Formation of mammalian preribosomes proceeds from intermediate to composed state during ribosome maturation

  • Danysh A. Abetov
    Footnotes
    Affiliations
    Department of Molecular and Cellular Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas 77030
    Search for articles by this author
  • Vladimir S. Kiyan
    Footnotes
    Affiliations
    Department of Molecular and Cellular Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas 77030
    Search for articles by this author
  • Assylbek A. Zhylkibayev
    Footnotes
    Affiliations
    Department of Molecular and Cellular Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas 77030
    Search for articles by this author
  • Dilara A. Sarbassova
    Affiliations
    Department of Molecular and Cellular Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas 77030
    Search for articles by this author
  • Sanzhar D. Alybayev
    Footnotes
    Affiliations
    Department of Molecular and Cellular Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas 77030
    Search for articles by this author
  • Eric Spooner
    Affiliations
    Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02142,
    Search for articles by this author
  • Min Sup Song
    Affiliations
    Department of Molecular and Cellular Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas 77030

    MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences, Houston, Texas 77030,
    Search for articles by this author
  • Rakhmetkazhy I. Bersimbaev
    Affiliations
    Department of Natural Sciences, L. N. Gumilyov Eurasian National University, Nur-Sultan 010000, Kazakhstan, and
    Search for articles by this author
  • Dos D. Sarbassov
    Correspondence
    To whom correspondence should be addressed: Dept. of Biology, Nazarbayev University, Nur-Sultan 010000, Kazakhstan. Tel.:7-717-270-5873;
    Affiliations
    Department of Molecular and Cellular Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas 77030

    MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences, Houston, Texas 77030,

    Department of Biology, Nazarbayev University, Nur-Sultan 010000, Kazakhstan
    Search for articles by this author
  • Author Footnotes
    1 Both authors contributed equally to this work.
    2 Present address: Graduate School, Cornell University, Ithaca, NY 14853.
    3 Present address: Head of the Research Platform of Agricultural Biotechnology, Dept. of Microbiology and Biotechnology, S. Seifullin Kazakh Agro Technical University, Nur-Sultan 010000, Kazakhstan.
    4 Present address: Senior Research Scientist, Laboratory of Stem Cells, National Center for Biotechnology, Nur-Sultan 010000, Kazakhstan.
    5 Present address: Graduate School, Al-Farabi Kazakh National University, Almaty 050040, Kazakhstan.
    7 The abbreviations used are: RNPribonucleoproteinRPSribosomal proteins of small subunitRPLribosomal proteins of large subunitIPRibintermediate preribosomeCPRibcomposed preribosomeLYARLy1 antibody–reactivePolRNA polymerasesnosmall nucleolarTAPtandem affinity purificationPwp2periodic tryptophan protein 2DFCdense fibrillar componentGCgranular componentDKC1dyskerin pseudouridine synthase 1ITSinternal transcribed spacerERendoplasmic reticulumTricineN-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine.
      In eukaryotes, ribosome assembly is a rate-limiting step in ribosomal biogenesis that takes place in a distinctive subnuclear organelle, the nucleolus. How ribosomes get assembled at the nucleolar site by forming initial preribosomal complexes remains poorly characterized. In this study, using several human and murine cell lines, we developed a method for isolation of native mammalian preribosomal complexes by lysing cell nuclei through mild sonication. A sucrose gradient fractionation of the nuclear lysate resolved several ribonucleoprotein (RNP) complexes containing rRNAs and ribosomal proteins. Characterization of the RNP complexes with MS-based protein identification and Northern blotting–based rRNA detection approaches identified two types of preribosomes we named here as intermediate preribosomes (IPRibs) and composed preribosome (CPRib). IPRib complexes comprised large preribosomes (105S to 125S in size) containing the rRNA modification factors and premature rRNAs. We further observed that a distinctive CPRib complex consists of an 85S preribosome assembled with mature rRNAs and a ribosomal biogenesis factor, Ly1 antibody–reactive (LYAR), that does not associate with premature rRNAs and rRNA modification factors. rRNA-labeling experiments uncovered that IPRib assembly precedes CPRib complex formation. We also found that formation of the preribosomal complexes is nutrient-dependent because the abundances of IPRib and CPRib decreased substantially when cells were either deprived of amino acids or exposed to an mTOR kinase inhibitor. These findings indicate that preribosomes form via dynamic and nutrient-dependent processing events and progress from an intermediate to a composed state during ribosome maturation.

      Introduction

      Ribosomal biogenesis is a cellular biosynthetic process of constructing the massive ribonucleoprotein (RNP)
      The abbreviations used are: RNP
      ribonucleoprotein
      RPS
      ribosomal proteins of small subunit
      RPL
      ribosomal proteins of large subunit
      IPRib
      intermediate preribosome
      CPRib
      composed preribosome
      LYAR
      Ly1 antibody–reactive
      Pol
      RNA polymerase
      sno
      small nucleolar
      TAP
      tandem affinity purification
      Pwp2
      periodic tryptophan protein 2
      DFC
      dense fibrillar component
      GC
      granular component
      DKC1
      dyskerin pseudouridine synthase 1
      ITS
      internal transcribed spacer
      ER
      endoplasmic reticulum
      Tricine
      N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine.
      complexes known as ribosomes. It is an elaborate process that determines the rate of protein synthesis, and by controlling a main anabolic cellular process, it regulates accumulation of cellular mass or cell growth (
      • Nazar R.N.
      Ribosomal RNA processing and ribosome biogenesis in eukaryotes.
      ,
      • Thomson E.
      • Ferreira-Cerca S.
      • Hurt E.
      Eukaryotic ribosome biogenesis at a glance.
      • Lempiäinen H.
      • Shore D.
      Growth control and ribosome biogenesis.
      ). An intensive and coordinated ribosomal biogenesis is crucial for eukaryotic cells because the evolutionary transition from a prokaryotic to a eukaryotic form of life is marked by a substantial increase in cell size. It is particularly relevant for mammalian cells considering that an average mammalian cell (15–20-μm cell diameter) is at least 1000 times larger than a bacterial Escherichia coli cell (1–1.5-μm cell diameter) (
      • Moran U.
      • Phillips R.
      • Milo R.
      SnapShot: key numbers in biology.
      ). In eukaryotes, a designated subnuclear organelle nucleolus has evolved to accommodate an intensive ribosomal biogenesis (
      • Lam Y.W.
      • Trinkle-Mulcahy L.
      • Lamond A.I.
      The nucleolus.
      ,
      • Pederson T.
      The nucleolus.
      • Klinge S.
      • Woolford Jr., J.L.
      Ribosome assembly coming into focus.
      ). The nucleolus is a nonmembrane-bound organelle located in the nucleus and is visualized as a dense particle at the chromatin sites of multiple ribosomal DNA (rDNA) repeats. Ribosome building is a main functional role of nucleoli where the massive ribosomal rDNA locus is integrated into a ribosomal construction site by various ribosomal biogenesis factors.
      Ribosomal biogenesis is a dynamic process, and it is determined by the rates of synthesis of ribosomal components, including its rRNAs and multiple ribosomal proteins (79 in yeast and 80 in human cells), the active nuclear import of ribosomal proteins from the cytoplasm to the nucleus, assembly of ribosomes, and nuclear export of assembled ribosomes to cytoplasm (
      • Nerurkar P.
      • Altvater M.
      • Gerhardy S.
      • Schütz S.
      • Fischer U.
      • Weirich C.
      • Panse V.G.
      Eukaryotic ribosome assembly and nuclear export.
      ,
      • de la Cruz J.
      • Karbstein K.
      • Woolford Jr., J.L.
      Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.
      ). Assembly of ribosomes is the most elaborate and rate-limiting step in ribosomal biogenesis. Mature human 80 Svedberg (80S) ribosome is composed of two ribosomal subunits: a small 40S subunit representing the RNP complex of 18S rRNA and 33 distinct ribosomal proteins of small (RPS) subunit and a large 60S subunit representing the RNP complex containing 28S, 5.8S, and 5S rRNAs and 47 distinct ribosomal proteins of large (RPL) subunit. rRNAs make up the core of both ribosomal subunits and predominate the ribosomal protein content by weight (
      • Yusupova G.
      • Yusupov M.
      High-resolution structure of the eukaryotic 80S ribosome.
      ). Most rRNAs are synthesized by RNA polymerase I (Pol I) as an rRNA precursor (47S rRNA in mammalian cells; a transcript of 13 kb) at nucleolar organizer regions containing several hundred ribosomal DNA (rDNA) gene repeats residing in five clusters located on chromosomes 13, 14, 15, 21, and 22 of human diploid cells. A newly synthesized rRNA precursor is processed rapidly by proper folding and specific endonucleolytic cleavages coupled with exonuclease treatments to generate three rRNAs (18S, 5.8S, and 28S), and Pol III synthesizes 5S rRNA by transcribing several hundred copies of 5S rDNA genes located on chromosome 1. Small nucleolar (sno) RNAs assembled into conserved snoRNP complexes also participate in rRNA processing by performing specific covalent modifications (methylation, acetylation, and pseudouridylation) that are critical for ribosomal assembly and function (
      • Nerurkar P.
      • Altvater M.
      • Gerhardy S.
      • Schütz S.
      • Fischer U.
      • Weirich C.
      • Panse V.G.
      Eukaryotic ribosome assembly and nuclear export.
      ,
      • de la Cruz J.
      • Karbstein K.
      • Woolford Jr., J.L.
      Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.
      ,
      • Watkins N.J.
      • Bohnsack M.T.
      The box C/D and H/ACA snoRNPs: key players in the modification, processing and the dynamic folding of ribosomal RNA.
      ).
      Assembly of both (40S and 60S) ribosomal subunits takes place simultaneously with the processing of rRNAs. According to the current model of eukaryotic ribosomal biogenesis, the rRNAs and ribosomal proteins are assembled at the granular zone of the nucleolus by coalescing into a large 90S preribosome. It is later divided into the pre-60S and pre-40S subunits, which facilitates their exit from the nucleus to cytoplasm through nuclear pores for their final maturation and functional localization (
      • Tschochner H.
      • Hurt E.
      Pre-ribosomes on the road from the nucleolus to the cytoplasm.
      ). The enormous and delicate task of simultaneous rRNA processing and assembly of ribosomes into 90S preribosome is carried out by a large and highly diverse group of ribosomal biogenesis factors. Functional studies in yeast indicate that more than 350 nucleolar proteins (half of all nucleolar proteins) participate in ribosomal biogenesis, indicating the complexity of ribosomal assembly (
      • Klinge S.
      • Woolford Jr., J.L.
      Ribosome assembly coming into focus.
      ). Assembly of eukaryotic preribosomes remains poorly characterized.
      Eukaryotic native preribosomal complexes and nascent rRNAs were originally detected in studies in the 1970s (
      • Warner J.R.
      • Soeiro R.
      Nascent ribosomes from HeLa cells.
      ,
      • Trapman J.
      • Retèl J.
      • Planta R.J.
      Ribosomal precursor particles from yeast.
      ). In 1975, a large RNP complex of 90S particle was detected in the nuclear lysates of yeast by sucrose fractionation (
      • Trapman J.
      • Retèl J.
      • Planta R.J.
      Ribosomal precursor particles from yeast.
      ). Following this breakthrough finding there were no active studies on the characterization of preribosomal complexes until the advances in proteomics. In 2002, Hurt and co-workers (
      • Grandi P.
      • Rybin V.
      • Bassler J.
      • Petfalski E.
      • Strauss D.
      • Marzioch M.
      • Schäfer T.
      • Kuster B.
      • Tschochner H.
      • Tollervey D.
      • Gavin A.C.
      • Hurt E.
      90S pre-ribosomes include the 35S pre-rRNA, the U3 snoRNP, and 40S subunit processing factors but predominantly lack 60S synthesis factors.
      ) introduced and established a tandem affinity purification (TAP) method to purify preribosomal complexes in yeast. The assumption was made that if a stably expressed recombinant protein (a ribosomal biogenesis factor) entered a sucrose gradient and copurified with ribosomal RNAs, then a recombinant protein is assembled into a preribosomal complex. Based on this assumption, a TAP-purified complex was isolated by expression of the ribosomal biogenesis factor periodic tryptophan protein 2 (Pwp2; also known as Utp1). The complex formed by a constitutively expressed Pwp2 did not show a sharp peak of 90S particle but instead was dispersed across the sucrose gradient, indicating the presence of heterogeneous complexes containing Pwp2 due to possible disintegration of a large complex. As the outcome of an initial assumption, the TAP purification–isolated Pwp2 complex was named as 90S (
      • Grandi P.
      • Rybin V.
      • Bassler J.
      • Petfalski E.
      • Strauss D.
      • Marzioch M.
      • Schäfer T.
      • Kuster B.
      • Tschochner H.
      • Tollervey D.
      • Gavin A.C.
      • Hurt E.
      90S pre-ribosomes include the 35S pre-rRNA, the U3 snoRNP, and 40S subunit processing factors but predominantly lack 60S synthesis factors.
      ), not because of its actual size but because of the original 1970s studies (
      • Trapman J.
      • Retèl J.
      • Planta R.J.
      Ribosomal precursor particles from yeast.
      ). Thus, native preribosomal complexes in eukaryotes have not been isolated and characterized, and for the last two decades, preribosomal complexes at nucleolar sites have been studied by purification of the tagged recombinant proteins (
      • Klinge S.
      • Woolford Jr., J.L.
      Ribosome assembly coming into focus.
      ,
      • Kornprobst M.
      • Turk M.
      • Kellner N.
      • Cheng J.
      • Flemming D.
      • Koš-Braun I.
      • Koš M.
      • Thoms M.
      • Berninghausen O.
      • Beckmann R.
      • Hurt E.
      Architecture of the 90S pre-ribosome: a structural view on the birth of the eukaryotic ribosome.
      ,
      • Sun Q.
      • Zhu X.
      • Qi J.
      • An W.
      • Lan P.
      • Tan D.
      • Chen R.
      • Wang B.
      • Zheng S.
      • Zhang C.
      • Chen X.
      • Zhang W.
      • Chen J.
      • Dong M.Q.
      • Ye K.
      Molecular architecture of the 90S small subunit pre-ribosome.
      ). The main purpose of the present study was to isolate and characterize mammalian preribosomal complexes with a focus on optimizing nuclear lysis conditions to preserve native preribosomal complexes and carrying out their detection and characterization.

