If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
From the Department of Food Science and the Rutgers Center for Lipid Research, New Jersey Institute for Food, Nutrition, and Health, Rutgers University, New Brunswick, New Jersey 08901
From the Department of Food Science and the Rutgers Center for Lipid Research, New Jersey Institute for Food, Nutrition, and Health, Rutgers University, New Brunswick, New Jersey 08901
2 In this paper, Saccharomyces cerevisiae is used interchangeably with yeast. 4 The PAP encoded by PAH1 differs from the lipid phosphate phosphatase enzymes encoded by APP1 (83, 84), DPP1 (85), and LPP1 (86), which dephosphorylate a broad spectrum of substrates (e.g. PA, lyso-PA, DAG pyrophosphate, and isoprenoid pyrophosphate) and are not involved in de novo lipid synthesis. 5 The S. cerevisiae PSS differs from the enzyme from Gram-negative bacteria (e.g. E. coli), which catalyzes its CDP–DAG–dependent reaction via a metal cofactor–independent ping-pong reaction mechanism (87), or the enzyme from mammalian cells, which catalyzes an exchange reaction between PC or PE and serine (88).
The PAH1-encoded phosphatidate phosphatase (PAP), which catalyzes the committed step for the synthesis of triacylglycerol in Saccharomyces cerevisiae, exerts a negative regulatory effect on the level of phosphatidate used for the de novo synthesis of membrane phospholipids. This raises the question whether PAP thereby affects the expression and activity of enzymes involved in phospholipid synthesis. Here, we examined the PAP-mediated regulation of CHO1-encoded phosphatidylserine synthase (PSS), which catalyzes the committed step for the synthesis of major phospholipids via the CDP–diacylglycerol pathway. The lack of PAP in the pah1Δ mutant highly elevated PSS activity, exhibiting a growth-dependent up-regulation from the exponential to the stationary phase of growth. Immunoblot analysis showed that the elevation of PSS activity results from an increase in the level of the enzyme encoded by CHO1. Truncation analysis and site-directed mutagenesis of the CHO1 promoter indicated that Cho1 expression in the pah1Δ mutant is induced through the inositol-sensitive upstream activation sequence (UASINO), a cis-acting element for the phosphatidate-controlled Henry (Ino2–Ino4/Opi1) regulatory circuit. The abrogation of Cho1 induction and PSS activity by a CHO1 UASINO mutation suppressed pah1Δ effects on lipid synthesis, nuclear/endoplasmic reticulum membrane morphology, and lipid droplet formation, but not on growth at elevated temperature. Loss of the DGK1-encoded diacylglycerol kinase, which converts diacylglycerol to phosphatidate, partially suppressed the pah1Δ-mediated induction of Cho1 and PSS activity. Collectively, these data showed that PAP activity controls the expression of PSS for membrane phospholipid synthesis.
), which dephosphorylate a broad spectrum of substrates (e.g. PA, lyso-PA, DAG pyrophosphate, and isoprenoid pyrophosphate) and are not involved in de novo lipid synthesis.
The S. cerevisiae PSS differs from the enzyme from Gram-negative bacteria (e.g. E. coli), which catalyzes its CDP–DAG–dependent reaction via a metal cofactor–independent ping-pong reaction mechanism (
Ribosomal-associated phosphatidylserine synthetase from Escherichia coli: purification by substrate-specific elution from phosphocellulose using cytidine 5′-diphospho-1,2-diacyl-sn-glycerol.
). The PAP reaction is the committed step for the synthesis of the neutral lipid TAG, whereas the PSS reaction is the committed step in the CDP–DAG pathway for the de novo synthesis of the major membrane phospholipids PC and PE (
) (Fig. 1). The DAG derived from the PAP reaction is also used in the CDP-choline and CDP-ethanolamine branches of the Kennedy pathway for the synthesis of PC and PE, respectively, when cells defective in PSS or other enzymes in the CDP–DAG pathway are supplemented with choline or ethanolamine (
) (Fig. 1). For catalytic function, both Cho1 and Pah1 are required to associate with the membrane where their phospholipid substrates reside; Cho1 is an integral membrane enzyme in the ER (
The spatial organization of lipid synthesis in the yeast Saccharomyces cerevisiae derived from large scale green fluorescent protein tagging and high resolution microscopy.
Figure 1.Lipid synthesis in yeast. The pathways shown for the synthesis of lipids include the relevant steps discussed in this work. A more comprehensive figure for the synthesis of TAG and membrane phospholipids via the CDP–DAG and Kennedy pathways may be found in Ref.
. The CDP–DAG pathway of phospholipid synthesis is highlighted in blue, whereas the Kennedy pathway is shown in gray to indicate its minor role in phospholipid synthesis in cells grown without choline (Cho) or ethanolamine (Etn). The reactions catalyzed by the CHO1-encoded PSS, PAH1-encoded PAP, and DGK1-encoded DGK are indicated.
