Advertisement

Mouse Ornithine Decarboxylase-like Gene Encodes an Antizyme Inhibitor Devoid of Ornithine and Arginine Decarboxylating Activity*

  • Andrés J. López-Contreras
    Affiliations
    Department of Biochemistry and Molecular Biology B and Immunology, Faculty of Medicine, University of Murcia, 30100 Murcia, Spain
    Search for articles by this author
  • Carlos López-Garcia
    Affiliations
    Department of Biochemistry and Molecular Biology B and Immunology, Faculty of Medicine, University of Murcia, 30100 Murcia, Spain
    Search for articles by this author
  • Celia Jiménez-Cervantes
    Affiliations
    Department of Biochemistry and Molecular Biology B and Immunology, Faculty of Medicine, University of Murcia, 30100 Murcia, Spain
    Search for articles by this author
  • Asunción Cremades
    Affiliations
    Department of Pharmacology, Faculty of Medicine, University of Murcia, 30100 Murcia, Spain
    Search for articles by this author
  • Rafael Peñafiel
    Correspondence
    To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, Faculty of Medicine, University of Murcia, Campus de Espinardo, 30100 Murcia, Spain. Tel.: 34-968-367174; Fax: 34-968-831950;
    Affiliations
    Department of Biochemistry and Molecular Biology B and Immunology, Faculty of Medicine, University of Murcia, 30100 Murcia, Spain
    Search for articles by this author
  • Author Footnotes
    * This work was supported by Grants 00466/PI/04 from the Seneca Foundation (Autonomous Community of Murcia) and BFU2005-09378-C02 from the Spanish Ministry of Education and Red CIEN (Spanish Ministry of Health). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Open AccessPublished:August 17, 2006DOI:https://doi.org/10.1074/jbc.M602840200
      Ornithine decarboxylase (ODC), a key enzyme in the biosynthesis of polyamines, is a labile protein that is regulated by interacting with antizymes (AZs), a family of polyamine-induced proteins. Recently, a novel human gene highly homologous to ODC, termed ODC-like or ODC-paralogue (ODCp), was cloned, but the studies aimed to determine its function rendered contradictory results. We have cloned the mouse orthologue of human ODCp and studied its expression and possible function. mRNA of mouse Odcp was found in the brain and testes, showing a conserved expression pattern with regard to the human gene. Transfection of mouse Odcp in HEK 293T cells elicited an increase in ODC activity, but no signs of arginine decarboxylase activity were evident. On the other hand, whereas the ODCp protein was mainly localized in the mitochondrial/membrane fraction, ODC activity was found in the cytosolic fraction and was markedly decreased by small interfering RNA against human ODC. Co-transfection experiments with combinations of Odc, Az1, Az2, Az3, antizyme inhibitor (Azi), and Odcp genes showed that ODCp mimics the action of AZI, rescuing ODC from the effects of AZs and prevented ODC degradation by the proteasome. A direct interaction between ODCp and AZs was detected by immunoprecipitation experiments. We conclude that mouse ODCp has no intrinsic decarboxylase activity, but it acts as a novel antizyme inhibitory protein (AZI2).
      The polyamines spermidine and spermine and their precursor putrescine are ubiquitous polycations implicated in the growth, differentiation, and death of eukaryotic cells (
      • Tabor C.W.
      • Tabor H.
      ,
      • Cohen S.S.
      ,
      • Thomas T.
      • Thomas T.J.
      ,
      • Wallace H.M.
      • Fraser A.V.
      • Hughes A.
      ). Intracellular levels of polyamines are tightly regulated through multiple mechanisms affecting their biosynthesis, catabolism, and transport (
      • Pegg A.E.
      ,
      • Heby O.
      • Persson L.
      ,
      • Seiler N.
      • Delcros J.G.
      • Moulinoux J.P.
      ,
      • Seiler N.
      ,
      • Janne J.
      • Alhonen L.
      • Pietila M.
      • Keinanen T.A.
      ). In mammalian cells, putrescine synthesis, the first step in the polyamine biosynthetic pathway, is mediated by ornithine decarboxylase (ODC)
      The abbreviations used are: ODC, ornithine decarboxylase; ADC, arginine decarboxylase; AZ, antizyme; AZI, antizyme inhibitor protein; DFMO, difluoromethylornithine; ODCp, ornithine decarboxylase paralogue; siRNA, small interfering RNA; RT, reverse transcription; HPLC, high pressure liquid chromatography; HA, hemagglutinin; PBS, phosphate-buffered saline.
      2The abbreviations used are: ODC, ornithine decarboxylase; ADC, arginine decarboxylase; AZ, antizyme; AZI, antizyme inhibitor protein; DFMO, difluoromethylornithine; ODCp, ornithine decarboxylase paralogue; siRNA, small interfering RNA; RT, reverse transcription; HPLC, high pressure liquid chromatography; HA, hemagglutinin; PBS, phosphate-buffered saline.
      (EC 4.1.1.17) through the decarboxylation of l-ornithine. This enzyme is subject to a complex regulation by transcriptional, translational, and post-translational mechanisms (
      • Bello-Fernandez C.
      • Packham G.
      • Cleveland J.L.
      ,
      • Hayashi S.
      • Murakami Y.
      • Matsufuji S.
      ,
      • Reddy S.G.
      • McIlheran S.M.
      • Cochran B.J.
      • Worth L.L.
      • Bishop L.A.
      • Brown P.J.
      • Knutson V.P.
      • Haddox M.K.
      ,
      • Li R.S.
      • Law G.L.
      • Seifert R.A.
      • Romaniuk P.J.
      • Morris D.R.
      ,
      • Shantz L.M.
      • Pegg A.E.
      ,
      • Coffino P.
      ,
      • Pegg A.E.
      ). At the post-translational level, ODC is finely regulated by a family of inhibitory proteins called antizymes (AZ) (
      • Coffino P.
      ,
      • Hayashi S.
      • Canellakis E.S.
      ,
      • Mangold U.
      ). AZ1, the first described member of the family, binds to ODC monomers preventing the formation of active ODC homodimers and promoting the degradation of ODC through the 26 S proteasome in a ubiquitin-independent manner (
      • Murakami Y.
      • Matsufuji S.
      • Kameji T.
      • Hayashi S.
      • Igarashi K.
      • Tamura T.
      • Tanaka K.
      • Ichihara A.
      ,
      • Murakami Y.
      • Tanahashi N.
      • Tanaka K.
      • Omura S.
      • Hayashi S.
      ,
      • Coffino P.
      ). Synthesis of AZ is influenced by polyamines through the stimulation of ribosomal frame-shifting (
      • Rom E.
      • Kahana C.
      ,
      • Matsufuji S.
      • Matsufuji T.
      • Miyazaki Y.
      • Murakami Y.
      • Atkins J.F.
      • Gesteland R.F.
      • Hayashi S.
      ). Moreover, the action of AZ on ODC function is also mediated by a protein called antizyme inhibitor (AZI). This protein, having a sequence highly similar to that of ODC, is devoid of ornithine decarboxylating activity; however, it can activate ODC by competing for AZ, because AZI binds to AZ with high affinity preventing or decreasing the formation of the ODC-AZ complex (
      • Murakami Y.
      • Ichiba T.
      • Matsufuji S.
      • Hayashi S.
      ,
      • Mangold U.
      • Leberer E.
      ). In addition, AZ1 and AZ2 not only decrease polyamine biosynthesis but also prevent the accumulation of excess polyamines by inhibiting or suppressing polyamine transport (
      • Suzuki T.
      • He Y.
      • Kashiwagi K.
      • Murakami Y.
      • Hayashi S.
      • Igarashi K.
      ,
      • Zhu C.
      • Lang D.W.
      • Coffino P.
      ,
      • Mitchell J.L.A.
      • Judd G.G.
      • Bareyalleyser A.
      • Ling S.Y.
      ). Transcription of a third member of the family (AZ3) appears to be restricted to human testis, where it could participate in spermatogenesis (
      • Ivanov I.P.
      • Rohrwasser A.
      • Terreros D.A.
      • Gesteland R.F.
      • Atkins J.F.
      ).
      Although there is ample evidence supporting that elevated polyamine levels and ODC overexpression are connected with cell transformation (
      • Auvinen M.
      • Paasinen A.
      • Andersson L.C.
      • Holtta E.
      ,
      • Megosh L.
      • Gilmour S.K.
      • Rosson D.
      • Soler A.P.
      • Blessing M.
      • Sawicki J.A.
      • Obrien T.G.
      ), less is known about the relevance of AZ and AZI in abnormal cell growth. Transgenic mice over-expressing AZ showed reduced tumorigenesis (
      • Feith D.J.
      • Shantz L.M.
      • Pegg A.E.
      ,
      • Fong L.Y.Y.
      • Feith D.J.
      • Pegg A.E.
      ), and AZI has been found to be elevated in some tumors (
      • Jung M.H.
      • Kim S.C.
      • Jeon G.A.
      • Kim S.H.
      • Kim Y.
      • Choi K.S.
      • Park S.I.
      • Joe M.K.
      • Kimm K.
      ) and stimulated by growth-promoting stimuli (
      • Nilsson J.
      • Grahn B.
      • Heby O.
      ). Recent reports have revealed that AZ may also interact with proteins other than ODC, related with signal transduction such as Smad-1 (
      • Gruendler C.
      • Lin Y.
      • Farley J.
      • Wang T.W.
      ) or cell cycle progression such as cyclin D1 (
      • Newman R.M.
      • Mobascher A.
      • Mangold U.
      • Koike C.
      • Diah S.
      • Schmidt M.
      • Finley D.
      • Zetter B.R.
      ), increasing the interest on the potential role of these ODC-related proteins in the control of cell growth. Furthermore, the demonstration during the last decade of the presence of agmatine in mammalian cells (
      • Li G.
      • Regunathan S.
      • Barrow C.J.
      • Eshraghi J.
      • Cooper R.
      • Reis D.J.
      ,
      • Raasch W.
      • Regunathan S.
      • Li G.
      • Reis D.J.
      ,
      • Lortie M.J.
      • Novotny W.F.
      • Peterson O.W.
      • Vallon V.
      • Malvey K.
      • Mendonca M.
      • Satriano J.
      • Insel P.
      • Thomson S.C.
      • Blantz R.C.
      ) and the existence in the human genome of the agmatinase gene (
      • Iyer R.K.
      • Kim H.K.
      • Tsoa R.W.
      • Grody W.W.
      • Cederbaum S.D.
      ,
      • Mistry S.K.
      • Burwell T.J.
      • Chambers R.M.
      • Rudolph-Owen L.
      • Spaltmann F.
      • Cook W.J.
      • Morris S.M.
      ), coding for the enzyme forming putrescine from agmatine, raised the possibility that this alternate pathway to putrescine synthesis could be relevant in polyamine metabolism in mammalian cells, in particular in therapeutic interventions based on the inhibition of ODC.
      Although there is sound evidence supporting that agmatine is present in mammalian tissues (
      • Li G.
      • Regunathan S.
      • Barrow C.J.
      • Eshraghi J.
      • Cooper R.
      • Reis D.J.
      ,
      • Raasch W.
      • Regunathan S.
      • Li G.
      • Reis D.J.
      ,
      • Lortie M.J.
      • Novotny W.F.
      • Peterson O.W.
      • Vallon V.
      • Malvey K.
      • Mendonca M.
      • Satriano J.
      • Insel P.
      • Thomson S.C.
      • Blantz R.C.
      ), the existence of authentic arginine decarboxylase (ADC), the enzyme forming agmatine from l-arginine, in mammalian tissues is subject to some controversy. Although it is clear that different rat tissues are able to produce 14CO2 from 14C-labeled l-arginine (
      • Li G.
      • Regunathan S.
      • Barrow C.J.
      • Eshraghi J.
      • Cooper R.
      • Reis D.J.
      ,
      • Lortie M.J.
      • Novotny W.F.
      • Peterson O.W.
      • Vallon V.
      • Malvey K.
      • Mendonca M.
      • Satriano J.
      • Insel P.
      • Thomson S.C.
      • Blantz R.C.
      ,
      • Sastre M.
      • Galea E.
      • Feinstein D.
      • Reis D.J.
      • Regunathan S.
      ,
      • Regunathan S.
      • Reis D.J.
      ), and in some cases agmatine formation has been claimed (
      • Lortie M.J.
      • Novotny W.F.
      • Peterson O.W.
      • Vallon V.
      • Malvey K.
      • Mendonca M.
      • Satriano J.
      • Insel P.
      • Thomson S.C.
      • Blantz R.C.
      ,
      • Horyn O.
      • Luhovyy B.
      • Lazarow A.
      • Daikhin Y.
      • Nissim A.
      • Yudkoff M.
      • Nissim I.
      ), in other studies agmatine production from arginine could not be found either in mouse (
      • Penafiel R.
      • Ruzafa C.
      • Pedreño E.
      • Cremades A.
      ,
      • Ruzafa C.
      • Monserrat F.
      • Cremades A.
      • Penafiel R.
      ) or in rat tissues (
      • Coleman C.S.
      • Hu G.R.
      • Pegg A.E.
      ). Moreover, although it was suggested that arginine decarboxylation reaction in the rodent brain may be catalyzed by ODC (
      • Gilad G.M.
      • Gilad V.H.
      • Rabey J.M.
      ), later studies reported that rat ADC was able to decarboxylate both arginine and ornithine, this enzyme being distinct from ODC (
      • Regunathan S.
      • Reis D.J.
      ). In this regard, a viral gene, a close homologue of eukaryotic ODC, has been shown to code for an enzyme capable of decarboxylating l-arginine preferentially to l-ornithine (
      • Shah R.
      • Coleman C.S.
      • Mir K.
      • Baldwin J.
      • Van Etten J.L.
      • Grishin N.V.
      • Pegg A.E.
      • Stanley B.A.
      • Phillips M.A.
      ). Recently, Regunathan and co-workers (
      • Zhu M.Y.
      • Iyo A.
      • Piletz J.E.
      • Regunathan S.
      ) have identified a human cDNA clone that exhibits ADC activity when expressed in COS-7 cells. The deduced amino acid sequence of this protein is not related to bacterial or plant ADC, but it is identical to a previously identified human ODC-like protein, a human ODC paralogue named ODCp (
      • Pitkanen L.T.
      • Heiskala M.
      • Andersson L.C.
      ). However, the facts that in vitro translated human ODCp did not decarboxylate l-ornithine (
      • Pitkanen L.T.
      • Heiskala M.
      • Andersson L.C.
      ) and that Escherichia coli extracts expressing recombinant human ODCp lacked ODC or ADC activity (
      • Coleman C.S.
      • Hu G.R.
      • Pegg A.E.
      ) raise doubts on its possible ADC activity, leaving unsettled the function of human ODCp.
      In our previous studies, in spite of the fact that we did not find agmatine synthesis in mouse extracts using HPLC and electro-phoretic techniques, we could not rule out the possibility that a minor part of the 14CO2 released from mouse tissue extracts incubated with 14C-labeled arginine could be the result of the existence of ADC in mammalian cells (
      • Penafiel R.
      • Ruzafa C.
      • Pedreño E.
      • Cremades A.
      ,
      • Ruzafa C.
      • Monserrat F.
      • Cremades A.
      • Penafiel R.
      ). In this work, we have taken advantage of the published sequence of the murine orthologue gene of human ODCp to study its expression in mouse tissues. We cloned and sequenced this gene and studied the activity of its product by means of transient transfection experiments of human HEK 293T cells. The results obtained support the view that the product of the murine Odcp gene acts as an antizyme inhibitor protein that is devoid of substantial intrinsic ODC or ADC activity.

