Advertisement

Immunoresponsive Gene 1 and Itaconate Inhibit Succinate Dehydrogenase to Modulate Intracellular Succinate Levels*

  • Thekla Cordes
    Affiliations
    Department of Bioengineering, University of California, San Diego, La Jolla, California 92093
    Search for articles by this author
  • Martina Wallace
    Affiliations
    Department of Bioengineering, University of California, San Diego, La Jolla, California 92093
    Search for articles by this author
  • Alessandro Michelucci
    Affiliations
    NORLUX Neuro-Oncology Laboratory, Department of Oncology, Luxembourg Institute of Health, 1526 Luxembourg, Luxembourg,

    Luxembourg Centre for Systems Biomedicine, University of Luxembourg, 4362 Esch-Belval, Luxembourg
    Search for articles by this author
  • Ajit S. Divakaruni
    Affiliations
    Department of Pharmacology, University of California, San Diego, La Jolla, California 92093
    Search for articles by this author
  • Sean C. Sapcariu
    Affiliations
    Luxembourg Centre for Systems Biomedicine, University of Luxembourg, 4362 Esch-Belval, Luxembourg
    Search for articles by this author
  • Carole Sousa
    Affiliations
    NORLUX Neuro-Oncology Laboratory, Department of Oncology, Luxembourg Institute of Health, 1526 Luxembourg, Luxembourg,

    Luxembourg Centre for Systems Biomedicine, University of Luxembourg, 4362 Esch-Belval, Luxembourg
    Search for articles by this author
  • Haruhiko Koseki
    Affiliations
    RIKEN Center for Integrative Medical Sciences, Yokohama, Kanagawa 230-0045, Japan
    Search for articles by this author
  • Pedro Cabrales
    Affiliations
    Department of Bioengineering, University of California, San Diego, La Jolla, California 92093
    Search for articles by this author
  • Anne N. Murphy
    Affiliations
    Department of Pharmacology, University of California, San Diego, La Jolla, California 92093
    Search for articles by this author
  • Karsten Hiller
    Affiliations
    Luxembourg Centre for Systems Biomedicine, University of Luxembourg, 4362 Esch-Belval, Luxembourg
    Search for articles by this author
  • Christian M. Metallo
    Correspondence
    To whom correspondence should be addressed: Dept. of Bioengineering, University of California, San Diego, 9500 Gilman Dr., MC-0412 PFBH 204, La Jolla, CA 92093. Tel.: 858-534-8209;.
    Affiliations
    Department of Bioengineering, University of California, San Diego, La Jolla, California 92093

    Institute of Engineering in Medicine, University of California, San Diego, La Jolla, California 92093,
    Search for articles by this author
  • Author Footnotes
    * This study was supported by National Institutes of Health Grants R01CA188652 (to C. M. M.) and P01DK054441 (to A. N. M.); California Institute of Regenerative Medicine (CIRM) Award RB5-07356 (to C. M. M.); a Searle scholar award (to C. M. M.); National Science Foundation CAREER Award 1454425 (to C. M. M.); NIAID, National Institutes of Health Grant R01AI082610 (to P. C.); NHLBI, National Institutes of Health Grants R53HL123015, P01HL110900, and R01HL052684 (to P. C.); Fonds National de la Recherche, Luxembourg Grant ATTRACT A10/03 (to K. H.); AFR Grant 6916713 (to C.S.); the HICE Virtual Institute (to S. C. S.); and Deutsche Forschungsgesellschaft (German Research Foundation) Grant CO1488/1-1 (to T. C.). The authors declare that they have no conflicts of interest with the contents of this article. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
      Metabolic reprogramming is emerging as a hallmark of the innate immune response, and the dynamic control of metabolites such as succinate serves to facilitate the execution of inflammatory responses in macrophages and other immune cells. Immunoresponsive gene 1 (Irg1) expression is induced by inflammatory stimuli, and its enzyme product cis-aconitate decarboxylase catalyzes the production of itaconate from the tricarboxylic acid cycle. Here we identify an immunometabolic regulatory pathway that links Irg1 and itaconate production to the succinate accumulation that occurs in the context of innate immune responses. Itaconate levels and Irg1 expression correlate strongly with succinate during LPS exposure in macrophages and non-immune cells. We demonstrate that itaconate acts as an endogenous succinate dehydrogenase inhibitor to cause succinate accumulation. Loss of itaconate production in activated macrophages from Irg1−/− mice decreases the accumulation of succinate in response to LPS exposure. This metabolic network links the innate immune response and tricarboxylic acid metabolism to function of the electron transport chain.