Analyses of the pah1Δ and cho1Δ mutants lacking Pah1 and Cho1, respectively, have shed light on the importance of PAP and PSS activities in lipid metabolism and cell physiology. The pah1Δ mutation increases the level of the PAP substrate PA but decreases the levels of the PAP product DAG and its derivative TAG (
). The lack of Pah1 causes a variety of phenotypes that include the derepression of phospholipid synthesis genes (e.g. INO1, OPI3, and INO2), the increase of phospholipid synthesis, the expansion of the nuclear/ER membrane, the susceptibility to fatty acid-induced toxicity, and the reduction of lipid droplet formation (
). The impact of the Pah1 deficiency on overall cell physiology is further exemplified by the fact that pah1Δ mutant cells cannot grow on non-fermentable carbon sources (i.e. respiratory deficiency) (
Cho1 and Pah1 are regulated for their functions in lipid metabolism by genetic mechanisms. The expression of CHO1 is elevated in the exponential phase when cells are grown in the absence of the phospholipid precursor molecules inositol, choline, ethanolamine, and serine (
). In contrast, the CHO1 expression is reduced by inositol supplementation in the exponential phase, and this regulation is enhanced by the addition of choline, ethanolamine, or serine in the growth medium (
). These regulations of the CHO1 expression are mediated by the Henry regulatory circuit, which involves the Ino2–Ino4 complex that drives transcriptional activation through its binding to the UASINO element and the PA-regulated repressor Opi1, which inhibits the function of the activator complex through its interaction with Ino2 (
). The CHO1 transcriptional regulation plays a role in the partitioning of CDP–DAG for the synthesis of PI and PS and the PS-derived synthesis of PE and PC in the CDP–DAG pathway (
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
). The transcriptional regulation of PAH1 involves the transcription factors Ino2, Ino4, Opi1, Gis1, and Rph1 (for inositol and growth phase regulation) as well as the transcription factor Zap1 (for zinc-mediated regulation) (
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
). On the one hand, the induced expression of PAP activity in zinc-replete stationary phase cells is responsible for increased synthesis and accumulation of TAG that occurs at the expense of phospholipid synthesis (
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
). On the other hand, the induced expression of PAP activity in zinc-depleted exponential phase cells is responsible for increased synthesis of PC via the CDP–choline branch of the Kennedy pathway (
The loss of Pah1 and its PAP activity (e.g. pah1Δ mutation) increases the level of PA and its utilization for the synthesis of membrane phospholipids (
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
), raising a question whether the expression of Cho1 and its PSS activity is regulated through cell growth. Here, we showed that the pah1Δ mutation results in the induction of Cho1 and PSS activity in a growth-dependent manner from the exponential to the stationary phase and that the elevation of the CHO1 expression is controlled through the UASINO element in the promoter. The mutation in the core consensus of UASINO abolished the induction of Cho1 and PSS activity, resulting in the suppression of the pah1Δ phenotypes in lipid synthesis, nuclear/ER membrane morphology, and lipid droplet formation. Collectively, this work advances the understanding of how PAP activity regulates phospholipid synthesis through the transcriptional regulation of the PSS enzyme.
Results
The pah1Δ mutation induces the expression of Cho1 and PSS activity
We examined the effect of growth phase on the expression of CHO1 and its encoded PSS activity in wild type and pah1Δ mutant cells (Fig. 2). In this work, the level of Cho1 was examined by immunoblotting to analyze the CHO1 expression because of the caveat that mRNA abundance does not necessarily correlate with protein abundance. The anti-Cho1 antibody recognizes two forms of Cho1 that differ in their electrophoretic mobility (
). The 30-kDa form represents Cho1 phosphorylated by protein kinase A at Ser-46 and Ser-47, whereas the 27-kDa form represents the unphosphorylated form of the enzyme (
). In wild-type cells, the levels of Cho1 (Fig. 2A) and its PSS activity (Fig. 2B) were reduced in the stationary phase when compared with the exponential phase. As described previously (
), PSS activity was 3.6-fold lower in the stationary phase than in the exponential phase. Compared with wild type, the pah1Δ mutant had 2.2-fold higher PSS activity in the exponential phase. In addition, the pah1Δ mutant showed a 2.4-fold induction of the enzyme activity from the exponential to the stationary phase. Consequently, in the stationary phase, the PSS activity of the pah1Δ mutant was 19-fold higher than the enzyme activity of wild type. The elevation of PSS activity in the pah1Δ mutant correlated with the increase of the Cho1 level. These results indicate that the induced expression of Cho1 and PSS activity in the pah1Δ mutant is up-regulated during growth from the exponential to the stationary phase.
Figure 2.The pah1Δ mutation induces the expression of Cho1 and PSS activity. Wild type (W303-1A) and the pah1Δ mutant were grown at 30 °C in SC medium to the exponential (E) and stationary (S) phases. Cell extracts were prepared and assayed for the expression of Cho1 by immunoblot analysis with anti-Cho1 antibody (A) or for PSS activity (B). The immunoblot in A is representative of two independent experiments, whereas the data in B are means ± S.D. (error bars) from triplicate determinations of two independent experiments. The positions of the 30-kDa (i.e. phosphorylated) and 27-kDa (i.e. unphosphorylated) forms of Cho1 are indicated in A.
Induced expression of Cho1 and PSS activity in the pah1Δ mutant is mediated by the CHO1 UASINO element
The up-regulation of the Cho1 level in the pah1Δ mutant suggested that the enzyme is controlled at the level of its gene expression. The CHO1 promoter contains a UASINO element as well as other putative regulatory elements. To identify the relevant element by an unbiased approach, we constructed CHO1 alleles that contain different lengths of the promoter by 5′-nested deletion and analyzed their expression on a low-copy plasmid in the pah1Δ mutant. We reasoned that if the plasmid-borne CHO1 allele contains a UAS, its expression would be up-regulated like the endogenous expression of Cho1 in the pah1Δ mutant. We did not analyze the plasmid-borne CHO1 alleles in the cho1Δ pah1Δ mutant background. Supplementation of choline or ethanolamine, which is required for viability of cells containing the cho1Δ mutation, alters the regulation of phospholipid synthesis (
). Accordingly, pah1Δ cells transformed with the CHO1 allele were grown to the exponential and stationary phases and were examined for the Cho1 level by immunoblot analysis (Fig. 3). Compared with the pah1Δ mutant that expresses the endogenous CHO1 (i.e. vector control), its transformants containing the CHO1 allele with the 200-bp or longer promoter exhibited higher levels of Cho1 in both the exponential and the stationary phases of growth (Fig. 3A). However, the increase of the Cho1 level was not shown by the expression of the CHO1 allele with the 100-bp or shorter promoter, indicating that the UAS element is located between −200 and −100 of the CHO1 promoter. Further truncation analysis of the 100-bp region showed that the Cho1 level of the pah1Δ mutant was increased by the CHO1 allele with the 170-bp or longer promoter, but not with the 150-bp promoter (Fig. 3B), indicating that the UAS element affecting expression is located between −170 and −150. Analysis of the 20-bp region of the CHO1 promoter revealed that it contains the UASINO element (−163 to −154).
