Advertisement

O-GlcNAcylation regulates integrin-mediated cell adhesion and migration via formation of focal adhesion complexes

  • Author Footnotes
    1 Both authors contributed equally to this work.
    Zhiwei Xu
    Footnotes
    1 Both authors contributed equally to this work.
    Affiliations
    Division of Regulatory Glycobiology, Institute of Molecular Biomembrane and Glycobiology, Tohoku Medical and Pharmaceutical University, 4-4-1 Komatsushima, Aoba-ku, Sendai Miyagi 981-8558, Japan
    Search for articles by this author
  • Author Footnotes
    1 Both authors contributed equally to this work.
    Tomoya Isaji
    Footnotes
    1 Both authors contributed equally to this work.
    Affiliations
    Division of Regulatory Glycobiology, Institute of Molecular Biomembrane and Glycobiology, Tohoku Medical and Pharmaceutical University, 4-4-1 Komatsushima, Aoba-ku, Sendai Miyagi 981-8558, Japan
    Search for articles by this author
  • Tomohiko Fukuda
    Affiliations
    Division of Regulatory Glycobiology, Institute of Molecular Biomembrane and Glycobiology, Tohoku Medical and Pharmaceutical University, 4-4-1 Komatsushima, Aoba-ku, Sendai Miyagi 981-8558, Japan
    Search for articles by this author
  • Yuqin Wang
    Affiliations
    Department of Pharmacology, Pharmacy College, Nantong University, Nantong, Jiangsu Province 226001, China
    Search for articles by this author
  • Jianguo Gu
    Correspondence
    To whom correspondence should be addressed. Tel.: 81-22-727-0216; Fax: 81-22-727-007;
    Affiliations
    Division of Regulatory Glycobiology, Institute of Molecular Biomembrane and Glycobiology, Tohoku Medical and Pharmaceutical University, 4-4-1 Komatsushima, Aoba-ku, Sendai Miyagi 981-8558, Japan
    Search for articles by this author
  • Author Footnotes
    1 Both authors contributed equally to this work.
Open AccessPublished:December 26, 2018DOI:https://doi.org/10.1074/jbc.RA118.005923
      O-GlcNAcylation is a post-translational modification of a protein serine or threonine residue catalyzed by O-GlcNAc transferase (OGT) in the nucleus and cytoplasm. O-GlcNAcylation plays important roles in the cellular signaling that affect the different biological functions of cells, depending upon cell type. However, whether or not O-GlcNAcylation regulates cell adhesion and migration remains unclear. Here, we used the doxycycline-inducible short hairpin RNA (shRNA) system to establish an OGT knockdown (KD) HeLa cell line and found that O-GlcNAcylation is a key regulator for cell adhesion, migration, and focal adhesion (FA) complex formation. The expression levels of OGT and O-GlcNAcylation were remarkably suppressed 24 h after induction of doxycycline. Knockdown of OGT significantly promoted cell adhesion, but it suppressed the cell migration on fibronectin. The immunostaining with paxillin, a marker for FA plaque, clearly showed that the number of FAs was increased in the KD cells compared with that in the control cells. The O-GlcNAcylation levels of paxillin, talin, and focal adhesion kinase were down-regulated in KD cells. Interestingly, the complex formation between integrin β1, focal adhesion kinase, paxillin, and talin was greatly increased in KD cells. Consistently, levels of active integrin β1 were significantly enhanced in KD cells, whereas they were decreased in cells overexpressing OGT. The data suggest a novel regulatory mechanism for O-GlcNAcylation during FA complex formation, which thereby affects integrin activation and integrin-mediated functions such as cell adhesion and migration.