      Introduction

      Immune cells must sense cues from the extracellular microenvironment and respond rapidly to protect against bacteria, viruses, or other pathogens (
      • Akira S.
      • Uematsu S.
      • Takeuchi O.
      Pathogen recognition and innate immunity.
      ). An emerging hallmark of inflammation and the innate immune system of cells is metabolic reprogramming (
      • Kelly B.
      • O'Neill L.A.
      Metabolic reprogramming in macrophages and dendritic cells in innate immunity.
      ). One of the most general metabolic changes that occurs under proinflammatory conditions is a biochemical switch from oxidative phosphorylation to aerobic glycolysis (
      • Krawczyk C.M.
      • Holowka T.
      • Sun J.
      • Blagih J.
      • Amiel E.
      • DeBerardinis R.J.
      • Cross J.R.
      • Jung E.
      • Thompson C.B.
      • Jones R.G.
      • Pearce E.J.
      Toll-like receptor-induced changes in glycolytic metabolism regulate dendritic cell activation.
      ,
      • Pearce E.L.
      • Pearce E.J.
      Metabolic pathways in immune cell activation and quiescence.
      ,
      • Rodríguez-Prados J.-C.
      • Través P.G.
      • Cuenca J.
      • Rico D.
      • Aragonés J.
      • Martín-Sanz P.
      • Cascante M.
      • Boscá L.
      Substrate fate in activated macrophages: a comparison between innate, classic, and alternative activation.
      ), which is mediated, in part, via stabilization of hypoxia-inducible factor 1α (HIF-1α)
      The abbreviations used are: HIF
      hypoxia-inducible factor
      TCA
      tricarboxylic acid
      CAD
      cis-aconitate decarboxylase
      SDH
      succinate dehydrogenase
      BMDM
      bone marrow-derived macrophage
      MSTFA
      2,2,2-trifluoro-N-methyl-N-trimethylsilyl-acetamide
      MTBSTFA
      N-tert-butyldimethylsilyl-N-methyltrifluoroacetamide
      OCR
      oxygen consumption rate.
      after pathogen infection (
      • Kempf V.A.
      • Lebiedziejewski M.
      • Alitalo K.
      • Wälzlein J.-H.
      • Ehehalt U.
      • Fiebig J.
      • Huber S.
      • Schütt B.
      • Sander C.A.
      • Müller S.
      • Grassl G.
      • Yazdi A.S.
      • Brehm B.
      • Autenrieth I.B.
      Activation of hypoxia-inducible factor-1 in bacillary angiomatosis: evidence for a role of hypoxia-inducible factor-1 in bacterial infections.
      ), LPS binding to toll-like receptors (
      • Blouin C.C.
      • Pagé E.L.
      • Soucy G.M.
      • Richard D.E.
      Hypoxic gene activation by lipopolysaccharide in macrophages: implication of hypoxia-inducible factor 1α.
      ), or by cytokine exposure (
      • Hellwig-Bürgel T.
      • Rutkowski K.
      • Metzen E.
      • Fandrey J.
      • Jelkmann W.
      Interleukin-1β and tumor necrosis factor-α stimulate DNA binding of hypoxia-inducible factor-1.
      ). Although it is known that macrophages undergo drastic metabolic reprogramming upon exposure to inflammatory stimuli, the underlying mechanisms driving this response are not completely understood.
      Increased succinate levels in macrophages are important mediators of the inflammatory response, linking metabolism to innate immunity. In addition to its role in TCA metabolism, succinate acts as a regulatory signal enhancing Il-1β expression through stabilization of HIF-1α, which, in turn, influences the function of various other metabolic pathways (
      • Tannahill G.M.
      • Curtis A.M.
      • Adamik J.
      • Palsson-McDermott E.M.
      • McGettrick A.F.
      • Goel G.
      • Frezza C.
      • Bernard N.J.
      • Kelly B.
      • Foley N.H.
      • Zheng L.
      • Gardet A.
      • Tong Z.
      • Jany S.S.
      • Corr S.C.
      • et al.
      Succinate is an inflammatory signal that induces IL-1β through HIF-1α.
      ). Succinate inhibits the hydroxylation of HIF-1α by EGLN1, resulting in pseudohypoxic HIF-1α stabilization under normoxic conditions (
      • Selak M.A.
      • Armour S.M.
      • MacKenzie E.D.
      • Boulahbel H.
      • Watson D.G.
      • Mansfield K.D.
      • Pan Y.
      • Simon M.C.
      • Thompson C.B.
      • Gottlieb E.
      Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.
      ,
      • Epstein A.C.
      • Gleadle J.M.
      • McNeill L.A.
      • Hewitson K.S.
      • O'Rourke J.
      • Mole D.R.
      • Mukherji M.
      • Metzen E.
      • Wilson M.I.
      • Dhanda A.
      • Tian Y.M.
      • Masson N.
      • Hamilton D.L.
      • Jaakkola P.
      • Barstead R.
      • Hodgkin J.
      • Maxwell P.H.
      • Pugh C.W.
      • Schofield C.J.
      • Ratcliffe P.J.
      C. elegans EGL-9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation.
      ,
      • Losman J.-A.
      • Kaelin Jr., W.G.
      What a difference a hydroxyl makes: mutant IDH, (R)-2-hydroxyglutarate, and cancer.
      ). Various mechanisms have been proposed as the cause of succinate accumulation, including increased glutamine anaplerosis and oxidation in the TCA cycle or increased flux through the GABA shunt (
      • Tannahill G.M.
      • Curtis A.M.
      • Adamik J.
      • Palsson-McDermott E.M.
      • McGettrick A.F.
      • Goel G.
      • Frezza C.
      • Bernard N.J.
      • Kelly B.
      • Foley N.H.
      • Zheng L.
      • Gardet A.
      • Tong Z.
      • Jany S.S.
      • Corr S.C.
      • et al.
      Succinate is an inflammatory signal that induces IL-1β through HIF-1α.
      ,
      • Mills E.
      • O'Neill L.A.
      Succinate: a metabolic signal in inflammation.
      ), although glycolytic metabolism is a prerequisite (
      • Palsson-McDermott E.M.
      • Curtis A.M.
      • Goel G.
      • Lauterbach M.A.
      • Sheedy F.J.
      • Gleeson L.E.
      • van den Bosch M.W.
      • Quinn S.R.
      • Domingo-Fernandez R.
      • Johnson D.G.
      • Jiang J.K.
      • Israelsen W.J.
      • Keane J.
      • Thomas C.
      • Clish C.
      • et al.
      Pyruvate kinase M2 regulates Hif-1α activity and IL-1β induction and is a critical determinant of the Warburg effect in LPS-activated macrophages.
      ). However, the specific driver(s) of this phenomenon has/have not yet been identified. Given the central role of succinate as a metabolic signal in inflammation, elucidation of the metabolic pathway(s) involved in succinate accumulation and its/their regulation may provide new avenues for controlling this process.
      Metabolites are important functional triggers that can regulate the activity of enzymes via substrate/product inhibition, posttranslational modifications, or allosteric interactions (
      • Wegner A.
      • Meiser J.
      • Weindl D.
      • Hiller K.
      How metabolites modulate metabolic flux.
      ). Beyond their direct roles as substrates and products, metabolites often serve as substrates for posttranslational modifications, as shown for succinate to succinylate proteins (
      • Tannahill G.M.
      • Curtis A.M.
      • Adamik J.
      • Palsson-McDermott E.M.
      • McGettrick A.F.
      • Goel G.
      • Frezza C.
      • Bernard N.J.
      • Kelly B.
      • Foley N.H.
      • Zheng L.
      • Gardet A.
      • Tong Z.
      • Jany S.S.
      • Corr S.C.
      • et al.
      Succinate is an inflammatory signal that induces IL-1β through HIF-1α.
      ). On the other hand, fructose 1,6-bisphosphate (
      • Bailey E.
      • Stirpe F.
      • Taylor C.B.
      Regulation of rat liver pyruvate kinase. The effect of preincubation, pH, copper ions, fructose 1,6-diphosphate and dietary changes on enzyme activity.
      ), serine, and other amino acids can allosterically influence the activity of the enzyme pyruvate kinase isoform M2 (PKM2) (
      • Chaneton B.
      • Hillmann P.
      • Zheng L.
      • Martin A.C.
      • Maddocks O.D.
      • Chokkathukalam A.
      • Coyle J.E.
      • Jankevics A.
      • Holding F.P.
      • Vousden K.H.
      • Frezza C.
      • O'Reilly M.
      • Gottlieb E.
      Serine is a natural ligand and allosteric activator of pyruvate kinase M2.
      ,
      • Chaneton B.
      • Gottlieb E.
      Rocking cell metabolism: revised functions of the key glycolytic regulator PKM2 in cancer.
      ). Recently, synthesis of the antimicrobial metabolite itaconate was identified in mammalian immune cells as being selectively up-regulated under proinflammatory conditions (
      • Strelko C.L.
      • Lu W.
      • Dufort F.J.
      • Seyfried T.N.
      • Chiles T.C.
      • Rabinowitz J.D.
      • Roberts M.F.
      Itaconic acid is a mammalian metabolite induced during macrophage activation.
      ). Itaconate exhibits an antibiotic function (
      • Michelucci A.
      • Cordes T.
      • Ghelfi J.
      • Pailot A.
      • Reiling N.
      • Goldmann O.
      • Binz T.
      • Wegner A.
      • Tallam A.
      • Rausell A.
      • Buttini M.
      • Linster C.L.
      • Medina E.
      • Balling R.
      • Hiller K.
      Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.
      ) via inhibition of isocitrate lyase, a key enzyme of the glyoxylate shunt needed by many bacteria to survive during infection (
      • Patel T.R.
      • McFadden B.A.
      Caenorhabditis elegans and Ascaris suum: inhibition of isocitrate lyase by itaconate.
      ,
      • Williams J.O.
      • Roche T.E.
      • McFadden B.A.
      Mechanism of action of isocitrate lyase from Pseudomonas indigofera.
      ,
      • McFadden B.A.
      • Purohit S.
      Itaconate, an isocitrate lyase-directed inhibitor in Pseudomonas indigofera.
      ). In mammals, itaconate is produced through the decarboxylation of the TCA cycle intermediate cis-aconitate, which is catalyzed by mammalian cis-aconitate decarboxylase (CAD, also known as immune-responsive gene 1 (IRG1) protein) encoded by immunoresponsive gene 1 (IRG1) (
      • Michelucci A.
      • Cordes T.
      • Ghelfi J.
      • Pailot A.
      • Reiling N.
      • Goldmann O.
      • Binz T.
      • Wegner A.
      • Tallam A.
      • Rausell A.
      • Buttini M.
      • Linster C.L.
      • Medina E.
      • Balling R.
      • Hiller K.
      Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.
      ). Itaconate production represents one of two characteristic TCA cycle “break points” discovered in classically activated immune cells (
      • O'Neill L.A.
      A broken Krebs cycle in macrophages.
      ,
      • Jha A.K.
      • Huang S.C.
      • Sergushichev A.
      • Lampropoulou V.
      • Ivanova Y.
      • Loginicheva E.
      • Chmielewski K.
      • Stewart K.M.
      • Ashall J.
      • Everts B.
      • Pearce E.J.
      • Driggers E.M.
      • Artyomov M.N.
      Network integration of parallel metabolic and transcriptional data reveals metabolic modules that regulate macrophage polarization.
      ). The first break occurs at isocitrate dehydrogenase, leading to the accumulation of citrate, the precursor for itaconate, and the second break occurs at succinate dehydrogenase (SDH), which may allow for succinate accumulation. Although itaconate has been shown previously to inhibit SDH ex vivo (
      • Booth A.N.
      • Taylor J.
      • Wilson R.H.
      • Deeds F.
      The inhibitory effects of itaconic acid in vitro and in vivo.
      ,
      • Ackermann W.W.
      • Potter V.R.
      Enzyme inhibition in relation to chemotherapy.
      ,
      • Dervartanian D.V.
      • Veeger C.
      Studies on succinate dehydrogenase: I: spectral properties of the purified enzyme and formation of enzyme-competitive inhibitor complexes.
      ), and LPS-activated murine macrophages produced up to 8 mm intracellular itaconate (
      • Michelucci A.
      • Cordes T.
      • Ghelfi J.
      • Pailot A.
      • Reiling N.
      • Goldmann O.
      • Binz T.
      • Wegner A.
      • Tallam A.
      • Rausell A.
      • Buttini M.
      • Linster C.L.
      • Medina E.
      • Balling R.
      • Hiller K.
      Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.
      ), a potential role of endogenously produced itaconate in succinate accumulation under inflammatory conditions has not yet been addressed and is unknown.
      To elucidate the role of itaconate in reprogramming immune cell metabolism, we modulated intracellular itaconate levels in primary bone marrow-derived macrophages (BMDMs), a macrophage cell line, as well as a lung adenocarcinoma cell line. In all cell models we observed metabolic changes reminiscent of SDH inhibition, including succinate accumulation. By measuring substrate-specific mitochondrial respiration, we demonstrated the inhibition of SDH by itaconate in a dose-dependent manner. Furthermore, stimulated BMDMs from Irg1 KO mice failed to produce itaconate and exhibited decreased succinate accumulation compared with BMDMs from WT mice. Based on these studies, we have elucidated an Irg1-induced immunomodulatory pathway in macrophages whereby its product, itaconate, acts as an endogenously produced metabolic regulator of mitochondrial metabolism.

      Experimental Procedures

       Cell Culture and Isotopic Labeling

      RAW 264.7 macrophages (
      • Raschke W.C.
      • Baird S.
      • Ralph P.
      • Nakoinz I.
      Functional macrophage cell lines transformed by Abelson leukemia virus.
      ) (ATCC, TIB-71) and A549 cells (
      • Giard D.J.
      • Aaronson S.A.
      • Todaro G.J.
      • Arnstein P.
      • Kersey J.H.
      • Dosik H.
      • Parks W.P.
      In vitro cultivation of human tumors: establishment of cell lines derived from a series of solid tumors.
      ) (ATCC, CCL-185) were maintained in high-glucose DMEM (Life Technologies) supplemented with 10% (v/v) FBS, 100 units·ml−1 penicillin/streptomycin, 25 mm glucose, and 4 mm l-glutamine. Cell lines tested negative for mycoplasma contamination using the MycoAlert mycoplasma detection kit (Lonza) according to the instructions of the manufacturer. Purified Escherichia coli LPS was used for the activation of RAW 264.7 macrophages and BMDMs at a concentration of 10 ng·ml−1. A549 and RAW 264.7 cells and BMDMs were exposed to increasing itaconate concentrations (5, 10, and 25 mm) for 6 h. For isotopic labeling experiments, RAW 264.7 macrophages were cultured in DMEM (Sigma) supplemented with 25 mm glucose, 4 mm [1-13C]glutamine (Cambridge Isotopes Inc.) and 10% (v/v) dialyzed FBS for 24 h prior to addition of LPS for 6 h. For isotope tracing with exposure to unlabeled itaconate, RAW 264.7 cells were exposed to labeled [U-13C6]glucose and [U-13C5]glutamine tracers over a period of three subcultures and then exposed further for 6 and 24 h to 10 mm unlabeled itaconate.