Figure 3.Induced expression of Cho1 in the pah1Δ mutant is mediated by the UASINO element in the CHO1 promoter.A and B, the pah1Δ mutant was transformed with pRS415 (V), pGH440 (pRS415 + CHO1 with 1,000-bp promoter), or its derivative with the indicated promoter truncation. C, the pah1Δ mutant was transformed with pRS415 (V), pGH440 (CHO1), or its derivative with the UASINO mutation (cho1). The transformants were grown at 30 °C in SC-Leu medium to the exponential (E) and stationary (S) phases. Cell extracts were prepared and subjected to immunoblot analysis with anti-Cho1 antibody. The immunoblots in the figure are representative of two independent experiments.
To determine whether the UASINO element is required for the induction of CHO1 expression in the pah1Δ mutant, we examined the effect of its mutation (CATGTGAAAG → TTTTTTAAAG, mutations underlined) (
Regulation of phospholipid synthesis in the yeast cki1Δ eki1Δ mutant defective in the Kennedy pathway. The CHO1-encoded phosphatidylserine synthase is regulated by mRNA stability.
) in the plasmid-borne CHO1. Compared with the wild type allele, the mutant allele of CHO1 lacking the consensus sequence of UASINO did not significantly increase the Cho1 level in the pah1Δ mutant (Fig. 3C). To further confirm this result, the UASINO mutation was introduced to the chromosomal CHO1 of wild type and the pah1Δ mutant. Immunoblot analysis (Fig. 4A) showed that the cho1 mutant had a significant reduction of the Cho1 level in the exponential phase. Compared with the pah1Δ mutant, the cho1 pah1Δ mutant showed a great reduction of the Cho1 level in the exponential and stationary phases (Fig. 4A). In fact, its Cho1 level was almost identical to that of the cho1 mutant. The effect of the UASINO mutation on the Cho1 level correlated with the decrease of PSS activity (Fig. 4B). In the exponential phase, PSS activity of the cho1 pah1Δ mutant was 5.2- and 8.4-fold, respectively, lower than that of wild type and the pah1Δ mutant; in the stationary phase, the enzyme activity was 1.2- and 12-fold, respectively, lower than that of wild type and the pah1Δ mutant. Taken together, these results indicate that the UASINO element is responsible for the induction of Cho1 expression in the pah1Δ mutant and its growth-dependent up-regulation from the exponential to the stationary phase.
Figure 4.The inductions of Cho1 and PSS activity in the pah1Δ mutant are abolished by the CHO1 UASINO mutation. Wild type, the pah1Δ mutant, and their derivatives containing the chromosomal CHO1 UASINO mutation (cho1) were grown at 30 °C in SC medium to the exponential (E) and stationary (S) phases. Cell extracts were prepared and assayed for the expression of Cho1 by immunoblot analysis with anti-Cho1 antibody (A) or for PSS activity (B). The immunoblot in A is representative of two independent experiments, whereas the data in B are means ± S.D. (error bars) from triplicate determinations of two independent experiments. The positions of the 30-kDa (i.e. phosphorylated) and 27-kDa (i.e. unphosphorylated) forms of Cho1 are indicated in A.
Effects of the CHO1 UASINO mutation on lipid composition of the pah1Δ mutant
We explored the effects of the CHO1 UASINO mutation on the changes of lipid composition imparted by the pah1Δ mutation. Yeast cells were grown in SC medium containing [2-14C]acetate for steady-state labeling of lipids (
). The radiolabeled lipids were extracted from exponential and stationary phase cells and analyzed by TLC for total lipids and phospholipids. As described previously (
), the pah1Δ mutant had a reduced level of TAG (1.8- and 2.4-fold, respectively) but an increased level of phospholipids (2.1- and 7.8-fold, respectively) in the exponential and stationary phases (Fig. 5). The alterations in the levels of TAG and phospholipids were suppressed by the CHO1 UASINO mutation in the exponential phase (Fig. 5A) and partially suppressed in the stationary phase (Fig. 5B). In addition, the pah1Δ mutation caused a high increase in the levels of sterol esters (6.7-fold) and fatty acids (20-fold) in the stationary phase (
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
). These effects of the pah1Δ mutation were also suppressed by the CHO1 UASINO mutation (Fig. 5B). As for individual phospholipid species, the pah1Δ mutant showed an increase in the levels of PC (1.9- and 13.4-fold), PE (3- and 6-fold), PI (2.5- and 7.8-fold), PS (1.5- and 6.4-fold), and PA (2.4- and 6-fold) in the exponential (Fig. 6A) and stationary (Fig. 6B) phases, respectively. The CHO1 UASINO mutation suppressed the pah1Δ-mediated increase in the levels of PC, PE, PS, and PA in the exponential phase but had little effect on the level of PI.
Figure 5.Effect of the CHO1 UASINO mutation on lipid composition in the pah1Δ mutant. Wild type, the pah1Δ mutant, and their derivatives containing the chromosomal CHO1 UASINO mutation (cho1) were grown at 30 °C in SC medium to the exponential (A) and stationary (B) phases of growth in the presence of [2-14C]acetate (1 μCi/ml). Lipids were extracted and separated by the one-dimensional thin-layer chromatography system for neutral lipids, and the images were subjected to ImageQuant analysis. The data are reported as counts/min found in a particular lipid per 106 cells. The amount of label found in the lipids from the stationary phase cultures was reduced relative to that found from the exponential phase because of the turnover of lipids during growth and incorporation of the label into other metabolites. The data are means ± S.D. (error bars) from triplicate determinations. Erg, ergosterol; ErgE, ergosterol ester; FA, fatty acid; PL, phospholipids.