      Results

       Isolation of native mammalian preribosomal complexes

      Biochemical characterization of preribosomal complexes is a challenging task because nucleoli are dense particles with heterogeneous segments (
      • Lam Y.W.
      • Trinkle-Mulcahy L.
      • Lamond A.I.
      The nucleolus.
      ,
      • de la Cruz J.
      • Karbstein K.
      • Woolford Jr., J.L.
      Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.
      ,
      • Derenzini M.
      • Trerè D.
      • Pession A.
      • Montanaro L.
      • Sirri V.
      • Ochs R.L.
      Nucleolar function and size in cancer cells.
      ). The fibrillar center, dense fibrillar component (DFC), and granular component (GC) represent distinct segments of nucleoli known to carry out different functions. DFC or the border between DFC and fibrillar center regions is mostly assigned to the nucleolar organizer regions for production of pre-rRNA carried out by Pol I transcription, whereas GC, the least dense segment of nucleoli, has been identified as a ribosomal assembly site. Considering that isolation of nucleoli requires a stringent lysis condition accompanied with sonication (
      • Andersen J.S.
      • Lam Y.W.
      • Leung A.K.
      • Ong S.E.
      • Lyon C.E.
      • Lamond A.I.
      • Mann M.
      Nucleolar proteome dynamics.
      ,
      • Li Z.F.
      • Lam Y.W.
      A new rapid method for isolating nucleoli.
      ), it is possible that purification of nucleoli might cause disruption of GC and loss of preribosomal complexes. To eliminate the potential loss of preribosomal complexes in preparative steps of nucleolar enrichment, we chose to work with isolated nuclei and optimize the nuclear lysis condition by an effective extraction of preribosomal complexes without their disintegration (Fig. S1).
      We selected cancer cells for our studies because their accelerated growth is accommodated by intensive ribosomal biogenesis (
      • Derenzini M.
      • Trerè D.
      • Pession A.
      • Montanaro L.
      • Sirri V.
      • Ochs R.L.
      Nucleolar function and size in cancer cells.
      ,
      • Guertin D.A.
      • Sabatini D.M.
      An expanding role for mTOR in cancer.
      ,
      • Guertin D.A.
      • Sabatini D.M.
      Defining the role of mTOR in cancer.
      ). As the primary step, we isolated intact nuclei from A549 cancer cells (a human adenocarcinoma lung cancer cell line) (
      • Giard D.J.
      • Aaronson S.A.
      • Todaro G.J.
      • Arnstein P.
      • Kersey J.H.
      • Dosik H.
      • Parks W.P.
      In vitro cultivation of human tumors: establishment of cell lines derived from a series of solid tumors.
      ) and performed a stringent nuclear washing step to assure removal of mature cytoplasmic ribosomes and disruption of the nuclear envelope. Purified nuclei were further lysed in Nuclear Lysis Buffer by mild sonication to obtain the soluble nucleolar lysate that was further analyzed for the presence of RNPs by sucrose gradient fractionation. The mild sonication of nuclei was titrated to obtain optimal conditions to lyse nucleoli and release preribosomal complexes without substantial damage to preribosomal complexes. We examined extraction of the nucleolar markers fibrillarin and NOP56 (
      • Hayano T.
      • Yanagida M.
      • Yamauchi Y.
      • Shinkawa T.
      • Isobe T.
      • Takahashi N.
      Proteomic analysis of human Nop56p-associated pre-ribosomal ribonucleoprotein complexes. Possible link between Nop56p and the nucleolar protein treacle responsible for Treacher Collins syndrome.
      ,
      • Lechertier T.
      • Grob A.
      • Hernandez-Verdun D.
      • Roussel P.
      Fibrillarin and Nop56 interact before being co-assembled in box C/D snoRNPs.
      ) to monitor lysis of nucleoli. The obtained soluble nucleolar fraction was precleared by centrifugation, and the precleared lysates were fractionated by ultracentrifugation on a linear 0–50% sucrose gradient (Fig. S2) with the parameters similar to those used to resolve ribosomal particles and polysomes (
      • Gandin V.
      • Sikstrom K.
      • Alain T.
      • Morita M.
      • McLaughlan S.
      • Larsson O.
      • Topisirovic I.
      Polysome fractionation and analysis of mammalian translatomes on a genome-wide scale.
      ). Fractionation with continuous monitoring of RNA absorbance detected several RNP complexes resolved on the sucrose gradient (Fig. 1). We observed a sharp and high peak corresponding to a particle of 85S in size with RNA absorbance of 1.1 (A254 = 1.1). The other smaller peaks corresponding to larger particles stretched from 125S to 105S. The largest particle among the trailing peaks was resolved as a 125S complex with RNA absorbance of 0.45 (A254 = 0.49). We characterized the resolved RNP complexes by analyzing their rRNA/protein compositions and rRNA labeling dynamics. According to our analysis, the sharp and high peak of 85S particle was detected in fractions 17 and 18 and was named as the composed preribosome (CPRib), and the larger RNP particles stretching from fractions 21 to 26 were designated as the intermediate preribosomes (IPRibs). Partially overlapping peaks of IPRib complexes were further distinguished by size as the IPRib1 (125S particles collected in fractions 25 and 26), IPRib2 (115S particles collected in fractions 23 and 24), and IPRib3 (105S particles collected in fractions 21 and 22).
      Figure thumbnail gr1
      Figure 1Detection of the native preribosomal CPRib and IPRib complexes. The soluble nuclear fraction was obtained from the human A549 cancer cells and analyzed by linear (0–50%) sucrose gradient fractionation. The resolved RNP complexes were detected by continuous monitoring of RNA absorbance at 254 nm using a BioComp gradient station with a Triax flow cell. The resolved CPRib (85S) and IPRib (105S–125S) RNP particles are indicated. Fractions 17 and 18, CPRib, 85S; fractions 25 and 26, IPRib1, 125S; fractions 23 and 24, IPRib2, 115S; fractions 21 and 22, IPRib3, 105S.
      Similar (IPRib and CPRib) RNP complexes were detected by fractionation of the nuclear lysates obtained from human MDA-MB-231 (
      • Kapoor C.L.
      • Cho-Chung Y.S.
      Mitotic apparatus and nucleoli compartmentalization of 50,000-dalton type II regulatory subunit of cAMP-dependent protein kinase in estrogen receptor negative MDA-MB-231 human breast cancer cells.
      ), HCT116 (
      • Deschoolmeester V.
      • Boeckx C.
      • Baay M.
      • Weyler J.
      • Wuyts W.
      • Van Marck E.
      • Peeters M.
      • Lardon F.
      • Vermorken J.B.
      KRAS mutation detection and prognostic potential in sporadic colorectal cancer using high-resolution melting analysis.
      ), HeLa (
      • Landry J.J.
      • Pyl P.T.
      • Rausch T.
      • Zichner T.
      • Tekkedil M.M.
      • Stütz A.M.
      • Jauch A.
      • Aiyar R.S.
      • Pau G.
      • Delhomme N.
      • Gagneur J.
      • Korbel J.O.
      • Huber W.
      • Steinmetz L.M.
      The genomic and transcriptomic landscape of a HeLa cell line.
      ), and mouse AK192 (
      • Ying H.
      • Kimmelman A.C.
      • Lyssiotis C.A.
      • Hua S.
      • Chu G.C.
      • Fletcher-Sananikone E.
      • Locasale J.W.
      • Son J.
      • Zhang H.
      • Coloff J.L.
      • Yan H.
      • Wang W.
      • Chen S.
      • Viale A.
      • Zheng H.
      • et al.
      Oncogenic Kras maintains pancreatic tumors through regulation of anabolic glucose metabolism.
      ) cancer cells and mouse immortalized embryonic fibroblasts (
      • Chen C.H.
      • Shaikenov T.
      • Peterson T.R.
      • Aimbetov R.
      • Bissenbaev A.K.
      • Lee S.W.
      • Wu J.
      • Lin H.K.
      • Sarbassov dos D.
      ER stress inhibits mTORC2 and Akt signaling through GSK-3β-mediated phosphorylation of rictor.
      ) as shown in Figs. S3–S7. Analysis of human primary lung MRC-5 and WI38 fibroblasts (
      • Yamamoto R.
      • Lin L.S.
      • Lowe R.
      • Warren M.K.
      • White T.J.
      The human lung fibroblast cell line, MRC-5, produces multiple factors involved with megakaryocytopoiesis.
      ,
      • McSwiggan D.A.
      • Darougar S.
      • Rahman A.F.
      • Gibson J.A.
      Comparison of the sensitivity of human embryo kidney cells, HeLa cells, and WI38 cells for the primary isolation of viruses from the eye.
      ) also detected the CPRib and IPRib complexes in their nuclear lysates (Figs. S8 and S9).

