Introduction
Results
VDR and pCREB are bound upstream of the Cyp27b1 gene in a kidney-specific manner
- Malecki J.
- Aileni V.K.
- Ho A.Y.Y.
- Schwarz J.
- Moen A.
- Sørensen V.
- Nilges B.S.
- Jakobsson M.E.
- Leidel S.A.
- Falnes P.


VDR and pCREB are localized to active enhancers in the introns of Mettl1 and Mettl21b

Deletion of the pCREB/VDR enhancers results in phenotypically unique strains of mice


Endocrine control of Cyp27b1 expression is altered in M1-IKO and M21-IKO kidneys

Basal suppression of kidney Cyp27b1 causes secondary suppression of Cyp24a1 and Vdr

Basal suppression of Cyp27b1 expression in M1-IKO but not M21-IKO kidneys results in altered vitamin D metabolite levels

Repressive abilities of the intronic Mettl21b enhancer

Regulation of Cyp27b1 expression in NRTCs is functionally unique from the kidney


Cyp27b1 locus in TPTG tissue contains signatures of both NRTCs and renal cells
Discussion

- International Multiple Sclerosis Genetics Consortium, Wellcome Trust Case Control Consortium 2
- Sawcer S.
- Hellenthal G.
- Pirinen M.
- Spencer C.C.
- Patsopoulos N.A.
- Moutsianas L.
- Dilthey A.
- Su Z.
- Freeman C.
- Hunt S.E.
- Edkins S.
- Gray E.
- Booth D.R.
- et al.
- Raychaudhuri S.
- Remmers E.F.
- Lee A.T.
- Hackett R.
- Guiducci C.
- Burtt N.P.
- Gianniny L.
- Korman B.D.
- Padyukov L.
- Kurreeman F.A.
- Chang M.
- Catanese J.J.
- Ding B.
- Wong S.
- van der Helm-van Mil A.H.
- et al.
- Alcina A.
- Fedetz M.
- Fernández O.
- Saiz A.
- Izquierdo G.
- Lucas M.
- Leyva L.
- García-León J.A.
- Abad-Grau Mdel M.
- Alloza I.
- Antigüedad A.
- Garcia-Barcina M.J.
- Vandenbroeck K.
- Varadé J.
- de la Hera B.
- et al.
Experimental procedures
Reagents
Gene expression
Sequence-based reagents | Sequence/source | Ref. |
---|---|---|
TaqMan primers | ||
Gapdh | Applied Biosystems | 4352339E |
Cyp27b1 | Applied Biosystems | Mm01165918 |
Cyp24a1 | Applied Biosystems | Mm00487244 |
Vdr | Applied Biosystems | Mm00437297 |
Mettl1 | Applied Biosystems | Mm00487686 |
Mettl21b | Applied Biosystems | Mm01165909 |
Tspan31 | Applied Biosystems | Mm00482543 |
Tsfm | Applied Biosystems | Mm00508436 |
March9 | Applied Biosystems | Mm01165913 |
Cdk4 | Applied Biosystems | Mm00726334 |
Primers for CRISPR | ||
M1-IKO Guide 1 | GATTAGTTGACCTTTCCTCCTGG | This paper |
M1-IKO Guide 2 | CAGGAACTCCAGACCATGAGAGG | This paper |
M21-IKO Guide 1 | CCTACCTTCCCGCTACTGTTGGG | This paper |
M21-IKO Guide 2 | CCCTTCCTTAGGGACTTCATGGG | This paper |
Primers for genotyping | ||
C27KO KO-F | ACTTTTCTGATTCAGGGATGAAGGTTTAGC | This paper |
C27KO KO-R | GAAGGAGGGCAGATTAGATATTCTAGGATGC | This paper |
C27KO WT-F | CTCCTGCCAGAGTCTATCCCTG | This paper |
C27KO WT-R | GAAGGAGGGCAGATTAGATATTCTAGGATGC | This paper |
M1-IKO spanF | AGTGGAGTTTGCAGACATAGGCT | This paper |
M1-IKO spanR | TTACCTGTCTATAGGGAAGATG | This paper |
M1-IKO internalF | TCTACTCTGGGTCTGTGGCCTT | This paper |
M1-IKO internalR | AGCTAGACAGAACAACCGGGG | This paper |
M21-IKO spanF | TTCCTCCACTGAGACAAGAGTTA | This paper |
M21-IKO spanR | CCTTGCTACTTTCCAACAGCCTGCCT | This paper |
M21-IKO internalF | ATGTATCCTCTCCCTCCTGAACA | This paper |
M21-IKO internalR | CCCCATACAATAGGGTTTCTCTCTG | This paper |
ChIP followed by sequencing (ChIP-seq)
CRISPR-generated and transgenic mice
Animal studies
Western blot analysis
Blood chemistry
Quantification of serum vitamin D metabolites
- Kaufmann M.
- Gallagher J.C.
- Peacock M.
- Schlingmann K.P.
- Konrad M.
- DeLuca H.F.
- Sigueiro R.
- Lopez B.
- Mourino A.
- Maestro M.