Figure 6.Effect of the CHO1 UASINO mutation on phospholipid composition in the pah1Δ mutant. Wild type, the pah1Δ mutant, and their derivatives containing the chromosomal CHO1 UASINO mutation (cho1) were grown at 30 °C in SC medium to the exponential (A) and stationary (B) phases of growth in the presence of [2-14C]acetate (1 μCi/ml). Lipids were extracted and separated by the one-dimensional thin-layer chromatography system for phospholipids, and the images were subjected to ImageQuant analysis. The data are reported as counts/min found in a particular lipid per 106 cells. The amount of label found in the phospholipids from the stationary phase cultures was reduced relative to that found from the exponential phase because of the turnover of lipids during growth and incorporation of the label into other metabolites. The data are means ± S.D. (error bars) from triplicate determinations.
). Because the CHO1 UASINO mutation exerts a suppressive effect on the pah1Δ-mediated increase of phospholipid synthesis, we examined the nuclear/ER membrane morphology of the cho1 pah1Δ mutant (Fig. 7A). The expression of the Sec63-GFP fusion protein was used to mark the nuclear/ER membrane in the cell (
). Compared with wild type, the cho1 mutant showed little difference in the nuclear/ER membrane morphology and contained a round nucleus. As described previously (
), most of the pah1Δ cells showed the irregular, expanded nuclear/ER morphology. In contrast, the cho1 pah1Δ cells (93%; Fig. 7B) had the round-shaped nucleus in the exponential phase, indicating that the CHO1 UASINO mutation suppresses the nuclear/ER membrane phenotype of the pah1Δ mutant. The suppressive effect was less strong in the stationary phase, and the number of cho1 pah1Δ cells containing a round nucleus was reduced by 53%.
Figure 7.Effect of the CHO1 UASINO mutation on nuclear/ER membrane morphology in the pah1Δ mutant. Wild type, the pah1Δ mutant, and their derivatives containing the chromosomal CHO1 UASINO mutation (cho1) were transformed with YCplac111-SEC63-GFP and grown at 30 °C in SC-Leu medium to the exponential and stationary phases. A, the fluorescence signal of the GFP-tagged ER marker Sec63 was visualized by fluorescence microscopy. The images shown are representative of multiple fields of view. White bar, 2 μm. B, the percentage of cells with round nuclear/ER membrane morphology was determined from ≥3 fields of view (≥150 cells). The data are averages ± S.D. (error bars).
We also examined the mutants for the formation of lipid droplets by staining with the fluorescent dye BODIPY 493/503 (Fig. 8A). The wild-type and cho1 cells had a similar number of lipid droplets and showed a ∼1.5-fold increase in the organelle number from the exponential to the stationary phase (Fig. 8B). Compared with wild type, the pah1Δ mutant showed a significant reduction (2- and 4.5-fold, respectively) of lipid droplet formation in the exponential and stationary phases. In addition, its lipid droplet formation was not increased in the stationary phase. This phenotype of the pah1Δ mutant was suppressed by the CHO1 UASINO mutation, and the cho1 pah1Δ mutant had a number of lipid droplets similar to that of the wild type in the exponential phase. In the stationary phase, the cho1 pah1Δ mutant showed a reduction in lipid droplet formation, but its lipid droplet number was still higher than that of wild type. This result indicates that, in the stationary phase of growth, the CHO1 UASINO mutation has a partial suppressive effect on the defect of the pah1Δ mutant in lipid droplet formation.
Figure 8.Effect of the CHO1 UASINO mutation on lipid droplet formation in the pah1Δ mutant. Wild type, the pah1Δ mutant, and their derivatives containing the chromosomal CHO1 UASINO mutation (cho1) were grown at 30 °C in SC medium to the exponential and stationary phases followed by staining with BODIPY 493/503. A, the stained lipid droplets were visualized by fluorescence microscopy. The images shown are representative of multiple fields of view. White bar, 2 μm. B, the number of lipid droplets was counted from ≥3 fields of view (≥150 cells) and presented by a box plot with the 5th and 95th percentile.
). Unlike the phenotypes described above, temperature sensitivity of the pah1Δ mutant in the exponential and stationary phases was not suppressed by the CHO1 UASINO mutation (Fig. 9).
Figure 9.Effect of the CHO1 UASINO mutation on growth at 37 °C in the pah1Δ mutant. Wild type, the pah1Δ mutant, and their derivatives containing the chromosomal CHO1 UASINO mutation (cho1) were grown at 30 °C in YEPD medium to saturation. Serial dilutions (1:10) of the cells were spotted (5 μl) onto YEPD plates, and growth was scored after 3 days of incubation at 30 and 37 °C. The data are representative of three independent experiments.
Effect of the dgk1Δ mutation on the induced expression of Cho1 and PSS activity of the pah1Δ mutant
The lack of Dgk1 (i.e. the dgk1Δ mutation) suppresses the pah1Δ phenotypes (e.g. increased phospholipid synthesis, nuclear/ER membrane expansion, and induced INO1 expression) that correlate with an increase in the PA level (
). Accordingly, we examined the effect of the dgk1Δ mutation on the Cho1 expression and PSS activity of wild type and the pah1Δ mutant (Fig. 10). The dgk1Δ mutation introduced into wild type did not have a major effect on the expression of Cho1 (Fig. 10A) and PSS activity (Fig. 10B). In contrast, it showed a partial suppressive effect on the Cho1 expression and PSS activity of the pah1Δ mutant in the stationary phase, but not in the exponential phase. For example, the PSS activity of the dgk1Δ pah1Δ mutant in the stationary phase was 32% lower than that of the pah1Δ mutant. Yet, the PSS activity of the double mutant was 7-fold higher than the enzyme activity of wild type in the stationary phase.