      EXPERIMENTAL PROCEDURES

      Materials

      l-[1-14C]Ornithine was purchased from Moravek Biochemicals Inc. (Brea, CA). l-[U-14C]arginine (specific activity from different lots ranged from 240-320 mCi/mmol) was supplied by American Radiolabeled Chemicals Inc. (St. Louis, MO). Moloney murine leukemia virus reverse transcriptase, Taq DNA polymerase, anti-FLAG M2 monoclonal antibody peroxidase conjugate, anti-HA monoclonal antibody peroxidase conjugate, anti-HA affinity gel beads, protease inhibitor mixture (4-(2-aminoethyl)benzenesulfonyl fluoride, EDTA, bestatin, E-64, leupeptin, aprotinin), Igepal CA-630, and E. coli ADC were purchased from Sigma. Pfu DNA polymerase was obtained from Biotools (Madrid, Spain). Restriction endo-nucleases EcoRI, XbaI, and BamHI were from Fermentas Life Sciences (Vilnius, Lithuania). Lipofectamine 2000 Transfection Reagent was purchased from Invitrogen. QuikChange site-directed mutagenesis kit was from Stratagene (La Jolla, CA). 2-Difluoromethylornithine (DFMO) was obtained from Ilex Products Inc. (San Antonio, TX). 2-Difluoromethylarginine was a gift from Merrell-Dow Pharmaceuticals.

      RT-PCR

      Total RNA was extracted from tissues with GenElute mammalian total RNA Miniprep kit (Sigma) following the manufacturer's instructions. Total RNA was reverse-transcribed using oligo(dT)18 as primer and Moloney murine leukemia virus reverse transcriptase. Products were amplified by means of Taq polymerase using specific primer pairs within the linear range for each gene product. Amplified products were resolved by electrophoresis in 2% agarose gel containing 40 mm Tris acetate and 1 mm EDTA (pH 8.0) in a horizontal slab gel apparatus using the same Tris acetate/EDTA buffer. The gel was stained with ethidium bromide (0.2 μg/ml for 15 min) and photographed by UV transillumination using a Gel Doc system camera (Bio-Rad). The bands were quantified using the Multi-Analyst PC software from Bio-Rad. Primers (Sigma Genosys) were as follows: mouse β-actin (forward, 5′-TGCGTCTGGACCTGGCTG; reverse, 5′-CTGCTGGAAGGTGGACAG); mouse ODC (forward, 5′-TGGAGTGAGAATCATAGCTG; reverse, 5′-TTGGCCTCTGGAACCCATTG); mouse ODCp (forward, 5′-GTGAATCGGACTTTGTGATGGT; reverse, 5′-GGGTAGCAATGCACAGAACC); mouse AZ1 (forward, 5′-ACGCAGCGCCACGCTTCACGC; reverse, 5′-TTCGGAGTAGGGCGGCTCTGT); mouse AZ2 (forward, 5′-AAGTGTCCCCAGCTCCAGTGCT; reverse, 5′-CGAGTCAACTCCGAGAACACAATG); mouse AZ3 (forward, 5′-TCCAGTGCTCCTGAGTCCCTA; reverse, 5′-CACATACTCCAGTGTTGCTG).

