Advertisement

A biochemical and biophysical model of G-quadruplex DNA recognition by positive coactivator of transcription 4

  • Wezley C. Griffin
    Affiliations
    From the Department of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205-7101
    Search for articles by this author
  • Jun Gao
    Affiliations
    From the Department of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205-7101
    Search for articles by this author
  • Alicia K. Byrd
    Affiliations
    From the Department of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205-7101
    Search for articles by this author
  • Shubeena Chib
    Affiliations
    From the Department of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205-7101
    Search for articles by this author
  • Kevin D. Raney
    Correspondence
    To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Slot 516, 4301 W Markham, Little Rock, AR 72205. Tel.: 501-686-5244.
    Affiliations
    From the Department of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205-7101
    Search for articles by this author
  • Author Footnotes
    2 The abbreviations used are: G4G-quadruplexPC4positive coactivator 4ssDNAsingle-strand DNARMSDroot mean square deviationHADDOCKHigh Ambiguity Driven DockinghTelohuman telomericDMSdimethyl sulfateRPAreplication protein A.
Open AccessPublished:April 17, 2017DOI:https://doi.org/10.1074/jbc.M117.776211
      DNA sequences that are guanine-rich have received considerable attention because of their potential to fold into a secondary, four-stranded DNA structure termed G-quadruplex (G4), which has been implicated in genomic instability and some human diseases. We have previously identified positive coactivator of transcription (PC4), a single-stranded DNA (ssDNA)-binding protein, as a novel G4 interactor. Here, to expand on these previous observations, we biochemically and biophysically characterized the interaction between PC4 and G4DNA. PC4 can bind alternative G4DNA topologies with a low nanomolar Kd value of ∼2 nm, similar to that observed for ssDNA. In consideration of the different structural features between G4DNA and ssDNA, these binding data indicated that PC4 can interact with G4DNA in a manner distinct from ssDNA. The stoichiometry of the PC4-G4 complex was 1:1 for PC4 dimer:G4 substrate. PC4 did not enhance the rate of folding of G4DNA, and formation of the PC4-G4DNA complex did not result in unfolding of the G4DNA structure. We assembled a G4DNA structure flanked by duplex DNA. We find that PC4 can interact with this G4DNA, as well as the complementary C-rich strand. Molecular docking simulations and DNA footprinting experiments suggest a model where a PC4 dimer accommodates the DNA with one monomer on the G4 strand and the second monomer bound to the C-rich strand. Collectively, these data provide a novel mode of PC4 binding to a DNA secondary structure that remains within the framework of the model for binding to ssDNA. Additionally, consideration of the PC4-G4DNA interaction could provide insight into the biological functions of PC4, which remain incompletely understood.

      Introduction

      Cells are confronted with a barrage of diverse genotoxic insults that can threaten cellular subsistence and organismal fitness (
      • Altieri F.
      • Grillo C.
      • Maceroni M.
      • Chichiarelli S.
      DNA damage and repair: from molecular mechanisms to health implications.
      ). Distinct from the covalent modifications that can develop from chemical bombardment of genomic DNA, the inherent structure of the DNA can function as a source of genomic instability once the protein constituents that recognize or resolve DNA secondary structures become compromised. Among the variety of secondary structures that DNA is able to adopt, the G-quadruplex (G4)
      The abbreviations used are: G4
      G-quadruplex
      PC4
      positive coactivator 4
      ssDNA
      single-strand DNA
      RMSD
      root mean square deviation
      HADDOCK
      High Ambiguity Driven Docking
      hTelo
      human telomeric
      DMS
      dimethyl sulfate
      RPA
      replication protein A.
      structure is one that has received a generous amount of interest to discern the biological consequence of these structures in cellular regulation and disease (
      • Maizels N.
      G4-associated human diseases.
      ).
      G-quadruplexes are four-stranded DNA or RNA structures that form from appropriately spaced di- or tri-guanine nucleotide repeats. Four guanine nucleotides are arranged in a cyclic conformation through Hoogsteen hydrogen bonds to form a G-quartet subunit (Fig. 1A). Multiple G-quartets stack, driven by the stabilization of π-π interactions between the planar face of adjacent G-quartets and the monovalent cations (K+ or Na+) to form the complete G4 structure (Fig. 1B) (
      • Murat P.
      • Balasubramanian S.
      Existence and consequences of G-quadruplex structures in DNA.
      ,
      • Lech C.J.
      • Heddi B.
      • Phan A.T.
      Guanine base stacking in G-quadruplex nucleic acids.
      ). The topological arrangement of G4 structures can be highly heterogeneous based on the number of strands involved and the strand directionality to adopt parallel, anti-parallel, or hybrid type G4 conformations (
      • Lane A.N.
      • Chaires J.B.
      • Gray R.D.
      • Trent J.O.
      Stability and kinetics of G-quadruplex structures.
      ,
      • Gray R.D.
      • Trent J.O.
      • Chaires J.B.
      Folding and unfolding pathways of the human telomeric G-quadruplex.
      ). G4-forming sequences are located in distinct, non-random regions of the genome, which include telomeres, DNA origins of replication, ribosomal DNA, and the promoters of proto-oncogenes (
      • Noer S.L.
      • Preus S.
      • Gudnason D.
      • Aznauryan M.
      • Mergny J.L.
      • Birkedal V.
      Folding dynamics and conformational heterogeneity of human telomeric G-quadruplex structures in Na+ solutions by single molecule FRET microscopy.
      ,
      • Cayrou C.
      • Ballester B.
      • Peiffer I.
      • Fenouil R.
      • Coulombe P.
      • Andrau J.C.
      • van Helden J.
      • Méchali M.
      The chromatin environment shapes DNA replication origin organization and defines origin classes.
      ,
      • Chiarella S.
      • De Cola A.
      • Scaglione G.L.
      • Carletti E.
      • Graziano V.
      • Barcaroli D.
      • Lo Sterzo C.
      • Di Matteo A.
      • Di Ilio C.
      • Falini B.
      • Arcovito A.
      • De Laurenzi V.
      • Federici L.
      Nucleophosmin mutations alter its nucleolar localization by impairing G-quadruplex binding at ribosomal DNA.
      ,
      • Balasubramanian S.
      • Hurley L.H.
      • Neidle S.
      Targeting G-quadruplexes in gene promoters: a novel anticancer strategy?.
      ). G4 sequences have also been mapped to the 5′- and 3′-untranslated regions of mRNA (
      • Bugaut A.
      • Balasubramanian S.
      5′-UTR RNA G-quadruplexes: translation regulation and targeting.
      ,
      • Millevoi S.
      • Moine H.
      • Vagner S.
      G-quadruplexes in RNA biology.
      ). This non-random distribution of G4 sequences has led to the suggestion that G4 structures are involved in the regulation of genomic processes, such as transcription, translation, and DNA replication (
      • Tarsounas M.
      • Tijsterman M.
      Genomes and G-quadruplexes: for better or for worse.
      ,
      • Rhodes D.
      • Lipps H.J.
      G-quadruplexes and their regulatory roles in biology.
      ). The development of effective ligands that can stabilize or destabilize specific G4 structures is being pursued to probe G4 function and to exploit their potential as chemotherapeutic targets (
      • Balasubramanian S.
      • Hurley L.H.
      • Neidle S.
      Targeting G-quadruplexes in gene promoters: a novel anticancer strategy?.
      ,
      • Cogoi S.
      • Xodo L.E.
      G4 DNA in ras genes and its potential in cancer therapy.
      ).
      Figure thumbnail gr1
      Figure 1Structural organization of G4DNA and PC4. A and B, the G-quartet in A is the subunit of the G4DNA structure as illustrated in B. C, the bimodal domain map of PC4 consists of an N-terminal regulatory domain composed of a serine and acidic residue-rich region (SEAC, red), a lysine rich region (blue), and a C-terminal functional ssDNA-binding domain (green). D, crystal structure of the DNA-binding domain of a PC4 dimer with the monomers colored in red and blue. The DNA-binding sites and the β-ridge are labeled (PDB code 1PCF (
      • Brandsen J.
      • Werten S.
      • van der Vliet P.C.
      • Meisterernst M.
      • Kroon J.
      • Gros P.
      C-terminal domain of transcription cofactor PC4 reveals dimeric ssDNA binding site.
      )).
      The transcriptional coactivator (PC4) is a highly conserved, small, homodimeric single-stranded DNA (ssDNA)-binding protein that was first discovered as an enhancer of activator-dependent transcription in HeLa cells (
      • Ge H.
      • Roeder R.G.
      Purification, cloning, and characterization of a human coactivator, PC4, that mediates transcriptional activation of class II genes.
      ). Multiple groups have since reported the involvement of PC4 in a variety of genomic activities including transcription (
      • Ge H.
      • Roeder R.G.
      Purification, cloning, and characterization of a human coactivator, PC4, that mediates transcriptional activation of class II genes.
      ,
      • Kaiser K.
      • Stelzer G.
      • Meisterernst M.
      The coactivator p15 (PC4) initiates transcriptional activation during TFIIA-TFIID-promoter complex formation.
      ,
      • Werten S.
      • Stelzer G.
      • Goppelt A.
      • Langen F.M.
      • Gros P.
      • Timmers H.T.
      • Van der Vliet P.C.
      • Meisterernst M.
      Interaction of PC4 with melted DNA inhibits transcription.
      ,
      • Akimoto Y.
      • Yamamoto S.
      • Iida S.
      • Hirose Y.
      • Tanaka A.
      • Hanaoka F.
      • Ohkuma Y.
      Transcription cofactor PC4 plays essential roles in collaboration with the small subunit of general transcription factor TFIIE.
      ,
      • Wu S.Y.
      • Chiang C.M.
      Properties of PC4 and an RNA polymerase II complex in directing activated and basal transcription in vitro.
      ,
      • Liao M.
      • Zhang Y.
      • Kang J.H.
      • Dufau M.L.
      Coactivator function of positive cofactor 4 (PC4) in Sp1-directed luteinizing hormone receptor (LHR) gene transcription.
      ,
      • Banerjee S.
      • Kumar B.R.
      • Kundu T.K.
      General transcriptional coactivator PC4 activates p53 function.
      ,
      • Fukuda A.
      • Nakadai T.
      • Shimada M.
      • Tsukui T.
      • Matsumoto M.
      • Nogi Y.
      • Meisterernst M.
      • Hisatake K.
      Transcriptional coactivator PC4 stimulates promoter escape and facilitates transcriptional synergy by GAL4-VP16.
      ,
      • Wang Z.
      • Roeder R.G.
      DNA topoisomerase I and PC4 can interact with human TFIIIC to promote both accurate termination and transcription reinitiation by RNA polymerase III.
      ,
      • Calvo O.
      • Manley J.L.
      Evolutionarily conserved interaction between CstF-64 and PC4 links transcription, polyadenylation, and termination.
      ,
      • Lewis B.A.
      • Sims 3rd, R.J.
      • Lane W.S.
      • Reinberg D.
      Functional characterization of core promoter elements: DPE-specific transcription requires the protein kinase CK2 and the PC4 coactivator.
      ,
      • Malik S.
      • Guermah M.
      • Roeder R.G.
      A dynamic model for PC4 coactivator function in RNA polymerase II transcription.
      ), DNA replication (
      • Pan Z.Q.
      • Ge H.
      • Amin A.A.
      • Hurwitz J.
      Transcription-positive cofactor 4 forms complexes with HSSB (RPA) on single-stranded DNA and influences HSSB-dependent enzymatic synthesis of simian virus 40 DNA.
      ), DNA repair (
      • Mortusewicz O.
      • Roth W.
      • Li N.
      • Cardoso M.C.
      • Meisterernst M.
      • Leonhardt H.
      Recruitment of RNA polymerase II cofactor PC4 to DNA damage sites.
      ,
      • Batta K.
      • Yokokawa M.
      • Takeyasu K.
      • Kundu T.K.
      Human transcriptional coactivator PC4 stimulates DNA end joining and activates DSB repair activity.
      ,
      • Mortusewicz O.
      • Evers B.
      • Helleday T.
      PC4 promotes genome stability and DNA repair through binding of ssDNA at DNA damage sites.
      ), chromatin condensation (
      • Das C.
      • Hizume K.
      • Batta K.
      • Kumar B.R.
      • Gadad S.S.
      • Ganguly S.
      • Lorain S.
      • Verreault A.
      • Sadhale P.P.
      • Takeyasu K.
      • Kundu T.K.
      Transcriptional coactivator PC4, a chromatin-associated protein, induces chromatin condensation.
      ,
      • Das C.
      • Gadad S.S.
      • Kundu T.K.
      Human positive coactivator 4 controls heterochromatinization and silencing of neural gene expression by interacting with REST/NRSF and CoREST.
      ), oxidative damage suppression (
      • Wang J.Y.
      • Sarker A.H.
      • Cooper P.K.
      • Volkert M.R.
      The single-strand DNA binding activity of human PC4 prevents mutagenesis and killing by oxidative DNA damage.
      ), and potential tumor suppressor activity by direct and indirect activation of p53 (
      • Banerjee S.
      • Kumar B.R.
      • Kundu T.K.
      General transcriptional coactivator PC4 activates p53 function.
      ,
      • Batta K.
      • Kundu T.K.
      Activation of p53 function by human transcriptional coactivator PC4: role of protein-protein interaction, DNA bending, and posttranslational modifications.
      ,
      • Rajagopalan S.
      • Andreeva A.
      • Teufel D.P.
      • Freund S.M.
      • Fersht A.R.
      Interaction between the transactivation domain of p53 and PC4 exemplifies acidic activation domains as single-stranded DNA mimics.
      ). PC4 has also been implicated in the progression and metastasis of several cancer types and might serve as a potential chemotherapeutic target (
      • Peng Y.
      • Yang J.
      • Zhang E.
      • Sun H.
      • Wang Q.
      • Wang T.
      • Su Y.
      • Shi C.
      Human positive coactivator 4 is a potential novel therapeutic target in non-small cell lung cancer.
      ,
      • Qian D.
      • Zhang B.
      • Zeng X.-L.
      • Le Blanc J.M.
      • Guo Y.-H.
      • Xue C.
      • Jiang C.
      • Wang H.-H.
      • Zhao T.-S.
      • Meng M.-B.
      • Zhao L.-J.
      • Hao J.-H.
      • Wang P.
      • Xie D.
      • Lu B.
      • et al.
      Inhibition of human positive cofactor 4 radiosensitizes human esophageal squmaous cell carcinoma cells by suppressing XLF-mediated nonhomologous end joining.
      ,
      • Chen L.
      • Du C.
      • Wang L.
      • Yang C.
      • Zhang J.R.
      • Li N.
      • Li Y.
      • Xie X.D.
      • Gao G.D.
      Human positive coactivator 4 (PC4) is involved in the progression and prognosis of astrocytoma.
      ,
      • Kim J.-M.
      • Kim K.
      • Schmidt T.
      • Punj V.
      • Tucker H.
      • Rice J.C.
      • Ulmer T.S.
      • An W.
      Cooperation between SMYD3 and PC4 drives a distinct transcriptional program in cancer cells.
      ,
      • Tao S.
      • Yu J.
      • Xu Y.
      • Deng B.
      • Sun T.
      • Hu P.
      • Wei Z.
      • Zhang J.
      • Wang R.
      • Shi C.
      • Tan Q.
      PC4 induces lymphangiogenesis dependent VEGF-C/VEGF-D/VEGFR-3 axis activation in lung adenocarcinoma.
      ,
      • Chakravarthi B.V.
      • Goswami M.T.
      • Pathi S.S.
      • Robinson A.D.
      • Cieślik M.
      • Chandrashekar D.S.
      • Agarwal S.
      • Siddiqui J.
      • Daignault S.
      • Carskadon S.L.
      • Jing X.
      • Chinnaiyan A.M.
      • Kunju L.P.
      • Palanisamy N.
      • Varambally S.
      MicroRNA-101 regulated transcriptional modulator SUB1 plays a role in prostate cancer.
      ). Interestingly, one report has suggested PC4 associates with Aurora kinases to enhance their kinase activity during cell cycle progression (
      • Dhanasekaran K.
      • Kumari S.
      • Boopathi R.
      • Shima H.
      • Swaminathan A.
      • Bachu M.
      • Ranga U.
      • Igarashi K.
      • Kundu T.K.
      Multifunctional human transcriptional coactivator protein PC4 is a substrate of Aurora kinases and activates the Aurora enzymes.
      ). Reports have also provided evidence for the involvement of a PC4 homolog in cellular migration and virulence of the parasitic amoeba Entamoeba histolytica, which is a common cause of amoebic colitis, dysentery, and liver abscesses (
      • de la Cruz O.H.
      • Muñiz-Lino M.
      • Guillén N.
      • Weber C.
      • Marchat L.A.
      • López-Rosas I.
      • Ruíz-García E.
      • Astudillo-de la Vega H.
      • Fuentes-Mera L.
      • Álvarez-Sánchez E.
      • Mendoza-Hernández G.
      • López-Camarillo C.
      Proteomic profiling reveals that EhPC4 transcription factor induces cell migration through up-regulation of the 16-kDa actin-binding protein EhABP16 in Entamoeba histolytica.
      ,
      • Hernández de la Cruz O.
      • Marchat L.A.
      • Guillén N.
      • Weber C.
      • LópezRosas I.
      • Díaz-Chávez J.
      • Herrera L.
      • Rojo-Domínguez A.
      • Orozco E.
      • López-Camarillo C.
      Multinucleation and polykaryon formation is promoted by the EhPC4 transcription factor in Entamoeba histolytica.
      ).
      PC4 has a bimodal domain architecture with an unstructured, lysine- and serine-rich regulatory domain that comprises the N-terminal half of the protein. The remaining C-terminal half is composed of the ssDNA-binding domain (Fig. 1C). PC4 consists of two shallow, anti-parallel DNA-binding grooves separated by a β-ridge region that is located at the interface between the two monomers (Fig. 1D). This anti-parallel DNA-binding site orientation is thought to allow for accommodation of the anti-parallel strands of the DNA upon strand separation (
      • Brandsen J.
      • Werten S.
      • van der Vliet P.C.
      • Meisterernst M.
      • Kroon J.
      • Gros P.
      C-terminal domain of transcription cofactor PC4 reveals dimeric ssDNA binding site.
      ,
      • Werten S.
      • Moras D.
      A global transcription cofactor bound to juxtaposed strands of unwound DNA.
      ,
      • Werten S.
      • Wechselberger R.
      • Boelens R.
      • van der Vliet P.C.
      • Kaptein R.
      Identification of the single-stranded DNA binding surface of the transcriptional coactivator PC4 by NMR.
      ). Indeed, biochemical evidence for this binding mode was supported when PC4-mediated duplex destabilization occurred on DNA substrates that contained ∼8 nucleotides of unpaired DNA (
      • Werten S.
      • Langen F.W.
      • van Schaik R.
      • Timmers H.T.
      • Meisterernst M.
      • van der Vliet P.C.
      High-affinity DNA binding by the C-terminal domain of the transcriptional coactivator PC4 requires simultaneous interaction with two opposing unpaired strands and results in helix destabilization.
      ).
      Recently, PC4 and the yeast homolog suppressor of TFIIB (Sub1) were identified as novel G4DNA interactors through pulldown assays and fluorescence equilibrium-binding analysis (
      • Gao J.
      • Zybailov B.L.
      • Byrd A.K.
      • Griffin W.C.
      • Chib S.
      • Mackintosh S.G.
      • Tackett A.J.
      • Raney K.D.
      Yeast transcription co-activator Sub1 and its human homolog PC4 preferentially bind to G-quadruplex DNA.
      ). Reported here is an expanded analysis of G4DNA recognition by PC4. Fluorescence equilibrium binding analysis of PC4 with G4DNA sequences that adopt multiple conformations resulted in similar Kd values to that observed for ssDNA substrates. Additional biophysical, molecular docking simulation, and biochemical footprinting experiments support a model whereby PC4 can stabilize G4DNA.