Figure 10.Effect of the dgk1Δ mutation on the pah1Δ mutant for its induced expressions of Cho1 and PSS activity, PA content, and temperature sensitivity. Wild type (RS453) and the indicated mutants were grown at 30 °C in SC medium to the exponential (E) and stationary (S) phases. Cell extracts were prepared and assayed for the expression of Cho1 by immunoblot analysis with anti-Cho1 antibody (A) or for PSS activity (B). Lipids extracted from the cells in the exponential and stationary phases were digested with lipoprotein lipase, and glycerol 3-phosphate produced from PA was measured by the fluorometric coupled enzyme assay (C). D, wild type and the indicated mutants were grown at 30 °C in YEPD medium to saturation. Serial dilutions (1:10) of the cells were spotted (5 μl) onto YEPD plates, and growth was scored after 3 days of incubation at 30 and 37 °C. The immunoblot in A and the cell growth in D are representative of two independent experiments, whereas the data in B and C are means ± S.D. (error bars) from triplicate determinations of two independent experiments. The positions of the 30-kDa (i.e. phosphorylated) and 27-kDa (i.e. unphosphorylated) forms of Cho1 are indicated in A.
), the pah1Δ mutation caused an increase in the PA content in both the exponential (2.2-fold) and stationary (2.7-fold) phases of growth. The dgk1Δ mutation suppressed the pah1Δ effect on PA content (Fig. 10C). We also examined the effect of the dgk1Δ mutation on temperature sensitivity exhibited by the pah1Δ mutant. Like the pah1Δ mutant, the dgk1Δ pah1Δ mutant showed no growth at 37 °C, indicating that temperature sensitivity of the pah1Δ mutant is not suppressed by the loss of DGK activity (Fig. 10D).
Discussion
PAP and PSS catalyze reactions in the overlapping pathways of lipid biosynthesis (Fig. 1). The enzyme reactions are linked to the lipid intermediate PA, which is the substrate of PAP and the precursor of CDP–DAG used as the substrate of PSS (Fig. 1). The conversion of PA to DAG and CDP–DAG appears to be a major regulatory step that bifurcates the lipid biosynthetic pathway into two branches (i.e. TAG synthesis and phospholipid synthesis) (
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
). The changes in PAP activity are directly correlated with TAG synthesis but are inversely correlated with phospholipid synthesis during cell growth (
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
). Accordingly, yeast cells have a lower PAP activity in the exponential phase when the rate of phospholipid synthesis is high, whereas they have a higher PAP activity in the stationary phase when the rate of phospholipid synthesis is low (
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
). The elevation of phospholipid synthesis in the pah1Δ mutant, which causes the expansion of the nuclear/ER membrane, is related to the increased availability of the precursor PA by the defect of its conversion to DAG as well as by the increased expression of phospholipid synthesis genes (
). We showed in this study that the expression of CHO1-encoded PSS, which catalyzes the committed step in the CDP–DAG pathway of de novo phospholipid synthesis, is highly induced in the pah1Δ mutant and that the enzyme induction is increased in the stationary phase when the CHO1 expression in wild type is reduced. That the induction of CHO1 expression in the pah1Δ mutant was mediated through the UASINO element supports the notion that the elevation of the PA level reduces the Opi1-mediated transcriptional repression of the UASINO-containing genes as per the Henry regulatory circuit (Fig. 11). PA is known to sequester Opi1 at the nuclear/ER membrane (
Figure 11.Model for the Pah1-mediated regulation of Cho1 expression and lipid synthesis during growth. The diagram shows the Henry regulatory circuit, which includes the repressor Opi1, the Ino2–Ino4 activator complex, and the UASINO element in CHO1 (
), and the bifurcation of PA for the synthesis of TAG and phospholipids via the CDP–DAG pathway. Under growth conditions (e.g. exponential phase; left) whereby Pah1 expression (green highlight) and PAP activity are low (
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
), the level of PA is elevated, and the Opi1 repressor is tethered to the nuclear/ER membrane via its interactions with PA and Scs2. The inhibition of Opi1 for its nuclear entry allows for the transcriptional activation (boldface arrow) of CHO1 by the Ino2–Ino4 complex and the inductions of Cho1 (pink highlight) and PSS activity for increased phospholipid synthesis (large letters) via the CDP–DAG pathway (this work). The reduced rate of TAG synthesis in the exponential phase of growth (
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
) is indicated with small gray letters. Under growth conditions (e.g. stationary phase; right) whereby Pah1 expression (pink highlight) and PAP activity are high (
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
), the synthesis of TAG is elevated (large letters) and the PA level is reduced (small gray letters). The reduction of the PA level allows for the dissociation of Opi1 from the nuclear/ER membrane and its entry into the nucleus, where it represses the transcriptional activation of CHO1 (thin gray arrow and letters) by inhibiting the function of the Ino2–Ino4 activator complex through its binding to Ino2. The repression of Cho1 (green highlight) and PSS activity results in the reduction of phospholipid synthesis (small gray letters).
The CHO1 UASINO mutation in the pah1Δ mutant abolished the up-regulation of the Cho1 level and PSS activity, suppressing the increase of phospholipid synthesis and nuclear/ER membrane as well as the decrease of TAG synthesis and lipid droplet formation. These observations highlight the role of the CHO1-encoded PSS in the synthesis of membrane phospholipids and the role of the PAH1-encoded PAP in the negative regulation of the CHO1 expression. The effects of the CHO1 UASINO mutation on the pah1Δ phenotypes were pronounced in the exponential phase of growth when PSS activity is expressed at its highest level (
). The partial suppression of the pah1Δ phenotypes in the stationary phase suggests that the higher availability of PA may compensate for the reduction of the PSS level.