      Cloning of Mouse ODCp, ODC, AZ1, AZ2, AZ3, and AZI

      Total RNA was extracted from brain and testis of Swiss CD1 adult mice, and cDNA was obtained as described above. The complete mouse ODCp coding sequence was amplified by PCR using Pfu polymerase with the forward primer 5′-CTGGAATTCATGGCTGGCTATCTGAGTG and the reverse primer 5′-ACATCTAGACTCACATGATGCTTGCTGG derived from the mouse ODCp cDNA sequence (GenBank™ accession number NM_172875). Thirty PCR rounds (denaturation for 1 min at 95 °C, annealing for 2 min at 64 °C, and extension for 2 min at 72 °C, followed by a final 10-min extension at 72 °C) were performed using brain cDNA as template, 5 μm of each primer, 200 μm of each dNTP, and 1.5 units of the proofreading Pfu polymerase. The amplification product was purified, digested, and inserted in the expression vector pcDNA3 (Invitrogen) by the added restriction sites (underlined) and used to transform competent DH5α E. coli cells following standard procedures (
      • Sambrook J.
      • Fritsch E.F.
      • Maniatis T.
      ). Mouse ODC, AZ1, AZ2, AZ3, and AZI coding sequences were cloned by a similar procedure using the following primers: ODC (forward, 5′-ACAGAATTCACCATGAGCAGCTTTAC; reverse 5′-AACTTCTAGACAAGAGCTACAAGAATG); AZ1 (forward, 5′-TGGGAATTCACCCCAGCGGCCGGATGG; reverse 5′-ACGTCTAGAGGACTAACCCAGGAGAGGG); AZ2 (forward, 5′-CCGGAATTCAAGTGTCCCCAGCTCC; reverse, 5′-GCTTCTAGACAAAGCATCCTCTGTGAC); AZ3 (forward, 5′-GCGGAATTCCTCTACTGTTACAAATAC; reverse 5′-TTATCTAGACTCACTGGCCAGGGTGGCC); and AZI (forward, 5′-ACGGAATTCATGAAAGGATTTATTGACGATG; reverse, 5′-ACTTCTAGACTAAGGAAGCGTTAATGCC). The identity of the clones was ascertained by DNA sequencing of the cloned inserts by means of an ABI PRISM® 310 Genetic Analyzer (Applied Biosystems) at the Servicio de Apoyo a las Ciencias Experimentales facilities, University of Murcia.

      Odc-FLAG, Odcp-FLAG, and Azi-FLAG Plasmid Construction

      The pcDNA3 plasmids containing ODC, ODCp, or AZI coding sequences inserted between the restriction sites EcoRI and XbaI of the polylinker were opened by digestion with BamHI and EcoRI enzymes. The FLAG epitope DYKDDDDK was added to the N terminus of ODC by inserting a double-stranded synthetic oligonucleotide encoding the epitope (in boldface) and designed for annealing with the cohesive ends of the open vector (
      • Szymanska G.
      • O'Connor M.B.
      • O'Connor C.M.
      ). The sense 33-oligomer had the sequence 5′-GATCCATGGACTATAAGGACGATGATGACAAGG and the antisense 33-oligomer had the sequence 5′-AATTCCTTGTCATCATCGTCCTTATAGTCCATG. One nmol of each oligonucleotide was diluted in 100 μl of water, and the mixture was incubated at 95 °C for 5 min and then left for annealing at room temperature. One μl of the annealed mixture and 10 ng of the digested plasmid were ligated and used to transform competent DH5α E. coli cells following standard procedures. The sequences of the constructs were verified as described above.

      Mutagenesis and Az-HA Construction

      To express full-length functional antizymes, the anti-zyme-specific stop codon of the ribosomal frame-shifting site was deleted by site-directed mutagenesis by means of the QuickChange site-directed mutagenesis kit, according to the manufacturer's protocol and the following mutagenic primers: ΔAZ1 (forward, 5′-CGGTGGTGCTCCGATGTCCCTCACCC; reverse, 5′-GGGTGAGGGACATCGGAGCACCACCG); ΔAZ2 (forward, 5′-CCTCTGTGGTGCTCCGATGCCCCTCACC; reverse, 5′-GGTGAGGGGCATCGGAGCACCACAGAGG); and ΔAZ3 (forward, 5′-CTCCAGTGCTCCGAGTCCCTAGGAG; reverse, 5′-CTCCTAGGGACTCGGAGCACTGGAG). Deletions were introduced by incorporating the appropriate nucleotide changes into the primers. The N-terminal HA (hemagglutinin) epitope was introduced into the three antizyme clones by PCR. The sequence for the HA epitope (in boldface) was added in front of the following sense primers: HA-AZ1 (5′-CGGGAATTCATGTACCCATACGATGTCCCAGATTACGCTATGGTGAAATCCTCCCTGCAGCGG); HA-AZ2 (5′-CTGGAATTCATGTACCCATACGATGTCCCAGATTACGCTATGCCCCTCACCCACTG); and HA-AZ3 (5′-AAGGAATTCATGTACCCATACGATGTCCCAGATACGCTATGCTGCCTTGTTGTTAC). HA-tagged antizymes were cloned into the EcoRI and XbaI sites of pcDNA3. The sequences of the constructs were verified as described above.

      Cell Culture and Transient Transfections

      Human embryonic HEK 293T cells obtained from the ATCC were cultured in RPMI 1640, containing 10% fetal calf serum, 100 units/ml penicillin, and 100 μg/ml streptomycin sulfate, in a humidified atmosphere containing 5% CO2 at 37 °C. Cells were grown to ∼90% confluence. Transient transfections were carried out with Lipofectamine 2000 transfection reagent with 1.5 or 0.75 μg of pcDNA3 plasmid per well for 6- or 12-well plates, respectively. After 6 h of incubation the transfection medium was removed, and fresh complete medium was added, and cells were grown for 16 h. The cells were then collected for ODC/ADC assays, RNA isolation, and Western blot. In co-transfection experiments, 0.75 μg of DNA per well was used, with the mixtures containing equimolecular amounts of each construct. The plasmid pcDNA3 without gene insertion was used as negative control.

      siRNA Assay

      Specific siRNAs targeting human ODC were selected using siRNA Target Finder, and the Silencer™ predesigned siRNA matching exon 4 (sense, 5′-GGAUGCCUUCUAUGUGGAtt; antisense 5′-UGCCACAUAGAAGGCAUCCtt) was obtained from Ambion Inc. (Austin, TX). This siRNA was used to co-transfect HEK 293T cells with pcDNA3 plasmid containing ODCp or AZI cDNA, as described above. siRNA concentration in the transfection medium ranged from 15 to 100 nm. Silencer Negative Control 1 siRNA (Ambion), having no significant similarity to any known gene sequences from mouse, rat, or human, was used as negative control.

      Enzyme Measurements

      Protocol I—Except when specifically indicated, ODC activity was assayed in the soluble fraction of HEK 293T cells lysed in a media containing the detergent Igepal. In brief, after transfection the medium was aspirated, and cells were washed with ice-cold phosphate-buffered saline (PBS) and pelleted. Then cells were resuspended and lysed in PBS containing 1% phenyl-methylsulfonyl fluoride, 1% Igepal, and 2 mm dithiothreitol. The extract was centrifuged at 20,000 × g for 20 min, and ODC activity was determined in the supernatant. ODC activity was assayed basically as described elsewhere (
      • Russell D.
      • Snyder S.H.
      ) by measuring 14CO2 release from l-[1-14C]ornithine. The incubation mixture contained 20 mm Tris (pH 7.2), 0.1 mm pyridoxal phosphate, 0.1 mm EDTA, 2 mm dithiothreitol, and 0.4 mm l-[1-14C]ornithine (specific activity, 4.7 mCi/mmol) in a total volume of 62.5 μl. The reaction was performed in glass tubes with tightly closed rubber stopper. The samples were incubated at 37 °C for 30 min, and the reaction was stopped by adding 0.5 ml of 2 m citric acid. 14CO2 was trapped in two disks of filter paper wetted in 0.5 m benzethonium hydroxide dissolved in methanol. The filter paper disks were transferred to scintillation vials and counted by liquid scintillation. Activity was expressed as nanomoles of 14CO2 produced per h and per mg of protein. 1% Igepal did not significantly affect ODC activity that was inhibited more than 95% by 1 mm DFMO.
      Protocol II—ODC and putative ADC measurements in homogenates and fractionated extracts of HEK 293T cells were carried out as follows. Cells collected and washed in PBS were homogenized in ice-cold Tris/sucrose buffer using a Polytron homogenizer. The composition of the homogenizing buffer (buffer A) was as follows: 10 mm Tris-HCl (pH 7.2), 0.1 mm pyridoxal phosphate, 0.2 mm EDTA, 1 mm di-thiothreitol, 0.25 m sucrose, 200 μm 4-(2-aminoethyl)benzenesulfonyl fluoride, 13 μm bestatin, 1.4 μm E-64, 100 μm leupeptin, 30 nm aprotinin. The cell homogenate was centrifuged at 500 × g for 10 min to obtain a post-nuclear supernatant that was centrifuged at 12,000 × g for 20 min to collect a post-mitochondrial supernatant (S12) and a crude mitochondrial pellet (P12). The P12 pellet was resuspended either in buffer A (for ODC determination) or in buffer B (for ADC determination) consisting of 10 mm Tris-HCl (pH 8.2), 0.1 mm pyridoxal phosphate, 1 mm dithiothreitol, 0.2 mm EDTA, 1 mm MgSO4, and protease inhibitors as in buffer A. ODC activity in the different cell fractions obtained was determined basically as described above. ADC activity was measured in buffer B containing 0.06 m sucrose and 0.25 mm l-[(U)-14C]arginine (specific activity 6.4 mCi/mmol) at 30 °C for 1 h, and 14CO2 was trapped and counted as described in the ODC assay. The protein content was determined by the method of Bradford (
      • Bradford M.M.
      ) using bovine serum albumin as standard.

