If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Key Laboratory Experimental Teratology of the Ministry of Education and Department of Biochemistry and Molecular Biology and Shandong University School of Medicine, Jinan, Shandong 250012, China
Department of Physiology, Shandong University School of Medicine, Jinan, Shandong 250012, China,Weifang Medical University, Weifang, Shandong 261053, China,
Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, Shandong University School of Life Sciences, Jinan, Shandong 250100, China,
Key Laboratory Experimental Teratology of the Ministry of Education and Department of Biochemistry and Molecular Biology and Shandong University School of Medicine, Jinan, Shandong 250012, ChinaBinzhou Medical University, Yantai, Shandong 264003, China, and
Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, Shandong University School of Life Sciences, Jinan, Shandong 250100, China,
Key Laboratory Experimental Teratology of the Ministry of Education and Department of Biochemistry and Molecular Biology and Shandong University School of Medicine, Jinan, Shandong 250012, China
Key Laboratory Experimental Teratology of the Ministry of Education and Department of Biochemistry and Molecular Biology and Shandong University School of Medicine, Jinan, Shandong 250012, China
Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, Shandong University School of Life Sciences, Jinan, Shandong 250100, China,
Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, Shandong University School of Life Sciences, Jinan, Shandong 250100, China,
Key Laboratory Experimental Teratology of the Ministry of Education and Department of Biochemistry and Molecular Biology and Shandong University School of Medicine, Jinan, Shandong 250012, China
* This work was supported by grants from the National Key Basic Research Program of China Grants 2013CB967700 (to X. Y., T. X., and Z.-G. X.), 2011CB504505 (to Z.-G. X.), and 2012CB910402 (to J.-P. S.); National Natural Science Foundation of China Grants 31371355 (to Z.-G. X.) and 31271505 (to J.-P. S.); Interdiscipline Fund of Shandong University Grants 2012JC021 (to Z.-G. X.) and 2014JC029 (to X. Y.); Independence Innovation Foundation of Shandong University Grant 2012TS114 (to J.-P. S.); and Program for Changjiang Scholars and Innovative Research Team in University Grant IRT13028. 1 These authors contributed equally to this work. 4 The abbreviations used are:
VLGR1very large G protein-coupled receptor 1ACadenylate cyclasePLCphospholipase CNFATnuclear factor of activated T cellsGPCRG protein-coupled receptorGAINGPCR autoproteolysis-inducingGPSGPCR proteolytic sitePTXpertussis toxinIP3inositol 1,4,5-trisphosphateaaamino acidsVgainVLGR1 C-terminal truncation containing transmembrane domain and GAIN domainVβVLGR1 β-subunitVncleaved Vgain N terminusPpostnatal dayCREBcAMP-responsive element-binding proteinVgsVgain-GαsVgiVgain-Gαi.
The very large G protein-coupled receptor 1 (VLGR1) is a core component in inner ear hair cell development. Mutations in the vlgr1 gene cause Usher syndrome, the symptoms of which include congenital hearing loss and progressive retinitis pigmentosa. However, the mechanism of VLGR1-regulated intracellular signaling and its role in Usher syndrome remain elusive. Here, we show that VLGR1 is processed into two fragments after autocleavage at the G protein-coupled receptor proteolytic site. The cleaved VLGR1 β-subunit constitutively inhibited adenylate cyclase (AC) activity through Gαi coupling. Co-expression of the Gαiq chimera with the VLGR1 β-subunit changed its activity to the phospholipase C/nuclear factor of activated T cells signaling pathway, which demonstrates the Gαi protein coupling specificity of this subunit. An R6002A mutation in intracellular loop 2 of VLGR1 abolished Gαi coupling, but the pathogenic VLGR1 Y6236fsx1 mutant showed increased AC inhibition. Furthermore, overexpression of another Usher syndrome protein, PDZD7, decreased the AC inhibition of the VLGR1 β-subunit but showed no effect on the VLGR1 Y6236fsx1 mutant. Taken together, we identified an independent Gαi signaling pathway of the VLGR1 β-subunit and its regulatory mechanisms that may have a role in the development of Usher syndrome.
The specific localizations of VLGR1 in the hearing and vision systems agree well with its functional significance. VLGR1 is found in the stereocilia of cochlear hair cells, forming the so-called ankle links (
). In the retina, VLGR1 is expressed at the periciliary membrane complex of photoreceptor cells that is involved in photoreceptor protein trafficking through the connecting cilium (
). Although there is a consensus that VLGR1 plays important roles in the hearing and vision systems, the details of VLGR1-regulated cell signaling and its function as a GPCR remain elusive.
As a seven-transmembrane receptor, VLGR1 belongs to the adhesion GPCR subfamily (or the LNB7TM subfamily) (
). VLGR1 has a very long extracellular region, which includes a pentraxin domain and an epilepsy-associated repeat domain surrounded by 35 calx-β motifs. The C terminus of VLGR1 has seven transmembrane helices and an intracellular C-terminal tail, which contains a PDZ domain-binding interface important for interacting with several Usher proteins, such as Whirlin, Harmonin, and PDZD7 (
). The N-terminal extracellular region of VLGR1 and its seven transmembrane regions are connected by a “GPCR autoproteolysis-inducing (GAIN) domain,” which harbors a GPCR proteolytic site (GPS). In many adhesion GPCRs, the GPS undergoes autoproteolysis that separates the receptor into two subunits. Recently, several studies have demonstrated that the cleaved β-subunits (containing the seven-transmembrane region and the C-terminal tail) of these GPCRs independently signals by coupling to specific G protein subtypes (
Until now, VLGR1 was regarded as an orphan receptor. However, adenylate cyclase 6 (AC6), a downstream effector of the Gαs and Gαi proteins, has been shown to localize at the base of hair cell stereocilia, and this localization is altered in vlgr1 knock-out mice, suggesting a potential functional coupling between VLGR1 and intracellular cyclase activities (
). Therefore we set out to delineate the specific G protein signaling downstream of VLGR1.
Concurrent with our study, a parallel work showed that a selective combination of various extracellular domains, transmembrane regions, and the C-terminal tail of VLGR1 resulted in extracellular calcium sensation and the activation of Gαs and Gαq subtypes as well as increased intracellular cAMP levels and PKC phosphorylation (
). Here, we report that VLGR1 mediates GPCR signaling through another mechanism. VLGR1 undergoes autocleavage at the GPS, which separates the receptor into α- and β-subunits. The cleaved VLGR1 β-subunit activates Gαi and blocks forskolin-induced cAMP elevation. Specific mutations in VLGR1 intracellular loops, pertussis toxin (PTX) interference, receptor-G protein fusions, and Gαiq chimera experiments further confirmed the specific coupling of Gαi to the VLGR1 β-subunit. The overexpression of another Usher protein, PDZD7, but not Whirlin or Harmonin, inhibited the VLGR1-Gαi signaling pathway. In contrast, the Usher syndrome-associated mutant VLGR1 Y6236fsX1 showed enhanced constitutive Gαi activity, and this activity was not inhibited by PDZD7 most likely due to its lack of a PDZ binding site. Our results indicated that an independent Gαi signaling pathway is mediated by VLGR1 β-subunit and may further our understanding of the mechanisms underlying Usher syndrome.