       BMDMs

      BMDM collection was approved by the Institutional Animal Care and Use Committee and was conducted according to the Guide for the Care and Use of Laboratory Animals (US National Research Council, 2010). BMDMs were isolated from femora and tibiae of C57BL/6J mice (The Jackson Laboratory, Bar Harbor, ME). Bones were collected in ice-cold PBS, cleaned of muscle, and flushed with 5 ml BMDM growth medium (DMEM, Life Technologies) supplemented with 10% (v/v) FBS, 100 units·ml−1 penicillin/streptomycin, 25 mm glucose, 4 mm l-glutamine, 20 ng·ml−1 recombinant-macrophage colony-stimulating factor (eBioscience), and 3.4 μl·l−1 β-mercaptoethanol). Cells were seeded at 5 × 106 cells on Petri dishes in 10 ml of growth medium. 5 ml of fresh growth medium was added on day 3. On day 6, BMDMs were collected and replated into 6-well tissue culture plates at a density of 5 × 105 cells/well in growth medium containing 2 ng·ml−1 recombinant-macrophage colony-stimulating factor. Metabolites were extracted on day 7.
      For Irg1 KO versus WT BMDM experiments, all animal procedures, such as handling and euthanasia, were performed according to the Federation of European Laboratory Animal Science Associations guidelines for the use of animals in research. The Irg1 KO mice were generated by Dr. Haruhiko Koseki at the RIKEN Institute using stem cells purchased from the Knockout Mouse Project Repository under strain ID Irg1tm1a(KOMP)Wtsi. Mice were anesthetized by intraperitoneal injection of 50 mg·kg−1 of ketamine hydrochloride and 5 mg·kg−1 xylazine hydrochloride, and bone marrow was isolated and cultured as described previously (
      • Zhang X.
      • Goncalves R.
      • Mosser D.M.
      The isolation and characterization of murine macrophages.
      ). Briefly, bone marrow was flushed from femora and tibiae of Irg1 KO and age-matched C57BL/6 WT mice, and the resultant cell suspension was passed through a 70-μm filter (Greiner Bio-One). After 10 min of centrifuging at 250 × g, the supernatant was discarded, and the pellet was resuspended in 2 ml of hypotonic solution (170 mm NH4Cl) for 5 min to allow lysis of any remaining extracellular red blood cells. Bone marrow-derived cells were plated in 12-well plates (Greiner Bio-One) at 5 × 105 cells/well. Cells were cultured for 6 days at 37 °C in RPMI 1640 VLE (Very Low Endotoxin) (Biochrom FG 1415) supplemented with 10% FBS and 20% conditioned medium from macrophage colony-stimulating factor-secreting L929 fibroblasts. After 6 days in culture, the BMDMs were used for experiments.

       Metabolite Quantification

      Metabolite levels of itaconate and TCA cycle intermediates were quantified using external standard curves (three biological replicates). For metabolite standard curves, increasing standard solutions were extracted under the conditions of sample preparation. Using the depicted standard curve, the metabolite quantity in each cell extract was calculated, taking into account cellular diameter (d, micrometers) of detached cells and cell number. We assumed a spherical shape and calculated the intracellular metabolite concentration using the following equation: [metabolite] = metabolite quantity (moles)/(((4/3000) π (d/2)3) cell number). Cell number and cell diameter were determined using a Countess automated cell counter (Invitrogen).

       Cell Transfections

      Irg1 gain-of function experiments in A549 cells were performed as described previously (
      • Michelucci A.
      • Cordes T.
      • Ghelfi J.
      • Pailot A.
      • Reiling N.
      • Goldmann O.
      • Binz T.
      • Wegner A.
      • Tallam A.
      • Rausell A.
      • Buttini M.
      • Linster C.L.
      • Medina E.
      • Balling R.
      • Hiller K.
      Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.
      ). Briefly, A549 cells were transfected with the pCMV6-Irg1 (OriGene) overexpressing plasmid or empty plasmid using Lipofectamine 2000 (Invitrogen) and further incubated for 24 h.

       RNA Isolation and RT-PCR

      Total RNA was purified from cultured cells using the Qiagen RNeasy mini kit (Qiagen) according to the instructions of the manufacturer. First-strand cDNA was synthesized from total RNA using SuperScript III (Invitrogen) with 1 μl (50 μm)/reaction oligo(dT)20 as primer according to the instructions of the manufacturer. Individual 20-μl SYBR Green real-time PCR reactions consisted of 2 μl of diluted cDNA, 10 μl of fast SYBR Green Master Mix (Applied Biosystems), and 0.5 μl of each 10 μm forward and reverse primers. For standardization of quantification, L27 was amplified simultaneously. PCR was carried out in 96-well plates on an Applied Biosystems ViiaTM 7 real-time PCR system using the following program: 95 °C for 20 s, 40 cycles of 95 °C for 1 s, and 60 °C for 20 s (Irg1, GCAACATGATGCTCAAGTCTG (forward) and TGCTCCTCCGAATGATACCA (reverse); L27, ACATTGACGATGGCACCTC (forward) and GCTTGGCGATCTTCTTCTTG (reverse)).

       Oxygen Consumption Measurements

      Respiration was measured in adherent monolayers of RAW 264.7 macrophages or BMDMs using a Seahorse XF96 analyzer. RAW 264.7 macrophages were plated at 3 × 104 cells/well (for assays with permeabilized cells) and 4 × 104 cells/well (for assays with intact cells) and BMDMs at 5 × 104 cells/well 24 h before measurement. Intact cells were assayed in DMEM (Sigma, 5030) supplemented with 8 mm glucose, 3 mm glutamine, 3 mm pyruvate, and 2 mm HEPES. Cells were permeabilized with 3 nm perfringolysin O (commercially, XF PMP (XF Plasma Membrane Permeabilizer)) as described previously (
      • Divakaruni A.S.
      • Rogers G.W.
      • Murphy A.N.
      Measuring mitochondrial function in permeabilized cells using the Seahorse XF analyzer or a Clark-type oxygen electrode.
      ). Phosphorylating (state 3), succinate-driven respiration in permeabilized cells was measured in cells offered 4 mm ADP, 2 μm rotenone, two different succinate concentrations (2.5 and 10 mm), and increasing itaconate concentrations (0, 5, 10, and 25 mm). When measuring respiration on different respiratory substrates, permeabilized cells were offered succinate (10 mm)/rotenone (2 μm), glutamate/malate (each 10 mm), pyruvate/malate (each 10 mm), or ascorbate (10 mm) plus N,N,N,N′-tetramethyl-p-phenylenediamine (TMPD) (100 μm) and antimycin A (1 μm). Maximal respiration was calculated as the difference between protonophore-stimulated respiration (600 nm carbonyl cyanide p-trifluoromethoxyphenylhydrazone) and nonmitochondrial respiration (measured after addition of 1 μm antimycin A). All data are mean ± S.E. of two or three repeated experiments (with a minimum of five biological replicates per experiment) as indicated in the text. For assays with BMDMs, cells were obtained from three different mice.

       GC-MS Sample Preparation and Analysis

      Polar metabolites were extracted using methanol/water/chloroform as described previously (
      • Michelucci A.
      • Cordes T.
      • Ghelfi J.
      • Pailot A.
      • Reiling N.
      • Goldmann O.
      • Binz T.
      • Wegner A.
      • Tallam A.
      • Rausell A.
      • Buttini M.
      • Linster C.L.
      • Medina E.
      • Balling R.
      • Hiller K.
      Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.
      ). For medium metabolites, medium was centrifuged at 4 °C for 5 min at 300 × g. 10 μl of supernatant was added to 80 μl of a −20 °C 8:1 methanol/water mixture, mixed for 10 min at 4 °C, and centrifuged at 16,000 × g for 10 min at 4 °C. 80 μl was collected and evaporated under a vacuum at −4 °C. Metabolite derivatization was performed using a Gerstel MPS. Dried polar metabolites were dissolved in 15 μl of 2% (w/v) methoxyamine hydrochloride (Thermo Scientific) in pyridine and incubated for 60 min at 45 °C. An equal volume of 2,2,2-trifluoro-N-methyl-N-trimethylsilyl-acetamide (MSTFA) or N-tert-butyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA) with 1% tert-butyl dimethylchlorosilane (Regis Technologies) was added and incubated further for 30 min at 45 °C. After derivatization, MSTFA-derivatized samples were analyzed as described previously (
      • Michelucci A.
      • Cordes T.
      • Ghelfi J.
      • Pailot A.
      • Reiling N.
      • Goldmann O.
      • Binz T.
      • Wegner A.
      • Tallam A.
      • Rausell A.
      • Buttini M.
      • Linster C.L.
      • Medina E.
      • Balling R.
      • Hiller K.
      Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.
      ). Briefly, derivatized samples were analyzed by GC-MS using a DB-35MS column (30 × 0.25 mm inner diameter × 0.25 μm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph interfaced with an Agilent 5975C mass spectrometer. For MTBSTFA-derivatized samples, the GC oven was held at 100 °C for 1 min, increased to 255 °C at 3.5 °C min−1, increased to 320 °C at 15 °C min−1, and held at 320 °C for 3 min. The total run time for one sample was 54.62 min. For Irg1 KO versus WT BMDM metabolite measurements, the GC oven was held at 100 °C for 2 min, increased to 300 °C at 10 °C min−1, and held at 325 °C for 3 min. The total run time for one sample was 26 min.
      MSTFA-derivatized metabolites were determined using the following quantification ions: itaconate (m/z 259) and succinate (m/z 247). Metabolite levels and mass isotopomer distributions of MTBSTFA-derivatized samples were analyzed by integrating metabolite fragment ions (itaconate, m/z 301–310; succinate, m/z 289–294; citrate, m/z 459–469; α-ketoglutarate, m/z 346–355; malate, m/z 419–428; and fumarate, m/z 287–292) and corrected for natural abundance using in-house algorithms.

       Statistical Analysis

      All results shown as averages of one to three repeated experiments with each at least two biological replicates as indicated in the text. A repeated experiment is defined as a separate experiment temporally. Biological replicates are defined as separate spatial replicates (i.e. wells of a tissue culture plate) within an experiment. In the case of BMDMs, repeated experiments are defined as cells from different mice. Error bars indicate mean ± S.E. The statistical tool R (
      R Core Team
      ) was used to calculate the Pearson correlation coefficient. For comparison of means between two different treatments, the statistical analysis was done by two-tailed Student's t test. *, p < 0.05; **, p < 0.01; ***, p < 0.001.