Although the PA level of the pah1Δ mutant was reduced by the CHO1 UASINO mutation in the stationary phase, it was still higher than that of wild type cells (Fig. 6B). This difference in the PA content would be expected to attenuate the Opi1 function. As indicated above, it has been known that transcription of other UASINO-containing phospholipid synthesis genes (e.g. INO1 and OPI3) is induced in the pah1Δ mutant (
). Although it is unknown whether transcriptional induction of these genes leads to the increased expression and function of their encoded proteins, the lack of total suppression of PC content, especially in the stationary phase, is consistent with an increase in phospholipid methyltransferase activity encoded by OPI3. Phospholipid synthesis genes (e.g. CKI1 (
)) in the Kennedy pathway are also subject to transcriptional regulation through the UASINO element, but their encoded activities are not expected to play a major role in this regulation because growth medium was not supplemented with choline and/or ethanolamine (
The increase of the PI content in the pah1Δ mutant was not suppressed by the CHO1 UASINO mutation in the exponential or stationary phase of growth. Whereas the expression of PIS1-encoded PI synthase is not regulated through Opi1 (
) is consistent with the increased availability of inositol for PI synthesis. However, if the induced expression of INO1 is translated to an increase in the level and activity of inositol-3-phosphate synthase, it would not be massive because pah1Δ mutant cells do not excrete inositol (
) (Fig. 5). Although the mechanism for these changes is unclear, the elevated levels of the lipids were almost reduced to the levels of wild type by alleviating the induced expression of PSS activity. We hypothesize that the PA content, as regulated by the pah1Δ and cho1 pah1Δ mutations, is the basis for the changes in the levels of fatty acids and ergosterol ester. This assertion is supported by the fact that fatty acid synthesis, as mediated by the ACC1, FAS1, and FAS2 genes, is under the control of the Henry regulatory circuit (
Coordinate genetic control of yeast fatty acid synthase genes FAS1 and FAS2 by an upstream activation site common to genes involved in membrane lipid biosynthesis.
) and that the ARE1 and ARE2 genes, which encode the acyl-CoA sterol acyltransferase enzymes, contain a putative UASINO element in their promoters. Accordingly, additional studies are warranted to addresses the expression regulation of those genes.
The lack of the DGK1-encoded DGK suppresses the pah1Δ phenotypes that are ascribed to the increase of the PA level (
), which include the induced expression of UASINO-containing genes and increased phospholipid content, nuclear/ER membrane expansion, decreased lipid droplet formation, and reduced chronological life span (
). As discussed above, we consider that the increase of the PA level is responsible for induced expression of Cho1 and PSS activity in the pah1Δ mutant. In further support of this, we showed that the dgk1Δ mutation suppressed the pah1Δ mutant for its induced Cho1 expression and PSS activity, but only in the stationary phase of growth with a partial effect. Thus, the PA-mediated regulation of the CHO1 expression is more complex than was expected.
Of the pah1Δ phenotypes examined in this study, temperature sensitivity was not suppressed by the CHO1 UASINO mutation or by the dgk1Δ mutation. These observations support the notion that the inability of the pah1Δ mutant to grow at the elevated temperature is not related to a change in the PA level but rather to other changes (e.g. decrease in DAG production) caused by the loss of PAP activity. Additional pah1Δ phenotypes that are not affected by the dgk1Δ mutation include the decrease of TAG synthesis, sensitivity to fatty acid toxicity (
In addition to the genetic regulation discussed above, the PAP and PSS activities of Pah1 and Cho1, respectively, are biochemically regulated by the substrates and products of their reactions. The PSS substrate CDP–DAG stimulates PAP activity by a mechanism that increases its affinity for PA (
Regulation of yeast phosphatidylserine synthase and phosphatidylinositol synthase activities by phospholipids in Triton X-100/phospholipid mixed micelles.
Regulation of yeast phosphatidylserine synthase and phosphatidylinositol synthase activities by phospholipids in Triton X-100/phospholipid mixed micelles.
Protein kinase A-mediated phosphorylation of Pah1p phosphatidate phosphatase functions in conjunction with the Pho85p-Pho80p and Cdc28p-cyclin B kinases to regulate lipid synthesis in yeast.
) and inhibits their PAP and PSS, activities, respectively. For Cho1, the posttranslational modification stabilizes its abundance in the cell for the net effect of stimulating the synthesis of PS (
In summary, the work reported here advances our understanding of how the PAP enzyme reaction regulates phospholipid synthesis through the transcriptional regulation of the PSS enzyme. Clearly, the long-term genetic regulations, coupled with the short-term biochemical regulations of the PAP and PSS enzymes are critical to controlling the balance between the synthesis of TAG for stasis and the synthesis of membrane phospholipids for cell growth.
Experimental procedures
Materials
All chemicals were reagent grade or better. Culture medium components were from BD Difco. DNA purification kits were from Qiagen. Restriction endonucleases, modifying enzymes, and DNA polymerases were from New England Biolabs. DNA size standards (1 Kb Plus DNA ladder) were from Invitrogen. Oligonucleotides, nucleotides, protease inhibitors, Triton X-100, Ponceau S stain, Aerococcus viridans glycerol-3-phosphate oxidase, horseradish peroxidase, and bovine serum albumin were from Sigma-Aldrich. Carrier DNA for yeast transformation was from Clontech. Bradford protein assay reagent, protein size standards, and electrophoretic reagents were from Bio-Rad. PVDF membrane and the enhanced chemifluorescence substrate for Western blotting were from GE Healthcare. Alkaline phosphatase–conjugated goat anti-rabbit IgG antibodies (product 31340, lot NJ178812), alkaline phosphatase-conjugated goat anti-mouse IgG antibodies (product 31322, lot PB1815636), Triton X-100 (Surfact-Amps, product 28314), Amplex Red, and BODIPY 493/503 were from Thermo Fisher Scientific. Pseudomonas sp. lipoprotein lipase was from Wako. Radiochemicals were from PerkinElmer Life Sciences. Phospholipids were from Avanti Polar Lipids. Liquid scintillation mixtures were from National Diagnostics. Silica gel 60 TLC plates were from EMD Millipore, and LK5D partisil silica gel TLC plates were from Whatman.
