Advertisement

Phosphorylation of proliferating cell nuclear antigen promotes cancer progression by activating the ATM/Akt/GSK3β/Snail signaling pathway

  • Bo Peng
    Affiliations
    Department of Basic Medical Sciences, Tsinghua University School of Medicine, Beijing, China 100084 and
    Search for articles by this author
  • Janice Ortega
    Affiliations
    Department of Radiation Oncology, University of Texas Southwestern Medical Center, Dallas, Texas 75390
    Search for articles by this author
  • Liya Gu
    Affiliations
    Department of Radiation Oncology, University of Texas Southwestern Medical Center, Dallas, Texas 75390
    Search for articles by this author
  • Zhijie Chang
    Affiliations
    Department of Basic Medical Sciences, Tsinghua University School of Medicine, Beijing, China 100084 and
    Search for articles by this author
  • Guo-Min Li
    Correspondence
    Holder of the Reece A. Overcash, Jr. Chair for Research on Colon Cancer. To whom correspondence should be addressed. Tel.:214-648-9955; Fax:214-648-5995
    Affiliations
    Department of Radiation Oncology, University of Texas Southwestern Medical Center, Dallas, Texas 75390
    Search for articles by this author
  • Author Footnotes
    2 The abbreviations used are: PCNAproliferating cell nuclear antigenEGFRepidermal growth factor receptorEMTepithelial-mesenchymal transitionDEGsdifferentially expressed genesGSEAgene set enrichment analysisIPAIngenuity Pathway AnalysisATMataxia telangiectasia, mutatedGSK3βglycogen synthase kinase 3 βDOXdoxycycline.
Open AccessPublished:April 26, 2019DOI:https://doi.org/10.1074/jbc.RA119.007897
      Proliferating cell nuclear antigen (PCNA) and its posttranslational modifications regulate DNA metabolic reactions, including DNA replication and repair, at replication forks. PCNA phosphorylation at Tyr-211 (PCNA-Y211p) inhibits DNA mismatch repair and induces misincorporation during DNA synthesis. Here, we describe an unexpected role of PCNA-Y211p in cancer promotion and development. Cells expressing phosphorylation-mimicking PCNA, PCNA-Y211D, show elevated hallmarks specific to the epithelial-mesenchymal transition (EMT), including the up-regulation of the EMT-promoting factor Snail and the down-regulation of EMT-inhibitory factors E-cadherin and GSK3β. The PCNA-Y211D–expressing cells also exhibited active cell migration and underwent G2/M arrest. Interestingly, all of these EMT-associated activities required the activation of ATM and Akt kinases, as inactivating these protein kinases by gene knockdown or inhibitors blocked EMT-associated signaling and cell migration. We concluded that PCNA phosphorylation promotes cancer progression via the ATM/Akt/GSK3β/Snail signaling pathway. In conclusion, this study identifies a novel PCNA function and reveals the molecular basis of phosphorylated PCNA-mediated cancer development and progression.

      Introduction

      Proliferating cell nuclear antigen (PCNA)
      The abbreviations used are: PCNA
      proliferating cell nuclear antigen
      EGFR
      epidermal growth factor receptor
      EMT
      epithelial-mesenchymal transition
      DEGs
      differentially expressed genes
      GSEA
      gene set enrichment analysis
      IPA
      Ingenuity Pathway Analysis
      ATM
      ataxia telangiectasia, mutated
      GSK3β
      glycogen synthase kinase 3 β
      DOX
      doxycycline.
      is a ring-shaped homotrimeric DNA clamp that is essential for many cellular processes, including DNA replication and DNA repair (
      • Stoimenov I.
      • Helleday T.
      PCNA on the Crossroad of Cancer.
      ,
      • Moldovan G.-L.
      • Pfander B.
      • Jentsch S.
      PCNA, the maestro of the replication fork.
      • Mailand N.
      • Gibbs-Seymour I.
      • Bekker-Jensen S.
      Regulation of PCNA–protein interactions for genome stability.
      ). The roles of PCNA in these processes are largely regulated through its posttranslational modifications. One of PCNA’s modifications is its phosphorylation at tyrosine 211 (Tyr-211) by epidermal growth factor receptor (EGFR), whose overexpression and/or activation is associated with a variety of cancers and their progression (
      • Markowitz S.D.
      • Bertagnolli M.M.
      Molecular basis of colorectal cancer.
      • Gullick W.
      Prevalence of aberrant expression of the epidermal growth factor receptor in human cancers.
      ,
      • Libermann T.A.
      • Nusbaum H.R.
      • Razon N.
      • Kris R.
      • Lax I.
      • Soreq H.
      • Whittle N.
      • Waterfield M.D.
      • Ullrich A.
      • Schlessinger J.
      Amplification, enhanced expression and possible rearrangement of EGF receptor gene in primary human brain tumours of glial origin.
      ,
      • Salomon D.S.
      • Brandt R.
      • Ciardiello F.
      • Normanno N.
      Epidermal growth factor-related peptides and their receptors in human malignancies.
      • Tillotson J.K.
      • Rose D.P.
      Endogenous secretion of epidermal growth factor peptides stimulates growth of DU145 prostate cancer cells.
      ). Tyr-211–phosphorylated PCNA has been shown to increase the half-life of PCNA and facilitate cell proliferation (
      • Wang S.-C.
      • Nakajima Y.
      • Yu Y.-L.
      • Xia W.
      • Chen C.-T.
      • Yang C.-C.
      • McIntush E.W.
      • Li L.-Y.
      • Hawke D.H.
      • Kobayashi R.
      • Hung M.-C.
      Tyrosine phosphorylation controls PCNA function through protein stability.
      ).
      PCNA is an essential component of the initiation and resynthesis reactions of DNA mismatch repair (
      • Umar A.
      • Buermeyer A.B.
      • Simon J.A.
      • Thomas D.C.
      • Clark A.B.
      • Liskay R.M.
      • Kunkel T.A.
      Requirement for PCNA in DNA mismatch repair at a step preceding DNA resynthesis.
      ,
      • Gu L.
      • Hong Y.
      • McCulloch S.
      • Watanabe H.
      • Li G.-M.
      ATP-dependent interaction of human mismatch repair proteins and dual role of PCNA in mismatch repair.
      • Kadyrov F.A.
      • Dzantiev L.
      • Constantin N.
      • Modrich P.
      Endonucleolytic function of MutLα in human mismatch repair.
      ), a critical cellular mechanism that ensures genome stability primarily by correcting mispairs generated during DNA replication (
      • Li G.-M.
      Mechanisms and functions of DNA mismatch repair.
      ). However, we recently demonstrated that Tyr-211–phosphorylated PCNA not only inhibits DNA mismatch repair, but also induces nucleotide misincorporation during DNA synthesis, leading to a hypermutator phenotype (
      • Ortega J.
      • Li J.Y.
      • Lee S.
      • Tong D.
      • Gu L.
      • Li G.M.
      Phosphorylation of PCNA by EGFR inhibits mismatch repair and promotes misincorporation during DNA synthesis.
      ). This hypermutability may give tumor cells more flexibility to adapt to new environments during progression. EGFR overexpression and activation promote tumor cell motility and invasion (
      • Lu Z.
      • Jiang G.
      • Blume-Jensen P.
      • Hunter T.
      Epidermal growth factor-induced tumor cell invasion and metastasis initiated by dephosphorylation and downregulation of focal adhesion kinase.
      ,
      • Weinberg R.A.
      The Biology of Cancer.
      ), and both EGFR and PCNA have been used as diagnostic and prognostic markers for many tumors (
      • Malkas L.H.
      • Herbert B.S.
      • Abdel-Aziz W.
      • Dobrolecki L.E.
      • Liu Y.
      • Agarwal B.
      • Hoelz D.
      • Badve S.
      • Schnaper L.
      • Arnold R.J.
      • Mechref Y.
      • Novotny M.V.
      • Loehrer P.
      • Goulet R.J.
      • Hickey R.J.
      A cancer-associated PCNA expressed in breast cancer has implications as a potential biomarker.
      • Ben-Izhak O.
      • Bar-Chana M.
      • Sussman L.
      • Dobiner V.
      • Sandbank J.
      • Cagnano M.
      • Cohen H.
      • Sabo E.
      Ki67 antigen and PCNA proliferation markers predict survival in anorectal malignant melanoma.
      ,
      • Juríková M.
      • Danihel Š.
      • Polák Š.
      • Varga I.
      Ki67, PCNA, and MCM proteins: Markers of proliferation in the diagnosis of breast cancer.
      ,
      • Korpanty G.J.
      • Graham D.M.
      • Vincent M.D.
      • Leighl N.B.
      Biomarkers that currently affect clinical practice in lung cancer: EGFR, ALK, MET, ROS-1, and KRAS.
      ,
      • Grandis J.R.
      • Tweardy D.J.
      Elevated levels of transforming growth factor α and epidermal growth factor receptor messenger RNA are early markers of carcinogenesis in head and neck cancer.
      • Rubin Grandis J.
      • Melhem M.F.
      • Gooding W.E.
      • Day R.
      • Holst V.A.
      • Wagener M.M.
      • Drenning S.D.
      • Tweardy D.J.
      Levels of TGF-α and EGFR protein in head and neck squamous cell carcinoma and patient survival.
      ), indicating that they both promote tumor progression. We therefore hypothesized that EGFR’s tumor promotion/progression activity is executed, at least in part, through activities triggered by PCNA-Y211 phosphorylation.
      To test this hypothesis, we used an inducible Tet-On system to express phosphorylation-mimicking or nonphosphorylation-mimicking PCNA in HeLa cells, and we analyzed the resulting cells for cancer progression. We demonstrate here that cells expressing phosphorylation-mimicking PCNA, a Tyr-211 to Asp-211 substitution (PCNA-Y211D or PCNA-YD), exhibit characteristics of the epithelial-mesenchymal transition (EMT), including the up-regulation of EMT-promoting factor Snail and the down-regulation of EMT-inhibitory factors E-cadherin and GSK3β. Accordingly, these cells exhibit active cell migration and undergo G2/M arrest. Strikingly, all of these EMT-associated events require the activation of ATM and Akt. This study, therefore, has identified a novel function for Tyr-211–phosphorylated PCNA in promoting cancer metastasis by activating the ATM/Akt/GSK3β/Snail signaling pathway.