      Introduction

      O-GlcNAcylation is controlled by OGT
      The abbreviations used are: OGT
      O-GlcNAc transferase
      KD
      knockdown
      DOX
      doxycycline
      shRNA
      short hairpin RNA
      FAK
      focal adhesion kinase
      FA
      focal adhesion
      ECM
      extracellular matrix
      VSV
      vesicular stomatitis virus glycoprotein
      DMEM
      Dulbecco’s modified Eagle’s medium.
      and is a specific type of post-translational modification that consists of the covalent attachment of single GlcNAc to the nucleus and cytoplasm of the serine or threonine residue of an extremely large family of target proteins (
      • Zachara N.E.
      • Hart G.W.
      Cell signaling, the essential role of O-GlcNAc!.
      ,
      • Vosseller K.
      • Sakabe K.
      • Wells L.
      • Hart G.W.
      Diverse regulation of protein function by O-GlcNAc: a nuclear and cytoplasmic carbohydrate post-translational modification.
      ). This post-translational modification is essential for cell survival and division (
      • Tan E.P.
      • Duncan F.E.
      • Slawson C.
      The sweet side of the cell cycle.
      ), and aberrant O-GlcNAcylation provokes tumorigenesis, diabetes, and Alzheimer’s disease by regulating cell signaling, transcription, metabolism, and cytoskeletal formation (
      • Singh J.P.
      • Zhang K.
      • Wu J.
      • Yang X.
      O-GlcNAc signaling in cancer metabolism and epigenetics.
      • Itkonen H.M.
      • Minner S.
      • Guldvik I.J.
      • Sandmann M.J.
      • Tsourlakis M.C.
      • Berge V.
      • Svindland A.
      • Schlomm T.
      • Mills I.G.
      O-GlcNAc transferase integrates metabolic pathways to regulate the stability of c-MYC in human prostate cancer cells.
      ,
      • Slawson C.
      • Hart G.W.
      O-GlcNAc signalling: implications for cancer cell biology.
      • Copeland R.J.
      • Han G.
      • Hart G.W.
      O-GlcNAcomics: revealing roles of O-GlcNAcylation in disease mechanisms and development of potential diagnostics.
      ). The increased O-GlcNAcylation seems to be a general characteristic of cancer cells. For example, higher levels of O-GlcNAcylation expression have been observed in cancers of the liver (
      • Zhang X.
      • Qiao Y.
      • Wu Q.
      • Chen Y.
      • Zou S.
      • Liu X.
      • Zhu G.
      • Zhao Y.
      • Chen Y.
      • Yu Y.
      • Pan Q.
      • Wang J.
      • Sun F.
      The essential role of YAP O-GlcNAcylation in high-glucose-stimulated liver tumorigenesis.
      ), lung, colon (
      • Mi W.
      • Gu Y.
      • Han C.
      • Liu H.
      • Fan Q.
      • Zhang X.
      • Cong Q.
      • Yu W.
      O-GlcNAcylation is a novel regulator of lung and colon cancer malignancy.
      ), and breast (
      • Gu Y.
      • Mi W.
      • Ge Y.
      • Liu H.
      • Fan Q.
      • Han C.
      • Yang J.
      • Han F.
      • Lu X.
      • Yu W.
      GlcNAcylation plays an essential role in breast cancer metastasis.
      ). Furthermore, numerous breast cancer cell lines have shown higher levels of O-GlcNAcylation, and the levels of OGT expression in aggressive breast cancer cell lines are much higher than those seen in less aggressive breast cancer cell lines (
      • Caldwell S.A.
      • Jackson S.R.
      • Shahriari K.S.
      • Lynch T.P.
      • Sethi G.
      • Walker S.
      • Vosseller K.
      • Reginato M.J.
      Nutrient sensor O-GlcNAc transferase regulates breast cancer tumorigenesis through targeting of the oncogenic transcription factor FoxM1.
      ). O-GlcNAc modifications have also been observed in important target proteins, such as p53 (
      • Yang W.H.
      • Kim J.E.
      • Nam H.W.
      • Ju J.W.
      • Kim H.S.
      • Kim Y.S.
      • Cho J.W.
      Modification of p53 with O-linked N-acetylglucosamine regulates p53 activity and stability.
      ), HIF-1α (
      • Ferrer C.M.
      • Lynch T.P.
      • Sodi V.L.
      • Falcone J.N.
      • Schwab L.P.
      • Peacock D.L.
      • Vocadlo D.J.
      • Seagroves T.N.
      • Reginato M.J.
      O-GlcNAcylation regulates cancer metabolism and survival stress signaling via regulation of the HIF-1 pathway.
      ), β-catenin (
      • Gu Y.
      • Mi W.
      • Ge Y.
      • Liu H.
      • Fan Q.
      • Han C.
      • Yang J.
      • Han F.
      • Lu X.
      • Yu W.
      GlcNAcylation plays an essential role in breast cancer metastasis.
      ), and G6PD (
      • Rao X.
      • Duan X.
      • Mao W.
      • Li X.
      • Li Z.
      • Li Q.
      • Zheng Z.
      • Xu H.
      • Chen M.
      • Wang P.G.
      • Wang Y.
      • Shen B.
      • Yi W.
      O-GlcNAcylation of G6PD promotes the pentose phosphate pathway and tumor growth.
      ), which are involved in the regulation of malignant cancer characteristics by controlling cellular metabolism and proliferation. On the other hand, the suppression of OGT expression in breast or liver cancer cell lines decreases cell motility, which suggests that O-GlcNAcylation could be involved in cell migration (
      • Gu Y.
      • Mi W.
      • Ge Y.
      • Liu H.
      • Fan Q.
      • Han C.
      • Yang J.
      • Han F.
      • Lu X.
      • Yu W.
      GlcNAcylation plays an essential role in breast cancer metastasis.
      ,
      • Xu W.
      • Zhang X.
      • Wu J.L.
      • Fu L.
      • Liu K.
      • Liu D.
      • Chen G.G.
      • Lai P.B.
      • Wong N.
      • Yu J.
      O-GlcNAc transferase promotes fatty liver-associated liver cancer through inducing palmitic acid and activating endoplasmic reticulum stress.
      ).
      Cell migration is a highly integrated multistep process that includes the development of cytoplasmic protrusions, attachment, and spreading (
      • Franz C.M.
      • Jones G.E.
      • Ridley A.J.
      Cell migration in development and disease.
      ). The migratory capacity of cancer cells is initially mediated by alterations in the expression of cell surface molecules known as integrins (
      • Hood J.D.
      • Cheresh D.A.
      Role of integrins in cell invasion and migration.
      ). It is becoming increasingly clear that integrins are crucial for cell migration in the tumor microenvironment (
      • Guo W.
      • Giancotti F.G.
      Integrin signalling during tumour progression.
      ). Following ligand binding, integrins cluster into focal contacts that contain different focal adhesion (FA)-associated proteins, such as α-actinin, vinculin, talin, FAK, and paxillin, which link the integrins to the actin cytoskeleton (
      • Parsons J.T.
      • Horwitz A.R.
      • Schwartz M.A.
      Cell adhesion: integrating cytoskeletal dynamics and cellular tension.
      ). The processes of adhesion formation and disassembly drive the migration cycle through ligand binding, which in turn regulates integrin activity and cytoskeletal complex formation as well as adhesion dynamics (
      • Webb D.J.
      • Parsons J.T.
      • Horwitz A.F.
      Adhesion assembly, disassembly and turnover in migrating cells: over and over and over again.
      ). O-GlcNAcylation appears to occur in actin cytoskeletal regulatory proteins, such as paxillin (
      • Kwak T.K.
      • Kim H.
      • Jung O.
      • Lee S.A.
      • Kang M.
      • Kim H.J.
      • Park J.M.
      • Kim S.H.
      • Lee J.W.
      Glucosamine treatment-mediated O-GlcNAc modification of paxillin depends on adhesion state of rat insulinoma INS-1 cells.
      ) and talin (
      • Hagmann J.
      • Grob M.
      • Burger M.M.
      The cytoskeletal protein talin is O-glycosylated.
      ), as well as in microtubule assembly proteins, such as tubulin (
      • Ji S.
      • Kang J.G.
      • Park S.Y.
      • Lee J.
      • Oh Y.J.
      • Cho J.W.
      O-GlcNAcylation of tubulin inhibits its polymerization.
      ), and in microtubule-associated proteins (
      • Ding M.
      • Vandré D.D.
      High molecular weight microtubule-associated proteins contain O-linked-N-acetylglucosamine.
      ). However, whether and how O-GlcNAcylation impacts cell migration remains unclear.
      In the present study, we used the doxycycline shRNA-inducible system to knock down the OGT gene to identify the biological functions of O-GlcNAcylation and its regulatory mechanisms in cell adhesion and migration. We found that the knockdown of OGT aberrantly increased cell adhesion, FA formation, and integrin β1 activation, which in turn decreased cell migration. Thus, our findings may provide new insight into integrin-mediated cell migration and explain why O-GlcNAcylation is usually highly expressed in some malignant cancers.