       The CPRib and IPRib complexes are distinguished not only by size but also by ribosomal biogenesis factors

      To characterize the detected RNP (IPRib and CPRib) complexes, we performed MS analysis of the isolated IPRib and CPRib complexes from A549 and MDA-MB-231 human cancer cells. We performed polyethylene glycol (PEG) precipitation of the CPRib and IPRib complexes, a procedure that is commonly used for isolation of ribosomal complexes from sucrose fractions (
      • Yusupova G.
      • Yusupov M.
      High-resolution structure of the eukaryotic 80S ribosome.
      ). Most RNAs within the obtained nuclear lysate were not associated with large complexes and remained on the surface of the sucrose gradient above fraction 5. We selected fraction 8 as the control fraction because it did not show the presence of RNA. According to the MS analysis, the control fraction contained mostly RNA polymerase components and 26S proteasome regulatory subunits. Most ribosomal proteins of the large (60S) and small (40S) ribosomal subunits were found in the IPRib and CPRib fractions. 73 and 71 ribosomal proteins of 80 known ribosomal proteins were detected by MS in the preribosomal fractions of A549 cells and MDA-MB-231 cells (Tables S1 and S2, respectively) (
      • Ishii K.
      • Washio T.
      • Uechi T.
      • Yoshihama M.
      • Kenmochi N.
      • Tomita M.
      Characteristics and clustering of human ribosomal protein genes.
      ). To validate the proteomics data, we examined the presence of ribosomal proteins in the sucrose gradient fractions. This analysis indicated that both CPRib and IPRib complexes contain the large (rpL5 and rpL26) and small (rpS6 and rpS11) ribosomal subunit proteins that were resolved from fractions 17–26 (Fig. 2). We also observed distinct fractions representing 40S particle that contained only rpS11 and rpS6 proteins but not rpL5 or rpL26, indicating that a small pre-40S ribosomal particle had been resolved as a barely detectable peak from fractions 11–14. Our analysis shows that the resolved RNP complexes representing IPRib and CPRib fractions contain most of the ribosomal proteins of the large and small ribosomal subunits.
      Figure thumbnail gr2
      Figure 2The CPRib and IPRib complexes are distinct preribosomes that contain different ribosomal biogenesis factors. The soluble nuclear fractions obtained from A549 cancer cells were resolved by sucrose fractionation, and the fractions were analyzed by immunoblotting with the indicated antibodies. The CPRib fractions and its components are shown in blue, and the IPRib fractions and its components are shown in red.
      The proteomics analysis was also instrumental to identify the distinct ribosomal biogenesis factors associated with the preribosomal complexes. The lists of identified ribosomal biogenesis factors are shown in Table S3 (A549 cells) and Table S4 (MDA-MB-231 cells). We found that EBP2, Lasil, and Brx1 (
      • Shimoji K.
      • Jakovljevic J.
      • Tsuchihashi K.
      • Umeki Y.
      • Wan K.
      • Kawasaki S.
      • Talkish J.
      • Woolford Jr., J.L.
      • Mizuta K.
      Ebp2 and Brx1 function cooperatively in 60S ribosomal subunit assembly in Saccharomyces cerevisiae.
      ) were detected in both CPRIb and IPRib complexes, and the presence of EBP2 was further validated by immunoblotting (Fig. 2). A ribosomal biogenesis factor, LYAR (also known as cell growth–regulating nucleolar protein) (
      • Miyazawa N.
      • Yoshikawa H.
      • Magae S.
      • Ishikawa H.
      • Izumikawa K.
      • Terukina G.
      • Suzuki A.
      • Nakamura-Fujiyama S.
      • Miura Y.
      • Hayano T.
      • Komatsu W.
      • Isobe T.
      • Takahashi N.
      Human cell growth regulator Ly-1 antibody reactive homologue accelerates processing of preribosomal RNA.
      ), was selectively enriched in CPRib fractions (Fig. 2 and Tables S3 and S4). Most importantly, the rRNA modification factors known to be critical for the assembly and function of ribosomes were found in the IPRib fractions. We detected the methyltransferase fibrillarin and its interacting proteins, NOP56 and NOP58 (
      • Hayano T.
      • Yanagida M.
      • Yamauchi Y.
      • Shinkawa T.
      • Isobe T.
      • Takahashi N.
      Proteomic analysis of human Nop56p-associated pre-ribosomal ribonucleoprotein complexes. Possible link between Nop56p and the nucleolar protein treacle responsible for Treacher Collins syndrome.
      ,
      • Lechertier T.
      • Grob A.
      • Hernandez-Verdun D.
      • Roussel P.
      Fibrillarin and Nop56 interact before being co-assembled in box C/D snoRNPs.
      ), in the IPRib fractions. These proteins are the components of the snoRNP complex known to assemble C/D box and play a crucial role in rRNA methylation. We also found that this complex plays a critical role in assembly of preribosomes because knockdown by shRNA targeting its central component, NOP56, resulted in a substantial suppression of CPRib and IPRib formation (Fig. S10). Besides the methyltransferase complex, IPRib complexes also contained the rRNA acetylation factor RNA cytidine acetyltransferase (NAT10) (
      • Ito S.
      • Horikawa S.
      • Suzuki T.
      • Kawauchi H.
      • Tanaka Y.
      • Suzuki T.
      • Suzuki T.
      Human NAT10 is an ATP-dependent RNA acetyltransferase responsible for N4-acetylcytidine formation in 18 S ribosomal RNA (rRNA).
      ,
      • Sharma S.
      • Langhendries J.L.
      • Watzinger P.
      • Kötter P.
      • Entian K.D.
      • Lafontaine D.L.
      Yeast Kre33 and human NAT10 are conserved 18S rRNA cytosine acetyltransferases that modify tRNAs assisted by the adaptor Tan1/THUMPD1.
      ), the rRNA pseudouridinylation factor dyskerin pseudouridine synthase 1 (DKC1) (
      • Jack K.
      • Bellodi C.
      • Landry D.M.
      • Niederer R.O.
      • Meskauskas A.
      • Musalgaonkar S.
      • Kopmar N.
      • Krasnykh O.
      • Dean A.M.
      • Thompson S.R.
      • Ruggero D.
      • Dinman J.D.
      rRNA pseudouridylation defects affect ribosomal ligand binding and translational fidelity from yeast to human cells.
      ,
      • Ruggero D.
      • Grisendi S.
      • Piazza F.
      • Rego E.
      • Mari F.
      • Rao P.H.
      • Cordon-Cardo C.
      • Pandolfi P.P.
      Dyskeratosis congenita and cancer in mice deficient in ribosomal RNA modification.
      ), and pescadillo ribosomal biogenesis factor 1 (PES1) with its interacting protein Bop1 (
      • Hölzel M.
      • Rohrmoser M.
      • Schlee M.
      • Grimm T.
      • Harasim T.
      • Malamoussi A.
      • Gruber-Eber A.
      • Kremmer E.
      • Hiddemann W.
      • Bornkamm G.W.
      • Eick D.
      Mammalian WDR12 is a novel member of the Pes1-Bop1 complex and is required for ribosome biogenesis and cell proliferation.
      ) (Fig. 2 and Tables S3 and S4). We also detected other factors known to participate in ribosome assembly, including rRNA processing HEAT repeat–containing protein 1 (
      • Dez C.
      • Dlakić M.
      • Tollervey D.
      Roles of the HEAT repeat proteins Utp10 and Utp20 in 40S ribosome maturation.
      ), RRP5 homolog (
      • Turner A.J.
      • Knox A.A.
      • Prieto J.L.
      • McStay B.
      • Watkins N.J.
      A novel small-subunit processome assembly intermediate that contains the U3 snoRNP, nucleolin, RRP5, and DBP4.
      ), MKI67 forkhead-associated (FHA) domain–interacting nucleolar phosphoprotein (
      • Pan W.A.
      • Tsai H.Y.
      • Wang S.C.
      • Hsiao M.
      • Wu P.Y.
      • Tsai M.D.
      The RNA recognition motif of NIFK is required for rRNA maturation during cell cycle progression.
      ), and U3 small nucleolar RNA–associated protein (
      • Champion E.A.
      • Lane B.H.
      • Jackrel M.E.
      • Regan L.
      • Baserga S.J.
      A direct interaction between the Utp6 half-a-tetratricopeptide repeat domain and a specific peptide in Utp21 is essential for efficient pre-rRNA processing.
      ) in the IPRib fractions (Tables S3 and S4). According to protein abundance (the sequenced peptide numbers and immunoblotting analysis), we observed an enrichment of the rRNA modification factors in the fractions corresponding to the largest IPRib complex (IPRib1), suggesting that IPRib1 is a core intermediate preribosome that has been processed to the smaller IPRib2 and IPRib3 complexes during its maturation or that it is partially disintegrated during the biochemical isolation. Thus, the preribosomal CPRib and IPRib complexes are distinct not only by size but also by the content of ribosomal biogenesis factors. The proteomic distinction of IPRib and CPRib implies their different functional roles in ribosomal biogenesis.