Strains and growth conditions
The strains used in this work are listed in %Table 1. Yeast cells were grown at 30 °C in YEPD medium (1% yeast extract, 2% peptone, 2% glucose) or in SC medium containing 2% glucose (
). For selection of yeast cells containing plasmids, appropriate amino acids were omitted from SC medium. Escherichia coli DH5α was used for plasmid maintenance and amplification and was grown at 37 °C in LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl, pH 7.4). E. coli transformants containing plasmids were selected by ampicillin (100 μg/ml) resistance. Solid media for the growth of E. coli and yeast contained agar at a concentration of 1.5 and 2%, respectively. Cell numbers in liquid cultures were estimated spectrophotometrically by measuring absorbance at 600 nm.
Standard methods were used for the isolation of plasmid and yeast genomic DNA and for the manipulation of DNA with restriction enzymes, DNA ligase, and modifying enzymes (
). Yeast and E. coli transformations were performed by standard protocols. DNA sequencing reactions were performed according to the dideoxy method with Taq DNA polymerase and analyzed by automated DNA sequencer (service provided by GENEWIZ, South Plainfield, NJ).
Plasmid constructions
The plasmids used in this work are listed in %Table 2. pGH340 was constructed from pRS416 at the XbaI and HindIII sites by insertion of PAH1 DNA fragments that were released from pGH315 by digestion with XbaI/BglII (2.002 kb) and BglII/HindIII (1.687 kb). pGH440 was constructed from pRS415 at the SacI and HindIII sites by insertion of 2.3-kb CHO1 DNA (1-kb 5′ UTR + 0.831-kb CDS + 0.5-kb 3′-UTR) that was amplified by PCR from genomic DNA of yeast strain W303-1A (forward primer, GTGGAGCTCTCAGCAGCATCTGGCTGAAA; reverse primer, ATCAAGCTTATTGATGCCATGAAAACCTC). The promoter truncation derivatives of pGH440 were constructed by replacing the SacI-NdeI fragment (2.25 kb) of CHO1 with those lacking 100–1,000 bp from the 5′-end (forward primers, GTGGAGCTCAAGGAACCAGATGACATGGG, GTGGAGCTCCCGACCCAAATGTAATGGAA, GTGGAGCTCTTTAGAAAACGTCATTTTGA, GTGGAGCTCACAAGCAGTATTAAGCATAA, GTGGAGCTCGATTATAGAGCTTATAGCTA, GTGGAGCTCTGTAAGTATTTGTATATATG, GTGGAGCTCGCATTATAGAAGATATCCCT, GTGGAGCTCACTTTGAACGTTCACACGGC, GTGGAGCTCAAGAGAGATACACCTATTTT, and GTGGAGCTCATGGTTGAATCAGATGAAGA; reverse primer, CTGCCATATGCAAATTCCTCA). pGH440m was produced from pGH440 by replacing the SacI-BsaBI fragment (869 bp) of CHO1 with that containing the UASINO mutation (CACATG → AAAAAA, −159 to −154). pGH442, which contains the cho1Δ::URA3 disruption cassette, was produced from pGH440 by replacing the BstZ17I-NdeI fragment of CHO1 with the URA3 gene.
Table 2Plasmids used in this study
Plasmid
Relevant characteristics
Source/Reference
pRS415
Single-copy E. coli/yeast shuttle vector with LEU2
Phosphorylation of phosphatidate phosphatase regulates its membrane association and physiological functions in Saccharomyces cerevisiae: identification of Ser602, Thr723, and Ser744 as the sites phosphorylated by CDC28 (CDK1)-encoded cyclin-dependent kinase.
). The W303-1A strain was transformed with a 2.9-kb cho1Δ::URA3 disruption cassette that was released from pGH442 by digestion with SacI and HindIII, and the resulting transformants were selected on the SC-Ura medium supplemented with 1 mm choline. The cho1Δ mutant was identified from the Ura+ transformants by choline auxotrophy and by PCR analysis of gene disruption. The cho1 mutant, which contains a defective CHO1 UASINO element, was derived from the cho1Δ::URA3 mutant by one-step gene replacement. The cho1Δ mutant was transformed with a 2.3-kb CHO1 DNA that was released from pGH440m by digestion with SacI and HindIII, and the resulting transformants were selected on 5-fluoroorotic acid–containing medium. The gene replacement in the 5-fluoroorotic acid–resistant transformant was confirmed by DNA sequencing of the PCR-amplified CHO1. The pah1Δ cho1 mutant was derived from the cho1Δ mutant by one-step gene replacement. The cho1 mutant was transformed with a 3-kb pah1Δ::URA3 disruption cassette that was released from pGH317 by digestion with the XbaI and HindIII. The pah1Δ mutation was confirmed from the Ura+ transformants by temperature sensitivity and PCR analysis of gene disruption.