EXPERIMENTAL PROCEDURES
Materials
The monoclonal anti-FLAG antibody (F3165), hydroxylamine (NH2OH) (438227), isoproterenol (I2760), and angiotensin (A2580) were purchased from Sigma. The polyclonal VLGR1 C terminus antibody (sc-21252), polyclonal anti-Myc antibody (sc-789), monoclonal anti-GFP (B2, sc-9996), and monoclonal anti-actin (sc-8432) antibodies were from Santa Cruz Biotechnology. The phospho-CREB-Ser133 (9198s) antibody was from Cell Signaling Technology. The GloSensorTM cAMP Assay (E1290) and Dual-Luciferase Reporter Assay System (E1960) were from Promega. Pertussis toxin (Bordetella pertussis, BML-G100-0050) was from Enzo Life Sciences. Cell culture medium (3097) was from BD Biosciences. Forskolin (S1612) was from Beyotime. The cAMP ELISA kit (KGE002) was from R&D Systems. The IP3 ELISA kit was from EIAab® (E2037 Ge). All other chemical and reagents were obtained from Sigma unless otherwise specified.
Constructs
Wild type vlgr1 C-terminal truncation (Vgain) (aa 5618–6298), β-subunit (Vβ) (aa 5884–6298), and cleaved Vgain N terminus (Vn) (aa 5618–5883) were cloned from mouse inner ear cDNA libraries using the following primers: forward, GATGATGACAAAGCCCTCGAGATGGACATCCTTGATGACAACCTTC and reverse, GTAGAAAAACTGCTGAATTCTCAGAGGTGGGTGTCAGC for Vgain or GATGATGACAAAGCCCTCGAGTCTGTGTATGCTGTCTAC for Vβ; and forward, CCGCTCGAGGAGCAGAAACTCATCTCTGAAGAGGATCTGGCTGTCTGGGGGCTTGAAG and reverse, CCGCTCGAGGAGCAGAAACTCATCTCTGAAGAGGATCTGTCTAGAGCTGTCTGGGGGCTTGAAG for Vn. The sequences were inserted into the mammalian pcDNA3.1 or pEGFP expression vector. The receptor-effector fusion protein Vgain-Gαi2 or Vgain-Gαs was constructed with an overlapping PCR method using Vgain and G protein cDNAs with the following primers: Vgain-Gαi2-reverse, CTCACGGTGCAGCCCATGAGGTGGGTGTCAGC; Gαi2-forward, GCTGACACCCACCTCATGGGCTGCACCGTGAG; Gαi2-reverse, GTAGAAAAACTGCTGAATTCTCAGAAGAGGCCACAGTC; Vgain-Gαs-reverse, CCCGAGGCAGCCCATGAGGTGGGTGTCAGC; Gαs-forward, GCTGACACCCACCTCATGGGCTGCCTCGGG; and Gαs-reverse, GTAGAAAAACTGCTGAATTCTTAGAGCAGCTCGTAC. The site-directed VLGR1 and Gαi mutants, including the Gαi1q, Gαi2q, Gαi3q, Vgain-H5882A, Vgain-S5884A Vgain-F5988A, Vgain-Y5990A, and Vgain-R6002A mutants, were generated by the QuikChange mutagenesis kit (Stratagene). Plasmids with Vgain-Y6236fsx1 (forward, GATGATGACAAAGCCCTCGAGATGGACATCCTTGATGACAACCTTC and reverse, CCGTCGACTGCAGAATTCCTAACCTCCAGAAGAAGG) and Vβ-Y6236fsx1 (forward, GATGATGACAAAGCCCTCGAGTCTGTGTATGCTGTCTAC and reverse, CCGTCGACTGCAGAATTCCTAACCTCCAGAAGAAGG) were subcloned by overlapping PCR. The pcDNA3.0-A1TaR, pcDNA3-FLAG-β2-adrenergic receptor, and dopamine D2 receptor were generous gifts from Professor Robert J. Lefkowitz at Duke University. All constructs were subjected to DNA sequencing to verify sequence identities.
Animals and Cochlea Isolation
All animal care and experiments were reviewed and approved by the Animal Use Committee of the Shandong University School of Medicine. Gpr98tm1Pwh/J mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and maintained in pathogen-free conditions at Shandong University. For cochlear protein preparation, P21 C57BL/6 and Gpr98tm1Pwh/J mice were euthanized by rapid decapitation, the cochlea were quickly removed, and the proteins were prepared with lysis buffer as described previously (
Human embryonic kidney 293 (HEK293) cells, U251 cells, and GloSensor HEK293 cells were maintained in Dulbecco's modified Eagle's medium or modified Eagle's medium, respectively, supplemented with 10% heat-inactivated fetal bovine serum (Hyclone Thermo Scientific, Scoresby, Victoria, Australia). PC12 cells were maintained in Dulbecco's modified Eagle's medium with 5% heat-inactivated fetal bovine serum and 5% donor equine serum (Hyclone Thermo Scientific, SH30074.03). For receptor or other protein expression, plasmids carrying the desired genes were transfected into cells using LipofectamineTM 2000 (Invitrogen). To monitor protein expression levels, cells were collected 48–72 h post-transfection with lysis buffer (50 mm Tris, pH 8.0, 150 mm NaCl, 1 mm NaF, 1% Nonidet P-40, 2 mm EDTA, 10% glycerol, 0.25% sodium deoxycholate, 1 mm Na3VO4, 0.3 μm aprotinin, 130 μm Bestatin, 1 μm leupeptin, 1 μm Pepstatin, and 0.5% iodoamino acids). Cell lysates were subjected to end-to-end rotation for 20 min and spun at 12,000 rpm for 20 min at 4 °C. Then an equal volume of 2× loading buffer was added. Proteins were denatured in loading buffer and subjected to Western blot analysis. The protein bands from Western blots were quantified with ImageJ software (National Institutes of Health, Bethesda, MD).
Retina Preparation and in Vivo Transfection
Before transfection, the plasmids were prepared as follows. The vgr1 (aa 5618–6298)-GFP or pcDNA3.1 control plasmid was mixed with 0.1 volume of 3 m sodium acetate and 2.5 volumes anhydrous ethanol. The mixture was bathed in ice for 15 min, centrifuged at 14,000 × g at 4 °C, and then washed and precipitated with anhydrous ethanol. The plasmids were further dried, resuspended in PBS, and adjusted to a concentration of 5 μg/μl.