       IPRib contains rRNA precursors, and its assembly precedes formation of CPRib

      rRNAs are the core components of ribosomal subunits, and we characterized rRNAs in preribosomal IPRib and CPRib complexes. Following isolation of the preribosomes by PEG precipitation, we isolated RNA from the preribosomal fractions using Trizol reagent and carried out Northern blot analysis using oligonucleotides as the probes (Fig. S11) for detecting rRNAs as described previously for analysis of rRNA processing (
      • Tafforeau L.
      • Zorbas C.
      • Langhendries J.L.
      • Mullineux S.T.
      • Stamatopoulou V.
      • Mullier R.
      • Wacheul L.
      • Lafontaine D.L.
      The complexity of human ribosome biogenesis revealed by systematic nucleolar screening of pre-rRNA processing factors.
      ). The total, nuclear, and cytoplasmic RNAs were resolved in parallel as internal controls for detecting the differences between rRNA and its precursor forms. Probing RNA blots with oligonucleotide probes specific for detection of mature rRNAs (28S, 18S, 5.8S, and 5S) did not show substantial differences among RNAs obtained from the CPRib and IPRib complexes, indicating the presence of rRNAs in the nuclear RNP complexes (Fig. 3B). Surprisingly, only 5S rRNA was less abundant in the cytoplasmic fraction, suggesting that it has an important role in processing and assembly of ribosomes but not in the process of translation as described previous studies (
      • Dinman J.D.
      5S rRNA: structure and function from head to toe.
      ,
      • Kiparisov S.
      • Petrov A.
      • Meskauskas A.
      • Sergiev P.V.
      • Dontsova O.A.
      • Dinman J.D.
      Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae.
      ).
      Figure thumbnail gr3
      Figure 3The 30S and 32S precursor rRNAs are present in the nucleolar preribosomal complexes but not in cytoplasm. A, schematic representation of the RNA precursors recognized by the ITS1 and ITS2 probes. B, RNAs were isolated from IPRib and CPRib complexes as well as total, nuclear, and cytoplasmic (Cytopl.) fractions. Similar amounts of RNA (5 μg) were resolved in an agarose gel and analyzed by Northern blot analysis by probing the membrane with the indicated oligonucleotides complimentary to different areas of human 47S rRNA.
      To detect the rRNA precursors in the IPRib and CPRib fractions, we probed the membranes with internal transcribed spacer 1 and 2 (ITS1 and ITS2) probes (Fig. 3A) (
      • Tafforeau L.
      • Zorbas C.
      • Langhendries J.L.
      • Mullineux S.T.
      • Stamatopoulou V.
      • Mullier R.
      • Wacheul L.
      • Lafontaine D.L.
      The complexity of human ribosome biogenesis revealed by systematic nucleolar screening of pre-rRNA processing factors.
      ). As expected, we observed a strong hybridization of both ITS probes with the total and nuclear but not cytoplasmic RNAs, indicating the presence of the rRNA precursors only in the nuclear but not the cytoplasmic fraction. As detected by both ITS1 and ITS2 probes, the precursor rRNAs (30S and 32S) were also found in the IPRib fractions. Remarkably, the abundance of 30S and 32S rRNAs was decreased substantially in the CPRib fraction (Fig. 3B), indicating that ITS precursors are mostly present in IPRib complexes. We detected fewer precursor rRNAs in the nuclear faction compared with the total RNA fraction, possibly explained by a sensitivity of the precursor rRNAs to degradation during lysis of cells and isolation of nuclei. In addition, we also probed the membranes with the 5′ external transcribed spacer probe to detect a nascent 47S rRNA (early precursor), which was detected mostly in the total RNA fraction, and only its degraded fragments were observed in the nuclear and IPRib fractions (Fig. S12). Thus, the 30S and 32S rRNA precursors were observed in IPRib and much less in CPRib complexes.
      We also assessed the dynamics of rRNA processing within the IPRib1 and CPRIb complexes by performing pulse-chase metabolic labeling of RNA with [3H]uridine according to the established method (
      • Pestov D.G.
      • Lapik Y.R.
      • Lau L.F.
      Assays for ribosomal RNA processing and ribosome assembly.
      ). The [3H]uridine was added to the cells for 30 min for pulse labeling and replaced with medium containing “cold” nonlabeled uridine for the indicated chase time (30, 60, 90, or 120 min). Following the chase incubations, the pulse-labeled cells were lysed for subcellular fractionation, and the obtained nuclear fractions were further analyzed by sucrose gradient fractionation to obtain the IPRib1 (fractions 25 and 26) and CPRib (fractions 17 and 18) complexes. The pulse-chase experiment revealed that the labeled RNAs were detected within 30 min of chase in the IPRib1 complex (Fig. 4A), and it took 4 times longer (120 min) to detect the pulsed RNA in the CPRib complex (Fig. 4B). The pulse-chase experiment identified a substantial difference in dynamics of IPRib and CPRib assembly, revealing that IPRib forms prior to the formation of CPRib in the preribosomal maturation process.
      Figure thumbnail gr4
      Figure 4The IPRib assembly precedes formation of CPRib. The pulse-chase experiment was performed by [3H]uridine labeling of A549 cells for 30 min followed by replacement of the cell culture medium with medium containing nonlabeled “cold” uridine for the indicated chase time (in minutes (′). The nuclear fractions were resolved on a sucrose gradient to obtain the preribosomal complexes. The RNAs isolated from fractions 25 and 26 representing IPRib1 (A) or fractions 17 and 18 representing CPRib (B) complex were resolved on a gel and blotted to the membrane for the fluorographic detection of the 3H-labeled RNAs.

       Formation of IPRib and CPRib is nutrient-dependent

      Nutrient-dependent regulation of ribosomal biogenesis is mediated by mTORC1 kinase activity, which known to control the rates of ribosomal protein synthesis (
      • Guertin D.A.
      • Sabatini D.M.
      Defining the role of mTOR in cancer.
      ,
      • Guertin D.A.
      • Sabatini D.M.
      The pharmacology of mTOR inhibition.
      ) and transcription of rDNA (
      • James M.J.
      • Zomerdijk J.C.
      Phosphatidylinositol 3-kinase and mTOR signaling pathways regulate RNA polymerase I transcription in response to IGF-1 and nutrients.
      • Tsang C.K.
      • Liu H.
      • Zheng X.F.
      mTOR binds to the promoters of RNA polymerase I- and III-transcribed genes.
      ,
      • Mayer C.
      • Grummt I.
      Ribosome biogenesis and cell growth: mTOR coordinates transcription by all three classes of nuclear RNA polymerases.
      • Mayer C.
      • Zhao J.
      • Yuan X.
      • Grummt I.
      mTOR-dependent activation of the transcription factor TIF-IA links rRNA synthesis to nutrient availability.
      ). To determine whether preribosomal complexes are sensitive to nutrient deprivation, we studied A549 cancer cells incubated in medium without amino acids for different time points. A substantial decrease of the preribosomal IPRib (1.9-fold) and CPRib (2.2-fold) peaks compared with the control was detected within 1 h of amino acid depletion (Fig. 5). The preribosomal complexes continued to decrease following the 3rd h of starvation and were at least 2.6-fold smaller for IPRib and 2.8-fold smaller for CPRib complexes (Fig. S13). Furthermore, inhibition of the mTOR kinase activity by treating A549 cancer cells with a potent mTOR kinase inhibitor Torin 1 for 1 h mimicked the amino acid deprivation effect by causing a significant decrease in abundance of IPRib (2.8-fold) and CPRib (2.7-fold) (Fig. 6) that was slightly recovered following the 3rd h of inhibition, indicating only a 2.3-fold decrease for both CPRib and IPRib complexes (Fig. S14). These findings show that the amino acid impact increased from 1 to 3 h of nutrient deprivation, whereas the drug effect was stronger at its 1st h, and its effect gradually decreased following a 3rd h of treatment. Thus, we show that inhibition of the nutrient-dependent mTORC1 signaling known to control ribosomal biogenesis leads to suppression of the preribosomal assembly as detected by low peaks of IPRib and CPRib complexes.
      Figure thumbnail gr5
      Figure 5Abundance of preribosomal CPRib and IPRib complexes is sensitive to amino acid deprivation. A549 cells were incubated in the medium with or without amino acids (−AA) for 1 h. The soluble nuclear fraction was obtained from cells and analyzed by linear (0–50%) sucrose gradient fractionation as described in . The overlaid profiles of preribosomal complexes are shown with control cells in green and 1-h amino acid (−AA)–deprived cells in blue.
      Figure thumbnail gr6
      Figure 6Abundance of preribosomal CPRib and IPRib complexes is sensitive to inhibition of the mTOR kinase activity. A549 cells were incubated with or without Torin 1 (250 nm) for 1 h. The soluble nuclear fraction was obtained from cells and analyzed by linear (0–50%) sucrose gradient fractionation as described in . The overlaid profiles of preribosomal complexes are shown with control cells in green and 1-h Torin 1–treated cells in blue.
      This study shows that CPRib presented as an 85S particle is distinct from a cytoplasmic 80S ribosome. It is well-known that the abundance of 80S ribosomes increases substantially following inhibition of nutrient-dependent mTORC1 signaling because disintegration of polysomes leads to the accumulation of ribosomal 80S particles (
      • Thoreen C.C.
      • Chantranupong L.
      • Keys H.R.
      • Wang T.
      • Gray N.S.
      • Sabatini D.M.
      A unifying model for mTORC1-mediated regulation of mRNA translation.
      ,
      • Hsieh A.C.
      • Liu Y.
      • Edlind M.P.
      • Ingolia N.T.
      • Janes M.R.
      • Sher A.
      • Shi E.Y.
      • Stumpf C.R.
      • Christensen C.
      • Bonham M.J.
      • Wang S.
      • Ren P.
      • Martin M.
      • Jessen K.
      • Feldman M.E.
      • et al.
      The translational landscape of mTOR signalling steers cancer initiation and metastasis.
      ). We examined the cytoplasmic fractions isolated from actively growing A549 cancer cells or cells treated with Torin 1 (
      • Thoreen C.C.
      • Chantranupong L.
      • Keys H.R.
      • Wang T.
      • Gray N.S.
      • Sabatini D.M.
      A unifying model for mTORC1-mediated regulation of mRNA translation.
      ). The sucrose fractionation study indicated a 6-fold increase of the cytoplasmic 80S peak following inhibition of mTORC1 by Torin 1 for 3 h (Fig. S15). Inhibition of the mTORC1 signaling by Torin 1 was validated by analysis of S6K1 phosphorylation according to our previous studies (
      • Kim D.H.
      • Sarbassov D.D.
      • Ali S.M.
      • King J.E.
      • Latek R.R.
      • Erdjument-Bromage H.
      • Tempst P.
      • Sabatini D.M.
      mTOR interacts with raptor to form a nutrient-sensitive complex that signals to the cell growth machinery.
      ,
      • Sarbassov D.D.
      • Sabatini D.M.
      Redox regulation of the nutrient-sensitive raptor-mTOR pathway and complex.
      ). In addition, the CPRib and IPRib preribosomal complexes did not show the presence of endoplasmic reticulum (ER) (ER57 or eIF2α) and mitochondrial (ATP synthase β) proteins (Fig. S16), which is consistent with nuclear assembly of the identified preribosomes. Detection of the nucleolar markers fibrillarin, BOP1, and DDX18 (
      • Klinge S.
      • Woolford Jr., J.L.
      Ribosome assembly coming into focus.
      ,
      • Hayano T.
      • Yanagida M.
      • Yamauchi Y.
      • Shinkawa T.
      • Isobe T.
      • Takahashi N.
      Proteomic analysis of human Nop56p-associated pre-ribosomal ribonucleoprotein complexes. Possible link between Nop56p and the nucleolar protein treacle responsible for Treacher Collins syndrome.
      ,
      • Lechertier T.
      • Grob A.
      • Hernandez-Verdun D.
      • Roussel P.
      Fibrillarin and Nop56 interact before being co-assembled in box C/D snoRNPs.
      ,
      • Hölzel M.
      • Rohrmoser M.
      • Schlee M.
      • Grimm T.
      • Harasim T.
      • Malamoussi A.
      • Gruber-Eber A.
      • Kremmer E.
      • Hiddemann W.
      • Bornkamm G.W.
      • Eick D.
      Mammalian WDR12 is a novel member of the Pes1-Bop1 complex and is required for ribosome biogenesis and cell proliferation.
      ) in the preribosomal fractions but not in the cytoplasmic fraction (Fig. S16) further validated the fractionation method and protein detection analysis by MS (Tables S3 and S4). Thus, our study indicates that CPRib and 80S ribosomes behave in an opposite manner in response to mTOR inhibition, indicating that they represent different RNP complexes despite being similar in size.