      Results

      PC4 recognizes multiple G4DNA topologies

      The G4DNA substrates that have been used previously to investigate recognition by PC4 have largely consisted of a G4 sequence modified from the c-MYC gene promoter (
      • Gao J.
      • Zybailov B.L.
      • Byrd A.K.
      • Griffin W.C.
      • Chib S.
      • Mackintosh S.G.
      • Tackett A.J.
      • Raney K.D.
      Yeast transcription co-activator Sub1 and its human homolog PC4 preferentially bind to G-quadruplex DNA.
      ,
      • Mathad R.I.
      • Hatzakis E.
      • Dai J.
      • Yang D.
      C-MYC promoter G-quadruplex formed at the 5′-end of NHE III 1 element: Insights into biological relevance and parallel-stranded G-quadruplex stability.
      ). This modified c-MYC promoter sequence (Table 1, c-MYC) predominantly adopts a parallel G4 structure indicated by a characteristic CD spectral profile with a global maximum and minimum at ∼265 and ∼245 nm, respectively (Fig. 2, A and B). Several reports have indicated that human telomeric (hTelo) DNA can adopt multiple topologies with respect to the strand directionality between adjacent loops within the G4 structure and these different topologies are dependent on the identity of the monovalent cation (Na+ or K+) present (
      • Gray R.D.
      • Trent J.O.
      • Chaires J.B.
      Folding and unfolding pathways of the human telomeric G-quadruplex.
      ,
      • Noer S.L.
      • Preus S.
      • Gudnason D.
      • Aznauryan M.
      • Mergny J.L.
      • Birkedal V.
      Folding dynamics and conformational heterogeneity of human telomeric G-quadruplex structures in Na+ solutions by single molecule FRET microscopy.
      ). To confirm that hTelo can adopt multiple G4 topologies, hTelo was analyzed by CD in 100 mm KCl or NaCl. In the presence of 100 mm NaCl (Fig. 2C), hTelo spectra possess a global maximum and minimum near 295 and 260 nm, respectively. This spectral profile corresponds to a predominantly anti-parallel G4 conformation (Fig. 2A, bottom left structure). However, in the presence of 100 mm KCl (Fig. 2D), hTelo spectra possess a global maximum and minimum near 290 and 235 nm, respectively. This spectral profile corresponds to the hybrid G4 conformations (Fig. 2A, top and bottom right structures). These CD data are consistent with previous observations that the identity of the monovalent cation present in solution has an important impact on the overall G-quadruplex conformation.
      Table 1Sequences of oligonucleotide substrates
      DNASequence (5′ → 3′)
      c-MYC FTGGGTGGGTAGGGTGGGTTT FAM
      hTelo FAGGGTTAGGGTTAGGGTTAGGGTT FAM
      ssDNA FFAM TTTTTTTTTTTTTTTTTTTT
      Cy5-Cy3 G4Cy5 TTTTTTTTTTTTTTTGAGGGTGGGTAGGGTGGGTAA Cy3
      c-MYCTGGGTGGGTAGGGTGGGT
      T30T30
      T50T50
      G4-multiplexGCGTTCTGAACTCG Cy3 ATATGGGTGGGTAGGGTGGGATTAGTGCTAGCTACGCG
      G4-multiplex complementCGCGTAGCTAGCAC Cy5 TAATCCCACCCTACCCACCCATATCGAGTTCAGAACGC
      c-MYC reporterT14GAGGGTGGGTAGGGTGGGTAACGCTGATGTCGC
      c-MYC reporter complementGCGACATCAGCG
      Figure thumbnail gr2
      Figure 2A, CD spectra of G-rich oligonucleotides indicate formation of various G-quadruplex topologies dependent on sequence and conditions. B–E, CD spectra of 10 μm each of c-MYC (B), hTelo (C and D), and ssDNA (E) with 100 mm of the indicated salt. Each CD spectrum is color-coded to the name of the G-quadruplex topology represented in A.
      To determine whether PC4 can interact with alternative G4DNA structures, equilibrium binding assays were conducted with fluorescently labeled c-MYC, hTelo, and ssDNA sequences (Table 1) in the presence of 100 mm KCl (Fig. 3A) or NaCl (Fig. 3B). In the presence of 100 mm KCl, PC4 bound equally well to hTelo, c-MYC, and ssDNA substrates (Kd = 3.0 ± 0.5, 3.1 ± 0.3, and 3.5 ± 1.5 nm, respectively). The strength of this interaction was not drastically altered in the presence of 100 mm NaCl (Kd = 2.6 ± 0.7, 4.9 ± 1.1, and 2.8 ± 0.6 nm, respectively). The Kd values that are reported here differ somewhat from those reported previously in which PC4 bound more tightly to G4DNA (Kd = 1.4 ± 0.3 nm) compared with ssDNA (Kd = 12.3 ± 1.7) (
      • Gao J.
      • Zybailov B.L.
      • Byrd A.K.
      • Griffin W.C.
      • Chib S.
      • Mackintosh S.G.
      • Tackett A.J.
      • Raney K.D.
      Yeast transcription co-activator Sub1 and its human homolog PC4 preferentially bind to G-quadruplex DNA.
      ). However, multiple preparations of PC4 displayed binding isotherms that are consistent with that reported here, so we conclude that the differences observed are likely preparation-dependent.
      Figure thumbnail gr3
      Figure 3PC4 can bind different DNA G-quadruplex topologies with similar affinities. A and B, fluorescence anisotropy of 1 nm hTelo F (purple squares), c-MYC F (green diamonds), and ssDNA F (black circles) titrated with increasing concentrations of PC4 in 100 mm KCl (A) or NaCl (B). C and D, fluorescence anisotropy of ssDNA F (C) and c-MYC F (D) substrates were titrated with increasing concentrations of PC4 mutants F77A (red squares) and W89A (blue triangles) and compared with wild-type PC4 (wt, black circles). The data were fit to the quadratic equation. The error bars represent the standard deviation of four independent experiments.
      Mutation of the aromatic amino acid residues Phe77 and Trp89, which are reported to be essential for ssDNA recognition, to alanine residues increased the Kd value of the PC4-G4DNA complex (Fig. 3C) ∼7–10-fold (Kd = 12.1 ± 2.7 and 16.7 ± 3.2 nm for W89A and F77A). A similar fold increase in the Kd value was also observed for the PC4-ssDNA complex (Fig. 3D) with Kd = 15.0 ± 2.3 and 17.5 ± 2.4 nm for W89A and F77A, respectively. Increasing the oligonucleotide concentration to 2 nm in the presence of 100 mm KCl resulted in Kd values similar to that observed in Fig. 3, which indicates that equilibrium binding was observed (supplemental Fig. S1A). The fluorescence intensity values were also not affected during the course of the titrations (supplemental Fig. S1B).
      Collectively, the CD and binding data indicate that PC4 recognition of G4DNA is not dependent on the strand directionality of the G4 structure because PC4 does not discriminate between different G4 topologies. Mutational analysis revealed the aromatic amino acids (Phe77 and Trp89) had similar deleterious effects on binding to both G4 and ssDNA substrates, which indicates that the DNA-binding domain is important for G4-binding activity. Thus, PC4 can accommodate alternative G4DNA structures with similar affinity to that observed for ssDNA, and the alternative topological G4 arrangements have no apparent effect on binding activity in vitro.