      Results

      Established OGT knockdown (KD) cells

      A growing number of studies have shown that O-GlcNAcylation plays a critical role in the regulation of tumor cell growth (
      • Caldwell S.A.
      • Jackson S.R.
      • Shahriari K.S.
      • Lynch T.P.
      • Sethi G.
      • Walker S.
      • Vosseller K.
      • Reginato M.J.
      Nutrient sensor O-GlcNAc transferase regulates breast cancer tumorigenesis through targeting of the oncogenic transcription factor FoxM1.
      ) and cancer metastasis (
      • Ferrer C.M.
      • Lu T.Y.
      • Bacigalupa Z.A.
      • Katsetos C.D.
      • Sinclair D.A.
      • Reginato M.J.
      O-GlcNAcylation regulates breast cancer metastasis via SIRT1 modulation of FOXM1 pathway.
      ,
      • Jiang M.
      • Xu B.
      • Li X.
      • Shang Y.
      • Chu Y.
      • Wang W.
      • Chen D.
      • Wu N.
      • Hu S.
      • Zhang S.
      • Li M.
      • Wu K.
      • Yang X.
      • Liang J.
      • Nie Y.
      • Fan D.
      O-GlcNAcylation promotes colorectal cancer metastasis via the miR-101-O-GlcNAc/EZH2 regulatory feedback circuit.
      ). To investigate the effects of O-GlcNAc expression on cell adhesion and migration, we used the DOX-dependent inducible shRNA KD system to establish OGT KD HeLa cells. In this cellular system, OGT and O-GlcNAc were expressed at normal levels in the absence of DOX, whereas both expressions were drastically suppressed in the presence of DOX in the culture medium at the indicated concentrations, as shown in Fig. 1A. Furthermore, similar suppression levels were observed even following incubation at the lowest concentration of 0.1 μg/ml after 24 h (Fig. 1B), suggesting an effective KD of OGT and a rapid turnover of O-GlcNAc levels in HeLa cells. After culture for 48 h, elongated cell shapes were converted to a more-rounded morphology, and the KD cells showed significantly increased cell spreading areas compared with those in the control cells (Fig. 1C). These observations suggest the impact that O-GlcNAcylation exerts on cell morphology.
      Figure thumbnail gr1
      Figure 1.Knockdown of OGT suppressed O-GlcNAcylation and enhanced cell spreading in HeLa cells. A and B, the expression levels of OGT and O-GlcNAcylation from cell lysates of DOX-controlled OGT KD HeLa cells were verified with concentrations of DOX at 0, 0. 1, 0.5, 1.0, and 5.0 μg/ml for 72 h (A) or at the indicated time with 0.1 μg/ml DOX (B). The control (Ctrl) indicates the cells treated without DOX. Cell lysates from the indicated cells were subjected to Western blotting with the O-GlcNAc (CTD110.6), OGT, and α-tubulin antibodies. C, representative images of cell spreading are shown after incubation for 48 h. Cells were incubated with (KD) or without (Ctrl) 0.1 μg/ml DOX for 24 or 48 h on a normal culture dish, after which the cell areas were measured. Values represent the mean ± S.E. (error bars) (n = 50). **, p < 0.01 (Welch’s correction t test). Scale bars, 15 μm. Experiments were independently repeated at least two times.