      Discussion

      A dense nucleolar structure is the main problem in isolation of eukaryotic preribosomal complexes. This problem has been circumvented by introduction of a recombinant protein purification method (
      • Grandi P.
      • Rybin V.
      • Bassler J.
      • Petfalski E.
      • Strauss D.
      • Marzioch M.
      • Schäfer T.
      • Kuster B.
      • Tschochner H.
      • Tollervey D.
      • Gavin A.C.
      • Hurt E.
      90S pre-ribosomes include the 35S pre-rRNA, the U3 snoRNP, and 40S subunit processing factors but predominantly lack 60S synthesis factors.
      ), and since 2002 this has been the main approach to isolate preribosomal complexes by an effective affinity purification method using tagged proteins. The isolation of native eukaryotic preribosomal complexes has not been actively pursued since 1975 (
      • Trapman J.
      • Retèl J.
      • Planta R.J.
      Ribosomal precursor particles from yeast.
      ). In our study, we isolated and characterized the mammalian native preribosomal complexes that we named IPRib and CPRib complexes. We developed a method of mammalian preribosome isolation by performing mild sonication of nuclei and detecting preribosomal RNP complexes by fractionation in a sucrose gradient. To prevent copurification of residual cytoplasmic ER or mitochondrial ribosomes with intact nuclei, prior to the sonication step the nuclei were incubated in a stringent buffer. Mild sonication of nuclei was a critical step in obtaining the preribosomal complexes, and this step that was optimized to balance extraction and preservation of the IPRib and CPRib complexes. We found that a sucrose gradient fractionation developed for profiling ribosomes and polysomes is also optimal for profiling preribosomal complexes by fractionation of nuclear lysates. The fractionation has been optimized to preserve the integrity of the preribosomal complexes by introducing a linear sucrose gradient from 0 to 45% with a slow acceleration mode of ultracentrifuge runs. The isolation of preribosomal complexes has been validated in a wide range of mammalian (human and mouse) cells, including cancer and primary cell lines.
      We show that the mild sonication of nuclei is sufficient to extract two distinct preribosomal complexes representing the intermediate and assembled (composed) stages of their formation. Detected large IPRib complexes were defined as the intermediate preribosomes because they contain premature rRNA (30S and 32S) (
      • Tafforeau L.
      • Zorbas C.
      • Langhendries J.L.
      • Mullineux S.T.
      • Stamatopoulou V.
      • Mullier R.
      • Wacheul L.
      • Lafontaine D.L.
      The complexity of human ribosome biogenesis revealed by systematic nucleolar screening of pre-rRNA processing factors.
      ) and rRNA modification factors (fibrillarin, NAT10, and DKC1) (
      • Watkins N.J.
      • Bohnsack M.T.
      The box C/D and H/ACA snoRNPs: key players in the modification, processing and the dynamic folding of ribosomal RNA.
      ). Considering its RNA/protein composition and the dynamics of assembly, IPRibs represent a ribosomal assembly stage at which rRNAs are methylated, acetylated, or pseudouridinylated on specific sites required for proper ribosomal assembly and function (
      • Nazar R.N.
      Ribosomal RNA processing and ribosome biogenesis in eukaryotes.
      ,
      • Watkins N.J.
      • Bohnsack M.T.
      The box C/D and H/ACA snoRNPs: key players in the modification, processing and the dynamic folding of ribosomal RNA.
      ,
      • Ito S.
      • Horikawa S.
      • Suzuki T.
      • Kawauchi H.
      • Tanaka Y.
      • Suzuki T.
      • Suzuki T.
      Human NAT10 is an ATP-dependent RNA acetyltransferase responsible for N4-acetylcytidine formation in 18 S ribosomal RNA (rRNA).
      ). This finding indicates that the rRNA modification factors form a large complex with a preribosome to carry out the modifications of rRNAs. The rRNA modification factors might exist as a multifunctional platform that forms a transitional complex with the preribosome to perform different types of rRNA modifications simultaneously and with high fidelity. Although the existence of an rRNA modification platform has yet to be confirmed, our study shows that IPRibs are transitional and intermediate preribosomes associated with the rRNA modification factors. A transitional state of IPRibs might explain why they are unstable complexes that are much more sensitive to the lysis conditions compared with CPRib. We found that prolongation of the sonication step resulted in much less IPRib but increased extraction of CPRib. It is also possible that the largest intermediate preribosome, IPRib1 (a 125S particle), is the main complex that disintegrates to the smaller IPRib2 (115S) and IPRib3 (105S) preribosomal particles during the sonication process. Detection of labeled rRNA within 30 min of chase indicates a rapid assembly of IPRib that is consistent with the dynamics of rRNA modifications. The presence of rRNA modification factors is the distinctive feature of IPRib complexes and suggests they have a functional role in mediating specific rRNA modifications known to be critical for rRNA processing in ribosomal biogenesis (
      • Watkins N.J.
      • Bohnsack M.T.
      The box C/D and H/ACA snoRNPs: key players in the modification, processing and the dynamic folding of ribosomal RNA.
      ).
      According to our study, CPRib is an abundant native mammalian 85S preribosome. Considering the resemblance of CPRib by size to the yeast 90S preribosomal particle observed in the original study of 1975 (
      • Trapman J.
      • Retèl J.
      • Planta R.J.
      Ribosomal precursor particles from yeast.
      ), we interpret that CPRib is most likely a native eukaryotic 90S preribosome. To avoid confusion with 90S preribosome purified by expression of the recombinant Pwp2 protein, we named the abundant 85S RNP complex CPRib to reflect a composed (assembled and tranquil) state of mammalian preribosome. Characterization of CPRib has distinguished it from larger IPRib complexes by its composition, assembly dynamics, and stability. In contrast to IPRib, CPRib contains only mature rRNAs and a ribosomal biogenesis factor, LYAR, that is marked by the absence of rRNA modification factors. The pulse-chase RNA labeling study indicated that CPRib is formed at the final stage of ribosomal biogenesis that corresponds with the dynamics of mammalian ribosome formation. The stable nature of CPRib also reflects an assembled state of preribosome, which remains intact even following a consecutive second sucrose fractionation (data not shown). Our study indicates that CPRib represents an assembled preribosome that is formed following completion of an intermediate phase of rRNA processing. The functional relevance of CPRib has yet to be determined, but it is likely an assembled preribosomal state in transition to become a functional ribosome where LYAR holds it in a locked nontranslated conformation prior to its export from the nucleus to the cytoplasm mediated by dissociation of the preribosome into two pre-40S and pre-60S subunits.
      Ribosomal assembly at the nucleolar site remains poorly characterized. Characterization of preribosomal complexes will be instrumental to determine how ribosomal assembly and processing take place at the nucleolar site. We show that mild sonication of nuclei obtained from mammalian cells is an effective approach to extract and isolate the intermediate and composed (late or assembled) preribosomal complexes. It is likely that early preribosomes with nascent rRNAs (47S–45S) are fragile complexes sensitive to mild sonication, and development of more delicate extraction conditions will be necessary to isolate early preribosomes. The abundance of preribosomal complexes is tightly regulated, and nutrient deprivation or inhibition of mTOR at least for 1 h is sufficient to decrease the preribosomal RNP peaks. The dynamics of the nutrient-dependent impact on the preribosomal complexes indicates that nutrient-dependent mTOR signaling coordinates assembly of preribosomal complexes and functional activities of the ribosomal biogenesis factors. How the nutrient-sensitive mTORC1 complex residing in the cytoplasm regulates assembly of preribosomes at the nucleolar site has yet to be determined. The mechanism could be related to mTOR-dependent regulation of rDNA transcription by RNA polymerase I (
      • James M.J.
      • Zomerdijk J.C.
      Phosphatidylinositol 3-kinase and mTOR signaling pathways regulate RNA polymerase I transcription in response to IGF-1 and nutrients.
      • Tsang C.K.
      • Liu H.
      • Zheng X.F.
      mTOR binds to the promoters of RNA polymerase I- and III-transcribed genes.
      ,
      • Mayer C.
      • Grummt I.
      Ribosome biogenesis and cell growth: mTOR coordinates transcription by all three classes of nuclear RNA polymerases.
      • Mayer C.
      • Zhao J.
      • Yuan X.
      • Grummt I.
      mTOR-dependent activation of the transcription factor TIF-IA links rRNA synthesis to nutrient availability.
      ), which also remains to be characterized.