      Results

      Phosphorylated PCNA promotes cell migration

      We have shown previously that phosphorylation-mimicking PCNA-YD and nonphosphorylation-mimicking PCNA-Y211F (PCNA-YF) function equivalently to natively phosphorylated and nonphosphorylated PCNAs, respectively, in mismatch repair assays in vitro (
      • Ortega J.
      • Li J.Y.
      • Lee S.
      • Tong D.
      • Gu L.
      • Li G.M.
      Phosphorylation of PCNA by EGFR inhibits mismatch repair and promotes misincorporation during DNA synthesis.
      ). To determine the tumorigenic activity of Tyr-211–phosphorylated PCNA, we used the Tet-On 3G inducible system (
      • Abe T.
      • Branzei D.
      High levels of BRC4 induced by a Tet-On 3G system suppress DNA repair and impair cell proliferation in vertebrate cells.
      ,
      • Das A.T.
      • Tenenbaum L.
      • Berkhout B.
      Tet-On systems for doxycycline-inducible gene expression.
      ) and CRISPR/Cas9 technology (
      • Cong L.
      • Ran F.A.
      • Cox D.
      • Lin S.L.
      • Barretto R.
      • Habib N.
      • Hsu P.D.
      • Wu X.B.
      • Jiang W.Y.
      • Marraffini L.A.
      • Zhang F.
      Multiplex genome engineering using CRISPR/Cas systems.
      ,
      • Ran F.A.
      • Hsu P.D.
      • Wright J.
      • Agarwala V.
      • Scott D.A.
      • Zhang F.
      Genome engineering using the CRISPR-Cas9 system.
      ), and successfully knocked in a 9.8-kb DNA sequence coding for FLAG-tagged PCNA-WT, PCNA-YD, or PCNA-YF into the AAVS1 locus in HeLa cells (Fig. 1A), as described previously (
      • Sadelain M.
      • Papapetrou E.P.
      • Bushman F.D.
      Safe harbours for the integration of new DNA in the human genome.
      ,
      • Smith J.R.
      • Maguire S.
      • Davis L.A.
      • Alexander M.
      • Yang F.
      • Chandran S.
      • ffrench-Constant C.
      • Pedersen R.A.
      Robust, persistent transgene expression in human embryonic stem cells is achieved with AAVS1-targeted integration.
      • González F.
      • Zhu Z.
      • Shi Z.D.
      • Lelli K.
      • Verma N.
      • Li Q.V.
      • Huangfu D.
      An iCRISPR platform for rapid, multiplexable, and inducible genome editing in human pluripotent stem cells.
      ). Western blot analysis showed that the resulting cell lines, designated HeLa-PCNAWT, HeLa-PCNAYD, and HeLa-PCNAYF, express the expected PCNA isoforms (Fig. 1, B and C), respectively, while still retaining the native PCNA (Fig. 1B).
      Figure thumbnail gr1
      Figure 1Phosphorylated PCNA promotes cell migration. A, schematic diagram showing the knocking-in (KI) locus at AAVS1 and the composition of the inducible FLAG-tagged PCNA gene, whose expression is controlled by the Tet-On 3G system containing the CAG constitutive synthetic promoter (CAG Pr), the Tet-On 3G transactivator protein (Tet-on 3G), the third generation of the tetracycline response element (TRE3G), the self-cleaving F2A peptide (F2A), and the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). B and C, Western blot analysis demonstrating expression of the individual forms of PCNA using an antibody against PCNA (B) and the FLAG tag (C). D, GSEA of the DEG in PCNAYD cells, which reveals the enrichment of the EMT hallmarks. The x axis shows the rank order of genes, from the most up-regulated to the most down-regulated, between HeLa-PCNAYD and HeLa-PCNAWT cells. The barcode indicates the position of related genes in the ranking list. The y axis shows the distribution of the running enrichment score generated by walking down the list of ranked genes. E and F, transwell cell migration assay showing statistical analysis of the assay results (E) and representative images of migrated cells after crystal violet staining (scale bar, 100 μm) (F). The results are expressed as the mean ± S.D. of three independent experiments; ns, not significant. ****, p < 0.0001.
      To explore the mechanism by which phosphorylated PCNA promotes tumor progression, we conducted RNA-Seq in cells expressing PCNA-WT and PCNA-YD, then performed a genome-wide analysis of differentially expressed genes (DEGs). These analyses identified 4088 DEGs (Log2|-fold change| >0, Padj <0.05). The gene set enrichment analysis (GSEA), a high-throughput method that yields a functional profile of the gene or protein set involved in a biological process (
      • Subramanian A.
      • Tamayo P.
      • Mootha V.K.
      • Mukherjee S.
      • Ebert B.L.
      • Gillette M.A.
      • Paulovich A.
      • Pomeroy S.L.
      • Golub T.R.
      • Lander E.S.
      • Mesirov J.P.
      Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles.
      ,
      • Mootha V.K.
      • Lindgren C.M.
      • Eriksson K.-F.
      • Subramanian A.
      • Sihag S.
      • Lehar J.
      • Puigserver P.
      • Carlsson E.
      • Ridderstråle M.
      • Laurila E.
      • Houstis N.
      • Daly M.J.
      • Patterson N.
      • Mesirov J.P.
      • Golub T.R.
      • et al.
      PGC-1α-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes.
      ), revealed a gene set related to EMT hallmarks (NES = 2.15, FDRq = 0.002) as a top candidate (Fig. 1D). We, therefore, hypothesized that phosphorylated PCNA promotes EMT. We performed a transwell migration assay (
      • Ying T.-H.
      • Lee C.-H.
      • Chiou H.-L.
      • Yang S.-F.
      • Lin C.-L.
      • Hung C.-H.
      • Tsai J.-P.
      • Hsieh Y.-H.
      Knockdown of Pentraxin 3 suppresses tumorigenicity and metastasis of human cervical cancer cells.
      ,
      • Valster A.
      • Tran N.L.
      • Nakada M.
      • Berens M.E.
      • Chan A.Y.
      • Symons M.
      Cell migration and invasion assays.
      • Shaw L.M.
      Tumor cell invasion assays.
      ). The results indeed showed that cells expressing PCNA-YD exhibit a strong migrating activity, as significantly more HeLa-PCNAYD cells migrated from the upper chamber to the lower chamber than any of the control cell lines (HeLa, HeLa-PCNAWT, or PCNAYF) (Fig. 1, E and F).