For transfection, newborn (P0–P3) mouse pups (C57BL/6) were anesthetized on ice for 5 min. The eyes were carefully opened by cutting along the closed eyelid using a sharp 26-gauge needle, and then a small incision was made in the sclera. A 20-μm micropipette (P-1000, Sutter Instruments) was inserted into the incision until the tip of micropipette touched the opposing sclera. Then 0.5 μl of high concentration plasmid DNA were slowly injected into the subretina (Nanoject II) followed by electroporation five pulses of 80 volts for 50 ms with 950-ms intervals using a Digidata 1440A pulse generator from Axon CNS Instruments (
). Three days after electroporation, the eyes were dissected, and the retinas were isolated for further experiments.
In Vitro Cleavage of Vgain Proteins
HEK293 cells were transfected with a FLAG-Vgain or Vgain-GFP plasmid in 10-cm plates. Forty-eight hours after transfection, cells were washed three times with ice-cold PBS and incubated with lysis buffer for 45 min with end-to-end rotation. After a 12,000 rpm centrifugation for 30 min, the supernatants were collected. One hundred micrograms of protein were added to 100 μl of cleavage buffer (50 mm Tris, pH 7.5, 20 mm NaCl, and 1 mm EDTA) and incubated at 37 °C for the desired time. Loading buffer was added to samples, and samples were analyzed by Western blotting. For NH2OH-facilitated receptor hydrolysis, the receptor was immunoprecipitated with anti-FLAG M2 affinity gel as described previously (
). The immunoprecipitated receptors were incubated with 250 mm NH2OH for the indicated times before examination by Western blotting.
CREB Phosphorylation
HEK293 cells transfected with the desired plasmids were maintained in medium and starved for 8 h. After a 10-min application of 10 μm forskolin or mock solution, the cells were quickly transferred to ice and incubated with cell lysis buffer. The cell lysates were subjected to Western blotting, and CREB phosphorylation levels were detected using a phospho-CREB-Ser133 antibody.
IP3 ELISA
Cells were washed with cold PBS followed by three freeze-thaw cycles in liquid nitrogen. The cells were then lysed for another 20 min at 4 °C with end-to-end rotation. After centrifugation at 12,000 rpm for 15 min at 4 °C, the supernatant was collected to determine IP3 concentrations according to the manufacturer's instructions (EIAab, E2037 Ge).
GloSensor cAMP Assay
GloSensor 22-F cells were transfected with the desired plasmids (0.8 μg of total DNA) with Lipofectamine 2000 in 24-well dishes. Twenty-four hours later, cells were plated on 96-well plates at a cell density of 20,000 cells/well. Cells were maintained in culture medium for another 22 h and washed with PBS. Cells were then incubated with 100 μl of equilibration medium (2% (v/v) GloSensor cAMP Reagent, 10% FBS, and 88% CO2-independent medium) in each well for 2 h. The basal cAMP signal was measured using a luminescence counter (Mithras LB 940). After the cAMP levels reached a steady baseline for more than 5 min, 10 μm forskolin was added to determine the effects of forskolin-stimulated cAMP increase. For PTX treatment, 100 ng/ml PTX was preincubated with cells for at least 16 h. Data are presented as the mean ± S.D. Statistical comparisons were performed with analysis of variance tests using GraphPad Prism5.
cAMP ELISA
HEK293 cells transfected with desired plasmids were cultured in 96-well plates. 48 h later, cells were washed three times with PBS and stimulated. After a certain time, cells were resuspended in 120 μl of lysis buffer (1×) with 500 μm isobutylmethylxanthine for each well and then frozen at −20 °C. Cells underwent two freeze-thaw cycles and then were subjected to centrifugation (600 × g) for 10 min at 4 °C to remove cellular debris. The supernatant were assessed for cAMP content according to the manufacturer's protocol (cAMP ELISA kit (KGE002) for R&D Systems).
NFAT Dual-Luciferase Reporter Assay
HEK293 cells were transfected using Lipofectamine 2000 in 24-well dishes with 0.8 μg of total DNA, including Vgain or Vβ, Gαi1q, Gαi2q, Gαi3q, A1TaR, dopamine D2 receptor, pGL3-NFAT luciferase or pGL3-Basic luciferase, and the pRL-TK plasmid (Promega, Madison, WI). Cells were cultured for 48 h and then harvested immediately following addition of 1× passive lysis buffer. After incubation for 15 min at room temperature on a table shaker, cell lysates were centrifuged at 12,000 rpm for 10 min at 4 °C. NFAT activity was quantified by a standard luciferase reporter gene assay and was normalized to Renilla luciferase activity (Promega). More than three independent experiments in 8 wells were performed for each Dual-Luciferase reporter assay.
Immunofluorescence
FLAG-tagged Vβ- or Vβ-Y6236fsx1-transfected cells grown on glass coverslips in 24-well tissue culture plates were fixed with 4% paraformaldehyde in phosphate-buffered saline. The cells were blocked and permeabilized with blocking buffer containing 0.1% Triton X-100 and 1% normal goat serum for 60 min at room temperature. Cells were then incubated sequentially with a primary anti-FLAG antibody at 4 °C overnight and an appropriate secondary antibody for 1 h at room temperature. Immunofluorescence was analyzed on a Bio-Rad Radiance 2000 laser-scanning confocal microscope.
Co-immunoprecipitation
Co-immunoprecipitation experiments were performed as described previously (
). Plasmids encoding FLAG-Vgain, FLAG-Vβ, Myc-Vn, or Myc-PDZD7 and control pcDNA3.1 were transfected or co-transfected into HEK293 cells that were cultured in 150-mm dishes. After allowing 30 h of protein expression, the cells were washed with phosphate-buffered saline containing 10 mm HEPES, pH 7.5. Cells were lysed in lysis buffer (50 mm Tris, pH 7.4, 150 mm NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 2 mm sodium pyrophosphate, 5 mm NaF, 25 mm β-glycerophosphate, 1 mm EDTA, and 1 mm Na3VO4 supplemented with protease inhibitor mixture (Roche Applied Science)). Cell lysates were then incubated with anti-FLAG M2 affinity gel (Sigma-Aldrich) for 4–6 h, and the FLAG-tagged Vgain or Vβ was precipitated by centrifugation. After extensive bead washing with PBS buffer, the immunoprecipitated complexes were subjected to electrophoresis, and complex formation was detected by Western blotting with an anti-Myc antibody.