      Experimental procedures

       Cell culture and cell lines

      The human A549, MDA-MB-231, HCT116, WI38, and MRC5 cell lines were obtained from the American Type Culture Collection (ATCC), and the mouse AK192 cancer cells were described previously (
      • Ying H.
      • Kimmelman A.C.
      • Lyssiotis C.A.
      • Hua S.
      • Chu G.C.
      • Fletcher-Sananikone E.
      • Locasale J.W.
      • Son J.
      • Zhang H.
      • Coloff J.L.
      • Yan H.
      • Wang W.
      • Chen S.
      • Viale A.
      • Zheng H.
      • et al.
      Oncogenic Kras maintains pancreatic tumors through regulation of anabolic glucose metabolism.
      ). Cells cultured at 37 °C in a humidified incubator were maintained in the Dulbecco's modified Eagle's medium/Ham's F-12 medium (Caisson Labs, catalog number DFL13) and supplemented with 10% fetal calf serum, 2 mm glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin. Five million A549 cancer cells were cultured on 145-mm dishes in 20 ml of cell culture medium and grown for 48 h (reaching ∼14 million cells) to perform the subcellular fractionation and obtain the nuclear or cytoplasmic fractions. Other cell lines were split to 50% density into 145-mm dishes in 20 ml of cell culture medium and grown for 48 h prior to subcellular fractionation. About four to six plates of cancer cells or 12 plates of primary cells were lysed to obtain the nuclear fraction for one gradient fractionation. The knockdown of NOP56 in A549 cells was performed by lentiviral expression of shRNA targeting luciferase (control) or NOP56 (obtained from Sigma-Aldrich, clone number NM_006392.2-462s21c1, with the following sequence CCGGACCGATCTGTCAGCTTGTAAACTCGAGTTTACAAGCTGGATCGGTTTTTTG) according to our previous study (
      • Chen C.H.
      • Shaikenov T.
      • Peterson T.R.
      • Aimbetov R.
      • Bissenbaev A.K.
      • Lee S.W.
      • Wu J.
      • Lin H.K.
      • Sarbassov dos D.
      ER stress inhibits mTORC2 and Akt signaling through GSK-3β-mediated phosphorylation of rictor.
      ).

       Subcellular fractionation to obtain the soluble nuclear fractions from mammalian cells

      All steps of the subcellular fractionation were performed at 4 °C. Cells with or without treatment were washed twice with 15 ml of ice-cold PBS. To aspirate most of the PBS, the plates were kept in a vertical position for at least 30 s. Washed cells were lysed in 0.6 ml of Magnesium (Mg) Buffer/plate. Mg Buffer was composed of 40 mm Hepes-NaOH, pH 7.5, 160 mm KCl, 10 mm MgCl2, 0.5% glycerol, and 0.5% Nonidet P-40. The prepared Mg Buffer stock was kept frozen at −20 °C, and the defrosted aliquots were kept at 4 °C and used within 1 month. Prior to use, Mg Buffer was supplemented with the phosphatase inhibitors (Biotool) and protease inhibitor (Roche Applied Science) according the manufacturers' instructions. Lysates from two plates were collected by scraping into a 2-ml tube and incubated for 30 min with rotation in a cold room. After incubation, the lysates were spun at 500 × g for 5 min to obtain the cytoplasm (supernatant) and nuclei (pellet). Nuclei were washed in 1 ml of Mg Buffer without detergent and resuspended by flicking and rotating the tube five to six times followed by an additional spin at 500 × g for 5 min to obtain the nuclei by discarding the supernatant. The nuclei were further washed under stringent conditions by adding 0.4 ml of Nuclear Lysis Buffer described below (with MgCl2 but without the protease and phosphates inhibitors) and incubating with gentle rotation for 15 min in a cold room. The stringent washing step was introduced to remove any residual cytoplasmic components, including mitochondria, and to perforate the nuclear envelope. After the stringent wash, nuclei were collected by spinning at 500 × g for 5 min and washed again with 1 ml of Mg Buffer without detergent by flicking and rotating the tube five to six times. After the final wash, the nuclei from four plates (145-mm cell culture plates) were collected in one tube by spinning at 500 × g for 5 min.

       Sucrose gradient fractionation

      The pellets of nuclei obtained from four plates (145-mm cell culture plates) and combined in one 1.5-ml tube were lysed in 0.4 ml of Nuclear Lysis Buffer (10 mm Tris-HCl, pH 8.0, 2.5 mm MgCl2, 1.5 mm KCl, 0.5% Triton X-100, 0.5% deoxycholate). Nuclear Lysis Buffer stock was prepared without MgCl2, aliquoted, and kept frozen at −20 °C, and prior to use the buffer aliquot was defrosted and supplemented with MgCl2 and phosphatase inhibitors (Biotool) and protease inhibitor (Roche Applied Science) according to the manufacturers' instructions. To perform a mild nuclear lysis, nuclei were resuspended by brief pipetting and sonicated using a Bioruptor (Diagenode) for four cycles at the low-level setting. Each cycle was carried out for 15 s of sonication and 30 s of pausing. For effective nuclear lysis, the final volume should not exceed 0.6 ml. Following the sonication step, the soluble nuclear fraction was obtained by spinning the nuclear lysates for 15 min at 20,000 × g at 4 °C. About 1.5 mg of soluble nuclear fraction was loaded on the top of a linear sucrose gradient tube (0–50%). The sucrose gradients were made in Sucrose Gradient Buffer (20 mm Hepes, pH 7.5, 100 mm KCl, 5 mm MgCl2) by adding an equal volume of 50% sucrose to the bottom of an ultracentrifugation tube (Seton, catalog number 7030) containing 0% sucrose. The BioComp gradient station with Triax flow cell 1 from BioComp Instruments (Fredericton, Canada) was instrumental to obtain the highly reproducible linear sucrose gradients and perform the automated fractionation analysis (
      • Chassé H.
      • Boulben S.
      • Costache V.
      • Cormier P.
      • Morales J.
      Analysis of translation using polysome profiling.
      ,
      • Marks M.S.
      Determination of molecular size by zonal sedimentation analysis on sucrose density gradients.
      ). The linear sucrose gradients were prepared by the BioComp gradient station with the optimized 11-step gradient making program described in Fig. S2. The soluble nuclear fraction samples were fractionated by ultracentrifugation for 3 h 45 min at 35,000 × g at 4 °C in a Beckman Optima ultracentrifuge with SW41 Ti swinging bucket rotor with the following settings: acceleration 9 and deceleration 4. Following ultracentrifugation, the sucrose gradients were fractionated by the BioComp gradient station with Triax flow cell 1 for monitoring UV light (254-nm wavelength) absorbance for detection of preribosomal RNP complexes, obtaining 28 fractions. Initially, detection of preribosomal RNP complexes was carried out using the BioComp gradient station with Bio-Rad EM1 that proceeded by mechanical navigation of fractionation and collecting 26 fractions (Figs. S4–S6 and S10).

       Isolation of the preribosomal complexes

      Sedimentation coefficients of the IPRib and CPRib preribosomal complexes were calculated relative to sedimentation of the known cytoplasmic ribosomal particles. Detected RNP complexes in the sucrose fractions were isolated by PEG precipitation or analyzed by boiling the sucrose fraction aliquots with protein loading buffer for immunoblotting analysis. The fractions containing the RNP complexes were combined for PEG precipitation (
      • Yusupova G.
      • Yusupov M.
      High-resolution structure of the eukaryotic 80S ribosome.
      ). PEG 20,000 was added to reach 7% final concentration, KCl was adjusted to 350 mm, MgCl2 was adjusted to 5 mm, and Tris-HCl, pH 7.5, was adjusted to 20 mm. Following mixing, the tubes were incubated on ice for 30 min. After the incubation, the tubes were centrifuged at 17,400 × g for 15 min at 4 °C, and supernatant was removed, leaving ∼100–150 μl of the solution. The samples were centrifuged again at 14,000 × g for 5 min to remove residual PEG 20,000 solution. Precipitated RNP complexes were further studied by isolating RNA with TRIzol reagent according to the manufacturer's instructions or boiling in the protein loading buffer.

       Protein identification by MS

      After resolving denatured proteins in a 10% polyacrylamide gel by a short run (20 min), the gel was stained by GelCode Blue Stain Reagent (Thermo Scientific, catalog number 24590) overnight and washed in water for 2 h. Stained protein lanes were excised, reduced, alkylated, and digested with trypsin at 37 °C overnight. The resulting peptides were extracted, concentrated, and injected onto a Waters NanoAcquity HPLC equipped with a self-packed Aeris 3-μm C18 analytical column (0.075 mm × 20 cm; Phenomenex). Peptides were eluted using standard reverse-phase gradients. The effluent from the column was analyzed using a Thermo Orbitrap Elite mass spectrometer (nanospray configuration) operated in a data-dependent manner. The resulting fragmentation spectra were correlated against the known database using Mascot (Matrix Science). Scaffold Q+S (Proteome Software) was used to provide consensus reports for the identified proteins.

       rRNA detection by Northern blotting

      RNA isolated from preribosomal complexes, cells, or subcellular fractions was resolved in a 1% agarose gel containing 7% formaldehyde in 1× TT buffer (30 mm Tricine, 30 mm triethanolamine). The RNA samples were loaded on a gel by mixing with the same volume of 2× RNA loading dye (New England Biolabs, catalog number B0363A) and incubated at 85 °C for 2 min. Resolved RNAs were transferred to a nylon membrane (Amersham Biosciences Hybond-XL, GE Healthcare, catalog number RPN203S) overnight by capillary downward absorption of 10× SSC buffer using a stack of Kimberly-Clark WypAll papers (
      • Wang M.
      • Pestov D.G.
      Quantitative Northern blot analysis of mammalian rRNA processing.
      ). Following the transfer, nylon membranes were baked at 80 °C for 30 min to achieve irreversible binding of RNA to the membranes. Membranes were prehybridized and hybridized in Perfecthyb Plus Buffer (Sigma, catalog number H7033) by incubation with continuous rotation. Specific oligonucleotides were end-labeled with [γ-32P]ATP and T4 polynucleotide kinase (New England Biolabs, catalog number M0201S) according to the manufacturer's protocol and used as probes following isolation of labeled oligonucleotides by Mini Quick Spin DNA columns (Roche Applied Science, catalog number 11814419001). Membranes prehybridized at 55 °C for 1 h were hybridized with the oligonucleotide probes dissolved in Perfecthyb Plus Buffer (1–1.5 × 106 cpm/ml) by incubation at 55 or 60 °C overnight. Sequences of the probes complementary to different areas of 47S rRNA are shown in Fig. S11. Following hybridization, the membranes were washed at 55 °C and exposed to X-ray films.