      Up-regulation of Snail is associated with phosphorylated PCNA-mediated EMT

      Transcription factor Snail is an important driving factor of EMT, as it represses the expression of E-cadherin, a transmembrane glycoprotein that connects epithelial cells together at adherens junctions to prevent EMT (
      • Zhou B.P.
      • Deng J.
      • Xia W.
      • Xu J.
      • Li Y.M.
      • Gunduz M.
      • Hung M.-C.
      Dual regulation of Snail by GSK-3β-mediated phosphorylation in control of epithelial-mesenchymal transition.
      • Hanahan D.
      • Weinberg R.A.
      Hallmarks of cancer: The next generation.
      ,
      • Wang Y.
      • Shi J.
      • Chai K.
      • Ying X.
      • Zhou B.P.
      The role of Snail in EMT and tumorigenesis.
      • Berx G.
      • van Roy F.
      Involvement of members of the cadherin superfamily in cancer.
      ). To determine if Snail and E-cadherin are involved in PCNA-YD–promoted EMT, we performed Western blotting experiments and showed that the protein level of Snail in PCNAYD cells is at least 41% more than in nonphosphorylated control cells (Fig. 2A). Also, little E-cadherin was detected in PCNAYD cells, but the protein was relatively abundant in all three control cell lines (Fig. 2A). To determine whether the up-regulated Snail is responsible for the observed EMT in PCNAYD cells, we knocked down Snail expression using an shRNA. As expected, partial depletion of Snail was associated with increased expression of E-cadherin (Fig. 2B). The transwell migration assay revealed that Snail knockdown dramatically reduced the cell migration capability of PCNAYD cells (Fig. 2, C and D). We, therefore, conclude that phosphorylated PCNA promotes EMT via up-regulating transcription factor Snail.
      Figure thumbnail gr2
      Figure 2Up-regulation of Snail in cells expressing PCNA-YD. A, Western blot analysis showing up-regulation of Snail and down-regulation of E-cadherin in HeLa-PCNAYD cells. B, Western blot analysis showing the expression of Snail and E-cadherin in Snail knockdown cells. C and D, transwell cell migration assay showing HeLa-PCNAYD cells’ reduced migration ability, with (C) being representative cell migration images and (D) being statistical analysis of the migration assay. The data represent the mean ± S.D. from three independent experiments. ****, p < 0.0001.

      Up-regulation of Snail in PCNAYD cells is mediated through the PI3K/Akt pathway

      To determine the molecular basis by which Snail is up-regulated in HeLa-PCNAYD cells, we conducted Ingenuity Pathway Analysis (IPA) of the DEG profile, as described (
      • Jimánez-Marín Á.
      • Collado-Romero M.
      • Ramirez-Boo M.
      • Arce C.
      • Garrido J.J.
      Biological pathway analysis by ArrayUnlock and Ingenuity Pathway Analysis.
      ,
      • Zhao D.
      • Lu X.
      • Wang G.
      • Lan Z.
      • Liao W.
      • Li J.
      • Liang X.
      • Chen J.R.
      • Shah S.
      • Shang X.
      • Tang M.
      • Deng P.
      • Dey P.
      • Chakravarti D.
      • Chen P.
      • et al.
      Synthetic essentiality of chromatin remodelling factor CHD1 in PTEN-deficient cancer.
      ). Among the top seven canonical pathways identified that are unique to PCNAYD cells, as opposed to PCNAWT cells, we found that the phosphatidylinositol 3-kinase (PI3K)/Akt pathway is the most active one, with a positive Z-score of 1.81 (Fig. 3A), suggesting that the PI3K/Akt pathway is associated with PCNA-YD–mediated EMT. We also compared the IPA data in PCNAYD cells with those in HeLa and HeLa-PCNAYF cells and plotted the enrichment scores as a heat map in Fig. 3B. The results showed that activation of the PI3K/Akt signaling pathway was the most enriched.
      Figure thumbnail gr3
      Figure 3Activation of ATM and Akt is essential for PCNA-YD-mediated EMT. A, identification of the PI3K/Akt signaling pathway as the most enriched pathway in HeLa-PCNAYD cells using the Ingenuity Pathway Analysis. The Z-score (orange bar) shows pathway enrichment prediction, with positive Z-score values representing up-regulation and negative Z-score values representing down-regulation. The −log (p value) (blue bar) indicates the statistical significance of a given pathway. B, heat map showing the differential enrichment of top signaling pathways in PCNA-YD compared with control cells. C, Western blots demonstrating the association of phosphorylation and activation of ATM and Akt with PCNA-YD-mediated EMT. D, Western blots showing that PI3K/Akt kinase inhibitor wortmannin blocks ATM/Akt activation and downstream signaling events required for EMT. E and F, transwell cell migration assay showing (E) inhibition by wortmannin of PCNA-YD-mediated EMT in HeLa-PCNAYD cells and (F) statistical analysis of the transwell migration assays. The data represent the mean ± S.D. from three independent experiments. ****, p < 0.0001.
      ATM (ataxia telangiectasia, mutated), a PI3K-related kinase, has been shown to promote cancer metastasis via stabilizing Snail (
      • Sun M.
      • Guo X.
      • Qian X.
      • Wang H.
      • Yang C.
      • Brinkman K.L.
      • Serrano-Gonzalez M.
      • Jope R.S.
      • Zhou B.
      • Engler D.A.
      • Zhan M.
      • Wong S.T.
      • Fu L.
      • Xu B.
      Activation of the ATM-Snail pathway promotes breast cancer metastasis.
      ). It is also known that the PI3K/Akt pathway down-regulates glycogen synthase kinase 3 β (GSK3β) and up-regulates Snail (
      • Grille S.J.
      • Bellacosa A.
      • Upson J.
      • Klein-Szanto A.J.
      • van Roy F.
      • Lee-Kwon W.
      • Donowitz M.
      • Tsichlis P.N.
      • Larue L.
      The protein kinase Akt induces epithelial mesenchymal transition and promotes enhanced motility and invasiveness of squamous cell carcinoma lines.
      • Lee Y.J.
      • Han H.J.
      Troglitazone ameliorates high glucose-induced EMT and dysfunction of SGLTs through PI3K/Akt, GSK-3β, Snail1, and β-catenin in renal proximal tubule cells.
      ,
      • Martini M.
      • De Santis M.C.
      • Braccini L.
      • Gulluni F.
      • Hirsch E.
      PI3K/AKT signaling pathway and cancer: An updated review.
      ,
      • Vanhaesebroeck B.
      • Guillermet-Guibert J.
      • Graupera M.
      • Bilanges B.
      The emerging mechanisms of isoform-specific PI3K signalling.
      • Liu L.
      • Dai Y.
      • Chen J.
      • Zeng T.
      • Li Y.
      • Chen L.
      • Zhu Y.-H.
      • Li J.
      • Li Y.
      • Ma S.
      • Xie D.
      • Yuan Y.-F.
      • Guan X.-Y.
      Maelstrom promotes hepatocellular carcinoma metastasis by inducing epithelial-mesenchymal transition by way of Akt/GSK-3 beta/Snail signaling.
      ). We hypothesized that these molecules (ATM, Akt, GSK-3β, and Snail) lie in the phosphorylated PCNA-mediated EMT signaling pathway. Upon inducing PCNA molecules by doxycycline (DOX), we analyzed cell lysates from various PCNA-expressing cells for activation of ATM and Akt, as well as up- and down-regulation of Snail and GSK3β, respectively. As shown in Fig. 3C, PCNAYD cells, but not the three control cell lines (HeLa, PCNAWT, and PCNAYF), expressed a high level of Ser-1981–phosphorylated ATM (active form). Increased phosphorylation of both Akt (Ser-473, active form) and GSK3β (Ser-9, inactive form) was also observed in cells expressing PCNA-YD, but not in the three control cell lines (Fig. 3C). Accordingly, high levels of Snail were associated with these phenomena (Fig. 3C). To verify the involvement of ATM signaling in PCNA-YD–promoted EMT, we treated cells with wortmannin, a PI3K-Akt pathway inhibitor (
      • Weber A.M.
      • Ryan A.J.
      ATM and ATR as therapeutic targets in cancer.
      ,
      • Paull T.T.
      • Rogakou E.P.
      • Yamazaki V.
      • Kirchgessner C.U.
      • Gellert M.
      • Bonner W.M.
      A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage.
      • Sarkaria J.N.
      • Tibbetts R.S.
      • Busby E.C.
      • Kennedy A.P.
      • Hill D.E.
      • Abraham R.T.
      Inhibition of phosphoinositide 3-kinase related kinases by the radiosensitizing agent wortmannin.
      ). We found that wortmannin treatment dramatically reduced the phosphorylation levels of ATM, Akt, and GSK3β (Fig. 3D). We also observed a dramatic reduction in Snail expression (Fig. 3D). In contrast, the treatment led to an increase in E-cadherin expression (Fig. 3D). Consistent with these anti-EMT phenomena, the transwell migration assay showed that wortmannin treatment blocked PCNAYD cells’ ability to migrate (Fig. 3, E and F). These results strongly suggest that the EMT in PCNAYD cells is processed through the PI3K/Akt/GSK3β/Snail signaling axis.
      We examined this idea further with experiments that directly inactivated ATM. First, we knocked down the expression of ATM in HeLa-PCNAYD cells using shRNAs against ATM and measured their EMT-related activities. The results showed a 45% reduction in ATM in PCNAYD cells (Fig. 4A). This partial reduction in ATM essentially blocked Akt activation. As expected, the knockdown was also associated with increased expression of GSK3β and decreased expression of Snail (Fig. 4A). More importantly, the partial depletion of ATM substantially reduced PCNAYD cells’ migration capacity (Fig. 4, B and C). Second, we treated HeLa-PCNAYD cells with KU-55933, an ATM-specific inhibitor. As expected, KU-55933 treatment inactivated ATM and blocked the downstream EMT process, much like what we observed in ATM knockdown cells (Fig. 4, D–F). We, therefore, conclude that the ATM/Akt/GSK3β/Snail signaling axis executes phosphorylated PCNA-mediated EMT.
      Figure thumbnail gr4
      Figure 4ATM activation is required for PCNA-YD-mediated EMT. A, Western blots showing the expression of EMT-related molecules in HeLa-PCNAYD cells with ATM knockdown. B and C, transwell cell migration assay showing reduced migration activity of HeLa-PCNAYD cells with ATM knockdown, with (B) being representative cell migration images and (C) being statistical analysis of transwell migration assays. The data represent the mean ± S.D. from three independent experiments. D, Western blots showing the expression of EMT-related molecules in HeLa-PCNAYD cells in the presence of ATM inhibitor KU-55933. E and F, transwell cell migration assay showing reduced migration activity of HeLa-PCNAYD cells in the presence of an ATM inhibitor, with (E) being representative cell migration images and (F) being statistical analysis of the transwell migration assays. The data represent the mean ± S.D. from three independent experiments. ***, p < 0.001; ****, p < 0.0001.

