenia (Barth syndrome): an update.
      ). The loss of tafazzin results in perturbation of CL metabolism. Specifically, the CL/MLCL ratio is decreased, as are the levels of unsaturated CL species. Although many studies suggest that the deleterious effects of tafazzin deficiency result from the absence of unsaturated CL (
      • Xu Y.
      • Kelley R.I.
      • Blanck T.J.
      • Schlame M.
      Remodeling of cardiolipin by phospholipid transacylation.
      ,
      • Schlame M.
      • Kelley R.I.
      • Feigenbaum A.
      • Towbin J.A.
      • Heerdt P.M.
      • Schieble T.
      • Wanders R.J.
      • DiMauro S.
      • Blanck T.J.
      Phospholipid abnormalities in children with Barth syndrome.
      ,
      • Schlame M.
      • Towbin J.A.
      • Heerdt P.M.
      • Jehle R.
      • DiMauro S.
      • Blanck T.J.
      Deficiency of tetralinoleoyl-cardiolipin in Barth syndrome.
      ,
      • Schlame M.
      • Ren M.
      Barth syndrome, a human disorder of cardiolipin metabolism.
      ,
      • Valianpour F.
      • Wanders R.J.
      • Overmars H.
      • Vaz F.M.
      • Barth P.G.
      • van Gennip A.H.
      Linoleic acid supplementation of Barth syndrome fibroblasts restores cardiolipin levels: implications for treatment.
      ), no reports to date have distinguished between decreased unsaturated CL and decreased CL/MLCL as the cause of the cellular defects. In this study, we addressed this question by characterizing the effects of CLD1 deletion on tafazzin-deficient yeast cells. The cld1Δ mutant has decreased unsaturated CL (similar to the taz1Δ mutant), but the CL/MLCL ratio is not decreased. We report that cld1Δ rescues growth and respiration defects of the taz1Δ mutant, indicating that the decreased CL/MLCL ratio, and not decreased unsaturated CL, leads to the defects in tafazzin-deficient cells.
      Interestingly, the double mutant cld1Δtaz1Δ exhibited defective growth in glycerol/ethanol medium at 37 °C as reported in Beranek et al. (
      • Beranek A.
      • Rechberger G.
      • Knauer H.
      • Wolinski H.
      • Kohlwein S.D.
      • Leber R.
      Identification of a cardiolipin-specific phospholipase encoded by the gene CLD1 (YGR110W) in yeast.
      ). We tested growth of WT, crd1Δ, cld1Δ, taz1Δ, and cld1Δtaz1Δ cells in media containing glucose, glycerol, ethanol, or glycerol/ethanol as carbon sources. Indeed, we found that the double mutant grew poorly compared with WT when glycerol/ethanol was used as carbon source, similar to the observation of Beranek et al. (
      • Beranek A.
      • Rechberger G.
      • Knauer H.
      • Wolinski H.
      • Kohlwein S.D.
      • Leber R.
      Identification of a cardiolipin-specific phospholipase encoded by the gene CLD1 (YGR110W) in yeast.
      ). However, in these carbon sources, we did not observe respiratory growth defects in taz1Δ at 30 °C. Although taz1Δ exhibited decreased growth in glycerol/ethanol at 37 °C, high temperature stress complicates respiration defects. In marked contrast, we observed that taz1Δ cells exhibit a significant respiratory growth defect in ethanol medium at 30 °C. Under these conditions, we observed that the double mutant rescued the respiratory defects of taz1Δ. As cld1Δ restores CL levels but not unsaturated CL species in taz1Δ, this finding indicates that rescue of respiratory growth of taz1Δ by cld1Δ results from restoration of CL levels.
      Although deletion of CLD1 does not appear to affect growth, expression of the gene is deleterious in the absence of reacylation, as taz1Δ cells that have the wild type CLD1 gene are defective, whereas those carrying the cld1Δ mutation grow normally. To gain insight into the mechanism underlying the deleterious effects of increased CLD1, we characterized growth and mitochondrial function of cells overexpressing this gene. Interestingly, overexpression of CLD1 resulted in increased ATP levels (Fig. 6A) despite a significant reduction in mitochondrial respiration (Fig. 5B). Two possibilities may explain this seemingly surprising finding. First, overexpression of CLD1 leads to a growth slowdown, and therefore less ATP is required and utilized to maintain cellular functions. Second, CLD1 overexpression shifts metabolism from respiration toward glycolysis and fermentation (Fig. 7), compensating for defective oxidative phosphorylation. This indicates that regulation of Cld1-mediated deacylation of CL influences energy metabolism by modulating the relative contribution of glycolysis and respiration. CL is an essential component of oxidative phosphorylation complexes. For example, it was identified in the crystal structure of cytochrome c oxidase (
      • Shinzawa-Itoh K.
      • Aoyama H.
      • Muramoto K.
      • Terada H.
      • Kurauchi T.
      • Tadehara Y.
      • Yamasaki A.
      • Sugimura T.
      • Kurono S.