      Polyamine Analysis

      Cells were extracted with 0.4 m perchloric acid, and the supernatant obtained after centrifugation at 10,000 × g for 10 min was used for polyamine determination. In brief, polyamines underwent dansylation according to the method described by Seiler (
      • Seiler N.
      ), and the dansylated polyamines were separated by HPLC using a Lichrosorb 10-RP-18 column (4.6 × 250 mm; Merck) and acetonitrile/methanol/water mixtures (running from 42:28:30 to 58:38:4 ratio during 40 min of analysis) as mobile phase and at a flow rate of 1 ml/min. 1,6-Hexanediamine was used as internal standard, and standard solutions of agmatine, putrescine, spermidine, and spermine were used to calibrate the column. Detection of the derivatives was achieved using a fluorescence detector, with a 340-nm excitation filter and a 435-nm emission filter. In addition, after ADC assays using l-[U-14C] arginine, the putative radioactive polyamines underwent dansylation and were separated by HPLC as described above. 1-ml fractions were collected, and aliquots were counted by liquid scintillation using Ecoscint™ H scintillation solution (National Diagnostics, Atlanta, GA). Agmatine formation was also estimated by analyzing the radioactive products formed after ADC assay by paper electrophoresis in 500 mm pyridine/acetic acid buffer (pH 6.1) (300 V, 1 h). The wet paper was dried, and radioactive spots were detected by PhosphorImaging using a Bio-Rad Molecular Imagen System and a β-imaging screen-CS (Bio-Rad). As a positive control of agmatine formation, ADC from E. coli (0.4 units/ml) was incubated with l-[U-14C]arginine under the conditions for assaying ADC activity described above.

      Western Blot Analysis

      Cells were solubilized in 50 mm Tris-HCl (pH 8), 1% Igepal, 1 mm EDTA, and 0.1 mm phenylmethylsulfonyl fluoride and centrifuged at 12000 × g for 20 min. Reducing SDS-PAGE was performed in 10% polyacrylamide gels. Gels were transferred to polyvinylidene difluoride membranes, blocked with 5% nonfat dry milk in PBS, and incubated overnight at 4 °C with the anti-FLAG antibody peroxidase-labeled (1:5000) or anti-HA antibody (1:20,000). Immunoreactive bands were detected by using ECL+ detection reagent (Amersham Biosciences) and commercial developing reagents and films (Amersham Biosciences). In loading controls, Erk2 was determined by means of polyclonal anti-Erk2 antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA).

      Immunoprecipitation

      HEK 293T cells were transfected with ODCp-FLAG, alone or in combination with HA epitope-labeled AZ variants. Approximately 2 × 106 cells were washed twice with phosphate-buffered saline and solubilized in 200 μl of solubilization buffer (50 mm Tris-HCl (pH 8), 1% Igepal, 1 mm EDTA, and 0.1 mm phenylmethylsulfonyl fluoride). The sample was centrifuged (12,000 × g, 20 min), and the supernatant was immunoprecipitated by adding anti-HA affinity gel beads. After a 3-h incubation, the sample was centrifuged, and the pellet was washed five times with the same solubilization buffer. Elution was performed in 20 μl of 2% SDS for 30 min at room temperature. Eluted supernatants were mixed in a ratio of 2:1 with an electrophoresis sample buffer (180 mm Tris-HCl (pH 6.8), 15% glycerol, 9% SDS, 0.075% bromphenol blue, and 7.5% β-mercaptoethanol). Electrophoresis and Western blotting were performed as described above.