      Cells expressing PCNA-YD arrest at G2/M

      It is well-documented that EMT is associated with G2/M cell cycle arrest (
      • Lovisa S.
      • LeBleu V.S.
      • Tampe B.
      • Sugimoto H.
      • Vadnagara K.
      • Carstens J.L.
      • Wu C.-C.
      • Hagos Y.
      • Burckhardt B.C.
      • Pentcheva-Hoang T.
      • Nischal H.
      • Allison J.P.
      • Zeisberg M.
      • Kalluri R.
      Epithelial-to-mesenchymal transition induces cell cycle arrest and parenchymal damage in renal fibrosis.
      ), although the cause and effect relationship is unclear. We therefore analyzed cell cycle distribution in cells expressing individual forms of PCNA. The results showed that all three control cell lines (HeLa, HeLa-PCNAWT, and HeLa-PCNAYF) demonstrated essentially the same pattern of cell cycle phases, but the pattern in PCNAYD cells is visibly different from that of the control cells (Fig. 5, A and B), as PCNAYD cells show more than twice (35% versus 17%) as many G2/M cells as each of the control cell lines (Fig. 5C), suggesting a G2/M arrest in PCNAYD cells. Morphologically, many PCNAYD cells exhibit a much larger nucleus (see red arrows) than control cells in Hoechst stain (Fig. 5D), indicating abnormal mitotic division in PCNAYD cells. Consistent with this assumption, PCNAYD cells contained a higher percentage of cells with a DNA content greater than 4N, compared with control cells. The production of these abnormal nuclei appears to depend on phosphorylated PCNA, because the percentage of cells with an abnormal nucleus is proportional to the length of DOX treatment (Fig. 5E). We then analyzed Cdc2 and Cdc25C, both of which are hallmarks of G2/M arrest (
      • Shiloh Y.
      ATM and ATR: Networking cellular responses to DNA damage.
      ,
      • Sanchez Y.
      • Wong C.
      • Thoma R.S.
      • Richman R.
      • Wu Z.
      • Piwnica-Worms H.
      • Elledge S.J.
      Conservation of the Chk1 checkpoint pathway in mammals: Linkage of DNA damage to Cdk regulation through Cdc25.
      • Hoffmann I.
      The role of Cdc25 phosphatases in cell cycle checkpoints.
      ). We observed high levels of phosphorylated Cdc2 (Tyr-15) and phosphorylated Cdc25C (Ser-216) in PCNAYD cells (Fig. 5F). Correspondingly, we detected phosphorylation of Chk1 and Chk2, downstream substrates of activated ATR and ATM, respectively, and upstream kinases of Cdc25C, in PCNAYD cells. These results indicate that PCNA phosphorylation–induced EMT is associated with G2/M arrest, which is probably triggered through the ATM/ATR signaling pathway (
      • Shiloh Y.
      ATM and ATR: Networking cellular responses to DNA damage.
      ,
      • Sanchez Y.
      • Wong C.
      • Thoma R.S.
      • Richman R.
      • Wu Z.
      • Piwnica-Worms H.
      • Elledge S.J.
      Conservation of the Chk1 checkpoint pathway in mammals: Linkage of DNA damage to Cdk regulation through Cdc25.
      • Hoffmann I.
      The role of Cdc25 phosphatases in cell cycle checkpoints.
      ). However, given the fact many PCNAYD cells underwent nuclear degradation when treated with an ATR inhibitor (Fig. S1), we believe that ATR activation in HeLa-PCNAYD cells is unrelated to EMT, but it is essential for cell survival and other cellular functions (
      • Kabeche L.
      • Nguyen H.D.
      • Buisson R.
      • Zou L.
      A mitosis-specific and R loop–driven ATR pathway promotes faithful chromosome segregation.
      ,
      • Yazinski S.A.
      • Zou L.
      Functions, regulation, and therapeutic implications of the ATR checkpoint pathway.
      ).
      Figure thumbnail gr5
      Figure 5Cells expressing PCNA-YD display G2/M arrest and abnormal cell division. A, percentage of cell cycle distribution in cells expressing individual PCNA isoforms, as indicated. The data represent the mean ± S.D. of three independent experiments. B, representative flow cytometry data showing more G2/M fraction in PCNAYD cells. C, quantification of G2/M fraction in cells expressing various PCNA isoforms, revealing significantly higher G2/M phase in PCNAYD cells than in other cells. D, representative cell images of the individual PCNA cells that were visualized by the bright field, tdTomato, and Hoechst staining methods, as indicated. Arrows point abnormally divided cells with a DNA content more than 4N. E, the percentage of individual PCNA cells showing abnormal DNA ploidy. The data represent the mean ± S.D. of three independent determinations. F, Western blots showing hallmark molecules (pCdc25C and pCdc2) associated with G2/M arrest. Note: F used the same patch of samples used in C, and the blot showing pATM (the kinase for Chk2) was from C. ****, p < 0.0001.