      Knockdown of O-GlcNAcylation enhanced cell adhesion and FA formation and suppressed cell motility

      Next, we used a fibronectin (FN)-coated dish to investigate the effects of OGT KD on cell adhesion, FA formation, and cell motility. To verify the initial stage of cell adhesion, we performed a 20-min cell adhesion assay on FN. Interestingly, the number of adhered cells was drastically increased in the KD cells compared with that in the control cells (Fig. 2A). During cell adhesion, integrins and cytoplasmic proteins such as paxillin, talin, and FAK become clustered in the plane of the cell membrane and in well-developed aggregates, the so-called FA plaque, which can be detected by immunofluorescence microscopy (
      • Giancotti F.G.
      • Ruoslahti E.
      Integrin signaling.
      ). Consistent with their enhancement of cell adhesion, in the present study, OGT KD cells also promoted an increase in FA formation, by comparison with the activity in control cells (Fig. 2B). By contrast, the KD cells showed a significant reduction in cell motility, as observed by video microscopy (Fig. 2C). These data indicate that a loss of O-GlcNAcylation promotes cell adhesion and focal contact formation while suppressing cell migration.
      Figure thumbnail gr2
      Figure 2.Reduced O-GlcNAcylation promoted cell adhesion and FA formation but decreased cell migration. HeLa cells were cultured in the presence (KD) or absence (Ctrl) of DOX for 24 h. A, 20 min after replating cells onto FN-coated 96-well plates, the attached cells were fixed, and then the nuclei were stained and counted. Representative fields were photographed via fluorescent microscopy. Scale bars, 30 μm. Values represent the mean ± S.E. (error bars) (n = 11). **, p < 0.01 (Welch’s correction t test). B, cells were allowed to spread on FN-coated coverslips for 1 h. Cells were then stained with anti-paxillin antibody (green) and TO-PRO-3 (blue). The numbers of focal adhesions were quantified by ImageJ software. Scale bars, 5 μm. Values represent the mean ± S.E. (n = 11). **, p < 0.01 (Welch’s correction t test). C, cell motility was observed by time-lapse video microscopy. Values represent the mean ± S.E. (n = 30). **, p < 0.01 (Welch’s correction t test). Experiments were independently repeated at least two times.

      Talin, FAK, and paxillin were O-GlcNAc–modified proteins

      Previous studies have revealed that some forms of protein FA plaque, such as paxillin and talin, are modified by O-GlcNAc (
      • Kwak T.K.
      • Kim H.
      • Jung O.
      • Lee S.A.
      • Kang M.
      • Kim H.J.
      • Park J.M.
      • Kim S.H.
      • Lee J.W.
      Glucosamine treatment-mediated O-GlcNAc modification of paxillin depends on adhesion state of rat insulinoma INS-1 cells.
      ,
      • Hagmann J.
      • Grob M.
      • Burger M.M.
      The cytoskeletal protein talin is O-glycosylated.
      ). In the present study, we investigated whether O-GlcNAc modification of those target proteins also occurred in HeLa cells in this system. Consistent with previous studies, O-GlcNAc modifications were detected on both paxillin and talin, whereas O-GlcNAcylation levels for both proteins were significantly decreased in KD cells, compared with that seen in control cells (Fig. 3, A and B). Importantly, we also found that FAK, a key molecule for integrin-mediated signaling, was also a target protein for O-GlcNAcylation, which was decreased in the KD cells (Fig. 3C). The suppression of O-GlcNAcylation on FAK and talin was also confirmed in DOX-induced OGT KD 293T cells (data not shown). To further establish the occurrence of O-GlcNAcylation in these proteins, we conducted a chemoenzymatic labeling assay using an azido-GalNAc sugar, as described under “Experimental procedures.” Clearly, talin, FAK, and paxillin were labeled, which proved that they are O-GlcNAcylated proteins (Fig. 4, A–C). These results suggest that O-GlcNAcylation may affect both integrin β1–mediated complex formation and FA formation, which confirms this process as a regulator of cell adhesion and migration.
      Figure thumbnail gr3
      Figure 3.Decreased O-GlcNAcylation levels of paxillin, talin, and FAK in OGT-KD cells. HeLa cells (A) or cells transfected with talin (B) or FAK (C) were incubated without (Ctrl) or with (KD) DOX. The cell extracts were immunoprecipitated (IP) with the indicated antibodies and Western blotted with anti-O-GlcNAc or the indicated antibodies, respectively. Experiments were independently repeated at least three times.
      Figure thumbnail gr4
      Figure 4.Confirmation of O-GlcNAcylation on talin, FAK, and paxillin. Cell lysates of 293T cells transfected with talin (A), FAK (B), or WT HeLa cells (C) were immunoprecipitated (IP) with anti-GFP, anti-VSV, or anti-paxillin antibodies, respectively, followed by click chemistry labeling of O-GlcNAc residues with (+) or without (−) GalT and UDP-GalNAz, and were detected using an ABC kit, as described under “Experimental procedures.” Experiments were independently repeated at least two times.