      • Tsujimoto K.
      • Mizushima T.
      • Yamashita E.
      • Tsukihara T.
      • Yoshikawa S.
      Structures and physiological roles of 13 integral lipids of bovine heart cytochrome c oxidase.
      ), the proposed rate-limiting enzyme of the electron transport chain (reviewed in Ref.
      • Hüttemann M.
      • Lee I.
      • Grossman L.I.
      • Doan J.W.
      • Sanderson T.H.
      Phosphorylation of mammalian cytochrome c and cytochrome c oxidase in the regulation of cell destiny: respiration, apoptosis, and human disease.
      ), and is required for optimal enzyme function and activity (
      • Koshkin V.
      • Greenberg M.L.
      Oxidative phosphorylation in cardiolipin-lacking yeast mitochondria.
      ). Therefore, reduced mitochondrial respiration in CLD1-overexpressing cells would be expected if the CL pool is modified. (We hypothesize that during stationary growth, when oxidative phosphorylation is used, CL may be tuned toward increased membrane fluidity or association with the supercomplexes.) Furthermore, such alterations lead to mitochondrial DNA instability.
      Figure thumbnail gr7
      FIGURE 7Proposed model. Regulation of Cld1-mediated deacylation of CL influences energy metabolism. CLD1 expression is up-regulated in response to increased respiration. Increased CLD1 expression modulates the relative contributions of oxidative phosphorylation and glycolysis to cellular energy production. We speculate that the function of CL deacylation, which is increased during respiratory conditions that are known to increase oxidative stress, is to remove peroxidized acyl chains from damaged CL.
      Apparently, there is yet another level of regulation of the CL metabolic pathway intersecting with cytochrome c oxidase regulation. We show here that CLD1 gene regulation is mediated by the Hap2/3/4/5p transcription factor complex (Fig. 4E), which is also a crucial regulator of cytochrome c oxidase subunit V isoforms Va and Vb (
      • Kwast K.E.
      • Burke P.V.
      • Staahl B.T.
      • Poyton R.O.
      Oxygen sensing in yeast: evidence for the involvement of the respiratory chain in regulating the transcription of a subset of hypoxic genes.
      ). These isoforms result in an enzyme with higher affinity for oxygen when the substrate is scarce. Furthermore, overexpression of components of the Hap2/3/4/5p complex rescues cytochrome c oxidase deficiencies (
      • Fontanesi F.
      • Jin C.
      • Tzagoloff A.
      • Barrientos A.
      Transcriptional activators HAP/NF-Y rescue a cytochrome c oxidase defect in yeast and human cells.
      ). In another example of coordinate control, regulation of COX4 translation requires Pgs1, the enzyme that catalyzes the committed step of CL synthesis (
      • Su X.
      • Dowhan W.
      Translational regulation of nuclear gene COX4 expression by mitochondrial content of phosphatidylglycerol and cardiolipin in Saccharomyces cerevisiae.
      ). Taken together these findings suggest an integrated and concerted response to environmental stress that affects the CL pathway and oxidative phosphorylation, both of which are interconnected.
      Our findings suggest that increased CLD1 is deleterious to cells because it decreases respiration. However, CLD1 expression was increased during respiratory growth and regulated by the HAP complex (Fig. 4), the transcriptional activator that responds to respiratory growth signals. This raises the following question. What is the function of the CL remodeling pathway? It also raises the following corollary question. Why is CLD1 expression increased in response to respiratory conditions? We speculate that the function of CL remodeling is to remediate the deleterious effects of respiration (Fig. 7). In support of this possibility, superoxides generated by respiratory complex III cause peroxidation of CL and decreased cytochrome c oxidase activity (
      • Paradies G.
      • Ruggiero F.M.
      • Petrosillo G.
      • Quagliariello E.
      Peroxidative damage to cardiac mitochondria: cytochrome oxidase and cardiolipin alterations.
      ,
      • Paradies G.
      • Petrosillo G.
      • Pistolese M.
      • Ruggiero F.M.
      The effect of reactive oxygen species generated from the mitochondrial electron transport chain on the cytochrome c oxidase activity and on the cardiolipin content in bovine heart submitochondrial particles.
      ,
      • Paradies G.
      • Petrosillo G.
      • Pistolese M.
      • Ruggiero F.M.
      Reactive oxygen species generated by the mitochondrial respiratory chain affect the complex III activity via cardiolipin peroxidation in beef-heart submitochondrial particles.
      ). Exogenous supplementation of CL, but not peroxidized CL or other phospholipids, rescued both reduced activity of cytochrome c oxidase and increased generation of reactive oxygen species in the reperfused heart (
      • Paradies G.
      • Petrosillo G.
      • Pistolese M.
      • Ruggiero F.M.
      Reactive oxygen species generated by the mitochondrial respiratory chain affect the complex III activity via cardiolipin peroxidation in beef-heart submitochondrial particles.
      ,
      • Petrosillo G.
      • Portincasa P.
      • Grattagliano I.