      Discussion

      PCNA is a critical cell proliferation factor that orchestrates essentially all metabolic reactions at the replication fork, including DNA replication and DNA repair (
      • Stoimenov I.
      • Helleday T.
      PCNA on the Crossroad of Cancer.
      ,
      • Moldovan G.-L.
      • Pfander B.
      • Jentsch S.
      PCNA, the maestro of the replication fork.
      • Mailand N.
      • Gibbs-Seymour I.
      • Bekker-Jensen S.
      Regulation of PCNA–protein interactions for genome stability.
      ). PCNA can be phosphorylated at Tyr-211 by tumor-promoting factor EGFR (
      • Wang S.-C.
      • Nakajima Y.
      • Yu Y.-L.
      • Xia W.
      • Chen C.-T.
      • Yang C.-C.
      • McIntush E.W.
      • Li L.-Y.
      • Hawke D.H.
      • Kobayashi R.
      • Hung M.-C.
      Tyrosine phosphorylation controls PCNA function through protein stability.
      ). We have shown previously that Tyr-211–phosphorylated PCNA inhibits DNA mismatch repair and induces nucleotide misincorporation during DNA synthesis, thereby inducing a mutator phenotype (
      • Ortega J.
      • Li J.Y.
      • Lee S.
      • Tong D.
      • Gu L.
      • Li G.M.
      Phosphorylation of PCNA by EGFR inhibits mismatch repair and promotes misincorporation during DNA synthesis.
      ). Interestingly, like EGFR, PCNA is also used as a diagnostic and prognostic marker for tumors (
      • Malkas L.H.
      • Herbert B.S.
      • Abdel-Aziz W.
      • Dobrolecki L.E.
      • Liu Y.
      • Agarwal B.
      • Hoelz D.
      • Badve S.
      • Schnaper L.
      • Arnold R.J.
      • Mechref Y.
      • Novotny M.V.
      • Loehrer P.
      • Goulet R.J.
      • Hickey R.J.
      A cancer-associated PCNA expressed in breast cancer has implications as a potential biomarker.
      • Ben-Izhak O.
      • Bar-Chana M.
      • Sussman L.
      • Dobiner V.
      • Sandbank J.
      • Cagnano M.
      • Cohen H.
      • Sabo E.
      Ki67 antigen and PCNA proliferation markers predict survival in anorectal malignant melanoma.
      ,
      • Juríková M.
      • Danihel Š.
      • Polák Š.
      • Varga I.
      Ki67, PCNA, and MCM proteins: Markers of proliferation in the diagnosis of breast cancer.
      ,
      • Korpanty G.J.
      • Graham D.M.
      • Vincent M.D.
      • Leighl N.B.
      Biomarkers that currently affect clinical practice in lung cancer: EGFR, ALK, MET, ROS-1, and KRAS.
      ,
      • Grandis J.R.
      • Tweardy D.J.
      Elevated levels of transforming growth factor α and epidermal growth factor receptor messenger RNA are early markers of carcinogenesis in head and neck cancer.
      • Rubin Grandis J.
      • Melhem M.F.
      • Gooding W.E.
      • Day R.
      • Holst V.A.
      • Wagener M.M.
      • Drenning S.D.
      • Tweardy D.J.
      Levels of TGF-α and EGFR protein in head and neck squamous cell carcinoma and patient survival.
      ), but the underlying mechanism of tumor progression is unclear. In this study, we provide evidence that Tyr-211–phosphorylated PCNA promotes EMT.
      We revealed the involvement of phosphorylated PCNA in EMT through a gene set enrichment analysis of RNA-Seq data derived from cells expressing individual isoforms of PCNA examined in this study, which identified molecular hallmarks specific to EMT in PCNAYD cells (Fig. 1D). Consistent with this prediction, we found that PCNAYD cells indeed display EMT characteristics. First, these cells exhibit a migration activity that is much more active than that of control cells (Fig. 1, E and F); second, EMT-promoting factor Snail and EMT-inhibitory factor E-cadherin are up- and down-regulated, respectively (Fig. 2A), in PCNAYD cells; and third, Snail knockdown prevents PCNAYD cells from migrating (Fig. 2, C and D). We show that Snail-mediated EMT appears to be activated by the PI3K/Akt signaling pathway. Evidence supporting this notion initially came from the IPA of the DEG’s profile, where the PI3K/Akt signaling pathway shows the most active one in PCNAYD cells. Correspondingly, we found that PCNAYD cells, but not control cells, expressed high levels of activated ATM and Akt (Fig. 3C). The activation of ATM and Akt is coupled with the down-regulation of GSK3β and the up-regulation of Snail (Fig. 3C). Inhibition of the ATM/Akt signaling pathway by wortmannin, KU-55933, or ATM knockdown blocks the up-regulation and down-regulation of Snail and GSK3β (Figs. 3D and 4, A and D), respectively, as well as the migration activity of PCNAYD cells (Figs. 3E and 4, B and E).
      On the basis of previously published data and the results presented here, we propose a signaling cascade for PCNA phosphorylation–induced EMT (Fig. 6). It has been shown that phosphorylated PCNA inhibits DNA mismatch repair and induces misincorporation during DNA synthesis (
      • Ortega J.
      • Li J.Y.
      • Lee S.
      • Tong D.
      • Gu L.
      • Li G.M.
      Phosphorylation of PCNA by EGFR inhibits mismatch repair and promotes misincorporation during DNA synthesis.
      ); cells with phosphorylated PCNA make numerous errors during replication. Even though the molecular basis underlying phosphorylated PCNA–induced misincorporation is unclear, it has been postulated that the modified PCNA recruits an error-prone translesion polymerase to carry out DNA synthesis (
      • Ortega J.
      • Li J.Y.
      • Lee S.
      • Tong D.
      • Gu L.
      • Li G.M.
      Phosphorylation of PCNA by EGFR inhibits mismatch repair and promotes misincorporation during DNA synthesis.
      ). The nonprocessive nature of translesion polymerases can lead to a severe delay in DNA replication. Although the delay in replication induces G2/M arrest, both the replication errors and the delays cause replication stress to activate the ATM-mediated DNA damage response. The activated ATM, which also facilitates G2/M arrest (
      • Shiloh Y.
      ATM and ATR: Networking cellular responses to DNA damage.
      ), then triggers a cascade of signaling reactions, which mediate phosphorylations of Akt, GSK3β, and Snail to promote EMT (
      • Sun M.
      • Guo X.
      • Qian X.
      • Wang H.
      • Yang C.
      • Brinkman K.L.
      • Serrano-Gonzalez M.
      • Jope R.S.
      • Zhou B.
      • Engler D.A.
      • Zhan M.
      • Wong S.T.
      • Fu L.
      • Xu B.
      Activation of the ATM-Snail pathway promotes breast cancer metastasis.
      ).
      Figure thumbnail gr6
      Figure 6A proposed signaling cascade for phosphorylated PCNA-promoted EMT. Phosphorylated PCNA causes abnormal DNA replication and replication stress because of its role in mediating error-prone DNA synthesis, which activates the ATM DNA damage response pathway, leading to G2/M cell cycle arrest. The activated ATM then triggers a cascade of signaling reactions that mediates the phosphorylation of Akt, GSK3β, and Snail in favor of EMT. Blue and red arrows represent down-regulation and up-regulation, respectively.
      However, there are many uncertainties. Although activation of the ATM/ATR DNA damage response pathway can trigger G2/M cell cycle arrest (
      • Shiloh Y.
      ATM and ATR: Networking cellular responses to DNA damage.
      ), recent studies also suggest that the process of EMT induces G2/M arrest (
      • Sarkaria J.N.
      • Tibbetts R.S.
      • Busby E.C.
      • Kennedy A.P.
      • Hill D.E.
      • Abraham R.T.
      Inhibition of phosphoinositide 3-kinase related kinases by the radiosensitizing agent wortmannin.
      ). It is well-established that genomic instability can lead to polyploidy/aneuploidy, which can result from G2/M arrest and abnormal cell division, leading to cancer development and progression (
      • Storchova Z.
      • Pellman D.
      From polyploidy to aneuploidy, genome instability and cancer.
      ). Thus, whether the G2/M arrest observed in HeLa-PCNAYD cells is induced by replication stress–activated ATM signaling or is a result of EMT is unknown. It is possible that these processes mutually promote each other. Another big question concerns the exact abnormal event or signal generated by the phosphorylated PCNA–mediated reaction at the replication fork that triggers the ATM/Akt signaling pathway to promote EMT. Future studies are required to address these important questions.