      Results

       Succinate and Itaconate Accumulate in LPS-activated RAW 264.7 Macrophages

      To better understand the relationship between Irg1-mediated itaconate production and the reprogramming of TCA metabolism under LPS-stimulated conditions, we quantified the dynamics of itaconate and TCA intermediate abundances in RAW 264.7 macrophages over time. To elicit an immune response, we exposed RAW 264.7 macrophages to 10 ng·ml−1 LPS for 6 h, conditions that induce high expression of Irg1 encoding CAD, the enzyme catalyzing itaconate production from cis-aconitate (
      • Michelucci A.
      • Cordes T.
      • Ghelfi J.
      • Pailot A.
      • Reiling N.
      • Goldmann O.
      • Binz T.
      • Wegner A.
      • Tallam A.
      • Rausell A.
      • Buttini M.
      • Linster C.L.
      • Medina E.
      • Balling R.
      • Hiller K.
      Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.
      ). Intriguingly, the levels of itaconate and succinate exhibited similar trends upon activation, in contrast to the dynamics of citrate, α-ketoglutarate, fumarate, and malate (Fig. 1a), suggesting that itaconate and succinate (or the enzymes metabolizing them) are regulated in a coordinated manner. Notably, basal oxygen consumption rates (OCR) remained unchanged compared with resting macrophages (Fig. 1b).
      Figure thumbnail gr1
      FIGURE 1Succinate and itaconate accumulate in LPS-activated murine RAW 264. 7 macrophages. a, dynamics of itaconate, succinate, citrate, α-ketoglutarate, fumarate, and malate levels. Cells were exposed to 10 ng·ml−1 LPS, and metabolites were extracted every hour over a 6-h period. Graphs represent the mean ± S.E. of time-dependent, intracellular metabolite concentrations [mm] of two repeated experiments, each with three biological replicates. b, the basal OCR is unchanged in LPS-activated (LPS) macrophages compared with resting macrophages (Ctr). Error bars represent mean ± S.E. of two repeated experiments.

       Exogenous Itaconate Drives Succinate Accumulation

      To determine whether itaconate directly contributes to succinate accumulation, we next supplemented the growth medium of resting and LPS-activated murine RAW 264.7 macrophages with increasing itaconate concentrations for 6 h and observed how intracellular itaconate levels correlated with those of various TCA cycle intermediates (Figs. 2, a–f). LPS-activated murine macrophages can produce up to 8 mm intracellular itaconate (
      • Michelucci A.
      • Cordes T.
      • Ghelfi J.
      • Pailot A.
      • Reiling N.
      • Goldmann O.
      • Binz T.
      • Wegner A.
      • Tallam A.
      • Rausell A.
      • Buttini M.
      • Linster C.L.
      • Medina E.
      • Balling R.
      • Hiller K.
      Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.
      ), but higher levels may accumulate in specific compartments (e.g. mitochondria). Therefore, we considered four different itaconate concentrations ranging from 0–25 mm. Exposure to exogenous itaconate resulted in increasing intracellular itaconate levels in a dose-dependent manner (Fig. 2c), indicating that cells have the capacity to take up itaconate from medium. However, medium itaconate levels were not appreciably affected (Fig. 2g). Interestingly, no mitochondrial or plasma membrane itaconate transporters have been described in mammalian cells to date.
      Figure thumbnail gr2
      FIGURE 2Exogenous itaconate drives succinate accumulation. Intracellular TCA cycle intermediate and itaconate quantification in resting (Ctr, continuous line) and LPS-activated (LPS, dashed line) RAW 264.7 macrophages after 6-h exposure to increasing extracellular itaconate concentrations (0, 5, 10, and 25 mm) (a, malate; b, citrate; c, itaconate; d, α-ketoglutarate; e, succinate; f, fumarate). Cells were exposed to 10 ng·ml−1 LPS for 6 h. Graphs represent the mean ± S.E. of intracellular metabolite concentrations [mm] of two repeated experiments, each with three biological replicates. Pearson correlation coefficient (r) represents correlation between intracellular itaconate and TCA cycle intermediate concentrations. g, medium itaconate levels of resting and LPS-activated RAW 264.7 macrophages (10 ng·ml−1 LPS) at 0 h (black) and after 6 h (gray). Data represent the mean ± S.E. of metabolite levels [mm] of three biological replicates. h, intracellular succinate quantification in resting and LPS-activated BMDMs after 6-h exposure to 0 mm (black) or 25 mm (gray) extracellular itaconate. Cells were exposed to 10 ng·ml−1 LPS for 6 h. Graphs represent the mean ± S.E. of succinate concentration [mm] obtained from two different mice, each with three biological replicates. *, p < 0.05; **, p < 0.01.
      We next calculated the Pearson correlation coefficient (r) between the intracellular abundance of itaconate and each TCA intermediate to gauge the relationship across each pair. Intriguingly, we observed that intracellular itaconate levels correlated strongly with succinate levels in resting (r = 0.99) as well as LPS-activated macrophages (r = 0.99) so that higher itaconate levels were associated with elevated succinate levels (Fig. 2e). Importantly, the levels of other TCA intermediates, including citrate, α-ketoglutarate, fumarate, and malate correlated poorly (or in some cases negatively) with intracellular itaconate levels (Fig. 2, a, b, d, and f). Because succinate accumulates after exposure to exogenous itaconate in RAW 264.7 macrophages (Fig. 2e) as well as BMDMs (Fig. 2h), these data suggest that LPS-induced itaconate production by mammalian CAD contributes to the elevated succinate levels observed in activated macrophages. Importantly, exposure to exogenous itaconate induces succinate accumulation in resting RAW 264.7 macrophages (Fig. 2e) as well as resting BMDMs (Fig. 2h), indicating that the mechanism through which itaconate acts is independent of other inflammatory signaling events.

       Itaconate and Irg1-induced Succinate Accumulation Is Not Specific to Immune Cells

      To further investigate whether itaconate reprograms TCA metabolism independent of inflammatory signals, we supplemented increasing itaconate concentrations (0, 5, 10, and 25 mm) to the growth medium of human A549 lung adenocarcinoma cells and quantified intracellular metabolite concentrations after 6 h. As before (Fig. 2c), uptake of extracellular itaconate from the medium was evidenced by increasing intracellular itaconate levels (Fig. 3a), whereas medium itaconate abundances did not change (Fig. 3b). Succinate levels increased linearly with itaconate levels and correlated strongly (r = 0.99), whereas other TCA cycle intermediates, including citrate, α-ketoglutarate, fumarate, and malate, did not accumulate (Fig. 3a). These results are consistent with our observations using RAW 264.7 macrophages (Fig. 2), and because A549 cells do not express IRG1 (
      • Michelucci A.
      • Cordes T.
      • Ghelfi J.
      • Pailot A.
      • Reiling N.
      • Goldmann O.
      • Binz T.
      • Wegner A.
      • Tallam A.
      • Rausell A.
      • Buttini M.
      • Linster C.L.
      • Medina E.
      • Balling R.
      • Hiller K.
      Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.
      ) they suggest that itaconate-mediated succinate accumulation occurs even in the absence of an active inflammatory signaling cascade.
      Figure thumbnail gr3
      FIGURE 3Itaconate- and Irg1-induced succinate accumulation is not specific to immune cells. a, intracellular itaconate and succinate levels increase in A549 lung adenocarcinoma cells after exposure to increasing exogenous itaconate concentrations (0, 5, 10, and 25 mm). Data represent the mean ± S.E. of metabolite levels [mm] of two repeated experiments with each three biological replicates. b, itaconate levels in medium after 6 h (gray) are not significantly affected compared with 0 h (black). Data represent the mean ± S.E. of metabolite levels of two repeated experiments with three biological replicates each. c and d, intracellular levels of itaconate (c, black) and succinate (d, gray) increased in Irg1 overexpression A549 cells after transient transfection with murine pCMV6-Irg1 overexpression (pmIrg1) plasmid compared with empty pCMV6-Entry (pCMV6) control plasmid. Error bars represent the intracellular metabolite levels (ion counts) 24 h after transfection of three biological replicates (mean ± S.E.). *, p < 0.05; **, p < 0.01.
      To determine whether CAD-mediated itaconate production can affect succinate levels in non-immune cells, we overexpressed Irg1 in human A549 cells using a pCMV6-plasmid encoding murine Irg1. Itaconate was only produced at detectable levels in pCMV6 Irg1-overexpressing A549 cells (pmIrg1) compared with vector (pCMV6) controls (Fig. 3c). Notably, pmIrg1 cells accumulated significantly higher amounts of succinate compared with pCMV6 controls (Fig. 3d), indicating that ectopic expression of CAD alone is sufficient to impact succinate levels. Collectively, these observations provide strong evidence that itaconate functions as metabolic trigger to modulate succinate levels.