      PC4 does not unfold G4DNA but slows the rate of G4 folding

      It has been reported previously that PC4 can destabilize duplex DNA. which ultimately leads to complete strand separation (
      • Werten S.
      • Langen F.W.
      • van Schaik R.
      • Timmers H.T.
      • Meisterernst M.
      • van der Vliet P.C.
      High-affinity DNA binding by the C-terminal domain of the transcriptional coactivator PC4 requires simultaneous interaction with two opposing unpaired strands and results in helix destabilization.
      ). To examine the possibility that PC4 binding to G4DNA results in unfolding of the G4DNA structure, a FRET-based assay that has been described previously was used (
      • Mergny J.-L.
      • Lacroix L.
      • Teulade-Fichou M.-P.
      • Hounsou C.
      • Guittat L.
      • Hoarau M.
      • Arimondo P.B.
      • Vigneron J.-P.
      • Lehn J.-M.
      • Riou J.-F.
      • Garestier T.
      • Hélène C.
      Telomerase inhibitors based on quadruplex ligands selected by a fluorescence assay.
      ,
      • Eddy S.
      • Ketkar A.
      • Zafar M.K.
      • Maddukuri L.
      • Choi J.-Y.
      • Eoff R.L.
      Human Rev1 polymerase disrupts G-quadruplex DNA.
      ,
      • Byrd A.K.
      • Raney K.D.
      A parallel quadruplex DNA is bound tightly but unfolded slowly by Pif1 helicase.
      ). In this assay, 25 nm of c-MYC G4DNA with Cy5 and Cy3 labels on the 5′ and 3′ ends, respectively (Cy5-Cy3 c-MYC G4; Table 1) is mixed with varying concentrations of PC4 or 0.2 μm Pif1 helicase. When the G4DNA is folded, the fluors are in close proximity, which gives a high fluorescence signal. Upon unfolding of the G4 structure, the distance between the Cy5 and Cy3 fluors is increased and results in a decrease in the fluorescence signal (Fig. 4A). Upon rapid mixing of the folded c-MYC G4 sequence with 0.2, 1, and 3 μm PC4, there was no observable decrease in the fluorescence signal up to 500 s. However, when rapidly mixed with 0.2 μm of the Pif1 helicase with ATP, which unfolds many different G4DNA structures (
      • Byrd A.K.
      • Raney K.D.
      A parallel quadruplex DNA is bound tightly but unfolded slowly by Pif1 helicase.
      ,
      • Sanders C.M.
      Human Pif1 helicase is a G-quadruplex DNA-binding protein with G-quadruplex DNA-unwinding activity.
      ,
      • Paeschke K.
      • Bochman M.L.
      • Garcia P.D.
      • Cejka P.
      • Friedman K.L.
      • Kowalczykowski S.C.
      • Zakian V.A.
      Pif1 family helicases suppress genome instability at G-quadruplex motifs.
      ,
      • Zhou R.
      • Zhang J.
      • Bochman M.L.
      • Zakian V.A.
      • Ha T.
      Periodic DNA patrolling underlies diverse functions of Pif1 on R-loops and G-rich DNA.
      ), there was a robust decrease in the fluorescence signal (Fig. 4B). These data indicate that PC4 alone is unable to induce G4DNA unfolding.
      Figure thumbnail gr4
      Figure 4The effect of unfolding and folding of G4DNA by PC4. A, schematic of the FRET-based assay used to measure folding. B, effect of G4DNA (25 nm) unfolding after addition of 0.2 μm (green), 1 μm (red), and 3 μm (blue) PC4 or 0.2 μm Pif1 (black) was monitored by a decrease in Cy5 fluorescence. C, G4DNA (25 nm) folding upon addition of 100 mm KCl with 0 (gray), 0.2 μm (green), 1 μm (red), and 3 μm (blue) PC4 was monitored by an increase in the Cy5 fluorescence. The data were fit to an equation for the sum of two exponentials in the absence or with low concentration of PC4. The rate constants were k1 = 0.56 ± 0.07 s−1 and k2 = 0.037 ± 0.001 s−1 for 0 μm PC4 and k1 = 0.15 ± 0.02 s−1 and k2 = 0.018 ± 0.001 s−1 for 0.2 μm PC4. In the presence of 1 or 3 μm PC4, the data were fit to a single exponential resulting in k = 0.01 ± 0.004 s−1 or 1 μm PC4 and k = 0.009 ± 0.001 s−1 for 3 μm PC4.
      The absence of any observable G4 unfolding activity by PC4 presents the possibility that PC4 could stabilize or even enhance the folding of the G4DNA structure. To address this potential activity, 25 nm of the unfolded Cy5-Cy3 c-MYC G4 sequence was rapidly mixed with 100 mm KCl alone or with varying concentrations of PC4 (Fig. 4C). In the absence and at lower concentrations of PC4, the data were best fit to a double exponential equation, which is consistent with a multistep G4 folding process (
      • Lane A.N.
      • Chaires J.B.
      • Gray R.D.
      • Trent J.O.
      Stability and kinetics of G-quadruplex structures.
      ,
      • Gray R.D.
      • Trent J.O.
      • Chaires J.B.
      Folding and unfolding pathways of the human telomeric G-quadruplex.
      ,
      • Gray L.T.
      • Vallur A.C.
      • Eddy J.
      • Maizels N.
      G quadruplexes are genomewide targets of transcriptional helicases XPB and XPD.
      ). Rate constant values obtained from the fitting analysis are presented in Table 2. Upon addition of 0.2 μm PC4 (Fig. 4C, green versus gray traces), there was a ∼4-fold reduction in the rate constant for the initial fast folding step and a ∼2-fold reduction in the rate constant for the slower step of the Cy3-Cy5 c-MYC G4 (0.56 ± 0.07 s−1 versus 0.15 ± 0.02 s−1 and 0.037 ± 0.001 s−1 versus 0.018 ± 0.001 s−1 for the fast and slow rate constants, respectively, in Fig. 4C). Upon addition of 1 or 3 μm (Fig. 4C, red and blue, respectively), there was a greater reduction in the rate constant for folding, and the data fit best to a single exponential equation with rate constants of 0.011 ± 0.004 and 0.009 ± 0.001 in the presence of a large excess of PC4 relative to DNA. Collectively, the data presented indicate that PC4 binding to a prefolded G4DNA structure does not induce G4DNA unfolding even in high excess of PC4. However, folding of G4DNA from an unfolded state is slowed in slight excess of PC4 and is severely perturbed at higher concentrations of PC4 that are in great excess of the DNA concentration.
      Table 2Rates of G-quadruplex folding
      PC4 (μm)G4 folding rate constants (s−1)
      k1k2
      00.56 ± 0.070.037 ± 0.001
      0.20.15 ± 0.020.018 ± 0.001
      10.011 ± 0.004
      30.009 ± 0.001

      G4DNA scaffold can accommodate a single dimer of PC4

      G4DNA adopts a more rigid, compact structure compared with an ssDNA counterpart of the same sequence. Despite this difference, the fluorescence equilibrium binding data combined with the absence of G4DNA unfolding activity by PC4 suggest that PC4 recognizes the folded G4DNA scaffold. However, the stoichiometry of the PC4-G4DNA interaction is a question that has not been addressed. It is known that PC4 possesses oligomeric activity on unpaired ssDNA strands of an open duplex conformation if enough unpaired nucleotides are available (
      • Wang J.Y.
      • Sarker A.H.
      • Cooper P.K.
      • Volkert M.R.
      The single-strand DNA binding activity of human PC4 prevents mutagenesis and killing by oxidative DNA damage.
      ). To appraise the stoichiometry of the binding interaction between PC4 and G4DNA, intrinsic protein fluorescence quenching experiments were conducted with 1 μm PC4 titrated with the indicated DNA substrates in the presence of 100 mm KCl or LiCl (Fig. 5). The data were plotted as the ratio of [DNA]/[PC4] versus FBuff/FPC4-DNA. The data display a characteristic linear increase that reaches a point of saturation that is represented as a plateau in the binding isotherm. The value of the [DNA]/[PC4] ratio at the point of saturation is the stoichiometry of the interaction (
      • Walker J.M.
      ). Titration of 1 μm PC4 with the folded c-MYC (Fig. 5, purple) resulted in a DNA/PC4 = 0.49 ± 0.03, which corresponds to 1 dimer of PC4 bound per folded G4DNA substrate. When titration of 1 μm PC4 was performed in the presence of 100 mm LiCl (which does not support G4DNA formation), there was an observed decrease in the DNA/PC4 = 0.34 ± 0.11, which corresponds to 1–2 dimers of PC4 per unfolded G4DNA substrate. These data are consistent with the hypothesis when the G4DNA scaffold is unfolded, additional binding sites are available to be bound by PC4. The same trend was observed for the T30 and T50 ssDNA substrates. DNA/PC4 = 0.15 ± 0.02 and 0.08 ± 0.002, respectively, which correspond to three dimers bound to the T30 substrate and six dimers bound to the T50 substrate.
      Figure thumbnail gr5
      Figure 5The G-quadruplex structure can accommodate one dimer of PC4. A, schematic of the protein fluorescence quench assay. B, PC4 (1 μm) was titrated with an increasing concentration of folded (purple) or unfolded (black) c-MYC DNA. C, PC4 (1 μm) was titrated with increasing concentrations of T30 (black) or T50 (blue) ssDNA. Stoichiometry was determined by calculating the [DNA]/[PC4] ratio at the point of saturation. The stoichiometric values were 0.49 ± 0.03, 0.34 ± 0.11, 0.15 ± 0.02, and 0.08 ± 0.002 for the folded, unfolded c-MYC, T30, and T50 DNA substrates, respectively.

      G4DNA structure is nested into the binding site of a single PC4 monomer

      In lieu of a crystal structure of the PC4-G4DNA complex, in silico molecular docking simulations were conducted with the previously solved structures of PC4 and c-MYC G4DNA (
      • Brandsen J.
      • Werten S.
      • van der Vliet P.C.
      • Meisterernst M.
      • Kroon J.
      • Gros P.
      C-terminal domain of transcription cofactor PC4 reveals dimeric ssDNA binding site.
      ,
      • Mathad R.I.
      • Hatzakis E.
      • Dai J.
      • Yang D.
      C-MYC promoter G-quadruplex formed at the 5′-end of NHE III 1 element: Insights into biological relevance and parallel-stranded G-quadruplex stability.
      ). Atomic structures were downloaded from the Protein Data Bank, and simulations were carried out with the High Ambiguity Driven DOCKing (HADDOCK) program (
      • Dominguez C.
      • Boelens R.
      • Bonvin A.M.
      HADDOCK: a protein-protein docking approach based on biochemical or biophysical information.
      ,
      • van Zundert G.C.
      • Rodrigues J.P.
      • Trellet M.
      • Schmitz C.
      • Kastritis P.L.
      • Karaca E.
      • Melquiond A.S.
      • van Dijk M.
      • de Vries S.J.
      • Bonvin A.M.
      The HADDOCK2.2 Web Server: user-friendly integrative modeling of biomolecular complexes.
      ). The simulation analysis resulted in 51 structures that were grouped into 9 clusters that represented 25.5% of the water-refined models. The statistics of these 9 clusters are tabulated in Table 3. The top-scored cluster based on the HADDOCK score, which is a weighted sum of the electrostatic, van der Waals, desolvation, and restraint violation energies, was cluster 3 with a value of −147.5 ± 7.0. However, upon a more detailed analysis of the interface and ligand RMSD values in addition to the fraction of native contacts (Fnat) with respect to the Critical Assessment of PRedicted Interactions (CAPRI) criteria (
      • Gao M.
      • Skolnick J.
      New benchmark metrics for protein-protein docking methods.
      ), cluster 4 resulted in the only favorable values (HADDOCK = −133.5 ± 16.3, interface RMSD = 0.88 ± 0.5, ligand RMSD = 1.7 ± 0.9, and Fnat = 0.79 ± 0.12).
      Table 3PC4-c-MYC G4DNA molecular docking simulation statistics.
      ClusterHADDOCK scorei-RMSDl-RMSDFnatz score
      1−95.7 ± 4.39.7 ± 0.318.1 ± 0.70.11 ± 0.010.9
      2−107.9 ± 5.811.9 ± 0.119.6 ± 0.20.13 ± 0.0070.2
      3−147.5 ± 7.010.9 ± 0.116.7 ± 0.1−2
      4−133.5 ± 16.30.88 ± 0.51.7 ± 0.90.79 ± 0.12−1.2
      5−94.7 ± 14.711.1 ± 0.118.1 ± 0.11
      6−96.0 ± 9.712.1 ± 0.0427.5 ± 0.20.11 ± 0.010.9
      7−101.6 ± 11.49.4 ± 0.215.6 ± 0.30.02 ± 0.020.6
      8−107.3 ± 5.59.5 ± 0.316.6 ± 0.60.09 ± 0.0010.3
      9−126.9 ± 4.79.4 ± 0.114.7 ± 0.20.03 ± 0.02−0.8
      The structure that represents cluster 4 is presented in Fig. 6. This structure has the c-MYC G4DNA cradled within one of the PC4 monomers (Fig. 6, A–C) with one planar face of the G4 structure placed against the DNA-binding groove of PC4 (Fig. 6B). This “face-down” mode of interaction places the free adenine nucleotides within congruent loops of the G4DNA (Fig. 6C, circled) in close (∼6 Å) proximity to the aromatic amino acids Trp89 and Phe77. A more detailed view of the interaction surface illustrates the positioning of the key residues Trp89 (Fig. 7A) and Phe77 (Fig. 7B), which are suggested to be essential for DNA recognition (
      • Werten S.
      • Stelzer G.
      • Goppelt A.
      • Langen F.M.
      • Gros P.
      • Timmers H.T.
      • Van der Vliet P.C.
      • Meisterernst M.
      Interaction of PC4 with melted DNA inhibits transcription.
      ). The distance between Trp89 and Phe77 and their respective base stacking partners was calculated to be ∼6 Å, which is on the upper limit of the maximum distance allowed for a stable π-π stacking interaction to form. A small (∼2 Å) contraction in the PC4 structure could bring these residues into closer proximity to allow for more favorable interactions.
      Figure thumbnail gr6
      Figure 6Folded G4DNA is nested into one monomer of the PC4 dimer. Molecular docking simulations were conducted with the HADDOCK software package using the default settings (
      • Dominguez C.
      • Boelens R.
      • Bonvin A.M.
      HADDOCK: a protein-protein docking approach based on biochemical or biophysical information.
      ,
      • van Zundert G.C.
      • Rodrigues J.P.
      • Trellet M.
      • Schmitz C.
      • Kastritis P.L.
      • Karaca E.
      • Melquiond A.S.
      • van Dijk M.
      • de Vries S.J.
      • Bonvin A.M.
      The HADDOCK2.2 Web Server: user-friendly integrative modeling of biomolecular complexes.
      ). A representative structure of the highest scored cluster from molecular docking simulations is shown. The monomers of the PC4 dimer are colored red and blue, respectively. A, top-down view of the PC4-G4DNA complex. B, front view rotated 90° from the top-down view shown in A. C, side view rotated 90° from the front view shown in B with the adenine bases predicted to be in close proximity to the base stacking amino acid residues circled in red.
      Figure thumbnail gr7
      Figure 7Highlighted interactions of the PC4-c-MYC G4 complex from molecular docking simulations. Close-up view of Trp89 (red) and Phe77 (blue) to their respective adenine (ADE) base stacking partners (A and B, respectively). C, the Phe77 molecular “pocket” created by the phosphate backbone and the adjacent adenine residue is shown as a space-filling model. D, additional interactions between Arg75, Lys78, Lys80, and Arg100 and the phosphate backbone.
      One interesting feature predicted by this docking simulation was the formation of a molecular “pocket” formed around the Phe77 residue by the phosphate back bone and the adenine residue predicted as a base stacking partner (Fig. 7C). In addition to the “poised” stacking interactions, several hydrogen bond interactions were predicted between the phosphate backbone and residues Arg75, Lys78, Lys80, and Arg100 (Fig. 7D). These hydrogen-bonding interactions are analogous to the interactions that have been observed within the crystal structure of the PC4-ssDNA complex (
      • Werten S.
      • Moras D.
      A global transcription cofactor bound to juxtaposed strands of unwound DNA.
      ). Collectively, the data from the in silico molecular docking simulation and biophysical stoichiometric experiments suggest that the G4DNA structure is recognized by one monomeric unit of the PC4 dimer.