- St-Arnaud R.
- Finkelstein J.S.
- Cooper D.P.
- Jones G.
BMD and μCT analysis
Immunohistochemistry
T cell activation
Statistical evaluation
Author contributions
Acknowledgments
Author Profile
Mark B. Meyer
References
- Overview of general physiologic features and functions of vitamin D.Am. J. Clin. Nutr. 2004; 80: 1689S-1696S
- Cytochrome P450-mediated metabolism of vitamin D.J. Lipid Res. 2014; 55: 13-31
- 25-Hydroxyvitamin D-24-hydroxylase (CYP24A1): its important role in the degradation of vitamin D.Arch. Biochem. Biophys. 2012; 523: 9-18
- Extrarenal expression of the 25-hydroxyvitamin D-1-hydroxylase.Arch. Biochem. Biophys. 2012; 523: 95-102
- Vitamin D metabolism and function in the skin.Mol. Cell. Endocrinol. 2011; 347: 80-89
- Parathyroid hormone as a trophic hormone for 1,25-dihydroxyvitamin D3, the metabolically active form of vitamin D.N. Engl. J. Med. 1972; 287: 250-251
- Control of 25-hydroxycholecalciferol metabolism by parathyroid glands.Proc. Natl. Acad. Sci. U.S.A. 1972; 69: 1673-1676
- Rat renal 25-hydroxyvitamin D3 1- and 24-hydroxylases: their in vivo regulation.Am. J. Physiol. 1984; 246: E168-E173
- FGF-23 is a potent regulator of vitamin D metabolism and phosphate homeostasis.J. Bone Miner. Res. 2004; 19: 429-435
- Targeted ablation of Fgf23 demonstrates an essential physiological role of FGF23 in phosphate and vitamin D metabolism.J. Clin. Invest. 2004; 113: 561-568
- 1,25-Dihydroxyvitamin D3 induces 25-hydroxyvitamin D3–24-hydroxylase in a cultured monkey kidney cell line (LLC-MK2) apparently deficient in the high affinity receptor for the hormone.J. Biol. Chem. 1984; 259: 2214-2222
- Two vitamin D response elements function in the rat 1,25-dihydroxyvitamin D24-hydroxylase promoter.J. Biol. Chem. 1995; 270: 1675-1678
- Skeletal secretion of FGF-23 regulates phosphate and vitamin D metabolism.Nat. Rev. Endocrinol. 2012; 8: 276-286
- A high-calcium and phosphate rescue diet and VDR-expressing transgenes normalize serum vitamin D metabolite profiles and renal Cyp27b1 and Cyp24a1 expression in VDR null mice.Endocrinology. 2015; 156: 4388-4397
- Hormonal regulation of 25-hydroxyvitamin D3–1α-hydroxylase and 24-hydroxylase gene transcription in opossum kidney cells.Arch. Biochem. Biophys. 2003; 409: 298-304
- Genomic determinants of vitamin D-regulated gene expression.Vitam. Horm. 2016; 100: 21-44
- Initial FGF23-mediated signaling occurs in the distal convoluted tubule.J. Am. Soc. Nephrol. 2009; 20: 955-960
- Characterization of FGF23-dependent Egr-1 cistrome in the mouse renal proximal tubule.PLoS ONE. 2015; 10: e0142924
- Epigenetic plasticity drives adipogenic and osteogenic differentiation of marrow-derived mesenchymal stem cells.J. Biol. Chem. 2016; 291: 17829-17847
- Regulation of mouse Cyp24a1 expression via promoter-proximal and downstream-distal enhancers highlights new concepts of 1,25-dihydroxyvitamin D(3) action.Arch. Biochem. Biophys. 2012; 523: 2-8
- Characterizing early events associated with the activation of target genes by 1,25-dihydroxyvitamin D3 in mouse kidney and intestine in vivo.J. Biol. Chem. 2007; 282: 22344-22352
- The tRNA methylase METTL1 is phosphorylated and inactivated by PKB and RSK in vitro and in cells.EMBO J. 2005; 24: 1696-1705
- The novel lysine specific methyltransferase METTL21B affects mRNA translation through inducible and dynamic methylation of Lys-165 in human eukaryotic elongation factor 1α (eEF1A).Nucleic Acids Res. 2017; 45: 4370-4389