      Experimental procedures

      Cell culture and materials

      HeLa and HeLa knock-in cell lines were cultured in DMEM with 10% FBS at 37 °C in a humidified atmosphere with 5% (v/v) CO2. To induce the expression of the knock-in PCNA, cells were treated with 1.0 μg/ml of DOX for 4 days. When present, the concentration of KU55933 (Selleck, S1092) or wortmannin (Selleck, S2758) used was 10 μm or 2 μm, respectively.
      The following antibodies and chemicals were purchased commercially: anti-PCNA (Santa Cruz Biotechnology, sc-56); anti-α-tubulin (Bioeasy, BE0031); anti-FLAG tag (Bioeasy, BE2004); anti-E-cadherin (Santa Cruz Biotechnology, sc-8426); anti-Snail (Cell Signaling Technology, 3895); anti-Akt (Cell Signaling Technology, 9272); anti-phosphorylated Akt Ser-473 (Cell Signaling Technology, 4060); anti-GSK3β (Cell Signaling Technology, 9315); anti-phosphorylated GSK3β Ser-9 (Cell Signaling Technology, 9323); anti-ATM (Cell Signaling Technology, 92356); anti-phosphorylated ATM Ser-1981 (Cell Signaling Technology, 5883); anti-phosphorylated ATR Thr-1989 (Cell Signaling Technology, 58014); anti-phosphorylated Chk1 Ser-345 (Cell Signaling Technology, 2348); anti-phosphorylated Chk2 Thr-68 (Cell Signaling Technology, 2197); anti-phosphorylated Cdc25c Ser-216 (Abcam, ab47322); and anti-phosphorylated cdc2 Tyr-15 (Cell Signaling Technology, 4539.

      Cell cycle analysis by flow cytometry

      For cell cycle determination, cells were cultured in media with 10 μg/ml Hoechst for 10 min before harvesting. Cells were then fixed with 75% ethanol before cytometry analysis.

      In vitro transwell cell migration assay

      An in vitro migration assay was performed using a 24-well Boyden chamber (
      • Ying T.-H.
      • Lee C.-H.
      • Chiou H.-L.
      • Yang S.-F.
      • Lin C.-L.
      • Hung C.-H.
      • Tsai J.-P.
      • Hsieh Y.-H.
      Knockdown of Pentraxin 3 suppresses tumorigenicity and metastasis of human cervical cancer cells.
      ). Approximately 5 × 104 cells (in 100 μl media) treated with DOX for 4 days were added to the upper chamber in serum-free medium containing DOX. The lower compartment was filled with 650 μl medium containing 10% FBS and DOX. All cells were seeded in the upper part of the Boyden chamber and incubated for 12 h. Nonmigrated cells were scraped from the upper surface of the membrane with a cotton swab. Migrated cells remaining on the bottom surface were fixed with 4% neutral buffered formaldehyde and then stained with 0.5% crystal violet for 20 min. The migratory phenotypes were determined by counting the cells that migrated to the lower side of the filter using microscopy at 10× magnification. Five fields were counted for each filter, and each sample was assayed in triplicate.

      shRNA experiment

      shRNAs for ATM and Snail were synthesized at the Center for Biomedical Analysis at Tsinghua University and cloned into the pLKO.1 vector. A scrambled shRNA was used as a control, whose sequence is CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT. Five different shRNAs were used for each shRNA knockdown. Western blot analysis was used to determine protein knockdown. We then selected the two most effective knockdown clones. For shSnail, effective knockdown was from sequences CCGGCCAGGCTCGAAAGGCCTTCAACTCGAGTTGAAGGCCTTTCGAGCCTGGTTTTTG and CCGGGCAGGACTCTAATCCAGAGTTCTCGAGAACTCTGGATTAGAGTCCTGCTTTTTG. For shATM, these sequences were CCGGCAAACGAAATCTCAGTGATATCTCGAGATATCACTGAGATTTCGTTTGTTTTTTG and CCGGGTATTACCTTTCGTGGTATAACTCGAGTTATACCACGAAAGGTAATACTTTTTTG.

      RNA-Seq and analysis

      RNAs were isolated from cells treated with DOX for 4 days using TRIzol Reagent (Invitrogen), and sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (New England Biolabs). The resulting libraries were sequenced on an Illumina platform and 150-bp pair-length reads were collected. Differentially expressed genes of two groups (HeLa-PCNAYD versus HeLa, HeLa-PCNAWT, or HeLa-PCNAYF) were calculated using software DEGSeq (1.12.0). The resulting p values were adjusted using the Benjamini-Hochberg procedure. Genes with an adjusted p value <0.05 were assigned as differentially expressed. The complete unedited RNA-Seq datasets are available at Gene Expression Omnibus (GEO) database (accession number GSE127276).
      The differentially expressed genes were used for GSEA analysis (
      • Subramanian A.
      • Tamayo P.
      • Mootha V.K.
      • Mukherjee S.
      • Ebert B.L.
      • Gillette M.A.
      • Paulovich A.
      • Pomeroy S.L.
      • Golub T.R.
      • Lander E.S.
      • Mesirov J.P.
      Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles.
      ,
      • Mootha V.K.
      • Lindgren C.M.
      • Eriksson K.-F.
      • Subramanian A.
      • Sihag S.
      • Lehar J.
      • Puigserver P.
      • Carlsson E.
      • Ridderstråle M.
      • Laurila E.
      • Houstis N.
      • Daly M.J.
      • Patterson N.
      • Mesirov J.P.
      • Golub T.R.
      • et al.
      PGC-1α-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes.
      ). The gene set collection used was the h.all.v6.2.symbols.gmt [Hallmarks] gene sets database. GSEA analyzed 1000 permutations, and enrichment statistic was weighted. For IPA, the differentially expressed coding genes identified by the RNA-Seq at a p <0.05, -fold change >2 were uploaded to the IPA software for canonical pathway analysis. The analysis was conducted based on prior knowledge of pathway network stored in the Ingenuity Knowledge Base. The p value represents the significance of a given pathway and the Z-score predicts the pathway activation or inactivation.

      Western blot analysis

      Whole cell lysates were obtained in the radioimmunoprecipitation assay lysis buffer containing protease and phosphatase inhibitors. Protein concentrations were determined using BCA Protein Assay Reagents (Thermo Fisher). Proteins were separated by SDS-PAGE on polyacrylamide gels, transferred onto PVDF membranes, and detected by Western blot analysis using antibodies against specific proteins.

      Statistical analysis

      All statistical analyses were performed with one-way analysis of variance (ANOVA) test using GraphPad Software. Data were expressed as mean ± S.D. and were considered statistically significant if p values were less than 0.05 or 0.01, as indicated.

      Author contributions

      B. P., J. O., Z. C., and G.-M. L. resources; B. P., Z. C., and G.-M. L. data curation; B. P. and Z. C. software; B. P., J. O., L. G., Z. C., and G.-M. L. formal analysis; B. P., J. O., L. G., Z. C., and G.-M. L. validation; B. P., J. O., L. G., Z. C., and G.-M. L. investigation; B. P., J. O., L. G., Z. C., and G.-M. L. visualization; B. P., L. G., Z. C., and G.-M. L. methodology; B. P. writing-original draft; J. O., L. G., Z. C., and G.-M. L. writing-review and editing; Z. C. and G.-M. L. conceptualization; Z. C. and G.-M. L. supervision; Z. C. and G.-M. L. funding acquisition; Z. C. and G.-M. L. project administration.

      Acknowledgments

      We thank Dr. Jonathan Feinberg for editing the manuscript.