      RESULTS

      Expression of ODCp in Murine Tissues—The expression of ODCp in different mouse tissues was studied by RT-PCR using primers derived from mouse ODCp sequence (GenBank™ accession number NM_172875). Fig. 1 shows that among the different tissues studied, mouse ODCp expression was restricted to brain and testes, in contrast to ODC, AZ1, and AZ2 that were expressed in all tissues tested. ODCp expression appears to be conserved because previous studies revealed that human ODCp expression was found in the central nervous system and testes (
      • Pitkanen L.T.
      • Heiskala M.
      • Andersson L.C.
      ). In agreement with previous findings, AZ3 was mainly expressed in testes (
      • Ivanov I.P.
      • Rohrwasser A.
      • Terreros D.A.
      • Gesteland R.F.
      • Atkins J.F.
      ), although we also found expression of this antizyme isoform in the brain.
      Figure thumbnail gr1
      FIGURE 1Expression of ODC, ODCp, AZ1, AZ2, and AZ3 in different mouse tissues. Total RNA was extracted from tissues of three male and two female mice and analyzed by semiquantitative RT-PCR using specific primers as described under “Experimental Procedures.” β-Actin was used as control.
      Cloning of Mouse ODCp and Comparison of Its Protein Sequence with Those of ODC and AZI—The coding region of mouse ODCp, deduced after the cloning and sequencing of cDNA obtained from ODCp mRNA isolated from mouse testes, is shown in Fig. 2. This sequence was identical to GenBank™ accession number NM_172875 corresponding to a murine ornithine decarboxylase-like protein, except that we found His instead of Tyr at position 317. His residue is also present at this position in human ODCp (ENSG00000142920), Gallus gallus ODCp (ENSGALG00000003614), and Canis familiaris ODCp (ENSCAFG00000010369). The comparison of the protein sequences of murine ODCp, ODC, and AZI showed that there is 48% identity and 69% similarity between ODCp and ODC. The corresponding values for ODCp and AZI were 44 and 66%, respectively. Higher dissimilarities were observed in the N- and C-terminal regions, whereas in the putative region of interaction with AZ (
      • Almrud J.J.
      • Oliveira M.A.
      • Kern A.D.
      • Grishin N.V.
      • Phillips M.A.
      • Hackert M.L.
      ), ODCp showed a high percentage of similarity (86%) with regard to the sequences in ODC and AZI. Important residues for ODC activity such as Lys-69, Asp-88, and Cys-360 (
      • Poulin R.
      • Lu L.
      • Ackermann B.
      • Bey P.
      • Pegg A.E.
      ,
      • Tsirka S.
      • Coffino P.
      ,
      • Tobias K.E.
      • Kahana C.
      ,
      • Coleman C.S.
      • Stanley B.A.
      • Pegg A.E.
      ,
      • Osterman A.L.
      • Kinch L.N.
      • Grishin N.V.
      • Phillips M.A.
      ) are not conserved in mouse ODCp, whereas conservative substitutions in other residues such as Lys-169, Asp-361, and Phe-400, associated with the catalytic activity (
      • Osterman A.L.
      • Kinch L.N.
      • Grishin N.V.
      • Phillips M.A.
      ,
      • Lu L.
      • Stanley B.A.
      • Pegg A.E.
      ), can be observed. Gly-387 and Asp-364, residues implicated in ODC dimerization (
      • Osterman A.L.
      • Kinch L.N.
      • Grishin N.V.
      • Phillips M.A.
      ,
      • Tobias K.E.
      • Mamroudkidron E.
      • Kahana C.
      ) are conserved in ODCp.
      Figure thumbnail gr2
      FIGURE 2Comparison of the amino acid sequences of mouse ODCp, ODC, and AZI using ClustalW program. Black background indicates amino acid identity, and gray background indicates amino acid similarity between at least two proteins. Asterisks represent changes in ODCp residues corresponding to residues associated with the catalytic activity of ODC. The putative AZ-binding site is underlined.
      The sequence of mouse ODCp protein exhibits 86% identity and 92% similarity with respect to that reported for human ODCp (
      • Pitkanen L.T.
      • Heiskala M.
      • Andersson L.C.
      ). To note that the residue Lys-69 that in ODC is involved in the binding of pyridoxal 5′-phosphate is conserved in human ODCp, but it is substituted by glycine in murine ODCp.
      Decarboxylating Activity of Mouse ODCp in Transfected HEK 293T Cells—To test the possible ODC or ADC activity of mouse ODC-like protein, ODCp was transiently expressed in HEK 293T cells, and its capacity to decarboxylate ornithine or arginine was measured in the cell homogenates, and cell fractions were obtained. These activities were also determined in homogenates from cells transfected with the empty vector and from cells transfected with mouse ODC cDNA. Table 1 shows, as expected, that ODC activity in ODC-transfected cells was remarkably high when compared with control cells, whereas in ODCp-transfected cells there was a moderate increase in the decarboxylation of ornithine with respect to control cells, but the activity was lower than 2% that of ODC-transfected cells. In both cases, ODC activity was mainly found in the post-mitochondrial fraction. This activity was inhibited more than 95% by 1 mm DFMO (results not shown), a specific inhibitor of mammalian ODC (
      • Metcalf B.W.
      • Bey P.
      • Danzin C.
      • Jung M.J.
      • Casara P.
      • Vevert J.P.
      ). To analyze whether the large differences observed in the decarboxylating activities of the extracts of ODC and ODCp could be due to gross variations in protein expression, HEK 293T cells were transfected with different constructs encoding ODC-FLAG, ODCp-FLAG, or AZI-FLAG fusion proteins, and expressed proteins were detected by an anti-FLAG antibody. Fig. 3A shows similar expression levels of fusion proteins. The decarboxylating activity of the fusion proteins appeared not to be significantly altered (data not shown).
      TABLE 1ODC activity of cell homogenates obtained from ODC or ODCp-transfected HEK 293T cells
      ODC activity
      CHS12P12
      nmol 14CO2/h/mg protein
      pcDNA3-transfected0.15 ± 0.120.13 ± 0.070.05 ± 0.03
      ODC-transfected106.8 ± 3.4293.6 ± 11.67.65 ± 0.4
      ODCp-transfected1.55 ± 0.433.51 ± 0.330.15 ± 0.05
      Figure thumbnail gr3
      FIGURE 3Expression of ODC, ODCp, and AZI in HEK 293T-transfected cells. A, Western blot of ODC-, ODCp-, and AZI-FLAG fusion proteins expressed in HEK 293T cells and detected by anti-FLAG antibody. Crude extracts were obtained as described under “Protocol I” (see under “Experimental Procedures”). B, Western blot analysis of ODC- and ODCp-tagged with the FLAG epitope in the cytosolic fraction (S12) and in the mitochondrial membrane pellet (P12) was from transient transfected HEK 293T cells. Cells were homogenized and fractions obtained as described under “Protocol II” (described under “Experimental Procedures”).
      To test whether the ornithine decarboxylating activity measured in ODCp-transfected cells is the result of authentic ODC activity of mouse ODCp protein or the consequence of increased endogenous ODC activity of HEK 293T cells, as result of a possible interaction of mouse ODCp protein with AZ, we examined ODC activity in ODCp-transfected cells that were co-transfected with human ODC-siRNA, specific for interfering human ODC mRNA but not for human or mouse ODCp mRNA. As shown in Fig. 4, ODC activity was markedly decreased in ODC-siRNA transfectants compared with control cells or control-siRNA transfectants. Fig. 4 also shows that in cells transfected with AZI, a rise in ODC activity similar to the one observed in the ODCp transfectants took place and that this activity was also remarkably reduced by 30 nm human ODC siRNA. It can be seen that human ODC siRNA did not affect the levels of ODCp protein (Fig. 4B). Furthermore, the analysis of protein localization of ODC and ODCp-tagged proteins with the FLAG epitope in the transient transfected HEK 293T cells showed that although ODC protein was mainly found in the cytosolic fraction, as it is widely accepted, ODCp protein was preferentially found in the mitochondrial pellet obtained after centrifuging the cell extracts at 12,000 × g (Fig. 3B). The fact that in the ODCp-transfected cells the enhancement of ODC activity was mainly found in the cytosolic fraction, whereas ODCp protein was fundamentally located at the mitochondrial/membranes fraction, also corroborates the view that ODCp lacks intrinsic ODC activity. Overall, these results suggest that ODCp protein may function as an AZ inhibitory protein.
      Figure thumbnail gr4
      FIGURE 4Effect of siRNA-mediated ODC silencing on ODC activity. A, HEK 293T cells were co-transfected with mouse ODCp cDNA inserted in the expression vector pcDNA3 and variable amounts of human ODC-siRNA or control siRNA ranging from 15 to 60 nm. Sixteen hours after transfection cells were homogenized as described under “Protocol I” (see “Experimental Procedures”), and ODC activity was assayed in the supernatant fraction. On the right, effect of 30 nm human ODC (hODC) siRNA on cells transfected with mouse AZI cDNA inserted in pcDNA3 on ODC activity. Bars represent mean values of duplicated transfection experiments. B, expression of ODCp-FLAG protein in HEK 293T cells co-transfected with ODCp-FLAG cDNA inserted in the expression vector pcDNA3 and control or human ODC siRNA.