      Expanded model of DNA multiplex recognition by PC4

      The current model to suggest how PC4 might interact with DNA was first presented by Brandsen et al. (
      • Brandsen J.
      • Werten S.
      • van der Vliet P.C.
      • Meisterernst M.
      • Kroon J.
      • Gros P.
      C-terminal domain of transcription cofactor PC4 reveals dimeric ssDNA binding site.
      ) upon solving the crystal structure of PC4. This model suggests the anti-parallel DNA-binding grooves of PC4 are positioned to accommodate the anti-parallel strands of the DNA duplex, which are separated by the β-ridge region of PC4 (Fig. 8, scheme 1). This model was supported further by biochemical data suggesting that PC4 interacts with unpaired strands of the DNA to destabilize the duplex and also inhibit transcription (
      • Werten S.
      • Stelzer G.
      • Goppelt A.
      • Langen F.M.
      • Gros P.
      • Timmers H.T.
      • Van der Vliet P.C.
      • Meisterernst M.
      Interaction of PC4 with melted DNA inhibits transcription.
      ,
      • Werten S.
      • Langen F.W.
      • van Schaik R.
      • Timmers H.T.
      • Meisterernst M.
      • van der Vliet P.C.
      High-affinity DNA binding by the C-terminal domain of the transcriptional coactivator PC4 requires simultaneous interaction with two opposing unpaired strands and results in helix destabilization.
      ).
      Figure thumbnail gr8
      Figure 8Multiplex model of DNA recognition by PC4 illustrating how PC4 might stabilize ssDNA and G4DNA within the context of melted dsDNA. In this model, normal mechanisms that result in duplex denaturation can accommodate PC4 as the previously proposed open complex conformation (scheme 1 and Refs.
      • Brandsen J.
      • Werten S.
      • van der Vliet P.C.
      • Meisterernst M.
      • Kroon J.
      • Gros P.
      C-terminal domain of transcription cofactor PC4 reveals dimeric ssDNA binding site.
      and
      • Werten S.
      • Wechselberger R.
      • Boelens R.
      • van der Vliet P.C.
      • Kaptein R.
      Identification of the single-stranded DNA binding surface of the transcriptional coactivator PC4 by NMR.
      ). However, if one strand is guanine-rich and is allowed to fold into a G4 structure, one monomer of PC4 can recognize and stabilize the G4 structure with adjacent monomer bound at any available site along the complementary C-rich strand (scheme 2). Alternatively, PC4 could bind the folded G4 or the complementary C-rich strand, separately allowing additional factors to bind to the open complex (scheme 3).
      In consideration of the data in the literature and the data presented here, an expanded model of DNA recognition by PC4 is presented in Fig. 8. In this model, normal cellular processes that promote duplex denaturation that result in an open DNA complex can be bound by PC4 in the canonical model of DNA recognition (Fig. 8, scheme 1). The data presented here suggest an extension of the concept to include the possibility of a folded G4 in one strand of the open duplex to form a G4-multiplex type structure (Fig. 8, scheme 2). In this model, one of the DNA strands that is folded into a G4 is bound by one monomer of PC4, leaving the adjacent monomer to bind at any available site along the length of the complementary C-rich strand (Fig. 8, scheme 2). Additionally, PC4 could bind to either G4 or ssDNA strands in the open duplex with the unbound strand available to accommodate another PC4 dimer or a separate protein partner (Fig. 8, scheme 3).

      G4-multiplex structure is bound and potentially stabilized by PC4

      It has been difficult to study G4DNA-associated activities in the context of duplex DNA because the stability of the GC-rich duplex out-competes the stability of the folded G4 structure under typical buffer conditions in vitro. However, if the two strands are annealed in the presence of a molecular crowding agent (PEG 200, glycerol, etc.), the structure of the G4DNA can persist in the presence of the complementary C-rich strand (
      • Zheng K.W.
      • Chen Z.
      • Hao Y.H.
      • Tan Z.
      Molecular crowding creates an essential environment for the formation of stable G-quadruplexes in long double-stranded DNA.
      ). In efforts to ascertain whether the model for PC4 binding to G4-multiplex is consistent with the model of duplex binding by PC4, a FRET-based assay that has been previously described was utilized (
      • Kreig A.
      • Calvert J.
      • Sanoica J.
      • Cullum E.
      • Tipanna R.
      • Myong S.
      G-quadruplex formation in double strand DNA probed by NMM and CV fluorescence.
      ). Briefly, a Cy3-labeled c-MYC G4DNA sequence flanked by 18 nucleotides on the 5′ and 3′ ends is annealed to a Cy5-labeled complementary C-rich strand. Annealing in the absence of PEG results in formation of the complete duplex structure, which should result in a low FRET signal. However, annealing in the presence of a molecular crowding agent, in this case 40% PEG 200, would result in persistence of the G4 structure and an increase in FRET signal even in the presence of adjacent duplex DNA (Fig. 9A).
      Figure thumbnail gr9
      Figure 9Formation of the G4-multiplex in the presence of the crowding agent PEG and stabilization of the structure by PC4. A illustrates the annealing of the duplex resulting in relatively low FRET in the absence of PEG or formation of the G4-multiplex structure in the presence of PEG resulting in relatively high FRET. The change in Cy5 fluorescence was monitored in the presence of 25 nm duplex or G4-multiplex substrates as a function of PC4 and PEG. B, (+)PEG PA indicates fluorescence of the duplex substrate with the addition of PEG post-annealing. C and D, fluorescence change over time for the duplex (C) and G4-multiplex (D) substrates up to 500 s.
      In the absence of PEG 200, the Cy5 fluor is distanced from the Cy3 fluor because of complete duplex formation, which resulted in a relatively low fluorescence value of ∼0.25 V (Fig. 9B). Neither the addition of PEG after the annealing reaction ((+) PEG PA) nor 3 μm PC4 post-annealing had any effect on the fluorescence of this complete duplex substrate (Fig. 9, B and C). However, when the annealing reaction was conducted in the presence of PEG 200, the G4DNA structure persisted, which positions the Cy5 and Cy3 fluors in relatively closer proximity to one another, resulting in a ∼2-fold increase in fluorescence signal from 0.25 to 0.5 V (Fig. 9B, (+)PEG). The DNA substrate, which consists of G4DNA, duplex, and single-stranded DNA, will be referred to as a G4-multiplex. However, when the G4-multiplex substrate was mixed with PC4 (1.5 and 3 μm) there was a further enhancement in the fluorescence signal from ∼0.5 to ∼0.7–0.8 V (Fig. 9B). Additionally, the formation of the PC4-G4-multiplex complex did not result in an extensive loss of fluorescence over time, which indicated that the integrity of the duplex was maintained up to 500 s (Fig. 9D).
      Dimethyl sulfate (DMS) footprinting of the folded G4-multiplex substrate validated the presence of the G4DNA structure (Fig. 10, A and B). The N7 position of guanines involved in G4DNA formation exhibit a greater degree of protection (∼3.4-fold) from reaction with DMS. This protection was not observed in the duplex or the duplex treated with 4% PEG 200, which suggests that PEG alone does not induce G4DNA formation and is consistent with the formation of the G4DNA structure when annealing is performed in the presence of PEG (
      • Kreig A.
      • Calvert J.
      • Sanoica J.
      • Cullum E.
      • Tipanna R.
      • Myong S.
      G-quadruplex formation in double strand DNA probed by NMM and CV fluorescence.
      ,
      • Sun D.
      • Hurley L.H.
      Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.
      ). Additionally, CD analysis of the complete duplex and the folded G4-multiplex substrates (Fig. 10C) suggests that the formation of the G4 structure did not perturb the flanking duplex regions because there was no discernible shift in the spectra minimum and maximum at ∼245 and ∼280 nm, respectively (
      • Kypr J.
      • Kejnovská I.
      • Renciuk D.
      • Vorlícková M.
      Circular dichroism and conformational polymorphism of DNA.
      ). The data in Figure 9, Figure 10 support the conclusion that the structure adopted by the DNA substrate is the G4-multiplex. Furthermore, PC4 can bind to this structure in a manner that maintains the G4DNA structure itself.
      Figure thumbnail gr10
      Figure 10Biochemical evaluation of the formation of the G4-multiplex. A, DMS footprinting reactions were performed with duplex or G4-multiplex substrates in the presence or absence of 4% PEG. M denotes the mock reacted substrates. B, quantification of guanine reactivity of duplex (blue circles), duplex (+) 4% PEG 200 (red squares), and the folded G4-multiplex (green diamonds) from the DMS footprinting reaction. C, CD spectra of duplex (blue) and multiplex (green) substrates compared with ssDNA, T15.