      Reduction of O-GlcNAcylation promoted complex formation

      FAK is a key component of the signal transduction pathways triggered by integrins. When cells bind to the extracellular matrix (ECM), FAK is usually recruited to integrin-mediated nascent FA, because it interacts directly through the cytoskeletal proteins talin and paxillin, with the cytoplasmic tail of integrin β1 (
      • Chen H.C.
      • Appeddu P.A.
      • Parsons J.T.
      • Hildebrand J.D.
      • Schaller M.D.
      • Guan J.L.
      Interaction of focal adhesion kinase with cytoskeletal protein talin.
      ). Therefore, we compared the ability of control and KD cells to form FA complexes. As shown in Fig. 5A, the complexes immunoprecipitated with anti-FAK antibody showed higher levels of paxillin in KD cells than in control cells. Consistently, KD cells demonstrated a greater number of complex formations composed of both β1 integrin and talin (Fig. 5B) and talin and FAK (Fig. 5C). A similar phenomenon was also confirmed in OGT-KD 293T cells (data not shown).
      Figure thumbnail gr5
      Figure 5.Increased focal adhesion complex formation in OGT KD cells. Cell lysates from the control (Ctrl) and KD HeLa cells that were transfected with expression plasmids of FAK (A), talin (B), or both FAK and talin (C) were immunoprecipitated (IP) by the indicated antibodies and then subjected to Western blotting as described under “Experimental procedures.” The relative ratios are shown at the bottom (n = 3 individual experiments). Values represent the mean ± S.E. (error bars). *, p < 0.05 (Welch’s correction t test). Cell lysates were used as input. Experiments were independently repeated at least three times.

      Knockdown of O-GlcNAcylation activated integrin β1

      Given the increase in FA complex formation in KD cells, it is reasonable to speculate that OGT-KD may affect integrin activation. Integrin-mediated adhesion can recruit FA proteins to form FA plaque and then trigger conformational activation, so-called inside-out signaling, of integrin β1 in the ectodomain, which then can be recognized by a specific antibody (
      • Valdembri D.
      • Serini G.
      Regulation of adhesion site dynamics by integrin traffic.
      ,
      • Askari J.A.
      • Tynan C.J.
      • Webb S.E.
      • Martin-Fernandez M.L.
      • Ballestrem C.
      • Humphries M.J.
      Focal adhesions are sites of integrin extension.
      ) that we used to examine the expression levels of active integrin β1 in both control and KD cells. The expression levels of active β1 in immunostaining (Fig. 6A) or cell lysates (Fig. 6B) were clearly up-regulated in the KD cells compared with control cells. In contrast to KD cells, the expression levels of active β1 were suppressed in the OGT-overexpressing HeLa cells, which further suggested that O-GlcNAcylation negatively regulates integrin-mediated inside-out signaling. Thus, we were convinced that OGT could be a novel regulator for FA complex formation and integrin activation by dynamically regulating cell adhesion and migration.
      Figure thumbnail gr6
      Figure 6.Comparison of the expression levels of active integrin β1 among the control (Ctrl), KD, and OGT-overexpressing cells. A, a representative immunostaining pattern with anti-active β1 or anti-β1 antibodies in the control, KD, and OGT-overexpressing (OGT) HeLa cells. Cells were cultured on FN-coated coverslips for 1 h and then subjected to immunostaining analyses. The relative fluorescence intensities of KD and OGT-overexpressing cells were compared with the control, and relative fluorescence intensity was 1.0 for the control cells. Scale bar, 5 μm. B, the expression levels of active and total integrin β1 were verified by immunoblotting with the indicated antibodies in control and KD HeLa cells or parent (WT) or transiently OGT-overexpressing HeLa cells. The relative ratios are shown at the bottom (n = 10 random fields of view). Values represent the mean ± S.E. (error bars). *, p < 0.05 (Welch’s correction t test); n.s, not significant (p > 0.05). Experiments were independently repeated at least two times.