Data Analysis
All data are presented as the mean ± S.D. from at least three independent experiments. Statistical comparisons were performed with analysis of variance tests using GraphPad Prism5. Significant differences were designated as follows: * and #, p < 0.05; ** and ##, p < 0.01; and *** and ###, p < 0.005. The sequence alignments were performed using T-Coffee.
RESULTS AND DISCUSSION
VLGR1 Can Be Processed into Two Fragments after Autoproteolysis
VLGR1 contains a GPS immediately preceding its seven-transmembrane domain (
). Recent crystallographic studies have discovered that the 40-residue GPS motif is located in an intact ∼320-residue domain called the GAIN domain. Biochemical studies show that the GAIN domain of several adhesion GPCRs is both necessary and sufficient for autocleavage (
). To test whether VLGR1 can be processed into two fragments in a manner similar to other adhesion GPCRs, we made a construct of the C-terminal portion of VLGR1 (aa 5618–6298; Vgain) that contained the intact GAIN domain, the seven-transmembrane region, and the intracellular C-terminal tail (Fig. 1A). In cells transfected with the FLAG-Vgain-expressing plasmid, a 75-kDa band was detected that is consistent with the size of full-length FLAG-Vgain. Several bands with molecular masses higher than 130 kDa were also evident, presumably due to glycosylation or dimerization (Fig. 1B). FLAG-Vgain was mainly expressed as an intact protein; however, at ∼35 kDa, a weak band corresponding to the N-terminal portion of FLAG-Vgain after cleavage at GPS was also detected (Fig. 1B). We then incubated the cell lysates at 37 °C to promote FLAG-Vgain autoproteolysis. The 35-kDa band corresponding to the cleaved N-terminal fragment increased abundantly, whereas the 80-kDa full-length FLAG-Vgain band decreased in intensity (Fig. 1C). Accordingly, the 45-kDa band corresponding to the cleaved C-terminal fragment of VLGR1 was detected by a specific VLGR1 C terminus antibody after incubation at 37 °C (Fig. 1D). Moreover, similar to the chemical cleavage that occurs at the GPS of other adhesion GPCRs, the autocleavage of VLGR1 can also be accelerated by the strong nucleophile NH2OH (Fig. 1E) (
FIGURE 1.Vgain underwent autoproteolysis that generated Vβ. A, a schematic diagram of the structure of the VLGR1 constructs used in the study. Vgain, aa 5618–6298 of VLGR1, includes the GAIN domain, the seven-transmembrane region, and the intracellular C-terminal tail. Vβ, aa 5884–6298 of VLGR1, corresponds to the region from the GPS cleavage site to the C terminus and includes the seven-transmembrane region and the intracellular C-terminal tail. Vn, aa 5618–5883 of VLGR1, is the N-terminal region of the GAIN domain. The residues of the GPS are displayed, and the autoproteolytic position is indicated by an arrow. The disease-related VLGR1 mutations, Y6236fsx1 in the C terminus and R6002A in the second intracellular loop, both of which were used in this study, are highlighted. B, Western blot of Vgain truncation (aa 5618–6298). Cells were transiently transfected with N-terminal FLAG-tagged Vgain and control pcDNA3.1 plasmids. The expression of Vgain was detected by anti-FLAG antibody. The top arrow indicates the expression of FLAG-Vgain with a calculated molecular mass of 74 kDa. The lower arrow indicates a 35-kDa band that corresponded to the molecular mass of the cleaved N-terminal Vgain fragment. Several bands with molecular masses greater than 130 kDa were also detected. C and D, VLGR1 undergoes autoproteolysis in HEK293 cells. HEK293 cells were transiently transfected with plasmids to express N-terminal FLAG-tagged Vgain or control pcDNA3.1 plasmid. The cell lysates were incubated at 37 °C for 0 or 12 h. The cleaved and uncleaved fragments were examined using an anti-FLAG antibody (C) or a specific VLGR1 C terminus antibody (D). E, NH2OH-facilitated cleavage of Vgain at GPS. Cells were transfected with Vgain plasmids. After 48 h, cells were collected, and the cell lysates were incubated at 37 °C with or without 250 mm NH2OH in cleavage buffer. After 16 h, most of the 74-kDa Vgain bands were cleaved, generating the 30-kDa band corresponding to the N-terminal fragment of the Vgain truncation. F, effects of GPS mutations on NH2OH-facilitated Vgain cleavage. HEK293 cells were transiently transfected with plasmids containing the FLAG-tagged wild type Vgain, Vgain-H5882A (HA) mutant, Vgain-S5884A (SA) mutant, or control pcDNA3.1. FLAG-tagged Vgain was immunoprecipitated and incubated with 250 mm NH2OH to facilitate cleavage. The cleaved receptor was detected with an anti-FLAG antibody. G, VLGR1 underwent autoproteolysis and produced the truncated Vβ in mouse retina. Mouse retina was transiently transfected with the control pcDNA3.1 plasmid or a plasmid encoding a C-terminal GFP-tagged Vgain. Three days were allowed for protein expression, and VLGR1 expression was detected with a GFP antibody. The transient expressions of Vβ-GFP (aa 5884–6298) and Vgain-GFP (aa 5618–6298) in HEK293 cells were used as controls. Multiple bands were detected in GFP-tagged Vgain-infected mouse retina, including the 80-kDa GFP-tagged fragment, which corresponded to the cleaved Vβ-GFP. H, detection of endogenous VLGR1 in mouse cochlea. VLGR1 expression in the inner ear at P21 of the VLGR1 mutant mice (lacking the seven-transmembrane domain and cytoplasmic tail) (m/m) and the wild type (WT) mice were detected with a specific VLGR1 C terminus antibody. The transiently expressed FLAG-Vβ in HEK293 cells was used as a control. A band around the same size as FLAG-Vβ was detected with the VLGR1 C terminus antibody in WT mice but not in VLGR1 mutant mice. I, direct interaction between Vβ and Vn (aa 5618–5883). FLAG-tagged Vβ was co-transfected with Myc-tagged Vn or control pcDNA4 plasmid. The Vβ and its associated proteins were immunoprecipitated with an anti-FLAG antibody, and the formation of the Vβ·Vn complex was detected with anti-Myc antibody. Con, control; IB, immunoblot.
To further demonstrate the presence of the autocleavage site, we examined the effects of specific VLGR1 GPS mutations on VLGR1 autoproteolysis. Previous studies have revealed the essential role of the conserved H(L/M)(S/T) motif for autocleavage at the GPS (
). Although His516 of EMR2 is the proton acceptor for the generation of the tetrahedral intermediate and deprotonates the hydroxyl group of Ser518, the deprotonated oxygen of Ser518 is important for the nucleophilic attack of the C–N ester bond that produces two polypeptide fragments (
). Therefore, we mutated the corresponding conserved His5882 and Ser5884 residues to Ala and examined their effects on VLGR1 autoproteolysis (Fig. 1F). The Vgain-H5882A mutant reduced autoproteolysis, and the Vgain-S5884A mutant almost abolished autoproteolysis. These results suggested that specific autoproteolysis occurred at the GPS.