      G4 structure within the G4-multiplex is stabilized in the presence of PC4

      To address the G4-multiplex further, an experiment was conducted in which PEG 200 was dialyzed away from the folded G4-multiplex substrate in the absence or presence of PC4 prior to examination by DMS footprinting. It was hypothesized that if the G4DNA structure is stabilized by PC4, the guanine nucleotides involved in G4DNA formation would exhibit a greater degree of protection from DMS in the presence of PC4 compared with the G4-multiplex in the absence of PC4.
      DMS footprinting gels for the G4-multiplex are shown in Fig. 11A in the presence or absence of PC4 after dialysis to remove PEG. The bands corresponding to the guanine residues are visibly darker in the absence of PC4. Quantitation of the band intensity reveals a significant increase in guanine reactivity in the absence of PC4 (Fig. 11B) Hence, PC4 does appear to remain bound to the G4DNA structure in the context of the duplex substrate, even after the removal of PEG.
      Figure thumbnail gr11
      Figure 11The folded G4 structure in the G4-multiplex is stabilized by PC4. A, DMS footprinting reactions were performed on the G4-multiplex after removal of the PEG crowding agent in the absence or presence of PC4. B, quantification of guanine reactivity in the G4-multiplex alone (red squares) or in the presence of 500 nm PC4 (green diamonds). C, bromine footprinting of the C-rich complementary strand indicates some protection by PC4. D, quantification of cytosine reactivity of the C-rich strand in the absence (red squares) or in the presence of 500 nm PC4 (green diamonds).
      The current binding model of PC4 suggests that the anti-parallel strands of an open DNA duplex are bound by the anti-parallel DNA-binding sites of the PC4 homodimer (Fig. 8). This binding model predicts that the complementary C-rich strand opposite the folded G4DNA would be protected against chemical attack in the presence of PC4. Cytosine-specific bromine footprinting of the complementary C-rich strand of the G4-multiplex was carried out in the absence and presence of 500 nm PC4 (Fig. 11, C and D). In the presence of PC4, there was a ∼2-fold reduction in reactivity of the cytosine residues opposite the G4DNA structure within the G4-multiplex. The protection provided by PC4 in the guanine and cytosine footprinting data (summarized in Fig. 12, A and B, respectively) suggests that the recognition of G4DNA by PC4 results in stabilization of the G4 structure and complementary C-rich strand.
      Figure thumbnail gr12
      Figure 12Overall DNA footprinting results for the duplex or G4-multiplex in the absence or presence of PC4. A and B, summary of guanine (A) and cytosine (B) reactivity. The data are the average reactivities of all bands in each condition ± standard deviation.
      To address the stabilization of G4DNA by PC4 further, a G4DNA reporter substrate that has been used previously to investigate Pif1-mediated G4 unfolding was used (
      • Byrd A.K.
      • Raney K.D.
      A parallel quadruplex DNA is bound tightly but unfolded slowly by Pif1 helicase.
      ). In this assay, the c-MYC G4DNA sequence is flanked on the 5′ and 3′ ends by ssDNA and 12-bp duplex, respectively (Table 1, c-MYC reporter). Pif1-mediated unfolding of the c-MYC reporter is monitored by unwinding of the 12-bp duplex on the 3′ end. There was a large (∼5-fold) decrease in the rate constant of Pif1 unwinding in the presence of PC4 compared with Pif1 alone (Fig. 13). The difference in Pif1 unwinding was not dependent on the order of addition as preincubating Pif1 with the DNA prior to addition of PC4 followed by ATP did not change the difference in rate constants. This unwinding activity was not observed for PC4 alone. The footprinting and Pif1-mediated G4 unfolding data taken together support a model where G4DNA bound by PC4 results in stabilization of the G4 structure.
      Figure thumbnail gr13
      Figure 13Pif1-mediated unwinding of c-MYC reporter is slowed by PC4. A, 2 nm c-MYC reporter was preincubated with 25 nm Pif1 alone (left panel), 50 nm PC4 alone (middle panel), or 25 nm Pif1 followed by 50 nm PC4 (right panel) before initiation with 5 mm ATP. B, fraction of ssDNA was plotted versus time and data were fit to a single exponential equation. The error bars represent the standard deviation of three separate experiments.

      Discussion

      G-quadruplex structures have garnered much attention to determine the roles these structures assume in biological regulation and disease (
      • Maizels N.
      G4-associated human diseases.
      ,
      • Tarsounas M.
      • Tijsterman M.
      Genomes and G-quadruplexes: for better or for worse.
      ,
      • Rhodes D.
      • Lipps H.J.
      G-quadruplexes and their regulatory roles in biology.
      ). Presently, there is some controversy over the exact number of G4DNA-forming sequences within the mammalian genome (
      • Maizels N.
      G4-associated human diseases.
      ). The values of potential G4DNA-forming sequences range from ∼300,000 to 750,000, and the broad range in number is largely due to the degree of stringency in loop length allowed within the search algorithm (
      • Maizels N.
      G4-associated human diseases.
      ). Regardless, the non-random distribution within or near functional regions of the genome largely lends the role of G4DNA-forming sequences as regulatory components in transcription, DNA replication, telomere maintenance, and recombination (
      • Rhodes D.
      • Lipps H.J.
      G-quadruplexes and their regulatory roles in biology.
      ). Functional characterization of the proteins and cofactors that recognize these structures is essential if a comprehensive physiological model of G-quadruplex structure is to be attained. The transcriptional coactivator PC4 is a ssDNA-binding protein that has multiple reported functions including G-quadruplex binding (
      • Gao J.
      • Zybailov B.L.
      • Byrd A.K.
      • Griffin W.C.
      • Chib S.
      • Mackintosh S.G.
      • Tackett A.J.
      • Raney K.D.
      Yeast transcription co-activator Sub1 and its human homolog PC4 preferentially bind to G-quadruplex DNA.
      ,
      • Conesa C.
      • Acker J.
      Sub1/PC4 a chromatin associated protein with multiple functions in transcription.
      ).
      Here it was shown that PC4 can recognize alternative G4DNA conformations with similar Kd values to that observed for ssDNA (Fig. 3). No unfolding of the G4DNA structure was observed upon binding by PC4 (Fig. 4B). This is in contrast to RPA, another abundant SSB, which has been shown to readily unfold G4DNA (
      • Ray S.
      • Qureshi M.H.
      • Malcolm D.W.
      • Budhathoki J.B.
      • Celik U.
      • Balci H.
      RPA-mediated unfolding of systematically varying G-quadruplex structures.
      ). However, PC4 significantly perturbed the folding rate of G4DNA (Fig. 4C).
      PC4 binds the folded c-MYC G4 substrate with a stoichiometric ratio of 1:1, PC4 dimer:c-MYC G4. This stoichiometric ratio increases ∼2-fold to 2:1 upon unfolding of the G4DNA structure (Fig. 5B). There are two important conclusions that can be drawn from this data: 1) a reduction in the number of binding sites available through folding of G4DNA (Fig. 5) could prevent the oligomerization of PC4 onto the DNA and potentially serve as a mechanism of regulation, and 2) the occlusion of ∼17–23 nucleotides into a compact folded G4DNA structure artificially increases the effective binding site size of PC4 (minimum of ∼8 nucleotides) ∼2–3-fold depending on the loop lengths of the G4DNA.
      Molecular docking simulations support a binding mode whereby one monomer of a PC4 dimer cradles the G4DNA (Fig. 6), which is consistent with the observed stoichiometry of the complex (Fig. 5). Docking studies revealed that the close proximity of the aromatic amino acid residues Trp89 and Phe77 to nucleobases within the loops of the G4DNA (Fig. 7, A and B) is consistent with the binding data (Fig. 2), which supports the role of these amino acids in G4DNA binding. Collectively, the data presented here suggest a structural model of G4DNA recognition by PC4 that builds on the existing structural and biochemical data for binding of ssDNA.
      A G4DNA structure was formed within the context of duplex DNA by using a molecular crowding agent, PEG 200 (
      • Kreig A.
      • Calvert J.
      • Sanoica J.
      • Cullum E.
      • Tipanna R.
      • Myong S.
      G-quadruplex formation in double strand DNA probed by NMM and CV fluorescence.
      ). The resulting structure is referred to as a G4-multiplex. Evidence for direct binding of PC4 to the G4-multiplex was observed by an increase in Cy5 fluorescence of the folded G4-multiplex substrate that was not observed in the completely annealed duplex (Fig. 9, compare C and D). The observed PC4-mediated FRET enhancement of the folded G4-multiplex substrate in 4% PEG 200 would suggest that PC4 shifts the equilibrium of the complex from a partially annealed state to a stabilized G4-multiplex complex. Stabilization of the G4-multiplex is proposed to occur through either: 1) sequestration of the single-stranded C-rich strand, which would then allow the complementary G-rich strand to adopt a folded G4 structure, 2) recognition of a partially folded G4 structure that is then stabilized upon PC4 binding, and/or 3) the simultaneous recognition of both the G4 and C-rich strands by PC4 to enhance the stability of the open G4-multiplex.
      Additionally, others have reported that PC4 can denature a canonical open duplex through an oligomerization-dependent mechanism (
      • Werten S.
      • Langen F.W.
      • van Schaik R.
      • Timmers H.T.
      • Meisterernst M.
      • van der Vliet P.C.
      High-affinity DNA binding by the C-terminal domain of the transcriptional coactivator PC4 requires simultaneous interaction with two opposing unpaired strands and results in helix destabilization.
      ). However, the modest decrease in Cy5 fluorescence upon PC4 binding to the G4-multiplex (Fig. 9D) indicates that the open G4-multiplex is not denatured by PC4. If PC4 were to unwind or unfold the complete G4-multiplex, a greater reduction in fluorescence would be expected.
      The ssDNA-binding domain of PC4 was initially thought to possess a unique structural arrangement, but upon superimposition of PC4 and replication protein A (RPA) crystal structures, a similar positional arrangement of amino acid residues between the two proteins was observed (
      • Brandsen J.
      • Werten S.
      • van der Vliet P.C.
      • Meisterernst M.
      • Kroon J.
      • Gros P.
      C-terminal domain of transcription cofactor PC4 reveals dimeric ssDNA binding site.
      ,
      • Werten S.
      • Moras D.
      A global transcription cofactor bound to juxtaposed strands of unwound DNA.
      ,
      • Werten S.
      • Wechselberger R.
      • Boelens R.
      • van der Vliet P.C.
      • Kaptein R.
      Identification of the single-stranded DNA binding surface of the transcriptional coactivator PC4 by NMR.
      ). Indeed, several reports suggest that there is compensational or complementary activity between both PC4 and RPA because both proteins are simultaneously involved in replication and DNA damage repair and have been reported to directly associate (
      • Pan Z.Q.
      • Ge H.
      • Amin A.A.
      • Hurwitz J.
      Transcription-positive cofactor 4 forms complexes with HSSB (RPA) on single-stranded DNA and influences HSSB-dependent enzymatic synthesis of simian virus 40 DNA.
      ). However, the evidence presented here suggests that there is a potential dichotomy of function between PC4 and RPA on G4DNA. Others have reported RPA can efficiently unfold G4DNA (
      • Ray S.
      • Qureshi M.H.
      • Malcolm D.W.
      • Budhathoki J.B.
      • Celik U.
      • Balci H.
      RPA-mediated unfolding of systematically varying G-quadruplex structures.
      ,
      • Safa L.
      • Gueddouda N.M.
      • Thiébaut F.
      • Delagoutte E.
      • Petruseva I.
      • Lavrik O.
      • Mendoza O.
      • Bourdoncle A.
      • Alberti P.
      • Riou J.-F.
      • Saintomé C.
      5′ to 3′ unfolding directionality of DNA secondary structures by replication protein A: G-quadruplexes and duplexes.
      ). The evidence here suggests that, unlike RPA, PC4 does not possess the same G4DNA unfolding ability on the c-MYC G4DNA substrate. In fact the c-MYC G4DNA structure appears to be stabilized by the recognition of PC4 (Fig. 11). However, other G4 structures should be investigated to determine the generality of this conclusion.
      Possible roles for the G4DNA-binding capacity of PC4 are increasingly being recognized. PC4 is involved in various stages of transcription. At the initiation stage of transcription and during the formation of the preinitiation complex, significant torsional strain on the DNA scaffold is produced to promote open complex formation and progression into transcription elongation (
      • Compe E.
      • Egly J.-M.
      Nucleotide excision repair and transcriptional regulation: TFIIH and beyond.
      ). The torsional strain that is invoked on the DNA can cause negative superhelical stress that can be transmitted along the DNA scaffold and away from the preinitiation complex. Formation of G4DNA is proposed to relieve the superhelical stress and serve as a temporary means of relieving the strain on the DNA and to serve as a sensor that can be recognized by regulatory factors (
      • Zhang C.
      • Liu H.H.
      • Zheng K.W.
      • Hao Y.H.
      • Tan Z.
      DNA G-quadruplex formation in response to remote downstream transcription activity: long-range sensing and signal transducing in DNA double helix.
      ). Apart from a regulatory function, formation of G4DNA downstream of an elongating RNA polymerase could provide the transcriptional machinery with a physical obstacle that must be resolved or bypassed before transcription is allowed to proceed (
      • Tarsounas M.
      • Tijsterman M.
      Genomes and G-quadruplexes: for better or for worse.
      ). This could provide additional downstream “sensors” that relay the DNA damage status to the active transcription complex to abort transcription in times of cellular stress (
      • Tang W.
      • Robles A.I.
      • Beyer R.P.
      • Gray L.T.
      • Nguyen G.H.
      • Oshima J.
      • Maizels N.
      • Harris C.C.
      • Monnat R.J.
      The Werner syndrome RECQ helicase targets G4 DNA in human cells to modulate transcription.
      ).
      PC4 has several reported functions throughout the process of transcription including transcriptional repression (
      • Zhang C.
      • Liu H.H.
      • Zheng K.W.
      • Hao Y.H.
      • Tan Z.
      DNA G-quadruplex formation in response to remote downstream transcription activity: long-range sensing and signal transducing in DNA double helix.
      ). PC4-mediated transcriptional repression is dependent on the ssDNA-binding domain, although the precise mechanism for how PC4 binds to the DNA and inhibits transcription has been largely unexplored. Given the overlapping roles of PC4 and G4DNA in transcriptional regulation, it is possible that formation of G4DNA during the transcriptional process could provide a structural “signal” that is then recognized by PC4 to regulate transcription.
      Indeed, it has been previously shown that the helicase function of the XPB subunit within the TFIIH complex is required to alleviate PC4-mediated transcriptional repression that is not dependent on the XPD subunit (
      • Fukuda A.
      • Tokonabe S.
      • Hamada M.
      • Matsumoto M.
      • Tsukui T.
      • Nogi Y.
      • Hisatake K.
      Alleviation of PC4-mediated transcriptional repression by the ERCC3 helicase activity of general transcription factor TFIIH.
      ). Additionally, it has been suggested that there is a differential activity between XPD/XPB subunits in G4DNA unfolding activity with XPD efficiently unfolding the G4DNA structure with no apparent G4DNA unfolding activity observed by XPB (
      • Gray L.T.
      • Vallur A.C.
      • Eddy J.
      • Maizels N.
      G quadruplexes are genomewide targets of transcriptional helicases XPB and XPD.
      ). It is not known whether PC4 stabilization of G4DNA would inhibit XPD-mediated G4DNA unfolding, but based on the G4 multiplex stabilization activity observed here by PC4, it is hypothesized that the PC4-G4DNA complex would serve as a physical block to XPD progression. In contrast, PC4 recognition of G4DNA could initiate recruitment of proteins that possess a greater G4DNA resolution activity to allow progression of the transcriptional complex. This transcriptionally protective mechanism by PC4 would be consistent with observations that PC4 promotes genomic stability (
      • Mortusewicz O.
      • Roth W.
      • Li N.
      • Cardoso M.C.
      • Meisterernst M.
      • Leonhardt H.
      Recruitment of RNA polymerase II cofactor PC4 to DNA damage sites.
      ,
      • Mortusewicz O.
      • Evers B.
      • Helleday T.
      PC4 promotes genome stability and DNA repair through binding of ssDNA at DNA damage sites.
      ,
      • Wang J.Y.
      • Sarker A.H.
      • Cooper P.K.
      • Volkert M.R.
      The single-strand DNA binding activity of human PC4 prevents mutagenesis and killing by oxidative DNA damage.
      ).
      Because of their inherent low redox potential, guanine nucleobases have been implicated as sites that are preferentially oxidized during the processes that generate oxidative lesions within DNA (
      • Pratviel G.
      • Meunier B.
      Guanine oxidation: one- and two-electron reactions.
      ). This has led to the hypothesis that G-rich DNA sequences with the capacity to form G4DNA structures upon oxidative damage could function as a molecular beacon that can relay the status of genome integrity and recruit the protein constituents necessary to initiate DNA repair (
      • Fleming A.M.
      • Burrows C.J.
      G-quadruplex folds of the human telomere sequence alter the site reactivity and reaction pathway of guanine oxidation compared to duplex DNA.
      ,
      • Fleming A.M.
      • Zhou J.
      • Wallace S.S.
      • Burrows C.J.
      A role for the fifth G-track in G-quadruplex forming oncogene promoter sequences during oxidative stress: do these “spare tires” have an evolved function?.
      ). Indeed, a recent report has suggested a novel signaling pathway in which DNA sequences that have the capacity to fold into G4 structures are excised from the genome and accumulate in the cytoplasm in response to oxidative damage (
      • Byrd A.K.
      • Zybailov B.L.
      • Maddukuri L.
      • Gao J.
      • Marecki J.C.
      • Jaiswal M.
      • Bell M.R.
      • Griffin W.C.
      • Reed M.R.
      • Chib S.
      • Mackintosh S.G.
      • MacNicol A.M.
      • Baldini G.
      • Eoff R.L.
      • Raney K.D.
      Evidence that G-quadruplex DNA accumulates in the cytoplasm and participates in stress granule assembly in response to oxidative stress.
      ).
      Recent attempts at generating viable homozygous PC4 knock-out mice have been unsuccessful (
      • Swaminathan A.
      • Delage H.
      • Chatterjee S.
      • Belgarbi-Dutron L.
      • Cassel R.
      • Martinez N.
      • Cosquer B.
      • Kumari S.
      • Mongelard F.
      • Lannes B.
      • Cassel J.C.
      • Boutillier A.L.
      • Bouvet P.
      • Kundu T.K.
      Transcriptional coactivator and chromatin protein PC4 is involved in hippocampal neurogenesis and spatial memory extinction.
      ). Additionally, our lab has been unsuccessful in obtaining a viable PC4 knock-out haploid cell line. These results suggest that PC4 is critical for multicellular organismal development. In line with this hypothesis, it has been previously shown that PC4 can serve as a potent suppressor of oxidative DNA damage, and this protective effect is dependent on the ssDNA-binding domain (
      • Mortusewicz O.
      • Evers B.
      • Helleday T.
      PC4 promotes genome stability and DNA repair through binding of ssDNA at DNA damage sites.
      ,
      • Wang J.Y.
      • Sarker A.H.
      • Cooper P.K.
      • Volkert M.R.
      The single-strand DNA binding activity of human PC4 prevents mutagenesis and killing by oxidative DNA damage.
      ). Analogous to the transcriptional dilemma discussed above, the precise mechanism of PC4-mediated suppression of oxidative DNA damage has not been extensively explored, although it is suggested that PC4 is involved in the processes of global and transcription-coupled nucleotide excision repair (
      • Wang J.Y.
      • Sarker A.H.
      • Cooper P.K.
      • Volkert M.R.
      The single-strand DNA binding activity of human PC4 prevents mutagenesis and killing by oxidative DNA damage.
      ). In conclusion, the binding of G4DNA provides yet another novel activity of DNA secondary structure recognition within the functional repertoire of PC4 and could provide additional insight into PC4-related activities that remain incompletely understood.