       RNA labeling and detection of incorporated [5,6-3H]uridine

      RNA labeling was performed according to a previous study (
      • Pestov D.G.
      • Lapik Y.R.
      • Lau L.F.
      Assays for ribosomal RNA processing and ribosome assembly.
      ). For the pulse labeling, [5,6-3H]uridine (Perkin Elmer Life Sciences, catalog number NET367001MC) was added to the medium of actively growing A549 cells to a final concentration of 3 μCi/ml for 30 min. The labeled uridine was replaced with cold (1 mm) uridine for the indicated chase time. Following pulse-chase labeling, the cells were lysed to obtain the preribosomal complexes as described above, and the preribosomal RNAs resolved on a gel and transferred to membrane were analyzed by autoradiography enhancement to detect incorporated [5,6-3H]uridine. For autoradiography enhancement, baked nylon membranes were incubated in methyl anthranilate containing 0.5% 2,5-diphenyloxazole for 5 min at room temperature according to the original study (
      • Bochner B.R.
      • Ames B.N.
      Sensitive fluorographic detection of 3H and 14C on chromatograms using methyl anthranilate as a scintillant.
      ). Membranes were dried for 5 min on tissue napkins and exposed to X-ray film at −80 °C overnight or for 2–3 days.

       Immunoblotting

      For protein detection, the sucrose gradient fractions or cellular lysates were boiled by adding the same volume of 2× protein loading buffer, or preribosomal complexes enriched by PEG 20,000 precipitation were boiled in 1× protein loading for 5 min. After boiling, the protein samples were resolved in 4–15% gradient gels (mini or midi gels from Bio-Rad) and transferred to polyvinylidene difluoride membrane by electrophoresis. The proteins were then visualized by immunoblotting with specific antibodies and detected with chemiluminescence ClarityTM Western ECL substrate (Bio-Rad, catalog number 170-5061). The antibodies against ribosomal proteins and nucleolar proteins used in this study were obtained from Bethyl Laboratories (Montgomery, TX). Antibodies against ATP synthase β antibody (Thermo Fisher Scientific, Waltham, MA, catalog number A21351), ER57 (EMD Millipore, Billerica, MA, catalog number 05-728), and eIF2α (Cell Signaling Technology, Danvers, MA, catalog number 9722) were used for detecting the ER and mitochondrial markers.

      Author contributions

      D. A. A., V. S. K., A. A. Z., E. S., and D. D. S. resources; D. A. A., V. S. K., A. A. Z., S. D. A., and E. S. formal analysis; D. A. A., V. S. K., A. A. Z., D. A. S., S. D. A., E. S., and D. D. S. validation; D. A. A., V. S. K., A. A. Z., D. A. S., S. D. A., and D. D. S. investigation; D. A. A., V. S. K., A. A. Z., S. D. A., and D. D. S. methodology; A. A. Z. visualization; D. A. S., E. S., M. S. S., R. I. B., and D. D. S. data curation; D. A. S. and D. D. S. writing-original draft; D. A. S. and D. D. S. project administration; E. S. software; D. D. S. conceptualization; D. D. S. supervision; D. D. S. funding acquisition.

      Acknowledgments

      We thank Dr. David Coomb (Fredericton, Canada) for developing the Triax flow cell system. It advanced the gradient fractionation to a fully automated process and was instrumental for detection and isolation of preribosomal complexes in our study. We are also grateful to our departmental colleague Dr. Haoqiang Ying for providing the mouse AK192 cancer cell line.