      The arginine decarboxylating activity of ODCp and ODC-transfected cell extracts was negligible in most experiments when recently purchased [14C]arginine was used. However, in some cases, cell extracts from ODCp and ODC-transfected cells were able to release 14CO2 from 14C-labeled l-arginine (Table 2). Even in these cases, the release of 14CO2 from arginine was remarkably lower than from ornithine, when the same homogenate was assayed with these amino acids. Moreover, this activity was much lower in ODCp than in ODC-transfected cells, and in both cases it was the lowest in the mitochondrial fraction. In all these homogenates, decarboxylation of arginine was not significantly affected by 1 mm difluoromethylarginine, an effective inhibitor of bacterial and plant ADC (
      • Bitonti A.J.
      • Casara P.J.
      • Mccann P.P.
      • Bey P.
      ), but it was markedly reduced (more than 95%) by 1 mm DFMO, whereas NG-hydroxyarginine, a potent inhibitor of arginase (
      • Boucher J.L.
      • Custot J.
      • Vadon S.
      • Delaforge M.
      • Lepoivre M.
      • Tenu J.P.
      • Yapo A.
      • Mansuy D.
      ,
      • Daghigh F.
      • Fukuto J.M.
      • Ash D.E.
      ), also decreased the release of 14CO2 from l-arginine, about 50% inhibition at 1 mm (data not shown). Although these results suggested that the 14CO2 release from l-arginine by extracts from the transfected cells incubated with [14C]arginine may be the result of the concerted action of arginase and ODC activities that may be present in these extracts, or from trace amounts of labeled ornithine formed by chemical decomposition of arginine, we also tested the formation of agmatine and putrescine, the direct products of ADC and ODC, respectively, to check this possibility. The analysis by HPLC of the radioactive polyamines that could be generated by incubation of cell extracts with [U-14C]arginine is shown in Fig. 5. Although in cells transfected with ODC a peak with a retention time identical to that of putrescine was seen, evidence for agmatine formation could not be found (Fig. 5B). In extracts from ODCp-transfected cells, we could not detect the formation of agmatine (Fig. 5C). In contrast, a peak with the same retention time as agmatine was clearly seen when incubates of bacterial ADC with labeled arginine were analyzed (Fig. 5A). When the products were separated according to their positive charge by means of paper electrophoresis at pH 6.1 and detected by PhosphorImager, the results were similar to those found by HPLC analysis (Fig. 5D). Similar results were obtained when Chinese hamster ovary and COS-7 cells were transfected with ODCp (results not shown).
      TABLE 2Arginine decarboxylating activity of cell homogenates obtained from ODC or ODCp-transfected HEK 293T cells
      Arginine decarboxylating activity
      CHS12P12
      nmol14CO2/h/mg protein
      pcDNA3-transfected<0.05<0.05<0.05
      ODC-transfected4.85 ± 0.1214.64 ± 0.454.58 ± 0.15
      ODCp-transfected0.51 ± 0.061.55 ± 0.100.08 ± 0.02
      Figure thumbnail gr5
      FIGURE 5Analysis of 14C-labeled polyamines formed by incubation of [U-14C]arginine with ADC from E. coli or homogenates from HEK 293T cells transfected with mouse ODC or mouse ODCp. Replicates of several incubates were pooled and analyzed. A-C, radioactivity in the different fractions collected after separation of the dansylated polyamines by HPLC. D, paper electrophoresis analysis of 14C-labeled polyamines from similar incubates. See “Experimental Procedures.” Arrows represent the position of the different markers: Agm, agmatine; Put, putrescine; HD, hexanediamine; Arg, arginine; O, origin.
      Functional Analysis of the Possible Antizyme Inhibitory Capacity of ODCp by Co-transfection Experiments in HEK 293T Cells—To investigate the possibility that ODCp protein may function as an antizyme inhibitor, as commented above, we also cloned cDNA corresponding to mouse ODC, AZ1, AZ2, AZ3, and AZI in the expression vector pcDNA3, and HEK 293T cells were transiently co-transfected with several combinations of the different recombinant plasmids. ODC activity was measured in the cytosolic fraction of the co-transfected cells and compared with the values of ODC-transfected cells. Fig. 6 shows that the three AZ tested down-regulated ODC activity, with AZ1 having an apparently stronger effect than AZ2 or AZ3. This figure also shows that both AZI and ODCp were able to rescue ODC from the inhibitory effect produced by AZ. The analysis of polyamines revealed that in the ODC-transfected cells there was a marked increase of putrescine (about 15-fold) and a moderate rise of spermidine (∼50%), whereas spermine remained unchanged (Table 3). These results suggest that the levels in polyamine concentration reached by the ODC-transfected cells seem to be sufficient to induce ribosomal frame-shifting of AZ mRNA (
      • Rom E.
      • Kahana C.
      ,
      • Matsufuji S.
      • Matsufuji T.
      • Miyazaki Y.
      • Murakami Y.
      • Atkins J.F.
      • Gesteland R.F.
      • Hayashi S.
      ) in the co-transfected cells, and they indicate that the product of the Odcp gene behaves similarly to that of Azi. Moreover, to assess the role of ODCp protein on ODC degradation in HEK cells, we studied the effect of AZ, AZI, and ODCp on the levels of ODC-tagged protein with the FLAG epitope, using a specific antibody directed to this sequence and Western blot analysis. As shown by Fig. 7A, there was a parallelism between the changes in ODC activity and ODC protein, with AZ decreasing ODC activity and promoting the degradation of ODC, and ODCp and AZI preventing this effect. In fact, preliminary results on the half-life of ODC indicated that transfection with ODCp increased the t½ of ODC.
      A. J. López-Contreras and R. Penafiel, unpublished results.
      It must be noted that AZ2 and AZ3 also appear to promote ODC degradation as reported previously for AZ1 (
      • Zhu C.
      • Lang D.W.
      • Coffino P.
      ,
      • Li X.Q.
      • Coffino P.
      ). However, the apparently higher effect observed for AZ1 could be related with the higher expression of AZ1 protein in the transfected cells (Fig. 7B), presumably as a consequence of a higher stability of AZ1 protein. Moreover, the fact that in the double transfectants (ODC + ODCp) ODCp increased the amount of ODC-tagged protein confirms the view that the rise in ODC activity induced by ODCp is related to its antizyme inhibitory action rather than to an intrinsic putative ODC activity. To assess a direct interaction of ODCp with AZs, immunoprecipitation experiments were carried out with AZ-HA fusion proteins and ODCp tagged with FLAG. As shown in Fig. 8, interactions between AZs and ODCp were observed in the homogenates of the double transfectants. Again, the higher intensity of ODCp found in AZ1 co-transfectant could be related to a higher level of expression of AZ1. This interaction was also detectable when AZ1 and ODCp extracts were incubated in vitro. Overall, these results clearly indicate that ODCp counteracts AZ as effectively as AZI, and they consequently suggest that ODCp should be considered as a novel antizyme inhibitor.
      Figure thumbnail gr6
      FIGURE 6Relative ODC activity in cell homogenates from HEK 293T cells transfected with different combinations of cDNAs inserted in the expression vector pcDNA3. The names of the single, double, and triple transfectants are given below the bars. Results are the mean ± S.D. from four transfection experiments, and each assay was carried out in duplicate. In these experiments 0.75 μg of DNA per well was used, and the mixtures contained equimolecular amounts of each construct. The plasmid pcDNA3 without gene insertion was used as a negative control vector in transfection experiments. ODC activity is expressed as the percentage of the ODC transfectant in each experiment. Absolute values of ODC activity in control ODC were about 250 nmol of 14CO2/h/mg of protein.
      TABLE 3Polyamine levels in HEK 293T cells transiently transfected with ODC or ODC+AZ1
      Polyamine concentration
      PutrescineSpermidineSpermine
      nmol/mg proteinnmol/mg proteinnmol/mg protein
      pcDNA3-transfected5.0 ± 0.410.1 ± 1.68.3 ± 1.1
      ODC-transfected79.1 ± 5.315.2 ± 2.18.4 ± 0.9
      (ODC+AZ1)-transfected9.6 ± 2.19.4 ± 1.25.6 ± 1.8
      Figure thumbnail gr7
      FIGURE 7Western blot analysis of ODC tagged with the FLAG epitope from HEK 293T cells transfected with the ODC-FLAG construct and different combinations of ODCp, Azs, and AZI cDNAs in the pcDNA3 vector. A, 16 h after transfection cells were harvested and lysed as described under “Protocol I,” and the homogenate was centrifuged at 12,000 × g for 20 min, and ODC-tagged protein was assayed in the supernatant fraction using an anti-FLAG antibody. B, comparison of the expression of the mutated forms of the antizymes (ΔAZs) tagged with the HA epitope. Proteins were separated in 12% SDS-polyacryamide gels and detected with anti-HA antibody. Crude extracts were obtained as described under “Protocol I” (see “Experimental Procedures”).
      Figure thumbnail gr8
      FIGURE 8Interaction between ODCp and AZs. HEK 293T cells were transfected with ODCp-FLAG construct, alone or in combination with HA epitope-labeled AZ construct variants (ΔAZs-HA). Cells were solubilized in Tris buffer containing 1% Igepal, and the supernatants obtained after centrifugation at 12,000 × g were immunoprecipitated with anti-HA affinity gel beads for 3 h. After extensive washing, the eluted proteins were resolved by electrophoresis. Blotted ODCp-FLAG fusion protein was detected using antibody against the FLAG tag. The lane marked with an asterisk corresponds to immunoprecipitation of in vitro incubates of the extract from ODCp-FLAG-transfected cells with extract from AZ1-HA-transfected cells.