Endogenous VLGR1 has been detected in many tissues, including brain, lung, kidney, eye, and cochlea (
). These genetic studies implied that the VLGR1 has important functions in the inner ear and retina. Therefore, we chose both the retina and cochlea as physiological models to investigate VLGR1 autocleavage along with the HEK293 cell system (Fig. 1, G and H). We transfected pcDNA3.1 control plasmids or Vgain (aa 5618–6298)-GFP plasmids into the retina of the newborn (P0–P3) mouse pups (C57BL/6). After 3 days of protein expression postelectroporation, mouse pup eyes were dissected, and the expression of Vgain was detected with a GFP antibody. Similar to the FLAG-Vgain-transfected HEK293 cells, a single band corresponding to the intact Vgain-GFP size (100 kDa) was mainly detected in the Vgain-transfected HEK293 cells (Fig. 1, B and G). However, a cleaved band corresponding to the Vβ-GFP (68 kDa) was detected in Vgain-transfected retina, suggesting that autocleavage was more likely to happen in a more physiological context (Fig. 1G). Next, we used inner ear tissue from Gpr98tm1Pwh/J mice or their C57BL/6 wild type littermates to examine endogenous VLGR1 expression. The Gpr98tm1Pwh/J mouse has a deletion of its seven-transmembrane and cytoplasmic regions. As shown in Fig. 1H in wild type cochlea, a 220-kDa band corresponding to VLGR1a (the shortest VLGR1 isoform) and a 45-kDa band corresponding to the VLGR1 β-subunit were detected by a specific VLGR1 C terminus antibody, whereas these bands were not detected in Gpr98tm1Pwh/J mice.
Several studies have also suggested that the two cleaved subunits of the adhesion GPCRs still maintain a complex via non-covalent interactions (
). Therefore, we overexpressed the FLAG-tagged Vβ and the Myc-tagged Vn (aa 5618–5883) in HEK293 cells. As shown in Fig. 1I, the complex formation of the two fragments of Vgain was detected by co-immunoprecipitation assays.
Vgain and Vβ Constitutively Inhibit the AC Pathway
Most of the two cleaved subunits (α-subunit corresponds to the N-terminal segment, and β-subunit corresponds to the C-terminal segment) of adhesion GPCRs still bind to each other to form heterodimers. In several cases, the β-subunit signals independently of the α-subunit, whereas the α-subunit serves as an inhibitor for the constitutive activity of the β-subunit (
). Without a known ligand, overexpression of an adhesion GPCR or its β-subunit constitutively activates specific signaling pathways that are normally stimulated by agonist activation (
Therefore, we made Vβ (aa 5884–6298) and examined the ability of the receptor to constitutively activate the classic G protein signaling pathways. The overexpression of Vgain or Vβ did not increase the basal intracellular cAMP levels or IP3 accumulation, indicating that Gαs and Gαq, respectively, are not constitutively activated by Vgain and Vβ (Fig. 2, A and B). In contrast, the overexpression of Vgain or Vβ significantly blocked the forskolin-induced intracellular cAMP increase, suggesting a negative regulatory role for Vgain and Vβ (Fig. 2C). To confirm these results, we used isoproterenol to stimulate endogenous β2-adrenergic receptor in HEK293 cells and kinetically monitored the effects of Vgain or Vβ on the isoproterenol-stimulated AC activity using the GloSensor assay. Again, the expression of Vgain or Vβ significantly suppressed the isoproterenol-induced increase in intracellular cAMP (Fig. 2D). Compared with Vgain, Vβ displayed an enhanced constitutive activity in the inhibition of the intracellular cAMP level in both experiments.
FIGURE 2.Vgain and the cleaved Vβ inhibited forskolin- and isoproterenol-induced cAMP elevation. A, effects of overexpression of Vgain or Vβ on basal cAMP level. HEK293 GloSensor cells were transfected with Vgain, Vβ, or β2-adrenergic receptor (β2AR) plasmids. After 46 h, the basal cAMP levels were monitored by the GloSensor assay. The β2-adrenergic receptor-transfected cells were used as a positive control. Overexpression of the β2-adrenergic receptor increased the basal cAMP level. The cAMP level can be further augmented by treating the β2-adrenergic receptor-transfected cells with its agonist, isoproterenol. In contrast, there is no basal cAMP level increase for Vgain-transfected cells. Overexpression of Vβ decreases, rather than increases, the basal cAMP level. One-way analysis of variance was used for statistical analysis. *, p < 0.05; **, p < 0.01; ***, p < 0.005. Error bars represent S.D. B, effects of overexpression of Vgain or Vβ on IP3 generation. HEK293 cells were transfected with Vgain, Vβ, or A1TaR plasmids. After 46 h, the basal IP3 levels were monitored with an ELISA kit. The A1TaR-transfected cells were used as a positive control. Overexpression of A1TaR increased basal IP3 levels. The IP3 levels were further stimulated by treating the cells with angiotensin II. An increase in IP3 levels was not detected in Vgain- or Vβ-transfected cells. One-way analysis of variance was used for statistical analysis. *, p < 0.05; **, p < 0.01. Error bars represent S.D. C, the overexpression of Vgain or Vβ blocked the forskolin-induced cAMP increase. HEK293 cells were transfected with the control pcDNA vector or the Vgain or Vβ expression vector. The absolute cAMP levels were measured using an ELISA kit. Error bars represent S.D. D, the overexpression of Vgain or Vβ blocked the isoproterenol-induced cAMP increase. GloSensor cAMP HEK293 cells were transiently transfected with the control pcDNA vector or the Vgain or Vβ expression vector. The kinetic responses of the cells to isoproterenol were monitored with FLIPRTETRA. Error bars represent S.D. E and F, the dose-dependent inhibition of the forskolin-induced cAMP increase by overexpression of Vgain or Vβ. GloSensor HEK293 cells were transfected with the control pcDNA vector or the Vgain or Vβ expression vector at the indicated concentrations. The protein expression levels were examined using a FLAG-specific antibody (E). The forskolin-induced cAMP increase was examined using FLIPRTETRA (F). Error bars represent S.D. G, the effect of dose-dependent inhibition of Vβ on forskolin-induced CREB phosphorylation. HEK293 cells were transfected with control plasmids or the indicated amounts of the Vβ plasmids. The phosphorylation of CREB at Ser133 was examined using a specific antibody following forskolin stimulation. H, statistics of G. *, p < 0.05; **, p < 0.01; ***, p < 0.005 for Vβ-transfected cells compared with non-Vβ-transfected cells. Error bars represent S.D. I–L, the dose-dependent inhibition of the forskolin-induced cAMP increase by overexpression of Vβ in U251 astrocyte cells (I and J) or PC12 cells (K and L). GloSensor plasmids were co-transfected with the control pcDNA vector or the Vgain or Vβ expression vector at the indicated concentrations in U251 cells (I and J) or PC12 cells (K and L). The protein expression levels were examined using a FLAG-specific antibody (J and L). The forskolin-induced cAMP increase was examined using FLIPRTETRA (I and K). *, p < 0.05; **, p < 0.01; ***, p < 0.005 for Vβ-transfected cells compared with non-Vβ-transfected cells. Error bars represent S.E. ISO, isoproterenol; FSK, forskolin; Con, control; IB, immunoblot; RLU, relative luciferase units; β2AR, β2-adrenergic receptor; AngII, angiotensin II; pCREB, phospho-CREB.