      • Casanova G.
      • Matera M.
      • Ruggiero F.M.
      • Ferri D.
      • Paradies G.
      Mitochondrial dysfunction in rat with nonalcoholic fatty liver Involvement of complex I, reactive oxygen species and cardiolipin.
      ). In this light, CL remodeling may be a mechanism whereby damaged fatty acyl chains are replaced. Although different approaches have been used, this proposed model is similar to the model described in Baile et al. (
      • Baile M.G.
      • Whited K.
      • Claypool S.M.
      Deacylation on the matrix side of the mitochondrial inner membrane regulates cardiolipin remodeling.
      ), in which they suggested a feedback loop between oxidative phosphorylation and CL remodeling. Specifically, they found that CLD1 expression is regulated by carbon sources, and the activity of Cld1 is increased by dissipating the mitochondrial membrane potential (
      • Baile M.G.
      • Whited K.
      • Claypool S.M.
      Deacylation on the matrix side of the mitochondrial inner membrane regulates cardiolipin remodeling.
      ). They suggested that CL remodeling functions to increase oxidative phosphorylation efficiency and/or replace oxidized CL.
      Our findings have implications for understanding the mechanism underlying BTHS. Many studies of BTHS have concluded that the disorder is due to the complete lack of the “normal” unsaturated (tetralinoleoyl or L4) CL in the heart (
      • Xu Y.
      • Kelley R.I.
      • Blanck T.J.
      • Schlame M.
      Remodeling of cardiolipin by phospholipid transacylation.
      ,
      • Schlame M.
      • Kelley R.I.
      • Feigenbaum A.
      • Towbin J.A.
      • Heerdt P.M.
      • Schieble T.
      • Wanders R.J.
      • DiMauro S.
      • Blanck T.J.
      Phospholipid abnormalities in children with Barth syndrome.
      ,
      • Schlame M.
      • Towbin J.A.
      • Heerdt P.M.
      • Jehle R.
      • DiMauro S.
      • Blanck T.J.
      Deficiency of tetralinoleoyl-cardiolipin in Barth syndrome.
      ,
      • Schlame M.
      • Ren M.
      Barth syndrome, a human disorder of cardiolipin metabolism.
      ,
      • Valianpour F.
      • Wanders R.J.
      • Overmars H.
      • Vaz F.M.
      • Barth P.G.
      • van Gennip A.H.
      Linoleic acid supplementation of Barth syndrome fibroblasts restores cardiolipin levels: implications for treatment.
      ). However, this study indicates that in yeast, a total lack of the normal unsaturated CL species is not deleterious to cells. The large number of mammalian phospholipases complicates the ability to distinguish between decreased CL/MLCL versus decreased unsaturated CL in human cells. Gross and co-workers (
      • Kiebish M.A.
      • Yang K.
      • Liu X.
      • Mancuso D.J.
      • Guan S.
      • Zhao Z.
      • Sims H.F.
      • Cerqua R.
      • Cade W.T.
      • Han X.
      • Gross R.W.
      Dysfunctional cardiac mitochondrial bioenergetic, lipidomic, and signaling in a murine model of Barth syndrome.
      ) reported that ablation of phospholipase calcium-independent PLA2γ in the mouse reduced MLCL levels by only ∼50% indicating that other phospholipases deacylate CL. Mass spectrometry analysis of phospholipase activity identified at least four phospholipases that deacylate CL in vitro (
      • Hsu Y.H.
      • Dumlao D.S.
      • Cao J.
      • Dennis E.A.
      Assessing phospholipase A2 activity toward cardiolipin by mass spectrometry.
      ). The identification of mammalian CL-specific phospholipases may ultimately enable this question to be addressed.

       Note Added in Proof

      During the review of this paper, a study was published reporting that remodeled and unremodeled cardiolipin are functionally indistinguishable in yeast (Baile et al., Nov. 27, 2013 (
      • Baile M.G.
      • Sathappa M.
      • Lu Y.W.
      • Pryce E.
      • Whited K.
      • McCaffery J.M.
      • Han X.
      • Alder N.N.
      • Claypool S.M.
      Unremodeled and remodeled cardiolipin are functionally indistinguishable in yeast.
      )). Consistent with our findings that deletion of CLD1 rescued taz1Δ growth and life span defects, Baile et al. showed that defective growth of taz1Δ was rescued by cld1Δ in different genetic backgrounds, which further supports the conclusion that CLD1 expression is deleterious in the absence of TAZ1. Interestingly, they demonstrated that CL remodeling is not required for mitochondrial morphology or optimal oxidative phosphorylation activity. Despite the importance of CL in mitochondrial morphology and functions, the remodeling of CL seems to be dispensable. In contrast, our findings suggested that excessive CL remodeling is deleterious as CLD1 overexpression leads to decreased respiration and instability of mitochondrial DNA. Taken together, the findings in both studies have important implications for BTHS, because if decreased CL/MLCL and not altered CL acyl composition is the cause of the pathology, attenuation of CL-specific phospholipase activity may be a potential strategy to treat BTHS patients.