      Supplementary Material

      References

        • Stoimenov I.
        • Helleday T.
        PCNA on the Crossroad of Cancer.
        Portland Press Limited, London2009
        • Moldovan G.-L.
        • Pfander B.
        • Jentsch S.
        PCNA, the maestro of the replication fork.
        Cell. 2007; 129 (17512402): 665-679
        • Mailand N.
        • Gibbs-Seymour I.
        • Bekker-Jensen S.
        Regulation of PCNA–protein interactions for genome stability.
        Nat. Rev. Mol. Cell Biol. 2013; 14 (23594953): 269-282
        • Markowitz S.D.
        • Bertagnolli M.M.
        Molecular basis of colorectal cancer.
        N. Engl. J. Med. 2009; 361 (20018966): 2449-2460
        • Gullick W.
        Prevalence of aberrant expression of the epidermal growth factor receptor in human cancers.
        Br. Med. Bull. 1991; 47 (1863851): 87-98
        • Libermann T.A.
        • Nusbaum H.R.
        • Razon N.
        • Kris R.
        • Lax I.
        • Soreq H.
        • Whittle N.
        • Waterfield M.D.
        • Ullrich A.
        • Schlessinger J.
        Amplification, enhanced expression and possible rearrangement of EGF receptor gene in primary human brain tumours of glial origin.
        Nature. 1985; 313 (2981413): 144-147
        • Salomon D.S.
        • Brandt R.
        • Ciardiello F.
        • Normanno N.
        Epidermal growth factor-related peptides and their receptors in human malignancies.
        Crit. Rev. Oncol. Hematol. 1995; 19 (7612182): 183-232
        • Tillotson J.K.
        • Rose D.P.
        Endogenous secretion of epidermal growth factor peptides stimulates growth of DU145 prostate cancer cells.
        Cancer Letters. 1991; 60 (1933834): 109-112
        • Wang S.-C.
        • Nakajima Y.
        • Yu Y.-L.
        • Xia W.
        • Chen C.-T.
        • Yang C.-C.
        • McIntush E.W.
        • Li L.-Y.
        • Hawke D.H.
        • Kobayashi R.
        • Hung M.-C.
        Tyrosine phosphorylation controls PCNA function through protein stability.
        Nat. Cell Biol. 2006; 8 (17115032): 1359-1368
        • Umar A.
        • Buermeyer A.B.
        • Simon J.A.
        • Thomas D.C.
        • Clark A.B.
        • Liskay R.M.
        • Kunkel T.A.
        Requirement for PCNA in DNA mismatch repair at a step preceding DNA resynthesis.
        Cell. 1996; 87 (8858149): 65-73
        • Gu L.
        • Hong Y.
        • McCulloch S.
        • Watanabe H.
        • Li G.-M.
        ATP-dependent interaction of human mismatch repair proteins and dual role of PCNA in mismatch repair.
        Nucleic Acids Res. 1998; 26 (9469823): 1173-1178
        • Kadyrov F.A.
        • Dzantiev L.
        • Constantin N.
        • Modrich P.
        Endonucleolytic function of MutLα in human mismatch repair.
        Cell. 2006; 126 (16873062): 297-308
        • Li G.-M.
        Mechanisms and functions of DNA mismatch repair.
        Cell Res. 2008; 18 (18157157): 85-98
        • Ortega J.
        • Li J.Y.
        • Lee S.
        • Tong D.
        • Gu L.
        • Li G.M.
        Phosphorylation of PCNA by EGFR inhibits mismatch repair and promotes misincorporation during DNA synthesis.
        Proc. Natl. Acad. Sci. U.S.A. 2015; 112 (25825764): 5667-5672
        • Lu Z.
        • Jiang G.
        • Blume-Jensen P.
        • Hunter T.
        Epidermal growth factor-induced tumor cell invasion and metastasis initiated by dephosphorylation and downregulation of focal adhesion kinase.
        Mol. Cell. Biol. 2001; 21 (11359909): 4016-4031
        • Weinberg R.A.
        The Biology of Cancer.
        2nd ed. Garland Science, New York2014
        • Malkas L.H.
        • Herbert B.S.
        • Abdel-Aziz W.
        • Dobrolecki L.E.
        • Liu Y.
        • Agarwal B.
        • Hoelz D.
        • Badve S.
        • Schnaper L.
        • Arnold R.J.
        • Mechref Y.
        • Novotny M.V.
        • Loehrer P.
        • Goulet R.J.
        • Hickey R.J.
        A cancer-associated PCNA expressed in breast cancer has implications as a potential biomarker.
        Proc. Natl. Acad. Sci. U.S.A. 2006; 103 (17159154): 19472-19477
        • Ben-Izhak O.
        • Bar-Chana M.
        • Sussman L.
        • Dobiner V.
        • Sandbank J.
        • Cagnano M.
        • Cohen H.
        • Sabo E.
        Ki67 antigen and PCNA proliferation markers predict survival in anorectal malignant melanoma.
        Histopathology. 2002; 41 (12460204): 519-525
        • Juríková M.
        • Danihel Š.
        • Polák Š.
        • Varga I.
        Ki67, PCNA, and MCM proteins: Markers of proliferation in the diagnosis of breast cancer.
        Acta Histochem. 2016; 118 (27246286): 544-552
        • Korpanty G.J.
        • Graham D.M.
        • Vincent M.D.
        • Leighl N.B.
        Biomarkers that currently affect clinical practice in lung cancer: EGFR, ALK, MET, ROS-1, and KRAS.
        Front. Oncol. 2014; 4 (25157335): 204
        • Grandis J.R.
        • Tweardy D.J.
        Elevated levels of transforming growth factor α and epidermal growth factor receptor messenger RNA are early markers of carcinogenesis in head and neck cancer.
        Cancer Res. 1993; 53 (8339264): 3579-3584
        • Rubin Grandis J.
        • Melhem M.F.
        • Gooding W.E.
        • Day R.
        • Holst V.A.
        • Wagener M.M.
        • Drenning S.D.
        • Tweardy D.J.
        Levels of TGF-α and EGFR protein in head and neck squamous cell carcinoma and patient survival.
        J. Natl. Cancer Inst. 1998; 90 (9625170): 824-832
        • Abe T.
        • Branzei D.
        High levels of BRC4 induced by a Tet-On 3G system suppress DNA repair and impair cell proliferation in vertebrate cells.
        DNA Repair. 2014; 22 (25218467): 153-164
        • Das A.T.
        • Tenenbaum L.
        • Berkhout B.
        Tet-On systems for doxycycline-inducible gene expression.
        Curr. Gene Ther. 2016; 16 (27216914): 156-167
        • Cong L.
        • Ran F.A.
        • Cox D.
        • Lin S.L.
        • Barretto R.
        • Habib N.
        • Hsu P.D.
        • Wu X.B.
        • Jiang W.Y.
        • Marraffini L.A.
        • Zhang F.
        Multiplex genome engineering using CRISPR/Cas systems.
        Science. 2013; 339 (23287718): 819-823
        • Ran F.A.
        • Hsu P.D.
        • Wright J.
        • Agarwala V.
        • Scott D.A.
        • Zhang F.
        Genome engineering using the CRISPR-Cas9 system.
        Nat. Protoc. 2013; 8 (24157548): 2281-2308
        • Sadelain M.
        • Papapetrou E.P.
        • Bushman F.D.
        Safe harbours for the integration of new DNA in the human genome.
        Nat. Rev. Cancer. 2011; 12 (22129804): 51-58
        • Smith J.R.
        • Maguire S.
        • Davis L.A.
        • Alexander M.
        • Yang F.
        • Chandran S.
        • ffrench-Constant C.
        • Pedersen R.A.
        Robust, persistent transgene expression in human embryonic stem cells is achieved with AAVS1-targeted integration.
        Stem Cells. 2008; 26 (18024421): 496-504
        • González F.
        • Zhu Z.
        • Shi Z.D.
        • Lelli K.
        • Verma N.
        • Li Q.V.
        • Huangfu D.
        An iCRISPR platform for rapid, multiplexable, and inducible genome editing in human pluripotent stem cells.
        Cell Stem Cell. 2014; 15 (24931489): 215-226