Preparation of cell extracts
All steps were performed at 4 °C. Yeast cell pellets were resuspended in breaking buffer (50 mm Tris-HCl, pH 7.5, 0.3 m sucrose, 10 mm 2-mercaptoethanol, 0.5 mm phenylmethanesulfonyl fluoride, 1 mm benzamidine, 5 μg/ml aprotinin, 5 μg/ml leupeptin, and 5 μg/ml pepstatin). Glass beads (0.5-mm diameter) were added to the cell suspension, and the mixture was vigorously agitated using the Mini-BeadBeater-16 (Biospec Products). Unbroken cells and glass beads were precipitated by centrifugation at 1,500 × g for 10 min, and the supernatant was transferred to a new tube for use as cell extracts. Protein concentration of cell extracts was estimated by the method of Bradford (
Estimation of isozymes of microsomal cytochrome P-450 in rats, rabbits, and humans using immunochemical staining coupled with sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
Western blotting: electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A.
) using PVDF membrane were performed as described previously. The samples for immunoblotting were normalized to total protein loading. Ponceau S staining was used to monitor the protein transfer from the polyacrylamide gels to the PVDF membrane. Immunoblot analysis of the protein Cho1 was performed with anti-Cho1 antibody raised against the N-terminal portion of the protein (
) at a concentration of 0.25 μg/ml. Goat anti-rabbit IgG antibody conjugated with alkaline phosphatase was used as a secondary antibody at a dilution of 1:5,000. Immune complexes were detected on immunoblots using the enhanced chemifluorescence Western blotting reagents as described by the manufacturer. Images were acquired by fluorimaging analysis. Immunoblotting signals were in the linear range of detectability.
Enzyme assays
All assays were conducted at 30 °C in a total volume of 0.1 ml. PSS activity was measured by following the incorporation of water-soluble [3-3H]serine (10,000 cpm/nmol) into chloroform-soluble [3-3H]PS (
). The enzyme assays were conducted in triplicate, and the average S.D. of the assays was ±5%. The reactions were linear with time and protein concentration. A unit of PSS activity was defined as the amount of enzyme that catalyzed the formation of 1 nmol of product/min.
Radiolabeling and analysis of lipids
The steady-state labeling of lipids with [2-14C]acetate was performed as described previously (
). The resolved lipids were visualized by phosphorimaging and quantified by ImageQuant software using a standard curve of [2-14C]acetate. The identity of radiolabeled lipids was confirmed by comparison with the migration of authentic standards visualized by staining with iodine vapor.
Analysis of PA
PA was analyzed by the fluorometric coupled enzyme assay of Morita et al. (
), solubilized with purified Triton X-100 (Surfact-Amps), and digested with lipoprotein lipase. The PA derived from glycerol 3-phosphate was coupled to the formation of resorufin with glycerol-3-phosphate oxidase to produce hydrogen peroxide, which is reduced by peroxidase using Amplex Red.
Microscopy
For nuclear/ER membrane morphology analysis, cells were grown at 30 °C and collected at the exponential and stationary phases of growth. The cells were resuspended in a reduced volume of the same medium. For the analysis of lipid droplets, cells were grown in the same medium and collected at the exponential and stationary phases, stained for 30 min with 2 μm BODIPY 493/503, and washed with phosphate-buffered saline (pH 7.4). The average number of cells with normal nuclear/ER membrane structure (i.e. round- to oval-shaped circle) or the number of lipid droplets per cell was scored from ≥3 fields of view (≥150 cells). The fluorescence images were observed under a microscope (Nikon Eclipse Ni-U) with a long pass green fluorescent protein filter, captured by the DS-Qi2 camera with the imaging software NIS-Elements BR.
Analyses of data
SigmaPlot software was used for the statistical analysis of data. The p values < 0.05 were taken as a significant difference.
Author contributions
G.-S. H. and G. M. C. designed the study, analyzed the results, and prepared the manuscript. G.-S. H. performed the experiments.
References
Carman G.M.
Han G.-S.
Regulation of phospholipid synthesis in the yeast Saccharomyces cerevisiae.
The spatial organization of lipid synthesis in the yeast Saccharomyces cerevisiae derived from large scale green fluorescent protein tagging and high resolution microscopy.
PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.
Regulation of phospholipid synthesis in the yeast cki1Δ eki1Δ mutant defective in the Kennedy pathway. The CHO1-encoded phosphatidylserine synthase is regulated by mRNA stability.
Coordinate genetic control of yeast fatty acid synthase genes FAS1 and FAS2 by an upstream activation site common to genes involved in membrane lipid biosynthesis.
Regulation of yeast phosphatidylserine synthase and phosphatidylinositol synthase activities by phospholipids in Triton X-100/phospholipid mixed micelles.
Protein kinase A-mediated phosphorylation of Pah1p phosphatidate phosphatase functions in conjunction with the Pho85p-Pho80p and Cdc28p-cyclin B kinases to regulate lipid synthesis in yeast.
Estimation of isozymes of microsomal cytochrome P-450 in rats, rabbits, and humans using immunochemical staining coupled with sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
Western blotting: electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A.
Ribosomal-associated phosphatidylserine synthetase from Escherichia coli: purification by substrate-specific elution from phosphocellulose using cytidine 5′-diphospho-1,2-diacyl-sn-glycerol.
Phosphorylation of phosphatidate phosphatase regulates its membrane association and physiological functions in Saccharomyces cerevisiae: identification of Ser602, Thr723, and Ser744 as the sites phosphorylated by CDC28 (CDK1)-encoded cyclin-dependent kinase.
This work was supported, in whole or in part, by National Institutes of Health Grant GM028140. The authors declare that they have no conflicts of interest with the contents of this article. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
38551-3&id=gr1.jpg){kind=link}
38551-3&id=gr2.jpg){kind=link}
38551-3&id=gr3.jpg){kind=link}
38551-3&id=gr4.jpg){kind=link}
38551-3&id=gr5.jpg){kind=link}
38551-3&id=gr6.jpg){kind=link}
38551-3&id=gr7.jpg){kind=link}
38551-3&id=gr8.jpg){kind=link}
38551-3&id=gr9.jpg){kind=link}
38551-3&id=gr10.jpg){kind=link}
38551-3&id=gr11.jpg){kind=link}