      REFERENCES

        • Hostetler K.Y.
        • van den Bosch H.
        • van Deenen L.L.
        The mechanism of cardiolipin biosynthesis in liver mitochondria.
        Biochim. Biophys. Acta. 1972; 260: 507-513
        • Joshi A.S.
        • Zhou J.
        • Gohil V.M.
        • Chen S.
        • Greenberg M.L.
        Cellular functions of cardiolipin in yeast.
        Biochim. Biophys. Acta. 2009; 1793: 212-218
        • Pangborn M.C.
        The composition of cardiolipin.
        J. Biol. Chem. 1947; 168: 351-361
        • Lecocq J.
        • Ballou C.E.
        On the structure of cardiolipin.
        Biochemistry. 1964; 3: 976-980
        • Jakovcic S.
        • Getz G.S.
        • Rabinowitz M.
        • Jakob H.
        • Swift H.
        Cardiolipin content of wild type and mutant yeasts in relation to mitochondrial function and development.
        J. Cell Biol. 1971; 48: 490-502
        • Schlame M.
        • Rua D.
        • Greenberg M.L.
        The biosynthesis and functional role of cardiolipin.
        Prog. Lipid Res. 2000; 39: 257-288
        • Claypool S.M.
        Cardiolipin, a critical determinant of mitochondrial carrier protein assembly and function.
        Biochim. Biophys. Acta. 2009; 1788: 2059-2068
        • Schlame M.
        • Ren M.
        The role of cardiolipin in the structural organization of mitochondrial membranes.
        Biochim. Biophys. Acta. 2009; 1788: 2080-2083
        • Klingenberg M.
        Cardiolipin and mitochondrial carriers.
        Biochim. Biophys. Acta. 2009; 1788: 2048-2058
        • Beyer K.
        • Klingenberg M.
        ADP/ATP carrier protein from beef heart mitochondria has high amounts of tightly bound cardiolipin, as revealed by 31P nuclear magnetic resonance.
        Biochemistry. 1985; 24: 3821-3826
        • Claypool S.M.
        • Oktay Y.
        • Boontheung P.
        • Loo J.A.
        • Koehler C.M.
        Cardiolipin defines the interactome of the major ADP/ATP carrier protein of the mitochondrial inner membrane.
        J. Cell Biol. 2008; 182: 937-950
        • Lange C.
        • Nett J.H.
        • Trumpower B.L.
        • Hunte C.
        Specific roles of protein-phospholipid interactions in the yeast cytochrome bc1 complex structure.
        EMBO J. 2001; 20: 6591-6600
        • Palsdottir H.
        • Lojero C.G.
        • Trumpower B.L.
        • Hunte C.
        Structure of the yeast cytochrome bc1 complex with a hydroxyquinone anion Qo site inhibitor bound.
        J. Biol. Chem. 2003; 278: 31303-31311
        • Eble K.S.
        • Coleman W.B.
        • Hantgan R.R.
        • Cunningham C.C.
        Tightly associated cardiolipin in the bovine heart mitochondrial ATP synthase as analyzed by 31P nuclear magnetic resonance spectroscopy.
        J. Biol. Chem. 1990; 265: 19434-19440
        • Shinzawa-Itoh K.
        • Aoyama H.
        • Muramoto K.
        • Terada H.
        • Kurauchi T.
        • Tadehara Y.
        • Yamasaki A.
        • Sugimura T.
        • Kurono S.
        • Tsujimoto K.
        • Mizushima T.
        • Yamashita E.
        • Tsukihara T.
        • Yoshikawa S.
        Structures and physiological roles of 13 integral lipids of bovine heart cytochrome c oxidase.
        EMBO J. 2007; 26: 1713-1725
        • Pfeiffer K.
        • Gohil V.
        • Stuart R.A.
        • Hunte C.
        • Brandt U.
        • Greenberg M.L.
        • Schägger H.
        Cardiolipin stabilizes respiratory chain supercomplexes.
        J. Biol. Chem. 2003; 278: 52873-52880
        • Zhang M.
        • Mileykovskaya E.
        • Dowhan W.
        Gluing the respiratory chain together. Cardiolipin is required for supercomplex formation in the inner mitochondrial membrane.
        J. Biol. Chem. 2002; 277: 43553-43556
        • Jiang F.
        • Ryan M.T.
        • Schlame M.
        • Zhao M.
        • Gu Z.
        • Klingenberg M.
        • Pfanner N.
        • Greenberg M.L.
        Absence of cardiolipin in the crd1 null mutant results in decreased mitochondrial membrane potential and reduced mitochondrial function.
        J. Biol. Chem. 2000; 275: 22387-22394
        • Gohil V.M.
        • Hayes P.
        • Matsuyama S.
        • Schägger H.
        • Schlame M.
        • Greenberg M.L.
        Cardiolipin biosynthesis and mitochondrial respiratory chain function are interdependent.