      Discussion

      In the present study, we clearly showed that O-GlcNAcylation negatively regulates integrin-mediated cell adhesion and FA complex formation as well as integrin activation, which results in the control of cell migration on the ECM (Fig. 7). Our findings are the first to demonstrate that OGT may function as a key regulator of FA complex formation during cell–ECM adhesion. These results provide clues to understanding the roles of O-GlcNAcylation in cell migration.
      Figure thumbnail gr7
      Figure 7.Proposed molecular mechanism for the regulation of cell adhesion and migration by O-GlcNAcylation. During cell adhesion, integrin may form a complex with focal adhesion proteins, such as FAK, talin, and paxillin, to connect with an actin cytoskeleton, which mediates appropriate cell adhesion to promote cell migration. It is well-known that focal adhesion assembly and disassembly processes are fundamental for efficient cell migration. Most focal adhesion proteins can be modified by O-GlcNAc and O-phosphate on serine or threonine residues. In the present study, suppression of the O-GlcNAcylation of paxillin, talin, and FAK aberrantly enhanced integrin activation, integrin-mediated cell adhesion, and complex formation, which in turn led to an inhibition of cell migration, which strongly suggests that OGT functions as a key regulator for cell adhesion.
      Cell migration is a central process in the development and maintenance of multicellular organisms (
      • Franz C.M.
      • Jones G.E.
      • Ridley A.J.
      Cell migration in development and disease.
      ). Although the detailed mechanisms underlying cell migration remain unclear, it is reasonable to postulate that integrin-mediated cell adhesion could regulate migration, which would allow communication between cell–ECM contact and the actin cytoskeleton through focal adhesions (
      • Collins C.
      • Nelson W.J.
      Running with neighbors: coordinating cell migration and cell-cell adhesion.
      ). The dynamic balance between adhesion receptors and the binding of ECM ligands provides FA turnover that regulates adhesion formation and disassembly (
      • Wolfram T.
      • Spatz J.P.
      • Burgess R.W.
      Cell adhesion to agrin presented as a nanopatterned substrate is consistent with an interaction with the extracellular matrix and not transmembrane adhesion molecules.
      ). In the framework of this model, an imbalance in the processes of attachment and detachment leads to conformational changes that mediate abnormal adhesion (
      • Parsons J.T.
      • Horwitz A.R.
      • Schwartz M.A.
      Cell adhesion: integrating cytoskeletal dynamics and cellular tension.
      ). In the present study, we clearly demonstrated that the suppression of O-GlcNAcylation inhibited HeLa cell migration, whereas it enhanced cell–ECM adhesion (Fig. 2), which indicated that O-GlcNAcylation is involved in the regulation of integrin-mediated cell adhesion. Consistently, FAK serves as a key regulator of FA assembly and disassembly processes that are fundamental for efficient cell migration (
      • Parsons J.T.
      • Martin K.H.
      • Slack J.K.
      • Taylor J.M.
      • Weed S.A.
      Focal adhesion kinase: a regulator of focal adhesion dynamics and cell movement.
      ). Indeed, there were more stress fibers and focal adhesions in FAK-deficient cells, whereas cell motility was inhibited (
      • Ilić D.
      • Furuta Y.
      • Kanazawa S.
      • Takeda N.
      • Sobue K.
      • Nakatsuji N.
      • Nomura S.
      • Fujimoto J.
      • Okada M.
      • Yamamoto T.
      Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK-deficient mice.
      ). Aberrant cell–ECM adhesiveness is likely to suppress cell migration, and proper cell adhesion is an important determinant for cell migration (
      • Hang Q.
      • Isaji T.
      • Hou S.
      • Wang Y.
      • Fukuda T.
      • Gu J.
      A key regulator of cell adhesion: identification and characterization of important N-glycosylation sites on integrin α5 for cell migration.
      ). Thus, our data are reasonable in that the knockdown of O-GlcNAcylation aberrantly increased cell adhesion, as well as spreading and FA complex formation, which in turn decreased cell migration. Consistently, a loss of paxillin phosphorylation at Ser-250 markedly inhibits focal adhesion turnover and cell migration (
      • Quizi J.L.
      • Baron K.
      • Al-Zahrani K.N.
      • O'Reilly P.
      • Sriram R.K.
      • Conway J.
      • Laurin A.A.
      • Sabourin L.A.
      SLK-mediated phosphorylation of paxillin is required for focal adhesion turnover and cell migration.
      ).
      We were intrigued as to why a knockdown of OGT would enhance integrin activation. Integrins are the major cell surface receptors used to assemble and recognize a functional ECM and to facilitate cell signaling and migration (
      • Anthis N.J.
      • Campbell I.D.
      The tail of integrin activation.
      ). The organization of cell adhesions is complex and includes a number of cytoplasmic proteins, such as paxillin, talin, FAK, vinculin, and α-actinin (
      • Valdembri D.
      • Serini G.
      Regulation of adhesion site dynamics by integrin traffic.
      ). Integrin activation is associated with an array of biological and pathological conditions involving both outside-in and inside-out signaling (
      • Wolfenson H.
      • Lavelin I.
      • Geiger B.