). To test whether this is also the case for VLGR1, we overexpressed various amounts of Vgain or Vβ in HEK293 GloSensor cells. In agreement with our hypothesis, increased expression of either Vgain or Vβ showed more inhibitory activity toward forskolin-induced cAMP elevation (Fig. 2, E and F). Consistently, the overexpression of Vβ down-regulated the forskolin-induced phosphorylation of CREB at amino acid 133, the downstream target of AC activation, in a dose-dependent manner (Fig. 2, G and H). To examine the Vβ-mediated signaling in a more physiological context, we overexpressed the Vβ in neuronal glioblastoma (astrocytoma) cell line U251 and the neuronal PC12 cell line and checked their effects on the forskolin-induced cAMP increase (Fig. 2, I–L). Similar to the results in the HEK293 cells, the constitutive AC inhibitory activity of Vβ is in proportion to its expression level in both U251 (Fig. 2, I and J) and PC12 cells (Fig. 2, K and L). Taken together, these results show that Vgain and the VLGR1 β-subunit constitutively inhibit the AC pathway and that Vβ has a stronger effect than Vgain.
G Protein Coupling Specificity of Vgain and the VLGR1 β-Subunit
We then examined whether the constitutive activity of Vgain and the VLGR1 β-subunit toward the regulation of intracellular cAMP levels is mediated via Gαi using its inhibitory protein, PTX. Incubation of the cells with PTX abolished the inhibition of Vgain and Vβ on AC activity, suggesting that Vgain and Vβ are indeed coupled to Gαi (Fig. 3A). To further dissect the G protein coupling specificity of Vgain and Vβ, we next examined the effects of Vgain-Gαs (Vgs) and Vgain-Gαi (Vgi) fusion proteins (Fig. 3, B and C). It has been shown that putting the receptor and effector together by receptor-effector fusion increases their binding affinity to agonist and increases the basal activity of the effector in the case of some GPCRs, such as GPR120 (
). Our results showed that, compared with Vgain, Vgi has a stronger AC inhibitory activity, whereas the Vgs has a weaker activity likely due to the blockade of the interaction of Vgain with endogenous Gαi protein (Fig. 3D). Forskolin-induced CREB phosphorylation also decreased more when Vgi was overexpressed than when Vgain was overexpressed (Fig. 3, E and F).
FIGURE 3.Vgain and Vβ inhibited intracellular cAMP formation by Gαi coupling. A, PTX blocked the Vgain- or Vβ-mediated cAMP inhibition. GloSensor cAMP HEK293 cells were transfected with either empty vector (Con), Vgain, or Vβ and then treated with 100 ng/ml PTX for 6 h followed by stimulation with forskolin. The intracellular cAMP levels were monitored using FLIPRTETRA. ***, p < 0.005 compared with control; ###, p < 0.005 compared with non-PTX treated cells. Error bars represent S.D. B, a schematic representation of the Vgi and Vgs fusion proteins. The start codon of Gαi2 or Gαs was placed immediately after the 3′-end of the coding region for VLGR1. C, the expression of N-terminal FLAG-tagged Vgs, Vgi, and Vgain were examined using a FLAG-specific antibody. D, covalently linking Vgain to Gαi leads to an enhanced constitutive activity, whereas linking Vgain to Gαs blocks its constitutive activity. GloSensor cAMP HEK293 cells were transfected with either empty vector, Vgain, Vgi, or Vgs. The forskolin-induced cAMP increase was monitored with FLIPRTETRA. Error bars represent S.D. E, effects of overexpression of Vgain, Vgi, or Vgs on the forskolin-induced CREB phosphorylation. CREB phosphorylation was examined using a phospho-CREB-Ser133-specific antibody. F, statistics of E. *, p < 0.05; **, p < 0.01; ***p < 0.005 for Vgain-, Vgi-, or Vgs-transfected cells compared with control vector-transfected cells; #, p < 0.05 for Vgi- or Vgs-transfected cells compared with Vgain-transfected cells. Error bars represent S.D. G, the methodology for the generation of the Gαiq chimeric proteins. The last five C-terminal residues of the corresponding Gαi proteins were replaced with the last five C-terminal residues of the Gαq protein that are important for the stimulation of PLC activity. H, the plasmids encoding the Gαq or the Gαiq chimeric proteins were co-transfected with the control vector, Vgain, or Vβ. The activation of the Gαiq-PLC pathway was assayed by detecting the luciferase activity of the NFAT-driven luciferase reporter gene. The known Gαi-coupled receptor D2 receptor was used as a positive control. Error bars represent S.D. RLU, relative luciferase units; Con, control; IB, immunoblot; pCREB, phospho-CREB; D2R, dopamine D2 receptor.
We further used the Gαiq chimeric protein to examine the G protein coupling specificity of Vgain and Vβ. It has been shown that the substitution of the last four to five C-terminal amino acids of Gαi with the corresponding residues of Gαq makes the Gαiq chimera couple to Gαi-coupled receptors but signal through the Gαq-mediated phospholipase C pathway (
). We made three Gαiq chimeras and examined their effects on the Gαq signaling pathway in Vgain- and Vβ-transfected cells using the pcDNA3.1 plasmid as a negative control and the dopamine D2 receptor as a positive control (Fig. 3G). In pcDNA3.1-transfected cells, the overexpression of the three Gαiq chimeras did not increase the activation of the Gαq downstream NFAT reporter gene. However, after transfection with dopamine D2 receptor, Vgain, or Vβ, these chimeras rerouted signaling to the PLCβ-NFAT signaling pathway (Fig. 3H). Notably, Gαi1q, Gαi2q, and Gαi3q all increased the signaling of the PLC pathway in the presence of Vgain and Vβ, suggesting that Vgain and Vβ recognize all three Gαi subtypes.