        J. Biol. Chem. 2004; 279: 42612-42618
        • DeVay R.M.
        • Dominguez-Ramirez L.
        • Lackner L.L.
        • Hoppins S.
        • Stahlberg H.
        • Nunnari J.
        Coassembly of Mgm1 isoforms requires cardiolipin and mediates mitochondrial inner membrane fusion.
        J. Cell Biol. 2009; 186: 793-803
        • Joshi A.S.
        • Thompson M.N.
        • Fei N.
        • Hüttemann M.
        • Greenberg M.L.
        Cardiolipin and mitochondrial phosphatidylethanolamine have overlapping functions in mitochondrial fusion in Saccharomyces cerevisiae.
        J. Biol. Chem. 2012; 287: 17589-17597
        • Gebert N.
        • Joshi A.S.
        • Kutik S.
        • Becker T.
        • McKenzie M.
        • Guan X.L.
        • Mooga V.P.
        • Stroud D.A.
        • Kulkarni G.
        • Wenk M.R.
        • Rehling P.
        • Meisinger C.
        • Ryan M.T.
        • Wiedemann N.
        • Greenberg M.L.
        • Pfanner N.
        Mitochondrial cardiolipin involved in outer-membrane protein biogenesis: implications for Barth syndrome.
        Curr. Biol. 2009; 19: 2133-2139
        • Zhong Q.
        • Gvozdenovic-Jeremic J.
        • Webster P.
        • Zhou J.
        • Greenberg M.L.
        Loss of function of KRE5 suppresses temperature sensitivity of mutants lacking mitochondrial anionic lipids.
        Mol. Biol. Cell. 2005; 16: 665-675
        • Zhong Q.
        • Li G.
        • Gvozdenovic-Jeremic J.
        • Greenberg M.L.
        Up-regulation of the cell integrity pathway in Saccharomyces cerevisiae suppresses temperature sensitivity of the pgs1Δ mutant.
        J. Biol. Chem. 2007; 282: 15946-15953
        • Chen S.
        • Tarsio M.
        • Kane P.M.
        • Greenberg M.L.
        Cardiolipin mediates cross-talk between mitochondria and the vacuole.
        Mol. Biol. Cell. 2008; 19: 5047-5058
        • Chen S.
        • Liu D.
        • Finley Jr., R.L.
        • Greenberg M.L.
        Loss of mitochondrial DNA in the yeast cardiolipin synthase crd1 mutant leads to up-regulation of the protein kinase Swe1p that regulates the G2/M transition.
        J. Biol. Chem. 2010; 285: 10397-10407
        • Zhou J.
        • Zhong Q.
        • Li G.
        • Greenberg M.L.
        Loss of cardiolipin leads to longevity defects that are alleviated by alterations in stress response signaling.
        J. Biol. Chem. 2009; 284: 18106-18114
        • Gonzalvez F.
        • Gottlieb E.
        Cardiolipin: setting the beat of apoptosis.
        Apoptosis. 2007; 12: 877-885
        • Houtkooper R.H.
        • Vaz F.M.
        Cardiolipin, the heart of mitochondrial metabolism.
        Cell. Mol. Life Sci. 2008; 65: 2493-2506
        • Schug Z.T.
        • Gottlieb E.
        Cardiolipin acts as a mitochondrial signalling platform to launch apoptosis.
        Biochim. Biophys. Acta. 2009; 1788: 2022-2031
        • Chang S.C.
        • Heacock P.N.
        • Clancey C.J.
        • Dowhan W.
        The PEL1 gene (renamed PGS1) encodes the phosphatidylglycero-phosphate synthase of Saccharomyces cerevisiae.
        J. Biol. Chem. 1998; 273: 9829-9836
        • Osman C.
        • Haag M.
        • Wieland F.T.
        • Brügger B.
        • Langer T.
        A mitochondrial phosphatase required for cardiolipin biosynthesis: the PGP phosphatase Gep4.
        EMBO J. 2010; 29: 1976-1987
        • Kelly B.L.
        • Greenberg M.L.
        Characterization and regulation of phosphatidylglycerol phosphate phosphatase in Saccharomyces cerevisiae.
        Biochim. Biophys. Acta. 1990; 1046: 144-150
        • Chang S.C.
        • Heacock P.N.
        • Mileykovskaya E.
        • Voelker D.R.
        • Dowhan W.
        Isolation and characterization of the gene (CLS1) encoding cardiolipin synthase in Saccharomyces cerevisiae.
        J. Biol. Chem. 1998; 273: 14933-14941
        • Tuller G.
        • Hrastnik C.
        • Achleitner G.
        • Schiefthaler U.
        • Klein F.
        • Daum G.
        YDL142c encodes cardiolipin synthase (Cls1p) and is non-essential for aerobic growth of Saccharomyces cerevisiae.
        FEBS Lett. 1998; 421: 15-18
        • Tamai K.T.
        • Greenberg M.L.
        Biochemical characterization and regulation of cardiolipin synthase in Saccharomyces cerevisiae.