       Itaconate Is Not Metabolized to Succinate

      One explanation for the above results could be that accumulated itaconate is metabolized to succinate directly or indirectly in macrophages. Indeed, Pseudomonas sp. can metabolize itaconate as a carbon source through cleavage into pyruvate and acetyl-CoA (
      • Cooper R.A.
      • Kornberg H.L.
      The utilization of itaconate by Pseudomonas sp.
      ), and a similar itaconate degradation pathway has been observed in isolated liver mitochondria (
      • Adler J.
      • Wang S.-F.
      • Lardy H.A.
      The metabolism of itaconic acid by liver mitochondria.
      ). To exclude the possibility that degradation of itaconate to succinate occurs, we applied a [1-13C]glutamine tracer to LPS-activated RAW 264.7 macrophages. During oxidative glutamine metabolism, decarboxylation of M1 α-ketoglutarate derived from this tracer results in M0 succinate. In contrast to the oxidative pathway, M1 α-ketoglutarate is converted to M1 isocitrate and citrate via reductive carboxylation (
      • Metallo C.M.
      • Gameiro P.A.
      • Bell E.L.
      • Mattaini K.R.
      • Yang J.
      • Hiller K.
      • Jewell C.M.
      • Johnson Z.R.
      • Irvine D.J.
      • Guarente L.
      • Kelleher J.K.
      • Vander Heiden M.G.
      • Iliopoulos O.
      • Stephanopoulos G.
      Reductive glutamine metabolism by IDH1 mediates lipogenesis under hypoxia.
      ), subsequently leading to M1 itaconate labeling. Thus, if itaconate is appreciably metabolized to succinate through the aforementioned degradation pathways, then we would detect significant labeling on succinate from this tracer (Fig. 4a). Although we observed high fractions of M1 itaconate isotopologues (∼65%) because of itaconate production via reductive glutamine metabolism, no labeling was detected on succinate (Fig. 4b).
      Figure thumbnail gr4
      FIGURE 4Itaconate is not metabolized to succinate in RAW 264. 7 macrophages. a, carbon labeling indicating oxidative (black lines) and reductive (gray lines) glutamine metabolism using [1-13C]glutamine. Labeled itaconate (M1) is only synthesized through reductive glutamine metabolism (gray), and if it is metabolized to succinate, then it would result in succinate containing one labeled carbon (M1). b, mass isotopomer distribution of itaconate (black) and succinate (white) of LPS-activated RAW 264.7 macrophages after 24-h exposure to [1-13C]glutamine tracer and 6-h exposure to 10 ng·ml−1 LPS. The major fraction of labeled itaconate contains one labeled carbon, whereas no labeling was found on succinate. Error bars represent the mean ± S.E. of mass isotopomer levels of three biological replicates. c, carbon labeling of TCA cycle intermediates using [U-13C6]glucose and [U-13C5]glutamine tracers. If exogenous, unlabeled itaconate is metabolized to succinate, then labeling would decrease but does not here. d, mass isotopomer distribution of succinate in resting and LPS-activated RAW 264.7 macrophages after 6-h (black) and 24-h (gray) exposure to exogenous, unlabeled itaconate remains ∼90%, indicating that itaconate is not metabolized to succinate. Cells were prelabeled with [U-13C6]glucose and [U-13C5]glutamine over a period of three subcultures. Error bars represent the mean ± S.E. of mass isotopomer levels of three biological replicates.
      To further demonstrate that itaconate is not metabolized to succinate, we cultured 13C-labeled resting and LPS-activated RAW 264.7 macrophages in the presence of 10 mm unlabeled itaconate and quantified succinate labeling. We exposed cells to labeled [U-13C6]glucose and [U-13C5]glutamine tracers over a period of three subcultures to obtain adequate isotope enrichment in succinate pools (Fig. 4c). Because labeling of succinate after exposure to exogenous, unlabeled itaconate was unchanged (even in the physiological concentration used here) (Fig. 4d), these data therefore confirm that itaconate is not metabolized to succinate in these mammalian cells.

       Itaconate Inhibits SDH

      Although enhanced flux through succinate-producing pathways from glutamine or glucose is likely contributing to its accumulation in inflammatory cells, our results suggest that itaconate degradation does not occur. An alternative mechanism through which endogenous itaconate could influence succinate levels is through inhibition of SDH/complex II. Indeed, in vitro enzyme activity assays using isolated SDH and respiratory studies have indicated that itaconate can reduce the activity of SDH (
      • Ackermann W.W.
      • Potter V.R.
      Enzyme inhibition in relation to chemotherapy.
      ,
      • Dervartanian D.V.
      • Veeger C.
      Studies on succinate dehydrogenase: I: spectral properties of the purified enzyme and formation of enzyme-competitive inhibitor complexes.
      ,
      • Németh B.
      • Doczi J.
      • Csete D.
      • Kacso G.
      • Ravasz D.
      • Adams D.
      • Kiss G.
      • Nagy A.M.
      • Horvath G.
      • Tretter L.
      • Mócsai A.
      • Csépányi-Kömi R.
      • Iordanov I.
      • Adam-Vizi V.
      • Chinopoulos C.
      Abolition of mitochondrial substrate-level phosphorylation by itaconic acid produced by LPS-induced Irg1 expression in cells of murine macrophage lineage.
      ). Mammalian CAD is localized to mitochondria in murine macrophages (
      • Degrandi D.
      • Hoffmann R.
      • Beuter-Gunia C.
      • Pfeffer K.
      The proinflammatory cytokine-induced IRG1 protein associates with mitochondria.
      ); therefore, itaconate production within or near this compartment could modulate SDH activity and, subsequently, succinate levels. To investigate the potential for itaconate to act as an SDH inhibitor, we measured mitochondrial respiration in permeabilized murine RAW 264.7 macrophages and BMDMs. First, we exposed permeabilized macrophages to increasing itaconate concentrations (0–25 mm) in the presence of two different succinate concentrations (2.5 and 10 mm) with 2 μm rotenone. Succinate is the substrate for complex II (SDH) of the mitochondrial respiratory chain, whereas rotenone was used to inhibit complex I and to prevent accumulation of the SDH inhibitor oxaloacetate (
      • Wojtczak L.
      • Wojtczak A.B.
      • Ernster L.
      The inhibition of succinate dehydrogenase by oxaloacetate.
      ), enabling us to directly measure maximal SDH-driven respiration. We observed a dose dependent inhibition of OCRs by itaconate in RAW 264.7 macrophages (Fig. 5a) and BMDMs (Fig. 5b), suggesting a regulatory role of itaconate for SDH activity. When the succinate concentration was lowered to 2.5 mm, itaconate had a greater proportional inhibitory effect. Considering the structural similarity of succinate to itaconate (also known as methylene succinate), our data suggest that itaconate acts as a competitive SDH inhibitor in immune cells, similar to the mechanisms described previously for the inhibition of purified SDH (
      • Ackermann W.W.
      • Potter V.R.
      Enzyme inhibition in relation to chemotherapy.
      ) and purified isocitrate lyase (
      • Williams J.O.
      • Roche T.E.
      • McFadden B.A.
      Mechanism of action of isocitrate lyase from Pseudomonas indigofera.
      ).
      Figure thumbnail gr5
      FIGURE 5Itaconate inhibits SDH. a and b, itaconate inhibits the OCR in (a) RAW 264. 7 macrophages and (b) BMDMs in a dose-dependent manner. Shown are normalized OCRs of resting permeabilized cells exposed to increasing itaconate concentrations (0, 2.5, 5, 10, and 25 mm) with either 10 mm (continuous line) or 2.5 mm (dashed line) succinate. Data represent the mean ± S.E. of three repeated experiments. c, itaconate inhibits SDH of the respiratory chain. Shown is the normalized maximal uncoupled OCR of permeabilized resting RAW 264.7 macrophages exposed to various substrates in the presence of 0 mm (black) or 10 mm (white) itaconate. Data represent the mean ± S.E. of three repeated experiments normalized to conditions with 0 mm itaconate and 10 mm succinate.
      Next, to confirm that itaconate specifically inhibits SDH rather than other mitochondrial pathways, we offered permeabilized RAW 264.7 macrophages various oxidizable substrates and compared the maximal uncoupler-stimulated OCR in the presence of 0 and 10 mm itaconate (Fig. 5c). As expected, itaconate supplementation significantly reduced respiration (>75%) in the presence of succinate (SDH substrate) and rotenone (complex I inhibitor). On the other hand, oxygen consumption rates in permeabilized cells in the presence of either pyruvate with malate or glutamate with malate, substrates that drive respiration via complex I activity, were not affected by itaconate supplementation. Additionally, ascorbate and TMPD were used to supply electrons for complex IV activity in the presence of antimycin A, an inhibitor of complex III. Itaconate also failed to impact this complex IV-mediated respiration. Together, these data provide evidence that itaconate contributes to succinate accumulation in macrophages by acting as an endogenous SDH inhibitor.

       Loss of Irg1 Influences Succinate Levels in BMDMs

      To determine how succinate levels are affected in the absence of endogenously produced itaconate, we analyzed BMDMs derived from Irg1 KO mice. We confirmed that Irg1 mRNA was not expressed in LPS-stimulated KO-derived BMDMs (Fig. 6a). Consistent with this result, LPS-stimulated BMDMs from Irg1 KO mice failed to produce significant levels of itaconate (Fig. 6b). Notably, succinate concentrations in stimulated BMDMs from Irg1 KO mice were significantly lower than those quantified in BMDMs from WT mice, suggesting that CAD-derived itaconate influences succinate accumulation in LPS-induced macrophages (Fig. 6c).
      Figure thumbnail gr6
      FIGURE 6Loss of Irg1 decreases itaconate and succinate levels in Irg1 KO BMDMs. a, Irg1 expression levels in LPS-activated (24 h, 10 ng·ml−1 LPS) BMDMs obtained from Irg1 KO and WT mice. Error bars represent expression levels obtained from two independent mice (mean ± S.E.) relative to L27. b and c, itaconate and succinate levels in BMDMs obtained from Irg1 KO and WT mice. Cells were activated for 6 h with 10 ng·ml−1 LPS. Error bars represent mean ± S.E. of metabolite levels [mm] of six biological replicates obtained from two independent mice.
      These results provide evidence that Irg1-mediated itaconate production plays a role in succinate accumulation within immune cells. Taken together, our data highlight a mechanistic function of itaconate whereby this metabolite acts as a SDH inhibitor to influence TCA cycle metabolism by driving succinate accumulation (Fig. 7).
      Figure thumbnail gr7
      FIGURE 7Mechanism of LPS-induced succinate accumulation. Under inflammatory conditions, such as LPS stimulation, mammalian CAD catalyzes the decarboxylation of the TCA cycle intermediate cis-aconitate to produce itaconate. This metabolite contributes to succinate accumulation in macrophages by acting as an endogenous SDH inhibitor.