      Dynamic regulation of the structure and functions of integrin adhesions.
      ). Accumulating data have indicated that the cytoplasmic domain of the integrin β1 subunit cooperatively promotes integrin activation through the binding of talin (
      • Shattil S.J.
      • Kim C.
      • Ginsberg M.H.
      The final steps of integrin activation: the end game.
      ). Consequently, our results clearly showed the interaction of integrin β1 with talin, and the association of FAK, paxillin, and/or talin both were greatly increased in the KD cells, which suggests that the KD of OGT promotes inside-out signaling (Fig. 5). A reciprocal relationship between O-GlcNAcylation and O-phosphorylation has been observed in the specific serine or threonine residue of particular proteins (
      • Comer F.I.
      • Hart G.W.
      O-Glycosylation of nuclear and cytosolic proteins: dynamic interplay between O-GlcNAc and O-phosphate.
      ,
      • Yang X.
      • Qian K.
      Protein O-GlcNAcylation: emerging mechanisms and functions.
      ), and, therefore, how O-GlcNAcylation affects the O-phosphorylation of FA complex proteins is worthy of clarification.
      The O-GlcNAcylation of FAK is noteworthy. Integrins do not possess enzymatic activity; rather, they associate with a number of cytoplasmic protein kinases, such as FAK and Src. Tyrosine-phosphorylated FAK is well-known to be a promoter of interactions with various Src homology 2– and 3–containing proteins and to initiate enzymatic cascades via these associated kinases that ultimately lead to changes in cell behavior (
      • Mitra S.K.
      • Hanson D.A.
      • Schlaepfer D.D.
      Focal adhesion kinase: in command and control of cell motility.
      ). By contrast, serine or threonine phosphorylation on FAK is not well-understood. FAK phosphorylation at either Ser-732 or Ser-722 has recently been recognized as important for microtubule organization, nuclear movement, and neuronal migration during cell adhesion (
      • Xie Z.
      • Sanada K.
      • Samuels B.A.
      • Shih H.
      • Tsai L.H.
      Serine 732 phosphorylation of FAK by Cdk5 is important for microtubule organization, nuclear movement, and neuronal migration.
      ,
      • Bianchi M.
      • De Lucchini S.
      • Marin O.
      • Turner D.L.
      • Hanks S.K.
      • Villa-Moruzzi E.
      Regulation of FAK Ser-722 phosphorylation and kinase activity by GSK3 and PP1 during cell spreading and migration.
      ). Interestingly, phosphorylation of both Ser-843 and Ser-910 on FAK exhibited synchronized phosphorylation during cell mitosis (
      • Ma A.
      • Richardson A.
      • Schaefer E.M.
      • Parsons J.T.
      Serine phosphorylation of focal adhesion kinase in interphase and mitosis: a possible role in modulating binding to p130Cas.
      ), which may be related to O-GlcNAcylation because expression levels of OGT change during mitosis (
      • Sakabe K.
      • Hart G.W.
      O-GlcNAc transferase regulates mitotic chromatin dynamics.
      ). Furthermore, a cluster of serine phosphorylation sites was recently identified at the initiation of the FA-targeting domain in FAK (
      • Grigera P.R.
      • Jeffery E.D.
      • Martin K.H.
      • Shabanowitz J.
      • Hunt D.F.
      • Parsons J.T.
      FAK phosphorylation sites mapped by mass spectrometry.
      ), which may suggest that some of those sites could be modified by O-GlcNAcylation. Thus, to elucidate the roles of OGT in cell biology, it is necessary to identify the specific sites and functions of O-GlcNAcylation in FAK.
      Our results indicate that O-GlcNAcylation plays important roles in regulating cell adhesion, FA complex formation, and cell migration. Emerging data have already established that O-GlcNAc modification has a critical role in the progress of human diseases, and particularly diseases such as cancer, diabetes, and Alzheimer’s (
      • Copeland R.J.
      • Han G.
      • Hart G.W.
      O-GlcNAcomics: revealing roles of O-GlcNAcylation in disease mechanisms and development of potential diagnostics.
      ). Intriguingly, FAK has been associated with insulin resistance in adipocytes in the early stages of type II diabetes (
      • Luk C.T.
      • Shi S.Y.
      • Cai E.P.
      • Sivasubramaniyam T.
      • Krishnamurthy M.
      • Brunt J.J.
      • Schroer S.A.
      • Winer D.A.
      • Woo M.
      FAK signalling controls insulin sensitivity through regulation of adipocyte survival.
      ,
      • Rondas D.
      • Tomas A.
      • Halban P.A.
      Focal adhesion remodeling is crucial for glucose-stimulated insulin secretion and involves activation of focal adhesion kinase and paxillin.
      ) and has also been implicated in the deposition of β-amyloid plaque (
      • Lachén-Montes M.
      • González-Morales A.
      • de Morentin X.M.
      • Pérez-Valderrama E.
      • Ausín K.
      • Zelaya M.V.
      • Serna A.
      • Aso E.
      • Ferrer I.
      • Fernández-Irigoyen J.
      • Santamaría E.
      An early dysregulation of FAK and MEK/ERK signaling pathways precedes the β-amyloid deposition in the olfactory bulb of APP/PS1 mouse model of Alzheimer’s disease.
      ,
      • Grace E.A.
      • Busciglio J.
      Aberrant activation of focal adhesion proteins mediates fibrillar amyloid β-induced neuronal dystrophy.
      ). It would be reasonable to assume that dynamic regulation of FAK O-GlcNAcylation with phosphorylation may partially serve as a possible explanation for a number of diseases.