        Biochim. Biophys. Acta. 1990; 1046: 214-222
        • Jiang F.
        • Rizavi H.S.
        • Greenberg M.L.
        Cardiolipin is not essential for the growth of Saccharomyces cerevisiae on fermentable or non-fermentable carbon sources.
        Mol. Microbiol. 1997; 26: 481-491
        • Beranek A.
        • Rechberger G.
        • Knauer H.
        • Wolinski H.
        • Kohlwein S.D.
        • Leber R.
        Identification of a cardiolipin-specific phospholipase encoded by the gene CLD1 (YGR110W) in yeast.
        J. Biol. Chem. 2009; 284: 11572-11578
        • Baile M.G.
        • Whited K.
        • Claypool S.M.
        Deacylation on the matrix side of the mitochondrial inner membrane regulates cardiolipin remodeling.
        Mol. Biol. Cell. 2013; 24: 2008-2020
        • Testet E.
        • Laroche-Traineau J.
        • Noubhani A.
        • Coulon D.
        • Bunoust O.
        • Camougrand N.
        • Manon S.
        • Lessire R.
        • Bessoule J.J.
        Ypr140wp, ‘the yeast tafazzin’, displays a mitochondrial lysophosphatidylcholine (lyso-PC) acyltransferase activity related to triacylglycerol and mitochondrial lipid synthesis.
        Biochem. J. 2005; 387: 617-626
        • Gu Z.
        • Valianpour F.
        • Chen S.
        • Vaz F.M.
        • Hakkaart G.A.
        • Wanders R.J.
        • Greenberg M.L.
        Aberrant cardiolipin metabolism in the yeast taz1 mutant: a model for Barth syndrome.
        Mol. Microbiol. 2004; 51: 149-158
        • Brandner K.
        • Mick D.U.
        • Frazier A.E.
        • Taylor R.D.
        • Meisinger C.
        • Rehling P.
        Taz1, an outer mitochondrial membrane protein, affects stability and assembly of inner membrane protein complexes: implications for Barth syndrome.
        Mol. Biol. Cell. 2005; 16: 5202-5214
        • Claypool S.M.
        • Boontheung P.
        • McCaffery J.M.
        • Loo J.A.
        • Koehler C.M.
        The cardiolipin transacylase, tafazzin, associates with two distinct respiratory components providing insight into Barth syndrome.
        Mol. Biol. Cell. 2008; 19: 5143-5155
        • Vaz F.M.
        • Houtkooper R.H.
        • Valianpour F.
        • Barth P.G.
        • Wanders R.J.
        Only one splice variant of the human TAZ gene encodes a functional protein with a role in cardiolipin metabolism.
        J. Biol. Chem. 2003; 278: 43089-43094
        • Xu Y.
        • Kelley R.I.
        • Blanck T.J.
        • Schlame M.
        Remodeling of cardiolipin by phospholipid transacylation.
        J. Biol. Chem. 2003; 278: 51380-51385
        • Barth P.G.
        • Scholte H.R.
        • Berden J.A.
        • Van der Klei-Van Moorsel J.M.
        • Luyt-Houwen I.E.
        • Van 't Veer-Korthof E.T.
        • Van der Harten J.J.
        • Sobotka-Plojhar M.A.
        An X-linked mitochondrial disease affecting cardiac muscle, skeletal muscle and neutrophil leucocytes.
        J. Neurol. Sci. 1983; 62: 327-355
        • Barth P.G.
        • Wanders R.J.
        • Vreken P.
        • Janssen E.A.
        • Lam J.
        • Baas F.
        X-linked cardioskeletal myopathy and neutropenia (Barth syndrome) (MIM 302060).
        J. Inherit. Metab. Dis. 1999; 22: 555-567
        • Barth P.G.
        • Valianpour F.
        • Bowen V.M.
        • Lam J.
        • Duran M.
        • Vaz F.M.
        • Wanders R.J.
        X-linked cardioskeletal myopathy and neutropenia (Barth syndrome): an update.
        Am. J. Med. Genet. A. 2004; 126: 349-354
        • Schlame M.
        • Kelley R.I.
        • Feigenbaum A.
        • Towbin J.A.
        • Heerdt P.M.
        • Schieble T.
        • Wanders R.J.
        • DiMauro S.
        • Blanck T.J.
        Phospholipid abnormalities in children with Barth syndrome.
        J. Am. Coll. Cardiol. 2003; 42: 1994-1999
        • Valianpour F.
        • Wanders R.J.
        • Barth P.G.
        • Overmars H.
        • van Gennip A.H.
        Quantitative and compositional study of cardiolipin in platelets by electrospray ionization mass spectrometry: application for the identification of Barth syndrome patients.
        Clin. Chem. 2002; 48: 1390-1397
        • Vreken P.
        • Valianpour F.
        • Nijtmans L.G.
        • Grivell L.A.
        • Plecko B.
        • Wanders R.J.
        • Barth P.G.