      Discussion

      Here we have demonstrated an important function of itaconate; it acts as a key regulatory metabolite to modulate TCA metabolism and succinate levels. In the cells studied, exogenous and endogenous, CAD-produced itaconate strongly correlated with succinate accumulation. Substrate-specific respirometry studies in permeabilized cells confirmed that itaconate acts as an SDH inhibitor. Finally, modulation of endogenous itaconate production in LPS-activated primary macrophages from Irg1 KO mice reduces succinate levels. Thus, itaconate alters mitochondrial metabolism to influence succinate accumulation in macrophages (Fig. 7).
      Numerous metabolic pathways have been implicated in the metabolic reprogramming of immune cells, in particular those that regulate succinate levels, which, in turn, can influence HIF signaling or other pathways (
      • Mills E.
      • O'Neill L.A.
      Succinate: a metabolic signal in inflammation.
      ,
      • Jha A.K.
      • Huang S.C.
      • Sergushichev A.
      • Lampropoulou V.
      • Ivanova Y.
      • Loginicheva E.
      • Chmielewski K.
      • Stewart K.M.
      • Ashall J.
      • Everts B.
      • Pearce E.J.
      • Driggers E.M.
      • Artyomov M.N.
      Network integration of parallel metabolic and transcriptional data reveals metabolic modules that regulate macrophage polarization.
      ,
      • Chouchani E.T.
      • Pell V.R.
      • James A.M.
      • Work L.M.
      • Saeb-Parsy K.
      • Frezza C.
      • Krieg T.
      • Murphy M.P.
      A unifying mechanism for mitochondrial superoxide production during ischemia-reperfusion injury.
      ,
      • Chouchani E.T.
      • Pell V.R.
      • Gaude E.
      • Aksentijević D.
      • Sundier S.Y.
      • Robb E.L.
      • Logan A.
      • Nadtochiy S.M.
      • Ord E.N.J.
      • Smith A.C.
      • Eyassu F.
      • Shirley R.
      • Hu C.-H.
      • Dare A.J.
      • James A.M.
      • et al.
      Ischaemic accumulation of succinate controls reperfusion injury through mitochondrial ROS.
      ). Glutamine serves as a major carbon source for succinate production in LPS-activated macrophages via α-ketoglutarate or, alternatively, through the GABA shunt (
      • Tannahill G.M.
      • Curtis A.M.
      • Adamik J.
      • Palsson-McDermott E.M.
      • McGettrick A.F.
      • Goel G.
      • Frezza C.
      • Bernard N.J.
      • Kelly B.
      • Foley N.H.
      • Zheng L.
      • Gardet A.
      • Tong Z.
      • Jany S.S.
      • Corr S.C.
      • et al.
      Succinate is an inflammatory signal that induces IL-1β through HIF-1α.
      ). A recent systems-based analysis of macrophages under proinflammatory conditions described key break points in TCA metabolism at isocitrate dehydrogenase and SDH (
      • Jha A.K.
      • Huang S.C.
      • Sergushichev A.
      • Lampropoulou V.
      • Ivanova Y.
      • Loginicheva E.
      • Chmielewski K.
      • Stewart K.M.
      • Ashall J.
      • Everts B.
      • Pearce E.J.
      • Driggers E.M.
      • Artyomov M.N.
      Network integration of parallel metabolic and transcriptional data reveals metabolic modules that regulate macrophage polarization.
      ). We have now identified a functional link between these nodes of the TCA cycle, where itaconate produced by mammalian CAD at the first break-point regulates SDH activity at the second break point. Within our analyses, we did observe variability in succinate accumulation upon LPS stimulation when comparing RAW 264.7 macrophages and BMDMs. This variance is in the range of succinate accumulation levels reported by others and is likely a function of cell, medium formulation, and LPS variability (
      • Tannahill G.M.
      • Curtis A.M.
      • Adamik J.
      • Palsson-McDermott E.M.
      • McGettrick A.F.
      • Goel G.
      • Frezza C.
      • Bernard N.J.
      • Kelly B.
      • Foley N.H.
      • Zheng L.
      • Gardet A.
      • Tong Z.
      • Jany S.S.
      • Corr S.C.
      • et al.
      Succinate is an inflammatory signal that induces IL-1β through HIF-1α.
      ). However, we consistently observed increased succinate downstream of itaconate production or administration in a variety of cell types.
      Succinate accumulation plays important roles during inflammation so that it contributes to the induction of Il-1β expression via HIF-1α stabilization (
      • Tannahill G.M.
      • Curtis A.M.
      • Adamik J.
      • Palsson-McDermott E.M.
      • McGettrick A.F.
      • Goel G.
      • Frezza C.
      • Bernard N.J.
      • Kelly B.
      • Foley N.H.
      • Zheng L.
      • Gardet A.
      • Tong Z.
      • Jany S.S.
      • Corr S.C.
      • et al.
      Succinate is an inflammatory signal that induces IL-1β through HIF-1α.
      ). Our results suggest that Irg1-mediated itaconate production may influence downstream inflammatory responses in macrophages (e.g. expression of Il-1β or associated inflammatory genes). At present, it is not known whether this inflammatory response is accomplished directly by succinate or itaconate or mediated through other mechanisms. Succinate inhibits HIF-1α signaling through inhibition of PHD2 but can also impact the activity of numerous α-ketoglutarate-dependent dioxygenases (
      • Xiao M.
      • Yang H.
      • Xu W.
      • Ma S.
      • Lin H.
      • Zhu H.
      • Liu L.
      • Liu Y.
      • Yang C.
      • Xu Y.
      • Zhao S.
      • Ye D.
      • Xiong Y.
      • Guan K.-L.
      Inhibition of α-KG-dependent histone and DNA demethylases by fumarate and succinate that are accumulated in mutations of FH and SDH tumor suppressors.
      ,
      • Metallo C.M.
      • Vander Heiden M.G.
      Understanding metabolic regulation and its influence on cell physiology.
      ). As such, itaconate may have pleiotropic effects on cells depending on the expression, Ki, and compartment-specific impacts on succinate concentrations. However, the physiological role of itaconate and Irg1 require further investigations, particularly in the context of macrophage development and differentiation. As noted above, various other pathways (e.g. GABA shunt, glutaminolysis) contribute to succinate synthesis in macrophages and could allow compensation (
      • Tannahill G.M.
      • Curtis A.M.
      • Adamik J.
      • Palsson-McDermott E.M.
      • McGettrick A.F.
      • Goel G.
      • Frezza C.
      • Bernard N.J.
      • Kelly B.
      • Foley N.H.
      • Zheng L.
      • Gardet A.
      • Tong Z.
      • Jany S.S.
      • Corr S.C.
      • et al.
      Succinate is an inflammatory signal that induces IL-1β through HIF-1α.
      ,
      • Mills E.
      • O'Neill L.A.
      Succinate: a metabolic signal in inflammation.
      ,
      • Palsson-McDermott E.M.
      • Curtis A.M.
      • Goel G.
      • Lauterbach M.A.
      • Sheedy F.J.
      • Gleeson L.E.
      • van den Bosch M.W.
      • Quinn S.R.
      • Domingo-Fernandez R.
      • Johnson D.G.
      • Jiang J.K.
      • Israelsen W.J.
      • Keane J.
      • Thomas C.
      • Clish C.
      • et al.
      Pyruvate kinase M2 regulates Hif-1α activity and IL-1β induction and is a critical determinant of the Warburg effect in LPS-activated macrophages.
      ). Intracellular signaling pathways also play key roles in macrophage polarization and likely sustain inflammation to some degree in the absence of Irg1 (
      • Sica A.
      • Mantovani A.
      Macrophage plasticity and polarization: in vivo veritas.
      ).
      Given the diverse effects of inflammation in human disease, the mechanistic interplay between itaconate and succinate is of clinical interest. Itaconate was only recently identified as an endogenous mammalian biochemical (
      • Strelko C.L.
      • Lu W.
      • Dufort F.J.
      • Seyfried T.N.
      • Chiles T.C.
      • Rabinowitz J.D.
      • Roberts M.F.
      Itaconic acid is a mammalian metabolite induced during macrophage activation.
      ), and subsequent studies demonstrated that this molecule was produced by mammalian CAD activity on cis-aconitate (
      • Michelucci A.
      • Cordes T.
      • Ghelfi J.
      • Pailot A.
      • Reiling N.
      • Goldmann O.
      • Binz T.
      • Wegner A.
      • Tallam A.
      • Rausell A.
      • Buttini M.
      • Linster C.L.
      • Medina E.
      • Balling R.
      • Hiller K.
      Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.
      ). Itaconate reprograms the metabolism of pathogens, such as Mycobacterium tuberculosis, by inhibition of isocitrate lyase, a key enzyme in the glyoxylate shunt (
      • Eoh H.
      • Rhee K.Y.
      Methylcitrate cycle defines the bactericidal essentiality of isocitrate lyase for survival of Mycobacterium tuberculosis on fatty acids.
      ); thus, macrophages produce the antimicrobial metabolite itaconate to combat against invading pathogens (
      • Michelucci A.
      • Cordes T.
      • Ghelfi J.
      • Pailot A.
      • Reiling N.
      • Goldmann O.
      • Binz T.
      • Wegner A.
      • Tallam A.
      • Rausell A.
      • Buttini M.
      • Linster C.L.
      • Medina E.
      • Balling R.
      • Hiller K.
      Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.
      ). Following these discoveries, it has recently been speculated that itaconate might contribute to the function of innate immune cells (
      • Kelly B.
      • O'Neill L.A.
      Metabolic reprogramming in macrophages and dendritic cells in innate immunity.
      ,
      • Cordes T.
      • Michelucci A.
      • Hiller K.
      Itaconic acid: the surprising role of an industrial compound as a mammalian antimicrobial metabolite.
      ). Importantly, IRG1 is induced by various non-bacterial stimuli, including influenza A viral infection (
      • Preusse M.
      • Tantawy M.A.
      • Klawonn F.
      • Schughart K.
      • Pessler F.
      Infection- and procedure-dependent effects on pulmonary gene expression in the early phase of influenza A virus infection in mice.
      ), Marek disease infection (
      • Smith J.
      • Sadeyen J.-R.
      • Paton I.R.
      • Hocking P.M.
      • Salmon N.
      • Fife M.
      • Nair V.
      • Burt D.W.
      • Kaiser P.
      Systems analysis of immune responses in Marek's disease virus-infected chickens identifies a gene involved in susceptibility and highlights a possible novel pathogenicity mechanism.
      ), during embryonic implantation (
      • Cheon Y.-P.
      • Xu X.
      • Bagchi M.K.
      • Bagchi I.C.
      Immune-responsive gene 1 is a novel target of progesterone receptor and plays a critical role during implantation in the mouse.
      ), neurotropic viral infections of neurons (
      • Cho H.
      • Proll S.C.
      • Szretter K.J.
      • Katze M.G.
      • Gale Jr., M.
      • Diamond M.S.
      Differential innate immune response programs in neuronal subtypes determine susceptibility to infection in the brain by positive-stranded RNA viruses.
      ), and in murine epidermal cells (
      • Hall C.J.
      • Boyle R.H.
      • Sun X.
      • Wicker S.M.
      • Misa J.P.
      • Krissansen G.W.
      • Print C.G.
      • Crosier K.E.
      • Crosier P.S.
      Epidermal cells help coordinate leukocyte migration during inflammation through fatty acid-fuelled matrix metalloproteinase production.
      ). Given the regulatory role of itaconate in succinate accumulation described here, IRG1-mediated itaconate production may act as a signaling molecule in other inflammatory situations or cellular states. Indeed, succinate can inhibit various other α-ketoglutarate-dependent dioxygenases to impact diverse cellular processes (
      • Xiao M.
      • Yang H.
      • Xu W.
      • Ma S.
      • Lin H.
      • Zhu H.
      • Liu L.
      • Liu Y.
      • Yang C.
      • Xu Y.
      • Zhao S.
      • Ye D.
      • Xiong Y.
      • Guan K.-L.
      Inhibition of α-KG-dependent histone and DNA demethylases by fumarate and succinate that are accumulated in mutations of FH and SDH tumor suppressors.
      ,
      • Metallo C.M.
      • Vander Heiden M.G.
      Understanding metabolic regulation and its influence on cell physiology.
      ). On the other hand, the mechanism outlined here for SDH inhibition could be used to mitigate pathogenic inflammation under certain circumstances (e.g. via CAD inhibition). For example, high levels of succinate have also been reported to occur under ischemic conditions because of reverse SDH activity (
      • Chouchani E.T.
      • Pell V.R.
      • James A.M.
      • Work L.M.
      • Saeb-Parsy K.
      • Frezza C.
      • Krieg T.
      • Murphy M.P.
      A unifying mechanism for mitochondrial superoxide production during ischemia-reperfusion injury.
      ,
      • Chouchani E.T.
      • Pell V.R.
      • Gaude E.
      • Aksentijević D.
      • Sundier S.Y.
      • Robb E.L.
      • Logan A.
      • Nadtochiy S.M.
      • Ord E.N.J.
      • Smith A.C.
      • Eyassu F.
      • Shirley R.
      • Hu C.-H.
      • Dare A.J.
      • James A.M.
      • et al.
      Ischaemic accumulation of succinate controls reperfusion injury through mitochondrial ROS.
      ). The accumulated succinate is rapidly oxidized after reperfusion, resulting in increased mitochondrial reactive oxygen species production and damage. A similar mechanism has been speculated to occur during sepsis (
      • Bar-Or D.
      • Carrick M.M.
      • Mains C.W.
      • Rael L.T.
      • Slone D.
      • Brody E.N.
      Sepsis, oxidative stress, and hypoxia: are there clues to better treatment?.
      ). Notably, SDH inhibition protected against brain injury after ischemia/reperfusion (
      • Chouchani E.T.
      • Pell V.R.
      • James A.M.
      • Work L.M.
      • Saeb-Parsy K.
      • Frezza C.
      • Krieg T.
      • Murphy M.P.
      A unifying mechanism for mitochondrial superoxide production during ischemia-reperfusion injury.
      ,
      • Chouchani E.T.
      • Pell V.R.
      • Gaude E.
      • Aksentijević D.
      • Sundier S.Y.
      • Robb E.L.
      • Logan A.
      • Nadtochiy S.M.
      • Ord E.N.J.
      • Smith A.C.
      • Eyassu F.
      • Shirley R.
      • Hu C.-H.
      • Dare A.J.
      • James A.M.
      • et al.
      Ischaemic accumulation of succinate controls reperfusion injury through mitochondrial ROS.
      ), suggesting that inhibition of SDH by endogenously produced itaconate may buffer against potential oxidative damage that can occur under such conditions.
      Our findings provide critical new insights into the regulatory machinery governing TCA cycle function, with mammalian CAD-produced itaconate serving as a metabolic inhibitor to cause succinate accumulation. Ultimately, these results may be clinically important when drugs that target such metabolic inflammatory signals are identified. The emerging role of itaconate as a regulatory molecule to reprogram immune cell metabolism provides an intriguing link between innate immunity, metabolism, and disease pathogenesis.