      Experimental procedures

      Oligonucleotides and purification

      The DNA and oligonucleotides used in this study were purchased from Integrated DNA Technologies (Coralville, IA) and Dharmacon (Lafayette, CO), respectively. The sequences of the oligonucleotides used are presented in Table 1. Before use, the oligonucleotide precipitants were briefly centrifuged and resuspended in storage buffer containing 10 mm Tris-Cl, pH 7.5. A 1:1 mixture of oligonucleotide stock and loading buffer containing 1× TBE, and 90% formamide was purified on denaturing PAGE consisting of 20% acrylamide and 7 m urea for several hours at 15–22 mA. Separated oligonucleotide bands were excised from the gel and were electroeluted. Oligonucleotides were then desalted on a C18 Sep-Pak column purchased from Waters (Milford, MA) and were eluted with 60% methanol. DNA oligonucleotides were then dried via vacuum centrifugation and resuspended in 10 mm Tris-Cl, pH 7.5. Final concentrations of oligonucleotides were quantified by UV absorbance with calculated extinction coefficients.

      Recombinant PC4 expression and purification

      Full-length recombinant PC4 was expressed and purified from the pET11a expression vector as previously described but with slight modifications (
      • Werten S.
      • Stelzer G.
      • Goppelt A.
      • Langen F.M.
      • Gros P.
      • Timmers H.T.
      • Van der Vliet P.C.
      • Meisterernst M.
      Interaction of PC4 with melted DNA inhibits transcription.
      ). Briefly, pET11a-PC4 was transformed into BL21 (DE3) pLysS-competent Escherichia coli cells (Agilent Technologies). Positive transformants were then selected with 100 μg/ml of ampicillin. Recombinant PC4 induction was initiated with 1 mm isopropyl β-d-thiogalactopyranoside and was allowed to continue for 4 h. Induced cultures were harvested via centrifugation at 3000 × g for 30 min at 4 °C. Cell pellets were resuspended and processed in a Dounce homogenizer in lysis buffer (20 mm Tris-Cl, pH 7.3, 1 mm EDTA, 5 mm DTT, 10 mm Na2S2O5, 10% glycerol) supplemented with 500 mm KCl, 1 mm PMSF, and 4 μg/ml pepstatin A, at a volume of 2 ml/gram of cell pellet. Suspended cells were flash frozen in liquid N2, thawed on ice, and then sonicated. Lysis solution was then ultracentrifuged at 148,000 × g for 90 min. The supernatant was diluted to 200 mm KCl with lysis buffer and loaded onto a HiTrapTM heparin-Sepharose column (GE Healthcare). Recombinant PC4 was eluted with lysis buffer supplemented with 500 mm KCl. The PC4 fractions that were the most pure by 15% SDS-PAGE analysis were pooled and diluted with lysis buffer to 75 mm KCl. The PC4 dilution was then loaded onto a HiTrapTM SP-Sepharose strong cation exchange column (GE Healthcare) and eluted with a linear salt gradient from 75 to 1000 mm KCl. Fractions that contained the most pure PC4 were pooled and diluted with lysis buffer again to 75 mm KCl and was loaded onto a ssDNA-cellulose column (Affymetrix). Full-length PC4 was eluted with a linear salt gradient from 75 to 1000 mm KCl. Purified PC4 was concentrated and buffer-exchanged into storage buffer (20 mm HEPES, pH 7.5, 150 mm KCl, 1 mm EDTA, 5 mm DTT, 20% glycerol) with Amicon® Ultra-4 centrifugal filter with a molecular weight cutoff of 3,000 (Millipore). Final concentration of purified protein was determined by UV absorbance at 280 nm with the calculated extinction coefficient, flash frozen in liquid N2, and stored at −80 °C.

      Circular dichroism analysis

      CD analysis was performed on a Jasco J-715 spectropolarimeter. DNA substrates were heated to 95 °C for 10 min and slow cooled to room temperature before analysis. Spectra were recorded at 25 °C with 10 μm DNA in 10 mm Tris-Cl, pH 7.5, with 100 mm salt unless indicated otherwise. Five CD spectra were recorded, averaged, and normalized to the buffer sample without DNA.

      Fluorescence equilibrium binding analysis

      Equilibrium binding analysis was performed with a PerkinElmer Life Sciences Victor3V 1420 multilabel counter with filters set at 485 and 535 nm. Fluorescence polarization measurements were recorded at 25 °C in assay buffer (10 mm Tris-Cl, pH 7.5, 0.1 mm EDTA, 1 mm DTT, 100 mm KCl or 100 mm LiCl, and 0.1 mg/ml bovine serum albumin). 6-Carboxyfluorescein (FAM)-labeled substrates (1 nm final concentration) were titrated with increasing concentrations of protein to measure binding. The FAM-labeled substrate without protein was measured and used to normalize the change in fluorescence polarization observed in the protein-titrated samples. Fluorescence data were plotted as change in anisotropy against protein concentration using Kaleidagraph software (Synergy Software, Reading, PA) and fit to the binding quadratic equation to obtain dissociation constants (Kd).

      Stopped-flow G4 unfolding analysis

      All concentrations listed are final. Cy3-Cy5-c-MYC G4 in PC4 reaction buffer (25 mm Tris-Cl, pH 7.5, 1 mm DTT, and 100 mm KCl) was mixed with 0.2, 1, or 3 μm PC4 in an SX.18MV stopped-flow reaction analyzer (Applied Photophysics). The reaction assay was excited at 550 nm, and FRET signal was detected after a 665-nm cutoff filter (Newport Corp., catalog no. 51330). Pif1 catalyzed G4 unfolding served as the positive control. Cy3-Cy5 c-MYC G4 in Pif1 reaction buffer (25 mm HEPES, pH 7.5, 2 mm β-ME, 10 mm MgCl2, 100 mm KCl, and 5 mm ATP) was mixed with 0.2 μm Pif1 to initiate the reaction.

      Fluorescence quench titration

      Fluorescence quench titrations were performed on a Series 2 Luminescence spectrometer (AMINCO-Bowman). PC4 (1 μm) was titrated with increasing concentrations of c-MYC and T30 and T50 ssDNA substrates (Table 1). Three fluorescence values were recorded after each titration point and averaged. Fluorescence data from each titration point were plotted as a fluorescence ratio FBuff/FDNA (where FBuff is the fluorescence from the buffer titrated sample, and FDNA is the fluorescence of the PC4-DNA complex) versus [DNA]/[PC4] ratio to obtain binding stoichiometry values. The data were fit to two linear equations, and the point of intersection of the two linear equations was calculated.

      G4 multiplex recognition by PC4

      All concentrations are final. Cy3-Cy5-c-MYC duplex and G4 multiplex substrates were annealed following protocols that have been previously reported with modifications (
      • Kreig A.
      • Calvert J.
      • Sanoica J.
      • Cullum E.
      • Tipanna R.
      • Myong S.
      G-quadruplex formation in double strand DNA probed by NMM and CV fluorescence.
      ). Briefly, Cy3-Cy5-c-MYC was annealed to the complementary strand in a 1:1 ratio in buffer (10 mm Tris-Cl, pH 7.5, 100 mm KCl) in the absence or presence of 40% PEG 200 to form the duplex or G4 multiplex structures, respectively. Duplex or G4 multiplex substrates (25 nm) in reaction buffer (20 mm Tris-Cl, pH 7.5, 100 mm KCl, and 4% PEG 200, if indicated) were mixed with 1.5 or 3 μm PC4 under instrumentation conditions that are described for measurements of G4 unfolding.

      Molecular docking simulations with HADDOCK

      Docking simulations were performed with the HADDOCK software package (
      • Dominguez C.
      • Boelens R.
      • Bonvin A.M.
      HADDOCK: a protein-protein docking approach based on biochemical or biophysical information.
      ,
      • van Zundert G.C.
      • Rodrigues J.P.
      • Trellet M.
      • Schmitz C.
      • Kastritis P.L.
      • Karaca E.
      • Melquiond A.S.
      • van Dijk M.
      • de Vries S.J.
      • Bonvin A.M.
      The HADDOCK2.2 Web Server: user-friendly integrative modeling of biomolecular complexes.
      ). The crystal structure of the apo-DNA-binding domain of PC4 (PDB code 1PCF (
      • Brandsen J.
      • Werten S.
      • van der Vliet P.C.
      • Meisterernst M.
      • Kroon J.
      • Gros P.
      C-terminal domain of transcription cofactor PC4 reveals dimeric ssDNA binding site.
      ) and a single NMR model of the G-quadruplex structure from the c-MYC gene promoter were used to determine the ambiguous interaction restraints to drive the docking simulation. The residues in the PC4 DNA-binding domain Arg75, Phe77, Gly79, Lys80, and Trp89 were set as “active” residues. Passive residues were allowed to be defined automatically around the active residues. The free base residues located in the loops of the G-quadruplex DNA structure were set as the active residues with the passive residues automatically defined around the active residues. Docking simulations were run using the default HADDOCK protocol of 1000 rigid body minimization docking simulations, followed by 200 semiflexible refinement simulations and 200 final explicit solvent refinement simulations. The RMSD cutoff for clustering was set at 0.75 fractions of common contacts with a minimum cluster size of 4.