      DISCUSSION

      In a recent study, Pitkanen et al. (
      • Pitkanen L.T.
      • Heiskala M.
      • Andersson L.C.
      ) reported the existence of a paralogue gene of human ODC (named ODCp) that coded for a novel human ODC-like protein expressed in the central nervous system and testes. This protein did not decarboxylate ornithine, and it was suggested, but not proven, that it might act as an AZ inhibitory protein. Our results indicate that the murine orthologue of human ODCp displays an expression pattern similar to its human orthologue and, more importantly, that the murine ODCp protein acts as an AZ inhibitory protein, at least in HEK 293 cells. This conclusion is based on our data showing the following. (a) The expression of ODCp in co-transfected HEK 293T cells may abolish the inhibitory effect produced by the co-expression of any member of the AZ family on ODC activity. (b) The action of ODCp on ODC not only affected ODC activity but also ODC stability, because the expression of ODCp appears to prevent the degradation of ODC protein mediated by AZ. (c) ODCp can directly interact with the three AZs. Furthermore, the effect produced by ODCp was similar to that found in parallel experiments using AZI instead of ODCp. This suggests that ODCp may mimic the action of AZI and that this inhibitory effect appears to be exerted on the three AZ isoforms. These findings are in agreement with the recently reported results that concluded that AZI is capable of acting as a general inhibitor of all members of the antizyme family (
      • Mangold U.
      • Leberer E.
      ). Our results also reveal that the overexpression of ODC in HEK 293T cells was associated with a marked increase in putrescine and a moderate elevation of spermidine levels, whereas spermine content was not affected. This situation is similar to that found in transgenic mice where the overproduction of ODC led to an increase of putrescine in some tissues but had less effect on spermidine or spermine (
      • Janne J.
      • Alhonen L.
      • Pietila M.
      • Keinanen T.A.
      ,
      • Pegg A.E.
      • Feith D.J.
      • Fong L.Y.Y.
      • Coleman C.S.
      • O'Brien T.G.
      • Shantz L.M.
      ). In any case, the elevation in polyamine levels found in the transfected HEK 293T cells appears to be sufficient to facilitate the frame-shifting in the translation of AZ mRNA (
      • Rom E.
      • Kahana C.
      ,
      • Matsufuji S.
      • Matsufuji T.
      • Miyazaki Y.
      • Murakami Y.
      • Atkins J.F.
      • Gesteland R.F.
      • Hayashi S.
      ). The fact that the expression of ODCp was able to counteract the effect mediated by AZ on ODC in culture cells, under conditions of similar amounts of their respective mRNA, suggests that ODCp may have a regulatory role in polyamine homeostasis in those tissues in which this protein is expressed. This assertion is based not only on the demonstrated effect of ODCp on putrescine biosynthesis shown here but also on its possible action on polyamine uptake, because it is known that AZ1 and AZ2 may act as negative regulators of polyamine transport (
      • Suzuki T.
      • He Y.
      • Kashiwagi K.
      • Murakami Y.
      • Hayashi S.
      • Igarashi K.
      ,
      • Zhu C.
      • Lang D.W.
      • Coffino P.
      ,
      • Mitchell J.L.A.
      • Judd G.G.
      • Bareyalleyser A.
      • Ling S.Y.
      ).
      Our results support the contention that mouse ODCp lacks intrinsic ODC activity, because the relatively low ODC activity found in the homogenates of HEK 293T cells transfected with ODCp could be abolished by means of siRNA directed specifically against ODC mRNA. This finding is in agreement with two previous reports that showed that human ODCp expressed either in an in vitro reticulocyte system (
      • Pitkanen L.T.
      • Heiskala M.
      • Andersson L.C.
      ) or in E. coli (
      • Coleman C.S.
      • Hu G.R.
      • Pegg A.E.
      ) was unable to decarboxylate ornithine. As was pointed out in these studies, the lack of ODC activity of human ODCp is not surprising because of the absence of key residues essential for ODC activity such as Asp-88, Cys-360, and Phe-400 (
      • Poulin R.
      • Lu L.
      • Ackermann B.
      • Bey P.
      • Pegg A.E.
      ,
      • Coleman C.S.
      • Stanley B.A.
      • Pegg A.E.
      ,
      • Osterman A.L.
      • Kinch L.N.
      • Grishin N.V.
      • Phillips M.A.
      ). In the case of mouse ODCp, apart from the changes in these critical residues, Lys-69 that is essential for ODC activity (
      • Poulin R.
      • Lu L.
      • Ackermann B.
      • Bey P.
      • Pegg A.E.
      ,
      • Coleman C.S.
      • Stanley B.A.
      • Pegg A.E.
      ) and for the binding of the coenzyme pyridoxal 5-phosphate (
      • Poulin R.
      • Lu L.
      • Ackermann B.
      • Bey P.
      • Pegg A.E.
      ,
      • Tsirka S.
      • Coffino P.
      ) is also substituted by glycine, suggesting that it is very unlikely that mouse ODCp may efficiently bind this cofactor.
      Although it is generally accepted that ODC is universally distributed in most members of the phylogenetic scale, from bacteria to mammals, it was believed for many years that ADC was not expressed in mammals (
      • Tabor C.W.
      • Tabor H.
      ). However, in the past decade several publications have sustained the existence of ADC in mammals, based on the measurement of arginine decarboxylating activity in rat brain (
      • Li G.
      • Regunathan S.
      • Barrow C.J.
      • Eshraghi J.
      • Cooper R.
      • Reis D.J.
      ,
      • Regunathan S.
      • Reis D.J.
      ,
      • Morrissey J.
      • Mccracken R.
      • Ishidoya S.
      • Klahr S.
      ), liver (
      • Lortie M.J.
      • Novotny W.F.
      • Peterson O.W.
      • Vallon V.
      • Malvey K.
      • Mendonca M.
      • Satriano J.
      • Insel P.
      • Thomson S.C.
      • Blantz R.C.
      ,
      • Regunathan S.
      • Reis D.J.
      ), kidney (
      • Lortie M.J.
      • Novotny W.F.
      • Peterson O.W.
      • Vallon V.
      • Malvey K.
      • Mendonca M.
      • Satriano J.
      • Insel P.
      • Thomson S.C.
      • Blantz R.C.
      ,
      • Morrissey J.
      • Mccracken R.
      • Ishidoya S.
      • Klahr S.
      ), vascular endothelial cells (
      • Regunathan S.
      • Youngson C.
      • Raasch W.
      • Wang H.
      • Reis D.J.
      ), and murine macrophages (
      • Sastre M.
      • Galea E.
      • Feinstein D.
      • Reis D.J.
      • Regunathan S.
      ). Moreover, the detection of agmatinase activity in rat brain (
      • Sastre M.
      • Regunathan S.
      • Galea E.
      • Reis D.J.
      ) and the cloning of human agmatinase (
      • Iyer R.K.
      • Kim H.K.
      • Tsoa R.W.
      • Grody W.W.
      • Cederbaum S.D.
      ,
      • Mistry S.K.
      • Burwell T.J.
      • Chambers R.M.
      • Rudolph-Owen L.
      • Spaltmann F.
      • Cook W.J.
      • Morris S.M.
      ) have led us to postulate that the co-expression of both enzymes in specific cells may contribute to the synthesis of putrescine by an alternate pathway to the classical route of ODC (
      • Mistry S.K.
      • Burwell T.J.
      • Chambers R.M.
      • Rudolph-Owen L.
      • Spaltmann F.
      • Cook W.J.
      • Morris S.M.
      ). Although there is convincing evidence that agmatine is present in mammalian tissues (38-40, it cannot be excluded that this agmatine may have a dietary origin. On the other hand, although it is clear that mammalian extracts are able to generate 14CO2 from l-[1-14C]arginine, the results on the formation of agmatine from arginine in cell extracts are subject to some controversy. Thus, whereas some reports identified agmatine as the product of the reaction (
      • Lortie M.J.
      • Novotny W.F.
      • Peterson O.W.
      • Vallon V.
      • Malvey K.
      • Mendonca M.
      • Satriano J.
      • Insel P.
      • Thomson S.C.
      • Blantz R.C.
      ,
      • Horyn O.
      • Luhovyy B.
      • Lazarow A.
      • Daikhin Y.
      • Nissim A.
      • Yudkoff M.
      • Nissim I.
      ), other studies could not confirm this observation (
      • Penafiel R.
      • Ruzafa C.
      • Pedreño E.
      • Cremades A.
      ,
      • Ruzafa C.
      • Monserrat F.
      • Cremades A.
      • Penafiel R.
      ,
      • Coleman C.S.
      • Hu G.R.
      • Pegg A.E.
      ). Even more, it is also possible that part of the 14CO2 generated from l-[1-14C]arginine in rodent tissue homogenates may be not derived directly by the action of ADC, but rather it may be generated from the concerted action of arginase- and ornithine-metabolizing enzymes such as ODC or ornithine aminotransferase present in the extracts as shown in plant extracts (
      • Birecka H.
      • Bitonti A.J.
      • Mccann P.P.
      ). Interestingly, the identification of a human cDNA clone that exhibited ADC activity when expressed on COS-7 cells was reported recently (
      • Zhu M.Y.
      • Iyo A.
      • Piletz J.E.
      • Regunathan S.
      ). The sequence of this gene was not related to that of a previously reported ADC partial clone isolated from rat kidney (
      • Morrissey J.
      • Mccracken R.
      • Ishidoya S.
      • Klahr S.
      ) that presented a high homology with that of E. coli ADC. Surprisingly, the ADC sequence deduced from this human ADC clone was identical to that of the previously identified human ODCp (
      • Pitkanen L.T.
      • Heiskala M.
      • Andersson L.C.
      ). However, in a more recent study neither ODC nor ADC activity could be detected in bacterial extracts of transfected E. coli with human ODCp (
      • Coleman C.S.
      • Hu G.R.
      • Pegg A.E.
      ). In our present results, in most cases we could not detect any significant ADC activity in HEK 293T cells transfected with the murine ODCp, which is in agreement with the results reported using human ODCp (
      • Coleman C.S.
      • Hu G.R.
      • Pegg A.E.
      ). In the few cases where we found decarboxylation of arginine in the HEK 293T ODCp-transfected cells, the activity was not comparable with that reported in the COS-7 cells transfected with the putative human ADC clone (
      • Zhu M.Y.
      • Iyo A.
      • Piletz J.E.
      • Regunathan S.
      ), and neither agmatine synthesis could be detected. In our opinion, the lack of ADC activity of mouse ODCp is not surprising because, as discussed above, it is unlikely that mouse ODCp may efficiently bind pyridoxal phosphate, the coenzyme needed by bacterial and plant ADC (
      • Tabor C.W.
      • Tabor H.
      ). At present, we do not known the reason for the discrepancy in ADC activity between human and murine genes, apart from the already commented substitution of lysine residue 69 by glycine.
      In conclusion, our results indicate that mouse ODCp is devoid of intrinsic decarboxylating activity of ornithine or arginine, but it may act as an AZ inhibitory protein as efficiently as the established AZI. Accordingly, it should be considered as a second member of the AZI family and tentatively named as AZI2. The preferential expression of ODCp in brain and testis, tissues with low ODC activity and having blood/tissue barrier, paralleling the expression of AZ3, together with the differences in compartmentation between ODC and ODCp led us to speculate that ODCp could participate in the control of polyamine uptake presumably by acting on AZ3. It will be of interest to determine whether such AZ inhibitory capacity is shared by human ODCp or other ODCp orthologues.