      Author Contributions

      T. C., M. W., K. H., and C. M. M. designed the research. A. S. D. and A. N. M. designed the oxygen consumption assays. T. C. performed the experiments and analyzed the data. T. C., M. W., and P. C. isolated primary BMDMs. H. K. derived the Irg1 KO mice. A. M., C. S., and S. C. S. performed the experiments with Irg1 KO BMDMs. T. C. and C. M. M. wrote the manuscript.

      Acknowledgments

      We thank Gregory Fonseca and Rudi Balling for helpful discussions.

      References

        • Akira S.
        • Uematsu S.
        • Takeuchi O.
        Pathogen recognition and innate immunity.
        Cell. 2006; 124: 783-801
        • Kelly B.
        • O'Neill L.A.
        Metabolic reprogramming in macrophages and dendritic cells in innate immunity.
        Cell Res. 2015; 25: 771-784
        • Krawczyk C.M.
        • Holowka T.
        • Sun J.
        • Blagih J.
        • Amiel E.
        • DeBerardinis R.J.
        • Cross J.R.
        • Jung E.
        • Thompson C.B.
        • Jones R.G.
        • Pearce E.J.
        Toll-like receptor-induced changes in glycolytic metabolism regulate dendritic cell activation.
        Blood. 2010; 115: 4742-4749
        • Pearce E.L.
        • Pearce E.J.
        Metabolic pathways in immune cell activation and quiescence.
        Immunity. 2013; 38: 633-643
        • Rodríguez-Prados J.-C.
        • Través P.G.
        • Cuenca J.
        • Rico D.
        • Aragonés J.
        • Martín-Sanz P.
        • Cascante M.
        • Boscá L.
        Substrate fate in activated macrophages: a comparison between innate, classic, and alternative activation.
        J. Immunol. 2010; 185: 605-614
        • Kempf V.A.
        • Lebiedziejewski M.
        • Alitalo K.
        • Wälzlein J.-H.
        • Ehehalt U.
        • Fiebig J.
        • Huber S.
        • Schütt B.
        • Sander C.A.
        • Müller S.
        • Grassl G.
        • Yazdi A.S.
        • Brehm B.
        • Autenrieth I.B.
        Activation of hypoxia-inducible factor-1 in bacillary angiomatosis: evidence for a role of hypoxia-inducible factor-1 in bacterial infections.
        Circulation. 2005; 111: 1054-1062
        • Blouin C.C.
        • Pagé E.L.
        • Soucy G.M.
        • Richard D.E.
        Hypoxic gene activation by lipopolysaccharide in macrophages: implication of hypoxia-inducible factor 1α.
        Blood. 2004; 103: 1124-1130
        • Hellwig-Bürgel T.
        • Rutkowski K.
        • Metzen E.
        • Fandrey J.
        • Jelkmann W.
        Interleukin-1β and tumor necrosis factor-α stimulate DNA binding of hypoxia-inducible factor-1.
        Blood. 1999; 94: 1561-1567
        • Tannahill G.M.
        • Curtis A.M.
        • Adamik J.
        • Palsson-McDermott E.M.
        • McGettrick A.F.
        • Goel G.
        • Frezza C.
        • Bernard N.J.
        • Kelly B.
        • Foley N.H.
        • Zheng L.
        • Gardet A.
        • Tong Z.
        • Jany S.S.
        • Corr S.C.
        • et al.
        Succinate is an inflammatory signal that induces IL-1β through HIF-1α.
        Nature. 2013; 496: 238-242
        • Selak M.A.
        • Armour S.M.
        • MacKenzie E.D.
        • Boulahbel H.
        • Watson D.G.
        • Mansfield K.D.
        • Pan Y.
        • Simon M.C.
        • Thompson C.B.
        • Gottlieb E.
        Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.
        Cancer Cell. 2005; 7: 77-85
        • Epstein A.C.
        • Gleadle J.M.
        • McNeill L.A.
        • Hewitson K.S.
        • O'Rourke J.
        • Mole D.R.
        • Mukherji M.
        • Metzen E.
        • Wilson M.I.
        • Dhanda A.
        • Tian Y.M.
        • Masson N.
        • Hamilton D.L.
        • Jaakkola P.
        • Barstead R.
        • Hodgkin J.
        • Maxwell P.H.
        • Pugh C.W.
        • Schofield C.J.
        • Ratcliffe P.J.
        C. elegans EGL-9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation.
        Cell. 2001; 107: 43-54
        • Losman J.-A.
        • Kaelin Jr., W.G.
        What a difference a hydroxyl makes: mutant IDH, (R)-2-hydroxyglutarate, and cancer.
        Genes Dev. 2013; 27: 836-852
        • Mills E.
        • O'Neill L.A.
        Succinate: a metabolic signal in inflammation.
        Trends Cell Biol. 2014; 24: 313-320
        • Palsson-McDermott E.M.
        • Curtis A.M.
        • Goel G.
        • Lauterbach M.A.
        • Sheedy F.J.
        • Gleeson L.E.
        • van den Bosch M.W.
        • Quinn S.R.
        • Domingo-Fernandez R.
        • Johnson D.G.
        • Jiang J.K.
        • Israelsen W.J.
        • Keane J.
        • Thomas C.
        • Clish C.
        • et al.
        Pyruvate kinase M2 regulates Hif-1α activity and IL-1β induction and is a critical determinant of the Warburg effect in LPS-activated macrophages.
        Cell Metab. 2015; 21: 65-80
        • Wegner A.
        • Meiser J.
        • Weindl D.
        • Hiller K.
        How metabolites modulate metabolic flux.
        Curr. Opin. Biotechnol. 2015; 34: 16-22
        • Bailey E.
        • Stirpe F.
        • Taylor C.B.
        Regulation of rat liver pyruvate kinase. The effect of preincubation, pH, copper ions, fructose 1,6-diphosphate and dietary changes on enzyme activity.
        Biochem. J. 1968; 108: 427-436
        • Chaneton B.
        • Hillmann P.
        • Zheng L.
        • Martin A.C.
        • Maddocks O.D.
        • Chokkathukalam A.
        • Coyle J.E.
        • Jankevics A.
        • Holding F.P.
        • Vousden K.H.
        • Frezza C.
        • O'Reilly M.
        • Gottlieb E.
        Serine is a natural ligand and allosteric activator of pyruvate kinase M2.
        Nature. 2012; 491: 458-462
        • Chaneton B.
        • Gottlieb E.
        Rocking cell metabolism: revised functions of the key glycolytic regulator PKM2 in cancer.
        Trends Biochem. Sci. 2012; 37: 309-316
        • Strelko C.L.
        • Lu W.
        • Dufort F.J.
        • Seyfried T.N.
        • Chiles T.C.
        • Rabinowitz J.D.
        • Roberts M.F.
        Itaconic acid is a mammalian metabolite induced during macrophage activation.
        J. Am. Chem. Soc. 2011; 133: 16386-16389
        • Michelucci A.
        • Cordes T.
        • Ghelfi J.
        • Pailot A.
        • Reiling N.
        • Goldmann O.
        • Binz T.
        • Wegner A.
        • Tallam A.
        • Rausell A.
        • Buttini M.
        • Linster C.L.
        • Medina E.
        • Balling R.
        • Hiller K.
        Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.
        Proc. Natl. Acad. Sci. U.S.A. 2013; 110: 7820-7825
        • Patel T.R.
        • McFadden B.A.
        Caenorhabditis elegans and Ascaris suum: inhibition of isocitrate lyase by itaconate.
        Exp. Parasitol. 1978; 44: 262-268
        • Williams J.O.
        • Roche T.E.
        • McFadden B.A.
        Mechanism of action of isocitrate lyase from Pseudomonas indigofera.
        Biochemistry. 1971; 10: 1384-1390
        • McFadden B.A.
        • Purohit S.
        Itaconate, an isocitrate lyase-directed inhibitor in Pseudomonas indigofera.
        J. Bacteriol. 1977; 131: 136-144
        • O'Neill L.A.
        A broken Krebs cycle in macrophages.
        Immunity. 2015; 42: 393-394
        • Jha A.K.
        • Huang S.C.
        • Sergushichev A.
        • Lampropoulou V.
        • Ivanova Y.
        • Loginicheva E.
        • Chmielewski K.
        • Stewart K.M.