      DMS DNA footprinting

      DMS footprinting reactions were performed in reaction buffer containing 25 mm HEPES, pH 7.6, 100 mm KCl, 5 nm radiolabeled (
      • Byrd A.K.
      • Raney K.D.
      Protein displacement by an assembly of helicase molecules aligned along single-stranded DNA.
      ) G4-multiplex DNA that possessed a 3′ biotin label on the G-rich strand, and where applicable, 4% PEG 200 and 500 nm PC4. DMS was added to a final concentration of 5% to initiate the reaction and was allowed to proceed for 10 s. The reactions were quenched by the addition of a quench solution to a final concentration of 1.2 m β-mercaptoethanol and 166 mm EDTA. Biotinylated DNA samples were then conjugated to M-280 streptavidin-conjugated Dynabeads® (Life Technologies Inc.). Dynabeads were prepared following the protocol for nucleic acid coupling provided by the manufacturer. DNA coupling to the beads was performed at a final concentration of 0.04 mg/ml Dynabeads, 20 mm Tris, pH 7.5, 1 mm EDTA, and 150 mm KCl. Coupling reaction was allowed to proceed for 30 min at room temperature with vortexing. Dynabeads containing the coupled DNA was precipitated with a strong magnet, and the supernatant was aspirated off. The Dynabead-DNA samples were then resuspended in 100 μl of cleavage solution containing 1 m piperidine, 0.1 mm biotin and heated for 30 min at 90 °C. DNA samples were then aspirated from the Dynabeads and evaporated to dryness using a SpeedVac. DNA samples were then resuspended in denaturing loading buffer containing 95% formamide, 0.025% bromphenol blue, and 20 mm EDTA. DNA samples were heated to 90 °C for 10 min and separated on a denaturing 20% polyacrylamide gel with 7 m urea. The samples were visualized on a Typhoon Trio phosphorimaging system and ImageQuant software. The radioactivity of each band representing the guanines involved in G4 formation were corrected for the background. The average corrected radioactivity of triplicate experiments for each band was divided by the total radioactivity in the lane to determine the fractional reactivity.

      Bromine DNA footprinting

      Bromine footprinting reactions with 5 nm DNA, 100 mm KCl, 4% PEG 200 with and without 500 nm PC4 were carried out as previously described with slight modifications (
      • Ross S.A.
      • Burrows C.J.
      Cytosine-specific chemical probing of DNA using bromide and monoperoxysulfate.
      ). Briefly, molecular bromine was generated in situ by the addition of 120 μm KBr followed by addition of 240 μm KHSO5 to initiate the reaction. The reaction was allowed to proceed for 10 min before the reaction was quenched by the addition of 25 mm HEPES, pH 7.5. DNA was precipitated, cleaved with piperidine, and visualized as described above for the DMS footprinting protocol.

      Pif1 unwinding of c-MYC reporter substrate

      All of the concentrations listed are final. 25 nm Pif1 and/or 50 nm PC4 were preincubated on ice with 2 nm radiolabeled c-MYC reporter in Pif1 reaction buffer containing 25 mm HEPES, pH 7.5, 100 mm KCl, 2 mm β-mercaptoethanol, 0.1 mm EDTA, 10 mm MgCl2, and 0.1 mg/ml BSA. The reactions were initiated at 25 °C with 5 mm ATP. The reactions were terminated at various times in sample buffer containing 25 mm Tris-Cl, pH 7.5, 0.1 mm EDTA, and 10% glycerol with 60 nm of unlabeled c-MYC reporter complement and 100 μg/ml of proteinase K. Prior to loading, the quenched samples were spiked with proteinase K to ensure complete proteolysis of Pif1 and PC4. The samples were separated on 15% native PAGE, visualized using a Typhoon Trio phosphorimaging system, and quantified with ImageQuant software (GE Healthcare). The fraction of substrate that was converted to product was determined, and the data were fit to a single exponential equation.

      Author contributions

      All authors designed and conceptualized experiments. W. C. G performed experiments and prepared the manuscript. All authors edited the manuscript.

      Acknowledgments

      We thank Robert L. Eoff and Leslie K. Climer for helpful technical and conceptual discussions.