      Supplementary Material

      Author Profiles

      References

        • Nazar R.N.
        Ribosomal RNA processing and ribosome biogenesis in eukaryotes.
        IUBMB Life. 2004; 56 (15545225): 457-465
        • Thomson E.
        • Ferreira-Cerca S.
        • Hurt E.
        Eukaryotic ribosome biogenesis at a glance.
        J. Cell Sci. 2013; 126 (24172536): 4815-4821
        • Lempiäinen H.
        • Shore D.
        Growth control and ribosome biogenesis.
        Curr. Opin. Cell Biol. 2009; 21 (19796927): 855-863
        • Moran U.
        • Phillips R.
        • Milo R.
        SnapShot: key numbers in biology.
        Cell. 2010; 141 (20603006): 1262-1262.e1
        • Lam Y.W.
        • Trinkle-Mulcahy L.
        • Lamond A.I.
        The nucleolus.
        J. Cell Sci. 2005; 118 (15788650): 1335-1337
        • Pederson T.
        The nucleolus.
        Cold Spring Harb. Perspect. Biol. 2011; 3 (21106648): a000638
        • Klinge S.
        • Woolford Jr., J.L.
        Ribosome assembly coming into focus.
        Nat. Rev. Mol. Cell Biol. 2019; 20 (30467428): 116-131
        • Nerurkar P.
        • Altvater M.
        • Gerhardy S.
        • Schütz S.
        • Fischer U.
        • Weirich C.
        • Panse V.G.
        Eukaryotic ribosome assembly and nuclear export.
        Int. Rev. Cell Mol. Biol. 2015; 319 (26404467): 107-140
        • de la Cruz J.
        • Karbstein K.
        • Woolford Jr., J.L.
        Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.
        Annu. Rev. Biochem. 2015; 84 (25706898): 93-129
        • Yusupova G.
        • Yusupov M.
        High-resolution structure of the eukaryotic 80S ribosome.
        Annu. Rev. Biochem. 2014; 83 (24580643): 467-486
        • Watkins N.J.
        • Bohnsack M.T.
        The box C/D and H/ACA snoRNPs: key players in the modification, processing and the dynamic folding of ribosomal RNA.
        Wiley Interdiscip. Rev. RNA. 2012; 3 (22065625): 397-414
        • Tschochner H.
        • Hurt E.
        Pre-ribosomes on the road from the nucleolus to the cytoplasm.
        Trends Cell Biol. 2003; 13 (12742169): 255-263
        • Warner J.R.
        • Soeiro R.
        Nascent ribosomes from HeLa cells.
        Proc. Natl. Acad. Sci. U.S.A. 1967; 58 (5237493): 1984-1990
        • Trapman J.
        • Retèl J.
        • Planta R.J.
        Ribosomal precursor particles from yeast.
        Exp. Cell Res. 1975; 90 (1122947): 95-104
        • Grandi P.
        • Rybin V.
        • Bassler J.
        • Petfalski E.
        • Strauss D.
        • Marzioch M.
        • Schäfer T.
        • Kuster B.
        • Tschochner H.
        • Tollervey D.
        • Gavin A.C.
        • Hurt E.
        90S pre-ribosomes include the 35S pre-rRNA, the U3 snoRNP, and 40S subunit processing factors but predominantly lack 60S synthesis factors.
        Mol. Cell. 2002; 10 (12150911): 105-115
        • Kornprobst M.
        • Turk M.
        • Kellner N.
        • Cheng J.
        • Flemming D.
        • Koš-Braun I.
        • Koš M.
        • Thoms M.
        • Berninghausen O.
        • Beckmann R.
        • Hurt E.
        Architecture of the 90S pre-ribosome: a structural view on the birth of the eukaryotic ribosome.
        Cell. 2016; 166 (27419870): 380-393
        • Sun Q.
        • Zhu X.
        • Qi J.
        • An W.
        • Lan P.
        • Tan D.
        • Chen R.
        • Wang B.
        • Zheng S.
        • Zhang C.
        • Chen X.
        • Zhang W.
        • Chen J.
        • Dong M.Q.
        • Ye K.
        Molecular architecture of the 90S small subunit pre-ribosome.
        eLife. 2017; 6 (28244370): e22086
        • Derenzini M.
        • Trerè D.
        • Pession A.
        • Montanaro L.
        • Sirri V.
        • Ochs R.L.
        Nucleolar function and size in cancer cells.
        Am. J. Pathol. 1998; 152 (9588897): 1291-1297
        • Andersen J.S.
        • Lam Y.W.
        • Leung A.K.
        • Ong S.E.
        • Lyon C.E.
        • Lamond A.I.
        • Mann M.
        Nucleolar proteome dynamics.
        Nature. 2005; 433 (15635413): 77-83
        • Li Z.F.
        • Lam Y.W.
        A new rapid method for isolating nucleoli.
        Methods Mol. Biol. 2015; 1228 (25311120): 35-42
        • Guertin D.A.
        • Sabatini D.M.
        An expanding role for mTOR in cancer.
        Trends Mol. Med. 2005; 11 (16002336): 353-361
        • Guertin D.A.
        • Sabatini D.M.
        Defining the role of mTOR in cancer.
        Cancer Cell. 2007; 12 (17613433): 9-22
        • Giard D.J.
        • Aaronson S.A.
        • Todaro G.J.
        • Arnstein P.
        • Kersey J.H.
        • Dosik H.
        • Parks W.P.
        In vitro cultivation of human tumors: establishment of cell lines derived from a series of solid tumors.
        J. Natl. Cancer Inst. 1973; 51 (4357758): 1417-1423
        • Hayano T.
        • Yanagida M.
        • Yamauchi Y.
        • Shinkawa T.
        • Isobe T.
        • Takahashi N.
        Proteomic analysis of human Nop56p-associated pre-ribosomal ribonucleoprotein complexes. Possible link between Nop56p and the nucleolar protein treacle responsible for Treacher Collins syndrome.
        J. Biol. Chem. 2003; 278 (12777385): 34309-34319
        • Lechertier T.
        • Grob A.
        • Hernandez-Verdun D.
        • Roussel P.
        Fibrillarin and Nop56 interact before being co-assembled in box C/D snoRNPs.
        Exp. Cell Res. 2009; 315 (19331828): 928-942
        • Gandin V.
        • Sikstrom K.
        • Alain T.
        • Morita M.
        • McLaughlan S.
        • Larsson O.
        • Topisirovic I.
        Polysome fractionation and analysis of mammalian translatomes on a genome-wide scale.
        J. Vis. Exp. 2014; (24893926): e51455
        • Kapoor C.L.
        • Cho-Chung Y.S.
        Mitotic apparatus and nucleoli compartmentalization of 50,000-dalton type II regulatory subunit of cAMP-dependent protein kinase in estrogen receptor negative MDA-MB-231 human breast cancer cells.
        Cell Biol. Int. Rep. 1983; 7 (6299590): 49-60
        • Deschoolmeester V.
        • Boeckx C.
        • Baay M.
        • Weyler J.
        • Wuyts W.
        • Van Marck E.
        • Peeters M.
        • Lardon F.
        • Vermorken J.B.
        KRAS mutation detection and prognostic potential in sporadic colorectal cancer using high-resolution melting analysis.
        Br. J. Cancer. 2010; 103 (20959826): 1627-1636
        • Landry J.J.
        • Pyl P.T.
        • Rausch T.
        • Zichner T.
        • Tekkedil M.M.
        • Stütz A.M.
        • Jauch A.
        • Aiyar R.S.
        • Pau G.
        • Delhomme N.
        • Gagneur J.
        • Korbel J.O.
        • Huber W.
        • Steinmetz L.M.
        The genomic and transcriptomic landscape of a HeLa cell line.
        G3. 2013; 3 (23550136): 1213-1224
        • Ying H.
        • Kimmelman A.C.
        • Lyssiotis C.A.
        • Hua S.
        • Chu G.C.
        • Fletcher-Sananikone E.
        • Locasale J.W.
        • Son J.
        • Zhang H.
        • Coloff J.L.
        • Yan H.
        • Wang W.
        • Chen S.
        • Viale A.
        • Zheng H.
        • et al.
        Oncogenic Kras maintains pancreatic tumors through regulation of anabolic glucose metabolism.
        Cell. 2012; 149 (22541435): 656-670
        • Chen C.H.
        • Shaikenov T.
        • Peterson T.R.
        • Aimbetov R.
        • Bissenbaev A.K.
        • Lee S.W.
        • Wu J.
        • Lin H.K.
        • Sarbassov dos D.
        ER stress inhibits mTORC2 and Akt signaling through GSK-3β-mediated phosphorylation of rictor.
        Sci. Signal. 2011; 4 (21343617): ra10
        • Yamamoto R.
        • Lin L.S.
        • Lowe R.
        • Warren M.K.
        • White T.J.
        The human lung fibroblast cell line, MRC-5, produces multiple factors involved with megakaryocytopoiesis.
        J. Immunol. 1990; 144 (2307841): 1808-1816
        • McSwiggan D.A.
        • Darougar S.
        • Rahman A.F.
        • Gibson J.A.
        Comparison of the sensitivity of human embryo kidney cells, HeLa cells, and WI38 cells for the primary isolation of viruses from the eye.
        J. Clin. Pathol. 1975; 28 (168234): 410-413
        • Ishii K.
        • Washio T.
        • Uechi T.
        • Yoshihama M.
        • Kenmochi N.
        • Tomita M.
        Characteristics and clustering of human ribosomal protein genes.
        BMC Genomics. 2006; 7 (16504170): 37
        • Shimoji K.
        • Jakovljevic J.
        • Tsuchihashi K.
        • Umeki Y.
        • Wan K.
        • Kawasaki S.
        • Talkish J.
        • Woolford Jr., J.L.
        • Mizuta K.
        Ebp2 and Brx1 function cooperatively in 60S ribosomal subunit assembly in Saccharomyces cerevisiae.
        Nucleic Acids Res. 2012; 40 (22319211): 4574-4588
        • Miyazawa N.
        • Yoshikawa H.
        • Magae S.
        • Ishikawa H.
        • Izumikawa K.
        • Terukina G.
        • Suzuki A.
        • Nakamura-Fujiyama S.
        • Miura Y.
        • Hayano T.
        • Komatsu W.
        • Isobe T.
        • Takahashi N.
        Human cell growth regulator Ly-1 antibody reactive homologue accelerates processing of preribosomal RNA.
        Genes Cells. 2014; 19 (24495227): 273-286
        • Ito S.
        • Horikawa S.
        • Suzuki T.
        • Kawauchi H.
        • Tanaka Y.
        • Suzuki T.
        • Suzuki T.
        Human NAT10 is an ATP-dependent RNA acetyltransferase responsible for N4-acetylcytidine formation in 18 S ribosomal RNA (rRNA).
        J. Biol. Chem. 2014; 289 (25411247): 35724-35730
        • Sharma S.
        • Langhendries J.L.
        • Watzinger P.
        • Kötter P.
        • Entian K.D.
        • Lafontaine D.L.
        Yeast Kre33 and human NAT10 are conserved 18S rRNA cytosine acetyltransferases that modify tRNAs assisted by the adaptor Tan1/THUMPD1.
        Nucleic Acids Res. 2015; 43 (25653167): 2242-2258
        • Jack K.
        • Bellodi C.
        • Landry D.M.
        • Niederer R.O.
        • Meskauskas A.
        • Musalgaonkar S.
        • Kopmar N.
        • Krasnykh O.
        • Dean A.M.
        • Thompson S.R.
        • Ruggero D.
        • Dinman J.D.
        rRNA pseudouridylation defects affect ribosomal ligand binding and translational fidelity from yeast to human cells.
        Mol. Cell. 2011; 44 (22099312): 660-666
        • Ruggero D.
        • Grisendi S.
        • Piazza F.
        • Rego E.
        • Mari F.
        • Rao P.H.
        • Cordon-Cardo C.
        • Pandolfi P.P.
        Dyskeratosis congenita and cancer in mice deficient in ribosomal RNA modification.
        Science. 2003; 299 (12522253): 259-262
        • Hölzel M.
        • Rohrmoser M.
        • Schlee M.
        • Grimm T.
        • Harasim T.
        • Malamoussi A.
        • Gruber-Eber A.
        • Kremmer E.
        • Hiddemann W.
        • Bornkamm G.W.
        • Eick D.
        Mammalian WDR12 is a novel member of the Pes1-Bop1 complex and is required for ribosome biogenesis and cell proliferation.
        J. Cell Biol. 2005; 170 (16043514): 367-378
        • Dez C.
        • Dlakić M.
        • Tollervey D.
        Roles of the HEAT repeat proteins Utp10 and Utp20 in 40S ribosome maturation.
        RNA. 2007; 13 (17652137): 1516-1527
        • Turner A.J.
        • Knox A.A.
        • Prieto J.L.
        • McStay B.
        • Watkins N.J.
        A novel small-subunit processome assembly intermediate that contains the U3 snoRNP, nucleolin, RRP5, and DBP4.
        Mol. Cell. Biol. 2009; 29 (19332556): 3007-3017
        • Pan W.A.
        • Tsai H.Y.
        • Wang S.C.
        • Hsiao M.
        • Wu P.Y.
        • Tsai M.D.
        The RNA recognition motif of NIFK is required for rRNA maturation during cell cycle progression.
        RNA Biol. 2015; 12 (25826659): 255-267
        • Champion E.A.
        • Lane B.H.
        • Jackrel M.E.
        • Regan L.
        • Baserga S.J.
        A direct interaction between the Utp6 half-a-tetratricopeptide repeat domain and a specific peptide in Utp21 is essential for efficient pre-rRNA processing.
        Mol. Cell. Biol. 2008; 28 (18725399): 6547-6556
        • Tafforeau L.
        • Zorbas C.
        • Langhendries J.L.
        • Mullineux S.T.
        • Stamatopoulou V.
        • Mullier R.
        • Wacheul L.
        • Lafontaine D.L.
        The complexity of human ribosome biogenesis revealed by systematic nucleolar screening of pre-rRNA processing factors.
        Mol. Cell. 2013; 51 (23973377): 539-551
        • Dinman J.D.
        5S rRNA: structure and function from head to toe.
        Int. J. Biomed. Sci. 2005; 1 (18074004): 2-7
        • Kiparisov S.
        • Petrov A.
        • Meskauskas A.
        • Sergiev P.V.
        • Dontsova O.A.
        • Dinman J.D.
        Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae.
        Mol. Genet. Genomics. 2005; 274 (16047201): 235-247
        • Pestov D.G.
        • Lapik Y.R.
        • Lau L.F.
        Assays for ribosomal RNA processing and ribosome assembly.
        Curr. Protoc. Cell Biol. 2008; (Chapter 22, Unit 22.11) (18551418)
        • Guertin D.A.
        • Sabatini D.M.
        The pharmacology of mTOR inhibition.
        Sci. Signal. 2009; 2 (19383975): pe24
        • James M.J.
        • Zomerdijk J.C.
        Phosphatidylinositol 3-kinase and mTOR signaling pathways regulate RNA polymerase I transcription in response to IGF-1 and nutrients.
        J. Biol. Chem. 2004; 279 (14688273): 8911-8918
        • Tsang C.K.
        • Liu H.
        • Zheng X.F.
        mTOR binds to the promoters of RNA polymerase I- and III-transcribed genes.
        Cell Cycle. 2010; 9 (20038818): 953-957
        • Mayer C.
        • Grummt I.
        Ribosome biogenesis and cell growth: mTOR coordinates transcription by all three classes of nuclear RNA polymerases.
        Oncogene. 2006; 25 (17041624): 6384-6391
        • Mayer C.
        • Zhao J.
        • Yuan X.
        • Grummt I.
        mTOR-dependent activation of the transcription factor TIF-IA links rRNA synthesis to nutrient availability.
        Genes Dev. 2004; 18 (15004009): 423-434
        • Thoreen C.C.
        • Chantranupong L.
        • Keys H.R.
        • Wang T.
        • Gray N.S.
        • Sabatini D.M.
        A unifying model for mTORC1-mediated regulation of mRNA translation.
        Nature. 2012; 485 (22552098): 109-113
        • Hsieh A.C.
        • Liu Y.
        • Edlind M.P.
        • Ingolia N.T.
        • Janes M.R.
        • Sher A.
        • Shi E.Y.
        • Stumpf C.R.
        • Christensen C.
        • Bonham M.J.
        • Wang S.
        • Ren P.
        • Martin M.
        • Jessen K.
        • Feldman M.E.
        • et al.
        The translational landscape of mTOR signalling steers cancer initiation and metastasis.
        Nature. 2012; 485 (22367541): 55-61
        • Kim D.H.
        • Sarbassov D.D.
        • Ali S.M.
        • King J.E.
        • Latek R.R.
        • Erdjument-Bromage H.
        • Tempst P.
        • Sabatini D.M.
        mTOR interacts with raptor to form a nutrient-sensitive complex that signals to the cell growth machinery.
        Cell. 2002; 110 (12150925): 163-175
        • Sarbassov D.D.
        • Sabatini D.M.
        Redox regulation of the nutrient-sensitive raptor-mTOR pathway and complex.
        J. Biol. Chem. 2005; 280 (16183647): 39505-39509
        • Chassé H.
        • Boulben S.
        • Costache V.
        • Cormier P.
        • Morales J.
        Analysis of translation using polysome profiling.
        Nucleic Acids Res. 2017; 45 (28180329): e15
        • Marks M.S.
        Determination of molecular size by zonal sedimentation analysis on sucrose density gradients.
        Curr. Protoc. Cell Biol. 2001; (Chapter 5, Unit 5.3) (18228371)
        • Wang M.
        • Pestov D.G.
        Quantitative Northern blot analysis of mammalian rRNA processing.
        Methods Mol. Biol. 2016; 1455 (27576717): 147-157
        • Bochner B.R.
        • Ames B.N.
        Sensitive fluorographic detection of 3H and 14C on chromatograms using methyl anthranilate as a scintillant.
        Anal. Biochem. 1983; 131 (6614485): 510-515