        • Ashall J.
        • Everts B.
        • Pearce E.J.
        • Driggers E.M.
        • Artyomov M.N.
        Network integration of parallel metabolic and transcriptional data reveals metabolic modules that regulate macrophage polarization.
        Immunity. 2015; 42: 419-430
        • Booth A.N.
        • Taylor J.
        • Wilson R.H.
        • Deeds F.
        The inhibitory effects of itaconic acid in vitro and in vivo.
        J. Biol. Chem. 1952; 195: 697-702
        • Ackermann W.W.
        • Potter V.R.
        Enzyme inhibition in relation to chemotherapy.
        Proc. Soc. Exp. Biol. Med. 1949; 72: 1-9
        • Dervartanian D.V.
        • Veeger C.
        Studies on succinate dehydrogenase: I: spectral properties of the purified enzyme and formation of enzyme-competitive inhibitor complexes.
        Biochim. Biophys. Acta. 1964; 92: 233-247
        • Raschke W.C.
        • Baird S.
        • Ralph P.
        • Nakoinz I.
        Functional macrophage cell lines transformed by Abelson leukemia virus.
        Cell. 1978; 15: 261-267
        • Giard D.J.
        • Aaronson S.A.
        • Todaro G.J.
        • Arnstein P.
        • Kersey J.H.
        • Dosik H.
        • Parks W.P.
        In vitro cultivation of human tumors: establishment of cell lines derived from a series of solid tumors.
        J. Natl. Cancer Inst. 1973; 51: 1417-1423
        • Zhang X.
        • Goncalves R.
        • Mosser D.M.
        The isolation and characterization of murine macrophages.
        Curr. Protoc. Immunol. 2008; (Chapter 14, Unit 14.1)
        • Divakaruni A.S.
        • Rogers G.W.
        • Murphy A.N.
        Measuring mitochondrial function in permeabilized cells using the Seahorse XF analyzer or a Clark-type oxygen electrode.
        Curr. Protoc. Toxicol. 2014; 60: 25.2.1-25.2.16
        • R Core Team
        R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria2013
        • Cooper R.A.
        • Kornberg H.L.
        The utilization of itaconate by Pseudomonas sp.
        Biochem. J. 1964; 91: 82-91
        • Adler J.
        • Wang S.-F.
        • Lardy H.A.
        The metabolism of itaconic acid by liver mitochondria.
        J. Biol. Chem. 1957; 229: 865-879
        • Metallo C.M.
        • Gameiro P.A.
        • Bell E.L.
        • Mattaini K.R.
        • Yang J.
        • Hiller K.
        • Jewell C.M.
        • Johnson Z.R.
        • Irvine D.J.
        • Guarente L.
        • Kelleher J.K.
        • Vander Heiden M.G.
        • Iliopoulos O.
        • Stephanopoulos G.
        Reductive glutamine metabolism by IDH1 mediates lipogenesis under hypoxia.
        Nature. 2012; 481: 380-384
        • Németh B.
        • Doczi J.
        • Csete D.
        • Kacso G.
        • Ravasz D.
        • Adams D.
        • Kiss G.
        • Nagy A.M.
        • Horvath G.
        • Tretter L.
        • Mócsai A.
        • Csépányi-Kömi R.
        • Iordanov I.
        • Adam-Vizi V.
        • Chinopoulos C.
        Abolition of mitochondrial substrate-level phosphorylation by itaconic acid produced by LPS-induced Irg1 expression in cells of murine macrophage lineage.
        FASEB J. 2015;
        • Degrandi D.
        • Hoffmann R.
        • Beuter-Gunia C.
        • Pfeffer K.
        The proinflammatory cytokine-induced IRG1 protein associates with mitochondria.
        J. Interferon Cytokine Res. 2009; 29: 55-67
        • Wojtczak L.
        • Wojtczak A.B.
        • Ernster L.
        The inhibition of succinate dehydrogenase by oxaloacetate.
        Biochim. Biophys. Acta. 1969; 191: 10-21
        • Chouchani E.T.
        • Pell V.R.
        • James A.M.
        • Work L.M.
        • Saeb-Parsy K.
        • Frezza C.
        • Krieg T.
        • Murphy M.P.
        A unifying mechanism for mitochondrial superoxide production during ischemia-reperfusion injury.
        Cell Metab. 2016; 23: 254-263
        • Chouchani E.T.
        • Pell V.R.
        • Gaude E.
        • Aksentijević D.
        • Sundier S.Y.
        • Robb E.L.
        • Logan A.
        • Nadtochiy S.M.
        • Ord E.N.J.
        • Smith A.C.
        • Eyassu F.
        • Shirley R.
        • Hu C.-H.
        • Dare A.J.
        • James A.M.
        • et al.
        Ischaemic accumulation of succinate controls reperfusion injury through mitochondrial ROS.
        Nature. 2014; 515: 431-435
        • Xiao M.
        • Yang H.
        • Xu W.
        • Ma S.
        • Lin H.
        • Zhu H.
        • Liu L.
        • Liu Y.
        • Yang C.
        • Xu Y.
        • Zhao S.
        • Ye D.
        • Xiong Y.
        • Guan K.-L.
        Inhibition of α-KG-dependent histone and DNA demethylases by fumarate and succinate that are accumulated in mutations of FH and SDH tumor suppressors.
        Genes Dev. 2012; 26: 1326-1338
        • Metallo C.M.
        • Vander Heiden M.G.
        Understanding metabolic regulation and its influence on cell physiology.
        Mol. Cell. 2013; 49: 388-398
        • Sica A.
        • Mantovani A.
        Macrophage plasticity and polarization: in vivo veritas.
        J. Clin. Invest. 2012; 122: 787-795
        • Eoh H.
        • Rhee K.Y.
        Methylcitrate cycle defines the bactericidal essentiality of isocitrate lyase for survival of Mycobacterium tuberculosis on fatty acids.
        Proc. Natl. Acad. Sci. U.S.A. 2014; 111: 4976-4981
        • Cordes T.
        • Michelucci A.
        • Hiller K.
        Itaconic acid: the surprising role of an industrial compound as a mammalian antimicrobial metabolite.
        Annu. Rev. Nutr. 2015; 35: 451-473
        • Preusse M.
        • Tantawy M.A.
        • Klawonn F.
        • Schughart K.
        • Pessler F.
        Infection- and procedure-dependent effects on pulmonary gene expression in the early phase of influenza A virus infection in mice.
        BMC Microbiol. 2013; 13: 293
        • Smith J.
        • Sadeyen J.-R.
        • Paton I.R.
        • Hocking P.M.
        • Salmon N.
        • Fife M.
        • Nair V.
        • Burt D.W.
        • Kaiser P.
        Systems analysis of immune responses in Marek's disease virus-infected chickens identifies a gene involved in susceptibility and highlights a possible novel pathogenicity mechanism.
        J. Virol. 2011; 85: 11146-11158
        • Cheon Y.-P.
        • Xu X.
        • Bagchi M.K.
        • Bagchi I.C.
        Immune-responsive gene 1 is a novel target of progesterone receptor and plays a critical role during implantation in the mouse.
        Endocrinology. 2003; 144: 5623-5630
        • Cho H.
        • Proll S.C.
        • Szretter K.J.
        • Katze M.G.
        • Gale Jr., M.
        • Diamond M.S.
        Differential innate immune response programs in neuronal subtypes determine susceptibility to infection in the brain by positive-stranded RNA viruses.
        Nat. Med. 2013; 19: 458-464
        • Hall C.J.
        • Boyle R.H.
        • Sun X.
        • Wicker S.M.
        • Misa J.P.
        • Krissansen G.W.
        • Print C.G.
        • Crosier K.E.
        • Crosier P.S.
        Epidermal cells help coordinate leukocyte migration during inflammation through fatty acid-fuelled matrix metalloproteinase production.
        Nat. Commun. 2014; 5: 3880
        • Bar-Or D.
        • Carrick M.M.
        • Mains C.W.
        • Rael L.T.
        • Slone D.
        • Brody E.N.
        Sepsis, oxidative stress, and hypoxia: are there clues to better treatment?.
        Redox Rep. 2015; 20: 193-197