        • Subramanian A.
        • Tamayo P.
        • Mootha V.K.
        • Mukherjee S.
        • Ebert B.L.
        • Gillette M.A.
        • Paulovich A.
        • Pomeroy S.L.
        • Golub T.R.
        • Lander E.S.
        • Mesirov J.P.
        Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles.
        Proc. Natl. Acad. Sci. U.S.A. 2005; 102 (16199517): 15545-15550
        • Mootha V.K.
        • Lindgren C.M.
        • Eriksson K.-F.
        • Subramanian A.
        • Sihag S.
        • Lehar J.
        • Puigserver P.
        • Carlsson E.
        • Ridderstråle M.
        • Laurila E.
        • Houstis N.
        • Daly M.J.
        • Patterson N.
        • Mesirov J.P.
        • Golub T.R.
        • et al.
        PGC-1α-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes.
        Nat. Genet. 2003; 34 (12808457): 267
        • Ying T.-H.
        • Lee C.-H.
        • Chiou H.-L.
        • Yang S.-F.
        • Lin C.-L.
        • Hung C.-H.
        • Tsai J.-P.
        • Hsieh Y.-H.
        Knockdown of Pentraxin 3 suppresses tumorigenicity and metastasis of human cervical cancer cells.
        Sci. Rep. 2016; 6 (27377307)29385
        • Valster A.
        • Tran N.L.
        • Nakada M.
        • Berens M.E.
        • Chan A.Y.
        • Symons M.
        Cell migration and invasion assays.
        Methods. 2005; 37 (16288884): 208-215
        • Shaw L.M.
        Tumor cell invasion assays.
        in: Cell Migration. Springer, New York2005: 97-105
        • Zhou B.P.
        • Deng J.
        • Xia W.
        • Xu J.
        • Li Y.M.
        • Gunduz M.
        • Hung M.-C.
        Dual regulation of Snail by GSK-3β-mediated phosphorylation in control of epithelial-mesenchymal transition.
        Nat. Cell Biol. 2004; 6 (15448698): 931-940
        • Hanahan D.
        • Weinberg R.A.
        Hallmarks of cancer: The next generation.
        Cell. 2011; 144 (21376230): 646-674
        • Wang Y.
        • Shi J.
        • Chai K.
        • Ying X.
        • Zhou B.P.
        The role of Snail in EMT and tumorigenesis.
        Curr. Cancer Drug Targets. 2013; 13 (24168186): 963-972
        • Berx G.
        • van Roy F.
        Involvement of members of the cadherin superfamily in cancer.
        Cold Spring Harb. Perspect. Biol. 2009; 1 (20457567)a003129
        • Jimánez-Marín Á.
        • Collado-Romero M.
        • Ramirez-Boo M.
        • Arce C.
        • Garrido J.J.
        Biological pathway analysis by ArrayUnlock and Ingenuity Pathway Analysis.
        BMC Proc. 2009; 3 (19615119): S6
        • Zhao D.
        • Lu X.
        • Wang G.
        • Lan Z.
        • Liao W.
        • Li J.
        • Liang X.
        • Chen J.R.
        • Shah S.
        • Shang X.
        • Tang M.
        • Deng P.
        • Dey P.
        • Chakravarti D.
        • Chen P.
        • et al.
        Synthetic essentiality of chromatin remodelling factor CHD1 in PTEN-deficient cancer.
        Nature. 2017; 542 (28166537): 484-488
        • Sun M.
        • Guo X.
        • Qian X.
        • Wang H.
        • Yang C.
        • Brinkman K.L.
        • Serrano-Gonzalez M.
        • Jope R.S.
        • Zhou B.
        • Engler D.A.
        • Zhan M.
        • Wong S.T.
        • Fu L.
        • Xu B.
        Activation of the ATM-Snail pathway promotes breast cancer metastasis.
        J. Mol. Cell Biol. 2012; 4 (22923499): 304-315
        • Grille S.J.
        • Bellacosa A.
        • Upson J.
        • Klein-Szanto A.J.
        • van Roy F.
        • Lee-Kwon W.
        • Donowitz M.
        • Tsichlis P.N.
        • Larue L.
        The protein kinase Akt induces epithelial mesenchymal transition and promotes enhanced motility and invasiveness of squamous cell carcinoma lines.
        Cancer Res. 2003; 63 (12727836): 2172-2178
        • Lee Y.J.
        • Han H.J.
        Troglitazone ameliorates high glucose-induced EMT and dysfunction of SGLTs through PI3K/Akt, GSK-3β, Snail1, and β-catenin in renal proximal tubule cells.
        Am. J. Physiol. Renal Physiol. 2010; 298 (20015942): F1263-F1275
        • Martini M.
        • De Santis M.C.
        • Braccini L.
        • Gulluni F.
        • Hirsch E.
        PI3K/AKT signaling pathway and cancer: An updated review.
        Ann. Med. 2014; 46 (24897931): 372-383
        • Vanhaesebroeck B.
        • Guillermet-Guibert J.
        • Graupera M.
        • Bilanges B.
        The emerging mechanisms of isoform-specific PI3K signalling.
        Nat. Rev. Mol. Cell Biol. 2010; 11 (20379207): 329-341
        • Liu L.
        • Dai Y.
        • Chen J.
        • Zeng T.
        • Li Y.
        • Chen L.
        • Zhu Y.-H.
        • Li J.
        • Li Y.
        • Ma S.
        • Xie D.
        • Yuan Y.-F.
        • Guan X.-Y.
        Maelstrom promotes hepatocellular carcinoma metastasis by inducing epithelial-mesenchymal transition by way of Akt/GSK-3 beta/Snail signaling.
        Hepatology. 2014; 59 (23929794): 531-543
        • Weber A.M.
        • Ryan A.J.
        ATM and ATR as therapeutic targets in cancer.
        Pharmacol. Ther. 2015; 149 (25512053): 124-138
        • Paull T.T.
        • Rogakou E.P.
        • Yamazaki V.
        • Kirchgessner C.U.
        • Gellert M.
        • Bonner W.M.
        A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage.
        Curr. Biol. 2000; 10 (10959836): 886-895
        • Sarkaria J.N.
        • Tibbetts R.S.
        • Busby E.C.
        • Kennedy A.P.
        • Hill D.E.
        • Abraham R.T.
        Inhibition of phosphoinositide 3-kinase related kinases by the radiosensitizing agent wortmannin.
        Cancer Res. 1998; 58 (9766667): 4375-4382
        • Lovisa S.
        • LeBleu V.S.
        • Tampe B.
        • Sugimoto H.
        • Vadnagara K.
        • Carstens J.L.
        • Wu C.-C.
        • Hagos Y.
        • Burckhardt B.C.
        • Pentcheva-Hoang T.
        • Nischal H.
        • Allison J.P.
        • Zeisberg M.
        • Kalluri R.
        Epithelial-to-mesenchymal transition induces cell cycle arrest and parenchymal damage in renal fibrosis.
        Nat. Med. 2015; 21 (26236991): 998-1009
        • Shiloh Y.
        ATM and ATR: Networking cellular responses to DNA damage.
        Curr. Opin. Genet. Dev. 2001; 11 (11163154): 71-77
        • Sanchez Y.
        • Wong C.
        • Thoma R.S.
        • Richman R.
        • Wu Z.
        • Piwnica-Worms H.
        • Elledge S.J.
        Conservation of the Chk1 checkpoint pathway in mammals: Linkage of DNA damage to Cdk regulation through Cdc25.
        Science. 1997; 277 (9278511): 1497-1501
        • Hoffmann I.
        The role of Cdc25 phosphatases in cell cycle checkpoints.
        Protoplasma. 2000; 211: 8-11
        • Kabeche L.
        • Nguyen H.D.
        • Buisson R.
        • Zou L.
        A mitosis-specific and R loop–driven ATR pathway promotes faithful chromosome segregation.
        Science. 2018; 359 (29170278): 108-114
        • Yazinski S.A.
        • Zou L.
        Functions, regulation, and therapeutic implications of the ATR checkpoint pathway.
        Annu. Rev. Genet. 2016; 50 (27617969): 155-173
        • Storchova Z.
        • Pellman D.
        From polyploidy to aneuploidy, genome instability and cancer.
        Nat. Rev. Mol. Cell Biol. 2004; 5 (14708009): 45-54

      Linked Article