Structural Requirements for the Gαi Protein Coupling of VLGR1
To further confirm that the constitutive activity of Vgain and Vβ are specific to Gαi, we next looked for potential mutations that would specifically decouple the interaction between VLGR1 and Gαi. In the recently solved β2-adrenergic receptor·Gαs complex crystal structure, intracellular loop 2 of the β2-adrenergic receptor forms extensive interactions with the N terminus of Gαs. In particular, Phe139 of β2-adrenergic receptor intracellular loop 2 is inserted into the hydrophobic pocket formed by His41, Val217, Phe376, and Arg380 of Gαs (
). This hydrophobic interaction may be a driving force for β2-adrenergic receptor and Gαs coupling. Assuming that the residues around intracellular loop 2 of VLGR1 are also important for G protein coupling, we examined the effects of mutating several conserved residues of VLGR1 (Fig. 4, A, B, and C). All of the mutants had normal expression levels and did not affect the cell surface localization of the receptor. The Phe5988 and Tyr5990 mutations did not significantly affect the inhibitory activity of Vgain, but the R6002A mutation eliminated the inhibition of Vgain toward the forskolin-induced cAMP increase (Fig. 4, B, C, and D). The R6002A mutant may directly impair Gαi protein coupling ability as demonstrated by the Gαiq chimera switching assay (Fig. 4E). Although overexpression of Gαi1q, Gαi2q, or Gαi3q promoted PLC signaling in the presence of the wild type Vgain, they produced no effects in the presence of the R6002A Vgain mutant. These results verified that the AC inhibitory activity was directly linked to the intact seven-transmembrane structure of VLGR1.
FIGURE 4.Structural requirements for VLGR1-Gαi protein coupling. A, the sequence alignments of transmembrane domains 3 (TM3) and 4 (TM4) and intracellular loop 2 of VLGR1 from different species and from the Gαi-coupled receptors SSTR1 and SSTR2. Selective mutations are highlighted by *. B, the effects of Vgain and Vgain mutants on forskolin-induced CREB phosphorylation. The expression levels of Vgain and the Vgain mutants were detected using a FLAG-specific antibody, and CREB phosphorylation was examined using a phospho-CREB-Ser133-specific antibody (pCREB). C, statistics of B. *, p < 0.05; **, p < 0.01 for Vgain wild type- or Vgain mutant-transfected cells compared with control vector-transfected cells; ##, p < 0.01 for specific Vgain mutant compared with Vgain wild type. Error bars represent S.D. D, the effects of Vgain and Vgain mutants on forskolin-induced cAMP levels. GloSensor cAMP HEK293 cells were transfected with equal amounts of Vgain or Vgain mutants. The intracellular cAMP levels were monitored with FLIPRTETRA. ***, p < 0.005 compared with control; ###, p < 0.005 compared with Vgain-transfected cells. Error bars represent S.D. E, the plasmids encoding the Gαq or the Gαiq chimeric proteins were co-transfected with the control vector, Vgain, or Vgain-R6002A mutant. The activation of the Gαiq-PLC pathway by Vgain-R6002A mutant was compared with Vgain. *, p < 0.05; **, p < 0.01 compared with control vector. Error bars represent S.E. Con, control; IB, immunoblot; RLU, relative luciferase units; DLR, Dual-Luciferase reporter.
A Disease-associated Mutant Has a Gain of Function in Gαi Coupling
Among the disease-associated VLGR1 mutations, the VLGR1 human Y6244fsX1 caught our attention because it is located in the intracellular part of the receptor (
). We therefore made a mouse VLGR1 Y6236fsx1 mutant that corresponds with the human Y6244fsx1 cDNA. Notably, the pathogenic Y6236fsx1 mutation has a frameshift that eliminates the last 62 residues of the C terminus, producing a 39-kDa band after gel electrophoresis (Fig. 5A). The Y6236fsx1 mutation did not change the plasma membrane receptor localization detected by immunofluorescence (Fig. 5D). However, the introduction of the Y6236fsx1 mutation into Vβ or Vgain increased their inhibitory effects on AC activity as demonstrated by the GloSensor assay and phospho-CREB levels (Figs. 5, B and C, and 6, A–D). These results suggest that the pathogenic mutation Y6236fsx1 increases its Gαi coupling ability.
FIGURE 5.Regulation of VLGR1-Gαi signaling by a VLGR1 pathogenic mutant. A, the effects of Vβ and Vβ-Y6236fsx1 on forskolin-induced CREB phosphorylation. The expression levels of the receptor and phospho-CREB-Ser133 (pCREB) were detected using their specific antibodies. B, statistics of A. **, p < 0.01 compared with control cells; #, p < 0.05 compared with Vβ-transfected cells. Error bars represent S.D. C, the effects of Vβ and Vβ-Y6236fsx1 on the forskolin-induced cAMP level examined using the GloSensor cAMP assay. ***, p < 0.005 compared with control; ###, p < 0.005 compared with Vβ-transfected cells. Error bars represent S.D. D, immunofluorescence of Vβ and Vβ-Y6236fsx1 showed that Vβ-Y6236fsx1 had unchanged receptor membrane localization. Plasmids encoding FLAG-tagged Vβ or Vβ-Y6236fsx1 were transiently transfected in HEK293 cells, and their cellular localization was monitored with an anti-FLAG antibody and confocal microscopy. Con, control; IB, immunoblot; RLU, relative luciferase units; IF, immunofluorescence.