        Defective remodeling of cardiolipin and phosphatidylglycerol in Barth syndrome.
        Biochem. Biophys. Res. Commun. 2000; 279: 378-382
        • Xu Y.
        • Condell M.
        • Plesken H.
        • Edelman-Novemsky I.
        • Ma J.
        • Ren M.
        • Schlame M.
        A Drosophila model of Barth syndrome.
        Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 11584-11588
        • Acehan D.
        • Vaz F.
        • Houtkooper R.H.
        • James J.
        • Moore V.
        • Tokunaga C.
        • Kulik W.
        • Wansapura J.
        • Toth M.J.
        • Strauss A.
        • Khuchua Z.
        Cardiac and skeletal muscle defects in a mouse model of human Barth syndrome.
        J. Biol. Chem. 2011; 286: 899-908
        • Houtkooper R.H.
        • Rodenburg R.J.
        • Thiels C.
        • van Lenthe H.
        • Stet F.
        • Poll-The B.T.
        • Stone J.E.
        • Steward C.G.
        • Wanders R.J.
        • Smeitink J.
        • Kulik W.
        • Vaz F.M.
        Cardiolipin and monolysocardiolipin analysis in fibroblasts, lymphocytes, and tissues using high-performance liquid chromatography-mass spectrometry as a diagnostic test for Barth syndrome.
        Anal. Biochem. 2009; 387: 230-237
        • Malhotra A.
        • Edelman-Novemsky I.
        • Xu Y.
        • Plesken H.
        • Ma J.
        • Schlame M.
        • Ren M.
        Role of calcium-independent phospholipase A2 in the pathogenesis of Barth syndrome.
        Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 2337-2341
        • Hsu Y.H.
        • Dumlao D.S.
        • Cao J.
        • Dennis E.A.
        Assessing phospholipase A2 activity toward cardiolipin by mass spectrometry.
        PLoS One. 2013; 8: e59267
        • Fabrizio P.
        • Longo V.D.
        The chronological life span of Saccharomyces cerevisiae.
        Aging Cell. 2003; 2: 73-81
        • Hu J.
        • Wei M.
        • Mirisola M.G.
        • Longo V.D.
        Assessing chronological aging in Saccharomyces cerevisiae.
        Methods Mol. Biol. 2013; 965: 463-472
        • Köhrer K.
        • Domdey H.
        Preparation of high molecular weight RNA.
        Methods Enzymol. 1991; 194: 398-405
        • Lee I.
        • Pecinova A.
        • Pecina P.
        • Neel B.G.
        • Araki T.
        • Kucherlapati R.
        • Roberts A.E.
        • Hüttemann M.
        A suggested role for mitochondria in Noonan syndrome.
        Biochim. Biophys. Acta. 2010; 1802: 275-283
        • Diekert K.
        • de Kroon A.I.
        • Kispal G.
        • Lill R.
        Isolation and subfractionation of mitochondria from the yeast Saccharomyces cerevisiae.
        Methods Cell Biol. 2001; 65: 37-51
        • Gardner P.R.
        Aconitase: sensitive target and measure of superoxide.
        Methods Enzymol. 2002; 349: 9-23
        • Houtkooper R.H.
        • Akbari H.
        • van Lenthe H.
        • Kulik W.
        • Wanders R.J.
        • Frentzen M.
        • Vaz F.M.
        Identification and characterization of human cardiolipin synthase.
        FEBS Lett. 2006; 580: 3059-3064
        • Ocampo A.
        • Liu J.
        • Schroeder E.A.
        • Shadel G.S.
        • Barrientos A.
        Mitochondrial respiratory thresholds regulate yeast chronological life span and its extension by caloric restriction.
        Cell Metab. 2012; 16: 55-67
        • Dimitrov L.N.
        • Brem R.B.
        • Kruglyak L.
        • Gottschling D.E.
        Polymorphisms in multiple genes contribute to the spontaneous mitochondrial genome instability of Saccharomyces cerevisiae S288C strains.
        Genetics. 2009; 183: 365-383
        • Nehlin J.O.
        • Ronne H.
        Yeast MIG1 repressor is related to the mammalian early growth response and Wilms' tumour finger proteins.
        EMBO J. 1990; 9: 2891-2898
        • Pfeifer K.
        • Kim K.S.
        • Kogan S.
        • Guarente L.
        Functional dissection and sequence of yeast HAP1 activator.
        Cell. 1989; 56: 291-301
        • Santangelo G.M.
        Glucose signaling in Saccharomyces cerevisiae.
        Microbiol. Mol. Biol. Rev. 2006; 70: 253-282
        • Schüller H.J.
        Transcriptional control of nonfermentative metabolism in the yeast Saccharomyces cerevisiae.
        Curr. Genet. 2003; 43: 139-160
        • Bu Y.
        • Schmidt M.C.
        Identification of cis-acting elements in the SUC2 promoter of Saccharomyces cerevisiae required for activation of transcription.
        Nucleic Acids Res. 1998; 26: 1002-1009
        • Wu J.