      References

        • Tabor C.W.
        • Tabor H.
        Annu. Rev. Biochem. 1984; 53: 749-790
        • Cohen S.S.
        A Guide to the Polyamines. University Press, Oxford, New York1998
        • Thomas T.
        • Thomas T.J.
        Cell. Mol. Life Sci. 2001; 58: 244-258
        • Wallace H.M.
        • Fraser A.V.
        • Hughes A.
        Biochem. J. 2003; 376: 1-14
        • Pegg A.E.
        Biochem. J. 1986; 234: 249-262
        • Heby O.
        • Persson L.
        Trends Biochem. Sci. 1990; 15: 153-158
        • Seiler N.
        • Delcros J.G.
        • Moulinoux J.P.
        Int. J. Biochem. Cell Biol. 1996; 28: 843-861
        • Seiler N.
        Amino Acids (Vienna). 2004; 26: 217-233
        • Janne J.
        • Alhonen L.
        • Pietila M.
        • Keinanen T.A.
        Eur. J. Biochem. 2004; 271: 877-894
        • Bello-Fernandez C.
        • Packham G.
        • Cleveland J.L.
        Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 7804-7808
        • Hayashi S.
        • Murakami Y.
        • Matsufuji S.
        Trends Biochem. Sci. 1996; 21: 27-30
        • Reddy S.G.
        • McIlheran S.M.
        • Cochran B.J.
        • Worth L.L.
        • Bishop L.A.
        • Brown P.J.
        • Knutson V.P.
        • Haddox M.K.
        J. Biol. Chem. 1996; 271: 24945-24953
        • Li R.S.
        • Law G.L.
        • Seifert R.A.
        • Romaniuk P.J.
        • Morris D.R.
        Exp. Cell Res. 1999; 247: 257-266
        • Shantz L.M.
        • Pegg A.E.
        Int. J. Biochem. Cell Biol. 1999; 31: 107-122
        • Coffino P.
        Nat. Rev. Mol. Cell Biol. 2001; 2: 188-194
        • Pegg A.E.
        J. Biol. Chem. 2006; 281: 14529-14532
        • Hayashi S.
        • Canellakis E.S.
        Hayashi S Ornithine Decarboxylase: Biology, Enzymology and Molecular Genetics. Pergamon Press Inc., Tarrytown, NY1989: 47-58
        • Mangold U.
        IUBMB Life. 2005; 57: 671-676
        • Murakami Y.
        • Matsufuji S.
        • Kameji T.
        • Hayashi S.
        • Igarashi K.
        • Tamura T.
        • Tanaka K.
        • Ichihara A.
        Nature. 1992; 360: 597-599
        • Murakami Y.
        • Tanahashi N.
        • Tanaka K.
        • Omura S.
        • Hayashi S.
        Biochem. J. 1996; 317: 77-80
        • Coffino P.
        Biochimie (Paris). 2001; 83: 319-323
        • Rom E.
        • Kahana C.
        Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3959-3963
        • Matsufuji S.
        • Matsufuji T.
        • Miyazaki Y.
        • Murakami Y.
        • Atkins J.F.
        • Gesteland R.F.
        • Hayashi S.
        Cell. 1995; 80: 51-60
        • Murakami Y.
        • Ichiba T.
        • Matsufuji S.
        • Hayashi S.
        J. Biol. Chem. 1996; 271: 3340-3342
        • Mangold U.
        • Leberer E.
        Biochem. J. 2005; 385: 21-28
        • Suzuki T.
        • He Y.
        • Kashiwagi K.
        • Murakami Y.
        • Hayashi S.
        • Igarashi K.
        Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8930-8934
        • Zhu C.
        • Lang D.W.
        • Coffino P.
        J. Biol. Chem. 1999; 274: 26425-26430
        • Mitchell J.L.A.
        • Judd G.G.
        • Bareyalleyser A.
        • Ling S.Y.
        Biochem. J. 1994; 299: 19-22
        • Ivanov I.P.
        • Rohrwasser A.
        • Terreros D.A.
        • Gesteland R.F.
        • Atkins J.F.
        Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4808-4813
        • Auvinen M.
        • Paasinen A.
        • Andersson L.C.
        • Holtta E.
        Nature. 1992; 360: 355-358
        • Megosh L.
        • Gilmour S.K.
        • Rosson D.
        • Soler A.P.
        • Blessing M.
        • Sawicki J.A.
        • Obrien T.G.
        Cancer Res. 1995; 55: 4205-4209
        • Feith D.J.
        • Shantz L.M.
        • Pegg A.E.
        Cancer Res. 2001; 61: 6073-6081
        • Fong L.Y.Y.
        • Feith D.J.
        • Pegg A.E.
        Cancer Res. 2003; 63: 3945-3954
        • Jung M.H.
        • Kim S.C.
        • Jeon G.A.
        • Kim S.H.
        • Kim Y.
        • Choi K.S.
        • Park S.I.
        • Joe M.K.
        • Kimm K.
        Genomics. 2000; 69: 281-286
        • Nilsson J.
        • Grahn B.
        • Heby O.
        Biochem. J. 2000; 346: 699-704
        • Gruendler C.
        • Lin Y.
        • Farley J.
        • Wang T.W.
        J. Biol. Chem. 2001; 276: 46533-46543
        • Newman R.M.
        • Mobascher A.
        • Mangold U.
        • Koike C.
        • Diah S.
        • Schmidt M.
        • Finley D.
        • Zetter B.R.
        J. Biol. Chem. 2004; 279: 41504-41511
        • Li G.
        • Regunathan S.
        • Barrow C.J.
        • Eshraghi J.
        • Cooper R.
        • Reis D.J.
        Science. 1994; 263: 966-969
        • Raasch W.
        • Regunathan S.
        • Li G.
        • Reis D.J.
        Life Sci. 1995; 56: 2319-2330
        • Lortie M.J.
        • Novotny W.F.
        • Peterson O.W.
        • Vallon V.
        • Malvey K.
        • Mendonca M.
        • Satriano J.
        • Insel P.
        • Thomson S.C.
        • Blantz R.C.
        J. Clin. Investig. 1996; 97: 413-420
        • Iyer R.K.
        • Kim H.K.
        • Tsoa R.W.
        • Grody W.W.
        • Cederbaum S.D.
        Mol. Genet. Metab. 2002; 75: 209-218
        • Mistry S.K.
        • Burwell T.J.
        • Chambers R.M.
        • Rudolph-Owen L.
        • Spaltmann F.
        • Cook W.J.
        • Morris S.M.
        Am. J. Physiol. 2002; 282: G375-G381
        • Sastre M.
        • Galea E.
        • Feinstein D.
        • Reis D.J.
        • Regunathan S.
        Biochem. J. 1998; 330: 1405-1409
        • Regunathan S.
        • Reis D.J.
        J. Neurochem. 2000; 74: 2201-2208
        • Horyn O.
        • Luhovyy B.
        • Lazarow A.
        • Daikhin Y.
        • Nissim A.
        • Yudkoff M.
        • Nissim I.
        Biochem. J. 2005; 388: 419-425
        • Penafiel R.
        • Ruzafa C.
        • Pedreño E.
        • Cremades A.
        Bardocz S. White A. Hajos G Metabolic Effects of Biologically Active Amines in Food. European Commission, Luxembourg1998: 79-85 (COST 917)
        • Ruzafa C.
        • Monserrat F.
        • Cremades A.
        • Penafiel R.
        J. Nutr. Biochem. 2003; 14: 333-341
        • Coleman C.S.
        • Hu G.R.
        • Pegg A.E.
        Biochem. J. 2004; 379: 849-855
        • Gilad G.M.
        • Gilad V.H.
        • Rabey J.M.
        Neurosci. Lett. 1996; 216: 33-36
        • Shah R.
        • Coleman C.S.
        • Mir K.
        • Baldwin J.
        • Van Etten J.L.
        • Grishin N.V.
        • Pegg A.E.
        • Stanley B.A.
        • Phillips M.A.
        J. Biol. Chem. 2004; 279: 35760-35767
        • Zhu M.Y.
        • Iyo A.
        • Piletz J.E.
        • Regunathan S.
        Biochim. Biophys. Acta. 2004; 1670: 156-164
        • Pitkanen L.T.
        • Heiskala M.
        • Andersson L.C.
        Biochem. Biophys. Res. Commun. 2001; 287: 1051-1057
        • Sambrook J.
        • Fritsch E.F.
        • Maniatis T.
        Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989
        • Szymanska G.
        • O'Connor M.B.
        • O'Connor C.M.
        Anal. Biochem. 1997; 252: 96-105
        • Russell D.
        • Snyder S.H.
        Proc. Natl. Acad. Sci. U. S. A. 1968; 60: 1420-1427
        • Bradford M.M.
        Anal. Biochem. 1976; 72: 248-254
        • Seiler N.
        Methods Enzymol. 1983; 94: 10-25
        • Almrud J.J.
        • Oliveira M.A.
        • Kern A.D.
        • Grishin N.V.
        • Phillips M.A.
        • Hackert M.L.
        J. Mol. Biol. 2000; 295: 7-16
        • Poulin R.
        • Lu L.
        • Ackermann B.
        • Bey P.
        • Pegg A.E.
        J. Biol. Chem. 1992; 267: 150-158
        • Tsirka S.
        • Coffino P.
        J. Biol. Chem. 1992; 267: 23057-23062
        • Tobias K.E.
        • Kahana C.
        Biochemistry. 1993; 32: 5842-5847
        • Coleman C.S.
        • Stanley B.A.
        • Pegg A.E.
        J. Biol. Chem. 1993; 268: 24572-24579
        • Osterman A.L.
        • Kinch L.N.
        • Grishin N.V.
        • Phillips M.A.
        J. Biol. Chem. 1995; 270: 11797-11802
        • Lu L.
        • Stanley B.A.
        • Pegg A.E.
        Biochem. J. 1991; 277: 671-675
        • Tobias K.E.
        • Mamroudkidron E.
        • Kahana C.
        Eur. J. Biochem. 1993; 218: 245-250
        • Metcalf B.W.
        • Bey P.
        • Danzin C.
        • Jung M.J.
        • Casara P.
        • Vevert J.P.
        J. Am. Chem. Soc. 1978; 100: 2551-2553
        • Bitonti A.J.
        • Casara P.J.
        • Mccann P.P.
        • Bey P.
        Biochem. J. 1987; 242: 69-74
        • Boucher J.L.
        • Custot J.
        • Vadon S.
        • Delaforge M.
        • Lepoivre M.
        • Tenu J.P.
        • Yapo A.
        • Mansuy D.
        Biochem. Biophys. Res. Commun. 1994; 203: 1614-1621
        • Daghigh F.
        • Fukuto J.M.
        • Ash D.E.
        Biochem. Biophys. Res. Commun. 1994; 202: 174-180
        • Li X.Q.
        • Coffino P.
        Mol. Cell. Biol. 1992; 12: 3556-3562
        • Pegg A.E.
        • Feith D.J.
        • Fong L.Y.Y.
        • Coleman C.S.
        • O'Brien T.G.
        • Shantz L.M.
        Biochem. Soc. Trans. 2003; 31: 356-360
        • Morrissey J.
        • Mccracken R.
        • Ishidoya S.
        • Klahr S.
        Kidney Int. 1995; 47: 1458-1461
        • Regunathan S.
        • Youngson C.
        • Raasch W.
        • Wang H.
        • Reis D.J.
        J. Pharmacol. Exp. Ther. 1996; 276: 1272-1282
        • Sastre M.
        • Regunathan S.
        • Galea E.
        • Reis D.J.
        J. Neurochem. 1996; 67: 1761-1765
        • Birecka H.
        • Bitonti A.J.
        • Mccann P.P.
        Plant Physiol. 1985; 79: 509-514
        • Tabor C.W.
        • Tabor H.
        Microbiol. Rev. 1985; 49: 81-99