- Mapping and analysis of chromatin state dynamics in nine human cell types.Nature. 2011; 473: 43-49
- Targeted ablation of the vitamin D receptor: an animal model of vitamin D-dependent rickets type II with alopecia.Proc. Natl. Acad. Sci. U.S.A. 1997; 94: 9831-9835
- Targeted inactivation of the 25-hydroxyvitamin D(3)-1(α)-hydroxylase gene (CYP27B1) creates an animal model of pseudovitamin D-deficiency rickets.Endocrinology. 2001; 142: 3135-3141
- An encyclopedia of mouse DNA elements (Mouse ENCODE).Genome Biol. 2012; 13: 418
- Enhancer-derived RNA: a primer.Genomics Proteomics Bioinformatics. 2017; 15: 196-200
- CTCF: an architectural protein bridging genome topology and function.Nat. Rev. Genet. 2014; 15: 234-246
- A CTCF Code for 3D genome architecture.Cell. 2015; 162: 703-705
- Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization.Cell. 2017; 169: 930-944
- Multiplex genome engineering using CRISPR/Cas systems.Science. 2013; 339: 819-823
- Fibroblast growth factor 23 regulation by systemic and local osteoblast-synthesized 1,25-dihydroxyvitamin D.J. Am. Soc. Nephrol. 2017; 28: 586-597
- Regulation of the murine renal vitamin D receptor by 1,25-dihydroxyvitamin D3 and calcium.Proc. Natl. Acad. Sci. U.S.A. 2003; 100: 9733-9737
- Biosynthesis, purification and receptor binding properties of high specific radioactivity 1α, 24(R),25-trihydroxy-[26,27-methyl-3H]-vitamin D3.J. Steroid Biochem. 1982; 16: 303-310
- Intestinal calcium-binding protein (CaBP) and bone calcium mobilization in response to 1,24(R),25-(OH)3D3. Comparative effects of 1,25-(OH)2D3 and 24(R),25-(OH)2D3 in rats.Mol. Pharmacol. 1980; 17: 362-366
- Fibroblast growth factor 23 is a counter-regulatory phosphaturic hormone for vitamin D.J. Am. Soc. Nephrol. 2006; 17: 1305-1315
- 1,25-Dihydroxyvitamin D and Klotho: a tale of two renal hormones coming of age.Vitam. Horm. 2016; 100: 165-230
- Temporal changes in tissue 1α,25-dihydroxyvitamin D3, vitamin D receptor target genes, and calcium and PTH levels after 1,25(OH)2D3 treatment in mice.Am. J. Physiol. Endocrinol. Metab. 2013; 304: E977-E989
- Role of FGF23 in vitamin D and phosphate metabolism: implications in chronic kidney disease.Exp. Cell Res. 2012; 318: 1040-1048
- Vitamin D and innate and adaptive immunity.Vitam. Horm. 2011; 86: 23-62
- Regulation of the extrarenal CYP27B1-hydroxylase.J. Steroid Biochem. Mol. Biol. 2014; 144: 22-27
- Distribution and regulation of the 25-hydroxyvitamin D3 1α-hydroxylase in human parathyroid glands.J. Steroid. Biochem. Mol. Biol. 2012; 130: 73-80
- 25-hydroxyvitamin D(3)-1α-hydroxylase expression in normal and pathological parathyroid glands.J. Clin. Endocrinol. Metab. 2002; 87: 2967-2972
- Deletion of the vitamin D receptor specifically in the parathyroid demonstrates a limited role for the receptor in parathyroid physiology.Am. J. Physiol. Renal. Physiol. 2009; 297: F1192-F1198
- Extra-renal 25-hydroxyvitamin D3–1α-hydroxylase in human health and disease.J. Steroid. Biochem. Mol. Biol. 2007; 103: 316-321
- Vitamin D and energy homeostasis–of mice and men.Nat. Rev. Endocrinol. 2014; 10: 79-87
- Comparative analysis of nutritional guidelines for vitamin D.Nat. Rev. Endocrinol. 2017; 13: 466-479
- Optimal vitamin D supplementation strategies.Endocrine. 2017; 56: 225-226
- 1,25-Dihydroxyvitamin D3 reversibly blocks the progression of relapsing encephalomyelitis, a model of multiple sclerosis.Proc. Natl. Acad. Sci. U.S.A. 1996; 93: 7861-7864
- The role of vitamin D in reducing cancer risk and progression.Nat. Rev. Cancer. 2014; 14: 342-357
- Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis.Nature. 2011; 476: 214-219
- Common variants at CD40 and other loci confer risk of rheumatoid arthritis.Nat. Genet. 2008; 40: 1216-1223
- Rare variants in the CYP27B1 gene are associated with multiple sclerosis.Ann. Neurol. 2011; 70: 881-886
- Confirmation of association between multiple sclerosis and CYP27B1.Eur. J. Hum. Genet. 2010; 18: 1349-1352
- Identification of a functional variant in the KIF5A-CYP27B1-METTL1-FAM119B locus associated with multiple sclerosis.J. Med. Genet. 2013; 50: 25-33
- The multiple sclerosis-associated regulatory variant rs10877013 affects expression of CYP27B1 and VDR under inflammatory or vitamin D stimuli.Mult. Scler. 2016; 22: 999-1006
- The RUNX2 cistrome in osteoblasts: characterization, down-regulation following differentiation, and relationship to gene expression.J. Biol. Chem. 2014; 289: 16016-16031
- VISTA: computational tools for comparative genomics.Nucleic Acids Res. 2004; 32: W273-W279
- Selective regulation of Mmp13 by 1,25(OH)2D3, PTH, and Osterix through distal enhancers.J. Steroid Biochem. Mol. Biol. 2016; 164: 258-264
- One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.Cell. 2013; 153: 910-918
- Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.Proc. Natl. Acad. Sci. U.S.A. 2010; 107: 15022-15026
- Deletion of the distal Tnfsf11 RL-D2 enhancer that contributes to PTH-mediated RANKL expression in osteoblast lineage cells results in a high bone mass phenotype in mice.J. Bone Miner. Res. 2016; 31: 416-429
- Development of hybridomas secreting monoclonal antibodies to the chicken intestinal 1 α,25-dihydroxyvitamin D3 receptor.Proc. Natl. Acad. Sci. U.S.A. 1982; 79: 7719-7723
- Clinical utility of simultaneous quantitation of 25-hydroxyvitamin D and 24,25-dihydroxyvitamin D by LC-MS/MS involving derivatization with DMEQ-TAD.J. Clin. Endocrinol. Metab. 2014; 99: 2567-2574
- Bioengineering anabolic vitamin D-25-hydroxylase activity into the human vitamin D catabolic enzyme, cytochrome P450 CYP24A1, by a V391L mutation.J. Biol. Chem. 2011; 286: 28729-28737
- Characterizing antibody cross-reactivity for immunoaffinity purification of analytes prior to multiplexed liquid chromatography-tandem mass spectrometry.Clin. Chem. 2012; 58: 1711-1716
- Improved screening test for idiopathic infantile hypercalcemia confirms residual levels of serum 24,25-(OH)2D3 in affected patients.J. Bone Miner. Res. 2017; 32: 1589-1596
- Guidelines for assessment of bone microstructure in rodents using micro-computed tomography.J. Bone Miner. Res. 2010; 25: 1468-1486
- Inhibin A is an endocrine stimulator of bone mass and strength.Endocrinology. 2007; 148: 1654-1665
Article info
Publication history
Footnotes
This work was supported by the Department of Biochemistry, University of Wisconsin-Madison, and University of Wisconsin Carbone Cancer Center Support Grant P30 CA014520 from the National Institutes of Health. The authors declare that they have no conflicts of interest with the contents of this article. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
This article was selected as one of our Editors' Picks.
Identification
Copyright
User license
Creative Commons Attribution (CC BY 4.0) |
Permitted
- Read, print & download
- Redistribute or republish the final article
- Text & data mine
- Translate the article
- Reuse portions or extracts from the article in other works
- Sell or re-use for commercial purposes
Elsevier's open access license policy