        • Trumbly R.J.
        Multiple regulatory proteins mediate repression and activation by interaction with the yeast Mig1 binding site.
        Yeast. 1998; 14: 985-1000
        • Chen X.J.
        • Wang X.
        • Kaufman B.A.
        • Butow R.A.
        Aconitase couples metabolic regulation to mitochondrial DNA maintenance.
        Science. 2005; 307: 714-717
        • Schlame M.
        • Towbin J.A.
        • Heerdt P.M.
        • Jehle R.
        • DiMauro S.
        • Blanck T.J.
        Deficiency of tetralinoleoyl-cardiolipin in Barth syndrome.
        Ann. Neurol. 2002; 51: 634-637
        • Schlame M.
        • Ren M.
        Barth syndrome, a human disorder of cardiolipin metabolism.
        FEBS Lett. 2006; 580: 5450-5455
        • Valianpour F.
        • Wanders R.J.
        • Overmars H.
        • Vaz F.M.
        • Barth P.G.
        • van Gennip A.H.
        Linoleic acid supplementation of Barth syndrome fibroblasts restores cardiolipin levels: implications for treatment.
        J. Lipid Res. 2003; 44: 560-566
        • Hüttemann M.
        • Lee I.
        • Grossman L.I.
        • Doan J.W.
        • Sanderson T.H.
        Phosphorylation of mammalian cytochrome c and cytochrome c oxidase in the regulation of cell destiny: respiration, apoptosis, and human disease.
        Adv. Exp. Med. Biol. 2012; 748: 237-264
        • Koshkin V.
        • Greenberg M.L.
        Oxidative phosphorylation in cardiolipin-lacking yeast mitochondria.
        Biochem. J. 2000; 347: 687-691
        • Kwast K.E.
        • Burke P.V.
        • Staahl B.T.
        • Poyton R.O.
        Oxygen sensing in yeast: evidence for the involvement of the respiratory chain in regulating the transcription of a subset of hypoxic genes.
        Proc. Natl. Acad. Sci. U.S.A. 1999; 96: 5446-5451
        • Fontanesi F.
        • Jin C.
        • Tzagoloff A.
        • Barrientos A.
        Transcriptional activators HAP/NF-Y rescue a cytochrome c oxidase defect in yeast and human cells.
        Hum. Mol. Genet. 2008; 17: 775-788
        • Su X.
        • Dowhan W.
        Translational regulation of nuclear gene COX4 expression by mitochondrial content of phosphatidylglycerol and cardiolipin in Saccharomyces cerevisiae.
        Mol. Cell. Biol. 2006; 26: 743-753
        • Paradies G.
        • Ruggiero F.M.
        • Petrosillo G.
        • Quagliariello E.
        Peroxidative damage to cardiac mitochondria: cytochrome oxidase and cardiolipin alterations.
        FEBS Lett. 1998; 424: 155-158
        • Paradies G.
        • Petrosillo G.
        • Pistolese M.
        • Ruggiero F.M.
        The effect of reactive oxygen species generated from the mitochondrial electron transport chain on the cytochrome c oxidase activity and on the cardiolipin content in bovine heart submitochondrial particles.
        FEBS Lett. 2000; 466: 323-326
        • Paradies G.
        • Petrosillo G.
        • Pistolese M.
        • Ruggiero F.M.
        Reactive oxygen species generated by the mitochondrial respiratory chain affect the complex III activity via cardiolipin peroxidation in beef-heart submitochondrial particles.
        Mitochondrion. 2001; 1: 151-159
        • Petrosillo G.
        • Portincasa P.
        • Grattagliano I.
        • Casanova G.
        • Matera M.
        • Ruggiero F.M.
        • Ferri D.
        • Paradies G.
        Mitochondrial dysfunction in rat with nonalcoholic fatty liver Involvement of complex I, reactive oxygen species and cardiolipin.
        Biochim. Biophys. Acta. 2007; 1767: 1260-1267
        • Kiebish M.A.
        • Yang K.
        • Liu X.
        • Mancuso D.J.
        • Guan S.
        • Zhao Z.
        • Sims H.F.
        • Cerqua R.
        • Cade W.T.
        • Han X.
        • Gross R.W.
        Dysfunctional cardiac mitochondrial bioenergetic, lipidomic, and signaling in a murine model of Barth syndrome.
        J. Lipid Res. 2013; 54: 1312-1325
        • Szijgyarto Z.
        • Garedew A.
        • Azevedo C.
        • Saiardi A.
        Influence of inositol pyrophosphates on cellular energy dynamics.
        Science. 2011; 334: 802-805
        • Baile M.G.
        • Sathappa M.
        • Lu Y.W.
        • Pryce E.
        • Whited K.
        • McCaffery J.M.
        • Han X.
        • Alder N.N.
        • Claypool S.M.
        Unremodeled and remodeled cardiolipin are functionally indistinguishable in yeast.
        J. Biol. Chem. 2014; 289: 1768-1778