FIGURE 6.Regulation of VLGR1-Gαi signaling by PDZD7. A, effects of Usher proteins on Vgain-Gαi or Vgain-Y6236fsX1-Gαi coupling. Equal amounts of Usher proteins, including Harmonin, Whirlin, and PDZD7, were co-expressed with Vgain or Vgain-Y6236fsX1. The forskolin-induced cAMP increase were monitored by GloSensor cAMP assay. Harmonin or Whirlin has no effect on AC inhibitory activity of Vgain or Vgain-Y6236fsX1. Although PDZD7 decouples Vgain-Gαi interaction, it has no effect on Vgain-Y6236fsX1-Gαi coupling. **, p < 0.01, ***, p < 0.005 compared with control cells; ##, p < 0.01 compared with Vgain only-transfected cells. Error bars represent S.D. C, the effects of the overexpression of PDZ domain-containing Usher proteins, including Harmonin, Whirlin, and PDZD7, on the effects of Vβ- and Vβ-Y6236fsx1-induced AC inhibition. Equal amounts of the cDNAs encoding Harmonin, Whirlin, or PDZD7 were co-transfected with Vβ or Vβ-Y6236fsx1 in GloSensor cAMP HEK293 cells. The forskolin-induced cAMP levels were examined. ***, p < 0.005 compared with control cells; ###, p < 0.005 compared with Vβ only-transfected cells. Error bars represent S.D. B and D, expression of FLAG-tagged Vgain (A) and Vβ (C). Myc-tagged Harmonin, Whirlin, and PDZD7 in B and D were detected with specific anti-FLAG and anti-Myc antibodies. E, the effects of the overexpression of the PDZD7 on the effects of Vβ- and Vβ-Y6236fsx1-induced AC inhibition. The PDZD7 and GloSensor plasmids were co-transfected with Vβ or Vβ-Y6236fsx1 in U251 cells. The forskolin-induced cAMP levels were examined. **, p < 0.01; ***, p < 0.005 compared with control cells; #, p < 0.05 compared with Vβ only-transfected cells. Error bars represent S.D. F, expression of FLAG-tagged Vβ and Myc-tagged PDZD7 in E was detected with specific anti-FLAG and anti-Myc antibodies. G, FLAG-tagged Vβ or Vβ-Y6236fsx1 was co-transfected with Myc-tagged PDZD7 in HEK293 cells. The VLGR1·PDZD7 complex was immunoprecipitated with an anti-FLAG antibody and detected with an anti-Myc antibody. H, formation of the Vgain·PDZD7 or Vgain-R6002A·PDZD7 complex was detected as in G. Con, control; IB, immunoblot; RLU, relative luciferase units.
PDZD7 Negatively Regulated Gαi Coupling Activity in Vgain and Vβ
Because of its short C-terminal tail, the pathogenic VLGR1 Y6236fsx1 mutation may affect its binding to downstream effectors and contribute to its increased Gαi coupling activity. We thus overexpressed three known VLGR1 C terminus-interacting partners, Harmonin, Whirlin, and PDZD7, all of which are involved in Usher syndrome, to investigate their effects on VLGR1-mediated AC inhibition (
). Interestingly, although overexpression of Harmonin or Whirlin had no effect on VLGR1-mediated AC inhibition, overexpression of the other Usher syndrome-related protein, PDZD7, inhibited both Vgain- and Vβ-mediated AC inhibition (Fig. 6, A–D). However, the overexpression of PDZD7 did not block Y6236fx1-mediated AC inhibition (Fig. 6, A–D). The specific inhibition of Vβ but not Vβ-Y6236fx1 activity by PDZD7 was also demonstrated in the neuronal glioblastoma (astrocytoma) cell line U251 (Fig. 6, E and F).
Removing the C-terminal PDZ binding motif “DTHL” has been shown to significantly reduce the interaction between PDZD7 and the VLGR1 C-tail (
). The effects of a loss of PDZD7 on Y6236fx1 mutants may be due to the loss of the interaction between these two proteins. Consistent with this hypothesis, the Vβ-Y6236fx1 mutation significantly reduced its interaction with PDZD7 compared with Vβ (Fig. 6G). In contrast, both the Vgain- and Vgain-R6002A mutants robustly co-immunoprecipitated with PDZD7 in equal amounts (Fig. 6H). These results suggested that the Y6236fsx1 mutation improved VLGR1 inhibitory activity on AC likely due to the loss of interaction with its C-terminal binding partners, such as PDZD7. However, the loss of function in the R6002A mutant did not alter its interaction with PDZD7. Whether the gain of function in Gαi signaling by the VLGR1 Y6236sfx1 mutant contributes to the development of Usher syndrome awaits further investigation.
Conclusion
In summary, we have demonstrated that the Usher protein VLGR1 can be separated into two subunits by autocleavage at its GPS. Without extracellular stimulation, the β-subunit of VLGR1 inhibits AC activity through Gαi coupling. Its Gαi coupling specificity was verified using site-directed mutagenesis, PTX interference, and receptor-G protein fusion proteins as well as co-expression with the Gαiq chimeric protein. Moreover, the intracellular pathogenic mutation VLGR1 Y6236fsx1 had an increased constitutive activation of Gαi signaling. The overexpression of the Usher protein PDZD7 blocked VLGR1 β-subunit-mediated AC inhibition, but PDZD7 had no effect on Y6236fsx1 mutant-mediated AC inhibition. Recent studies have identified the digenic inheritance of PDZD7 and VLGR1 as well as the physical interaction between PDZD7 and the VLGR1 C terminus. However, the molecular mechanism underlying this genetic linkage is unclear (
). The association of the Usher protein PDZD7 as well as the Usher mutant VLGR1 Y6236fsx1 with Gαi activity suggests a potential role for VLGR1-mediated Gαi signaling in Usher disease development.
Recently, a parallel work showed that a recombinant VLGR1 truncation protein senses extracellular calcium, activates Gαs and Gαq signaling, and regulates the stability of myelin-associated glycoprotein, which is important for the prevention of audiogenic epilepsy (
). Although the reported G protein subtype signaling downstream of VLGR1 is different from that in our study, the known beneficial effects of AC activation in the prevention of audiogenic epilepsy are logically consistent with our finding that the disease-associated VLGR1 mutant inhibited AC activity (
). Moreover, the switching of G protein coupling specificity in different physiological/pathological conditions has been demonstrated in other GPCRs, such as the β2-adrenergic receptor in which the receptor phosphorylation by PKA switched its coupling from Gαs to Gαi (
Enhanced Gi signaling selectively negates β2-adrenergic receptor (AR)–but not β1-AR-mediated positive inotropic effect in myocytes from failing rat hearts.
). Our result showed that Vβ has stronger Gαi coupling activity than Vgain, suggesting that the N-terminal fragment has an inhibitory role in VLGR1 activity. Thus, it is likely that the cleaved Vβ subunit signals independently and switched the VLGR1 G protein coupling specificity. Taken together, our data show the constitutive Gαi coupling activity of the VLGR1 β-subunit and the regulation of this activity by the N terminus of VLGR1, a disease-associated mutant, and the Usher protein PDZD7. This study may shed light on the molecular mechanisms underlying Usher syndrome.
REFERENCES
Sun J.P.
Li R.
Ren H.Z.
Xu A.T.
Yu X.
Xu Z.G.
The very large G protein coupled receptor (Vlgr1) in hair cells.
Enhanced Gi signaling selectively negates β2-adrenergic receptor (AR)–but not β1-AR-mediated positive inotropic effect in myocytes from failing rat hearts.
31960-8&id=gr1.jpg){kind=link}
31960-8&id=gr2.jpg){kind=link}
31960-8&id=gr3.jpg){kind=link}
31960-8&id=gr4.jpg){kind=link}
31960-8&id=gr5.jpg){kind=link}
31960-8&id=gr6.jpg){kind=link}