      Supplementary Material

      References

        • Altieri F.
        • Grillo C.
        • Maceroni M.
        • Chichiarelli S.
        DNA damage and repair: from molecular mechanisms to health implications.
        Antioxid. Redox Signal. 2008; 10: 891-937
        • Maizels N.
        G4-associated human diseases.
        EMBO Rep. 2015; 16: 910-922
        • Murat P.
        • Balasubramanian S.
        Existence and consequences of G-quadruplex structures in DNA.
        Curr. Opin. Genet. Dev. 2014; 25: 22-29
        • Lech C.J.
        • Heddi B.
        • Phan A.T.
        Guanine base stacking in G-quadruplex nucleic acids.
        Nucleic Acids Res. 2013; 41: 2034-2046
        • Lane A.N.
        • Chaires J.B.
        • Gray R.D.
        • Trent J.O.
        Stability and kinetics of G-quadruplex structures.
        Nucleic Acids Res. 2008; 36: 5482-5515
        • Gray R.D.
        • Trent J.O.
        • Chaires J.B.
        Folding and unfolding pathways of the human telomeric G-quadruplex.
        J. Mol. Biol. 2014; 426: 1629-1650
        • Noer S.L.
        • Preus S.
        • Gudnason D.
        • Aznauryan M.
        • Mergny J.L.
        • Birkedal V.
        Folding dynamics and conformational heterogeneity of human telomeric G-quadruplex structures in Na+ solutions by single molecule FRET microscopy.
        Nucleic Acids Res. 2016; 44: 464-471
        • Cayrou C.
        • Ballester B.
        • Peiffer I.
        • Fenouil R.
        • Coulombe P.
        • Andrau J.C.
        • van Helden J.
        • Méchali M.
        The chromatin environment shapes DNA replication origin organization and defines origin classes.
        Genome Res. 2015; 25: 1873-1885
        • Chiarella S.
        • De Cola A.
        • Scaglione G.L.
        • Carletti E.
        • Graziano V.
        • Barcaroli D.
        • Lo Sterzo C.
        • Di Matteo A.
        • Di Ilio C.
        • Falini B.
        • Arcovito A.
        • De Laurenzi V.
        • Federici L.
        Nucleophosmin mutations alter its nucleolar localization by impairing G-quadruplex binding at ribosomal DNA.
        Nucleic Acids Res. 2013; 41: 3228-3239
        • Balasubramanian S.
        • Hurley L.H.
        • Neidle S.
        Targeting G-quadruplexes in gene promoters: a novel anticancer strategy?.
        Nat. Rev. Drug Discov. 2011; 10: 261-275
        • Bugaut A.
        • Balasubramanian S.
        5′-UTR RNA G-quadruplexes: translation regulation and targeting.
        Nucleic Acids Res. 2012; 40: 4727-4741
        • Millevoi S.
        • Moine H.
        • Vagner S.
        G-quadruplexes in RNA biology.
        Wiley Interdiscip. Rev. RNA. 2012; 3: 495-507
        • Tarsounas M.
        • Tijsterman M.
        Genomes and G-quadruplexes: for better or for worse.
        J. Mol. Biol. 2013; 425: 4782-4789
        • Rhodes D.
        • Lipps H.J.
        G-quadruplexes and their regulatory roles in biology.
        Nucleic Acids Res. 2015; 43: 8627-8637
        • Cogoi S.
        • Xodo L.E.
        G4 DNA in ras genes and its potential in cancer therapy.
        Biochim. Biophys. Acta. 2016; 1859: 663-674
        • Ge H.
        • Roeder R.G.
        Purification, cloning, and characterization of a human coactivator, PC4, that mediates transcriptional activation of class II genes.
        Cell. 1994; 78: 513-523
        • Kaiser K.
        • Stelzer G.
        • Meisterernst M.
        The coactivator p15 (PC4) initiates transcriptional activation during TFIIA-TFIID-promoter complex formation.
        EMBO J. 1995; 14: 3520-3527
        • Werten S.
        • Stelzer G.
        • Goppelt A.
        • Langen F.M.
        • Gros P.
        • Timmers H.T.
        • Van der Vliet P.C.
        • Meisterernst M.
        Interaction of PC4 with melted DNA inhibits transcription.
        EMBO J. 1998; 17: 5103-5111
        • Akimoto Y.
        • Yamamoto S.
        • Iida S.
        • Hirose Y.
        • Tanaka A.
        • Hanaoka F.
        • Ohkuma Y.
        Transcription cofactor PC4 plays essential roles in collaboration with the small subunit of general transcription factor TFIIE.
        Genes Cells. 2014; 19: 879-890
        • Wu S.Y.
        • Chiang C.M.
        Properties of PC4 and an RNA polymerase II complex in directing activated and basal transcription in vitro.
        J. Biol. Chem. 1998; 273: 12492-12498
        • Liao M.
        • Zhang Y.
        • Kang J.H.
        • Dufau M.L.
        Coactivator function of positive cofactor 4 (PC4) in Sp1-directed luteinizing hormone receptor (LHR) gene transcription.
        J. Biol. Chem. 2011; 286: 7681-7691
        • Banerjee S.
        • Kumar B.R.
        • Kundu T.K.
        General transcriptional coactivator PC4 activates p53 function.
        Mol. Cell Biol. 2004; 24: 2052-2062
        • Fukuda A.
        • Nakadai T.
        • Shimada M.
        • Tsukui T.
        • Matsumoto M.
        • Nogi Y.
        • Meisterernst M.
        • Hisatake K.
        Transcriptional coactivator PC4 stimulates promoter escape and facilitates transcriptional synergy by GAL4-VP16.
        Mol. Cell Biol. 2004; 24: 6525-6535
        • Wang Z.
        • Roeder R.G.
        DNA topoisomerase I and PC4 can interact with human TFIIIC to promote both accurate termination and transcription reinitiation by RNA polymerase III.
        Mol. Cell. 1998; 1: 749-757
        • Calvo O.
        • Manley J.L.
        Evolutionarily conserved interaction between CstF-64 and PC4 links transcription, polyadenylation, and termination.
        Mol. Cell. 2001; 7: 1013-1023
        • Lewis B.A.
        • Sims 3rd, R.J.
        • Lane W.S.
        • Reinberg D.
        Functional characterization of core promoter elements: DPE-specific transcription requires the protein kinase CK2 and the PC4 coactivator.
        Mol. Cell. 2005; 18: 471-481
        • Malik S.
        • Guermah M.
        • Roeder R.G.
        A dynamic model for PC4 coactivator function in RNA polymerase II transcription.
        Proc. Natl. Acad. Sci. U.S.A. 1998; 95: 2192-2197
        • Pan Z.Q.
        • Ge H.
        • Amin A.A.
        • Hurwitz J.
        Transcription-positive cofactor 4 forms complexes with HSSB (RPA) on single-stranded DNA and influences HSSB-dependent enzymatic synthesis of simian virus 40 DNA.
        J. Biol. Chem. 1996; 271: 22111-22116
        • Mortusewicz O.
        • Roth W.
        • Li N.
        • Cardoso M.C.
        • Meisterernst M.
        • Leonhardt H.
        Recruitment of RNA polymerase II cofactor PC4 to DNA damage sites.
        J. Cell Biol. 2008; 183: 769-776
        • Batta K.
        • Yokokawa M.
        • Takeyasu K.
        • Kundu T.K.
        Human transcriptional coactivator PC4 stimulates DNA end joining and activates DSB repair activity.
        J. Mol. Biol. 2009; 385: 788-799
        • Mortusewicz O.
        • Evers B.
        • Helleday T.
        PC4 promotes genome stability and DNA repair through binding of ssDNA at DNA damage sites.
        Oncogene. 2016; 35: 761-770
        • Das C.
        • Hizume K.
        • Batta K.
        • Kumar B.R.
        • Gadad S.S.
        • Ganguly S.
        • Lorain S.
        • Verreault A.
        • Sadhale P.P.
        • Takeyasu K.
        • Kundu T.K.
        Transcriptional coactivator PC4, a chromatin-associated protein, induces chromatin condensation.
        Mol. Cell Biol. 2006; 26: 8303-8315
        • Das C.
        • Gadad S.S.
        • Kundu T.K.
        Human positive coactivator 4 controls heterochromatinization and silencing of neural gene expression by interacting with REST/NRSF and CoREST.
        J. Mol. Biol. 2010; 397: 1-12
        • Wang J.Y.
        • Sarker A.H.
        • Cooper P.K.
        • Volkert M.R.
        The single-strand DNA binding activity of human PC4 prevents mutagenesis and killing by oxidative DNA damage.
        Mol. Cell Biol. 2004; 24: 6084-6093
        • Batta K.
        • Kundu T.K.
        Activation of p53 function by human transcriptional coactivator PC4: role of protein-protein interaction, DNA bending, and posttranslational modifications.
        Mol. Cell Biol. 2007; 27: 7603-7614
        • Rajagopalan S.
        • Andreeva A.
        • Teufel D.P.
        • Freund S.M.
        • Fersht A.R.
        Interaction between the transactivation domain of p53 and PC4 exemplifies acidic activation domains as single-stranded DNA mimics.
        J. Biol. Chem. 2009; 284: 21728-21737
        • Peng Y.
        • Yang J.
        • Zhang E.
        • Sun H.
        • Wang Q.
        • Wang T.
        • Su Y.
        • Shi C.
        Human positive coactivator 4 is a potential novel therapeutic target in non-small cell lung cancer.
        Cancer Gene Ther. 2012; 19: 690-696
        • Qian D.
        • Zhang B.
        • Zeng X.-L.
        • Le Blanc J.M.
        • Guo Y.-H.
        • Xue C.
        • Jiang C.
        • Wang H.-H.
        • Zhao T.-S.
        • Meng M.-B.
        • Zhao L.-J.
        • Hao J.-H.
        • Wang P.
        • Xie D.
        • Lu B.
        • et al.
        Inhibition of human positive cofactor 4 radiosensitizes human esophageal squmaous cell carcinoma cells by suppressing XLF-mediated nonhomologous end joining.
        Cell Death Dis. 2014; 5: e1461
        • Chen L.
        • Du C.
        • Wang L.
        • Yang C.
        • Zhang J.R.
        • Li N.
        • Li Y.
        • Xie X.D.
        • Gao G.D.
        Human positive coactivator 4 (PC4) is involved in the progression and prognosis of astrocytoma.
        J. Neurol. Sci. 2014; 346: 293-298
        • Kim J.-M.
        • Kim K.
        • Schmidt T.
        • Punj V.
        • Tucker H.
        • Rice J.C.
        • Ulmer T.S.
        • An W.
        Cooperation between SMYD3 and PC4 drives a distinct transcriptional program in cancer cells.
        Nucleic Acids Res. 2015; 43: 8868-8883
        • Tao S.
        • Yu J.
        • Xu Y.
        • Deng B.
        • Sun T.
        • Hu P.
        • Wei Z.
        • Zhang J.
        • Wang R.
        • Shi C.
        • Tan Q.
        PC4 induces lymphangiogenesis dependent VEGF-C/VEGF-D/VEGFR-3 axis activation in lung adenocarcinoma.
        Am. J. Cancer Res. 2015; 5: 1878-1889
        • Chakravarthi B.V.
        • Goswami M.T.
        • Pathi S.S.
        • Robinson A.D.
        • Cieślik M.
        • Chandrashekar D.S.
        • Agarwal S.
        • Siddiqui J.
        • Daignault S.
        • Carskadon S.L.
        • Jing X.
        • Chinnaiyan A.M.
        • Kunju L.P.
        • Palanisamy N.
        • Varambally S.
        MicroRNA-101 regulated transcriptional modulator SUB1 plays a role in prostate cancer.
        Oncogene. 2016; 35: 6330-6340
        • Dhanasekaran K.
        • Kumari S.
        • Boopathi R.
        • Shima H.
        • Swaminathan A.
        • Bachu M.
        • Ranga U.
        • Igarashi K.
        • Kundu T.K.
        Multifunctional human transcriptional coactivator protein PC4 is a substrate of Aurora kinases and activates the Aurora enzymes.
        FEBS J. 2016; 283: 968-985
        • de la Cruz O.H.
        • Muñiz-Lino M.
        • Guillén N.
        • Weber C.
        • Marchat L.A.
        • López-Rosas I.
        • Ruíz-García E.
        • Astudillo-de la Vega H.
        • Fuentes-Mera L.
        • Álvarez-Sánchez E.
        • Mendoza-Hernández G.
        • López-Camarillo C.
        Proteomic profiling reveals that EhPC4 transcription factor induces cell migration through up-regulation of the 16-kDa actin-binding protein EhABP16 in Entamoeba histolytica.
        J. Proteomics. 2014; 111: 46-58
        • Hernández de la Cruz O.
        • Marchat L.A.
        • Guillén N.
        • Weber C.
        • LópezRosas I.
        • Díaz-Chávez J.
        • Herrera L.
        • Rojo-Domínguez A.
        • Orozco E.
        • López-Camarillo C.
        Multinucleation and polykaryon formation is promoted by the EhPC4 transcription factor in Entamoeba histolytica.
        Sci. Rep. 2016; 6: 19611
        • Brandsen J.
        • Werten S.
        • van der Vliet P.C.
        • Meisterernst M.
        • Kroon J.
        • Gros P.
        C-terminal domain of transcription cofactor PC4 reveals dimeric ssDNA binding site.
        Nat. Struct. Biol. 1997; 4: 900-903
        • Werten S.
        • Moras D.
        A global transcription cofactor bound to juxtaposed strands of unwound DNA.
        Nat. Struct. Mol. Biol. 2006; 13: 181-182
        • Werten S.
        • Wechselberger R.
        • Boelens R.
        • van der Vliet P.C.
        • Kaptein R.
        Identification of the single-stranded DNA binding surface of the transcriptional coactivator PC4 by NMR.
        J. Biol. Chem. 1999; 274: 3693-3699
        • Werten S.
        • Langen F.W.
        • van Schaik R.
        • Timmers H.T.
        • Meisterernst M.
        • van der Vliet P.C.
        High-affinity DNA binding by the C-terminal domain of the transcriptional coactivator PC4 requires simultaneous interaction with two opposing unpaired strands and results in helix destabilization.
        J. Mol. Biol. 1998; 276: 367-377
        • Gao J.
        • Zybailov B.L.
        • Byrd A.K.
        • Griffin W.C.
        • Chib S.
        • Mackintosh S.G.
        • Tackett A.J.
        • Raney K.D.
        Yeast transcription co-activator Sub1 and its human homolog PC4 preferentially bind to G-quadruplex DNA.
        Chem. Commun. (Camb.). 2015; 51: 7242-7244
        • Mathad R.I.
        • Hatzakis E.
        • Dai J.
        • Yang D.
        C-MYC promoter G-quadruplex formed at the 5′-end of NHE III 1 element: Insights into biological relevance and parallel-stranded G-quadruplex stability.
        Nucleic Acids Res. 2011; 39: 9023-9033
        • Mergny J.-L.
        • Lacroix L.
        • Teulade-Fichou M.-P.
        • Hounsou C.
        • Guittat L.
        • Hoarau M.
        • Arimondo P.B.
        • Vigneron J.-P.
        • Lehn J.-M.
        • Riou J.-F.
        • Garestier T.
        • Hélène C.
        Telomerase inhibitors based on quadruplex ligands selected by a fluorescence assay.
        Proc. Natl. Acad. Sci. 2001; 98: 3062-3067
        • Eddy S.
        • Ketkar A.
        • Zafar M.K.
        • Maddukuri L.
        • Choi J.-Y.
        • Eoff R.L.
        Human Rev1 polymerase disrupts G-quadruplex DNA.
        Nucleic Acids Res. 2014; 42: 3272-3285
        • Byrd A.K.
        • Raney K.D.
        A parallel quadruplex DNA is bound tightly but unfolded slowly by Pif1 helicase.
        J. Biol. Chem. 2015; 290: 6482-6494
        • Sanders C.M.
        Human Pif1 helicase is a G-quadruplex DNA-binding protein with G-quadruplex DNA-unwinding activity.
        Biochem. J. 2010; 430: 119-128
        • Paeschke K.
        • Bochman M.L.
        • Garcia P.D.
        • Cejka P.
        • Friedman K.L.
        • Kowalczykowski S.C.
        • Zakian V.A.
        Pif1 family helicases suppress genome instability at G-quadruplex motifs.
        Nature. 2013; 497: 458-462
        • Zhou R.
        • Zhang J.
        • Bochman M.L.
        • Zakian V.A.
        • Ha T.
        Periodic DNA patrolling underlies diverse functions of Pif1 on R-loops and G-rich DNA.
        Elife. 2014; 3: e02190
        • Gray L.T.
        • Vallur A.C.
        • Eddy J.
        • Maizels N.
        G quadruplexes are genomewide targets of transcriptional helicases XPB and XPD.
        Nat. Chem. Biol. 2014; 10: 313-318
        • Walker J.M.
        DNA-Protein Interactions. 2nd Ed. Humana Press, Totowa, NJ2009
        • Dominguez C.
        • Boelens R.
        • Bonvin A.M.
        HADDOCK: a protein-protein docking approach based on biochemical or biophysical information.
        J. Am. Chem. Soc. 2003; 125: 1731-1737
        • van Zundert G.C.
        • Rodrigues J.P.
        • Trellet M.
        • Schmitz C.
        • Kastritis P.L.
        • Karaca E.
        • Melquiond A.S.
        • van Dijk M.
        • de Vries S.J.
        • Bonvin A.M.
        The HADDOCK2.2 Web Server: user-friendly integrative modeling of biomolecular complexes.
        J. Mol. Biol. 2016; 428: 720-725
        • Gao M.
        • Skolnick J.
        New benchmark metrics for protein-protein docking methods.
        Proteins. 2011; 4: 1623-1634
        • Zheng K.W.
        • Chen Z.
        • Hao Y.H.
        • Tan Z.
        Molecular crowding creates an essential environment for the formation of stable G-quadruplexes in long double-stranded DNA.
        Nucleic Acids Res. 2010; 38: 327-338
        • Kreig A.
        • Calvert J.
        • Sanoica J.
        • Cullum E.
        • Tipanna R.
        • Myong S.
        G-quadruplex formation in double strand DNA probed by NMM and CV fluorescence.
        Nucleic Acids Res. 2015; 43: 7961-7970
        • Sun D.
        • Hurley L.H.
        Biochemical techniques for the characterization of G-quadruplex structures: EMSA, DMS footprinting, and DNA polymerase stop assay.
        Methods Mol. Biol. 2010; 608: 65-79
        • Kypr J.
        • Kejnovská I.
        • Renciuk D.
        • Vorlícková M.
        Circular dichroism and conformational polymorphism of DNA.
        Nucleic Acids Res. 2009; 37: 1713-1725
        • Conesa C.
        • Acker J.
        Sub1/PC4 a chromatin associated protein with multiple functions in transcription.
        RNA Biol. 2010; 7: 287-290
        • Ray S.
        • Qureshi M.H.
        • Malcolm D.W.
        • Budhathoki J.B.
        • Celik U.
        • Balci H.
        RPA-mediated unfolding of systematically varying G-quadruplex structures.
        Biophys. J. 2013; 104: 2235-2245
        • Safa L.
        • Gueddouda N.M.
        • Thiébaut F.
        • Delagoutte E.
        • Petruseva I.
        • Lavrik O.
        • Mendoza O.
        • Bourdoncle A.
        • Alberti P.
        • Riou J.-F.
        • Saintomé C.
        5′ to 3′ unfolding directionality of DNA secondary structures by replication protein A: G-quadruplexes and duplexes.
        J. Biol. Chem. 2016; 291: 21246-21256
        • Compe E.
        • Egly J.-M.
        Nucleotide excision repair and transcriptional regulation: TFIIH and beyond.
        Annu. Rev. Biochem. 2016; 85: 265-290
        • Zhang C.
        • Liu H.H.
        • Zheng K.W.
        • Hao Y.H.
        • Tan Z.
        DNA G-quadruplex formation in response to remote downstream transcription activity: long-range sensing and signal transducing in DNA double helix.
        Nucleic Acids Res. 2013; 41: 7144-7152
        • Tang W.
        • Robles A.I.
        • Beyer R.P.
        • Gray L.T.
        • Nguyen G.H.
        • Oshima J.
        • Maizels N.
        • Harris C.C.
        • Monnat R.J.
        The Werner syndrome RECQ helicase targets G4 DNA in human cells to modulate transcription.
        Hum. Mol. Genet. 2016; 25: 2060-2069
        • Fukuda A.
        • Tokonabe S.
        • Hamada M.
        • Matsumoto M.
        • Tsukui T.
        • Nogi Y.
        • Hisatake K.
        Alleviation of PC4-mediated transcriptional repression by the ERCC3 helicase activity of general transcription factor TFIIH.
        J. Biol. Chem. 2003; 278: 14827-14831
        • Pratviel G.
        • Meunier B.
        Guanine oxidation: one- and two-electron reactions.
        Chemistry. 2006; 12: 6018-6030
        • Fleming A.M.
        • Burrows C.J.
        G-quadruplex folds of the human telomere sequence alter the site reactivity and reaction pathway of guanine oxidation compared to duplex DNA.
        Chem. Res. Toxicol. 2013; 26: 593-607
        • Fleming A.M.
        • Zhou J.
        • Wallace S.S.
        • Burrows C.J.
        A role for the fifth G-track in G-quadruplex forming oncogene promoter sequences during oxidative stress: do these “spare tires” have an evolved function?.
        ACS Cent. Sci. 2015; 1: 226-233
        • Byrd A.K.
        • Zybailov B.L.
        • Maddukuri L.
        • Gao J.
        • Marecki J.C.
        • Jaiswal M.
        • Bell M.R.
        • Griffin W.C.
        • Reed M.R.
        • Chib S.
        • Mackintosh S.G.
        • MacNicol A.M.
        • Baldini G.
        • Eoff R.L.
        • Raney K.D.
        Evidence that G-quadruplex DNA accumulates in the cytoplasm and participates in stress granule assembly in response to oxidative stress.
        J. Biol. Chem. 2016; 291: 18041-18057
        • Swaminathan A.
        • Delage H.
        • Chatterjee S.
        • Belgarbi-Dutron L.
        • Cassel R.
        • Martinez N.
        • Cosquer B.
        • Kumari S.
        • Mongelard F.
        • Lannes B.
        • Cassel J.C.
        • Boutillier A.L.
        • Bouvet P.
        • Kundu T.K.
        Transcriptional coactivator and chromatin protein PC4 is involved in hippocampal neurogenesis and spatial memory extinction.
        J. Biol. Chem. 2016; 291: 20303-20314
        • Byrd A.K.
        • Raney K.D.
        Protein displacement by an assembly of helicase molecules aligned along single-stranded DNA.
        Nat. Struct. Mol. Biol. 2004; 11: 531-538
        • Ross S.A.
        • Burrows C.J.
        Cytosine-specific chemical probing of DNA using bromide and monoperoxysulfate.
        Nucleic Acids Res. 1996; 24: 5062-5063