      Experimental procedures

      Antibodies and reagents

      Experiments were performed using the following antibodies: mAb against O-GlcNAc (CTD110.6, 9875S) and peroxidase-conjugated secondary antibody against rabbit (7074S) from Cell Signaling Technology; the rabbit polyclonal antibody against OGT (O0164) and mAb against α-tubulin (T6199) and VSV (V5507) from Sigma; mAb against integrin β1 (610468) and paxillin (610052) from BD Biosciences; mAb against active integrin β1 (HUTS-4; 2079Z) and peroxidase-conjugated secondary antibodies against mouse (AP124P) and goat (AB324P) from Millipore; Alexa Fluor 488–conjugated anti-mouse (A11029) from Invitrogen; TO-PRO-3 (T3605) from Molecular Probes, Inc.; and GFP-agarose (MBL, D153-8) and goat antibody against GFP (Rockland, 600-101-215). The mAb against human β1 (P5D2) was obtained from the Developmental Studies Hybridoma Bank, University of Iowa. Human FN and doxycycline hyclate (D9891) were from Sigma-Aldrich. An ABC kit was acquired from Vector Laboratories, and Ab-Capcher Mag was from ProteNova (Takamatsu, Japan).

      Cell culture and expression plasmids

      HeLa and 293T cell lines (RIKEN, Japan) were maintained at 37 °C in DMEM high-glucose (Invitrogen) supplemented with 10% fetal bovine serum under a humidified atmosphere that contained 5% CO2. To express GFP-tagged talin (
      • Franco S.J.
      • Rodgers M.A.
      • Perrin B.J.
      • Han J.
      • Bennin D.A.
      • Critchley D.R.
      • Huttenlocher A.
      Calpain-mediated proteolysis of talin regulates adhesion dynamics.
      ) and 2× VSV-tagged FAK, expression vector pEGFP-N1-talin-GFP (Addgene 26724) and pRKVSV-FAK were kindly provided by Dr. Anna Huttenlocher (
      • Franco S.J.
      • Rodgers M.A.
      • Perrin B.J.
      • Han J.
      • Bennin D.A.
      • Critchley D.R.
      • Huttenlocher A.
      Calpain-mediated proteolysis of talin regulates adhesion dynamics.
      ) and Dr. Kenneth Yamada (
      • Segarra M.
      • Vilardell C.
      • Matsumoto K.
      • Esparza J.
      • Lozano E.
      • Serra-Pages C.
      • Urbano-Márquez A.
      • Yamada K.M.
      • Cid M.C.
      Dual function of focal adhesion kinase in regulating integrin-induced MMP-2 and MMP-9 release by human T lymphoid cells.
      ), respectively. The pcDNA3.1/myc-his expression vector containing human OGT was kindly provided by Dr. Yuanyuan Ruan (School of Basic Medical Sciences, Fudan University, Shanghai, China). Transfection was performed using PEI MAX (molecular mass, 40 kDa; Polysciences Inc.) and following the dictates of the United States patent application (number US20110020927A1) with minor modifications. Briefly, 24 h prior to transfections, cells were seeded on a 10-cm dish, and expression vectors with PEI MAX (1 mg/ml in 0.2 m hydrochloric acid) were preincubated for 15 min at a 1:3 ratio in 2,000 μl of a solution that contained 20 mm CH3COONa buffer, pH 4.0, and 150 mm NaCl. Cells and DNA complexes were further incubated for 24 h with 10 ml of normal culture medium to promote expression.

      Establishment of doxycycline-inducible OGT knockdown cells

      We used CS-RfA-ETBsd DOX-dependent inducible RNAi mediated by a single lentivirus vector (RIKEN) for the knockdown experiment (
      • Isaji T.
      • Im S.
      • Gu W.
      • Wang Y.
      • Hang Q.
      • Lu J.
      • Fukuda T.
      • Hashii N.
      • Takakura D.
      • Kawasaki N.
      • Miyoshi H.
      • Gu J.
      An oncogenic protein Golgi phosphoprotein 3 up-regulates cell migration via sialylation.
      ). The following oligonucleotides were inserted into pENTR/H1/TO (sense, CACCGCTGAGCAGTATTCCGAGAAACTCGAGTTTCTCGGAATACTGCTCAGCC; antisense, AAAAGGCTGAGCAGTATTCCGAGAAACTCGAGTTTCTCGGAATACTGCTCAGC) with minor modification from a procedure established in a previous report (
      • Ferrer C.M.
      • Lynch T.P.
      • Sodi V.L.
      • Falcone J.N.
      • Schwab L.P.
      • Peacock D.L.
      • Vocadlo D.J.
      • Seagroves T.N.
      • Reginato M.J.
      O-GlcNAcylation regulates cancer metabolism and survival stress signaling via regulation of the HIF-1 pathway.
      ). Using LR clonase, inserted oligonucleotide was then transferred to CS-RfA-ETBsd, which encodes tetracycline-dependent transactivators for shRNA expression. To prepare the viruses, PEI MAX was used to transfect the resultant vector into 293T cells with packaging plasmids. HeLa and 293T cells were then infected by the obtained viruses and selected for stable integration with 10 μg/ml blasticidin. The shRNA-mediated silencing of OGT was induced by the addition of DOX in the established cell line, and the cells cultured by DOX-free medium were used as the control in the present study.

      Immunoprecipitation and Western blotting

      The cells were washed with PBS, and lysed in lysis buffer (20 mm Tris-HCl, pH 7.4, 150 mm NaCl, 0.1% Triton X-100) with protease and phosphatase inhibitors (Nacalai Tesque, Kyoto, Japan). The supernatants were collected, and the protein concentrations were determined using a bicinchoninic acid protein assay kit (Pierce). Equal amounts of proteins were subjected to SDS-PAGE and then transferred to polyvinylidene difluoride membranes. To detect active integrin β1, we prepared samples under nonreducing conditions. The membranes were blocked either with 5% nonfat milk in TBST or with 3% BSA for 2 h at room temperature, and then the proteins were probed with antibodies against O-GlcNAc, OGT, α-tubulin, active integrin β1 (HUTS-4) (
      • Du J.
      • Chen X.
      • Liang X.
      • Zhang G.
      • Xu J.
      • He L.
      • Zhan Q.
      • Feng X.Q.
      • Chien S.
      • Yang C.
      Integrin activation and internalization on soft ECM as a mechanism of induction of stem cell differentiation by ECM elasticity.
      ,
      • McFarlane S.
      • McFarlane C.
      • Montgomery N.
      • Hill A.
      • Waugh D.J.
      CD44-mediated activation of α5β1-integrin, cortactin and paxillin signaling underpins adhesion of basal-like breast cancer cells to endothelium and fibronectin-enriched matrices.
      ), integrin β1 (Millipore), paxillin, VSV, and GFP. After being washed, the membranes were incubated with horseradish peroxidase–conjugated secondary antibodies. Detection was accomplished using a horseradish peroxidase substrate (Millipore) according to the manufacturer’s instructions. For immunoprecipitation, the supernatant (500 μg of protein) was incubated with an anti-VSV or an anti-paxillin with an Ab-Capcher Mag. GFP-talin was immunoprecipitated with GFP-conjugated beads. The immunoprecipitates were washed with lysis buffer and subjected to SDS-PAGE. The immunocomplexes then were detected using the indicated antibodies. An mAb against α-tubulin was used as the loading control.

      Cell adhesion assay

      Cell adhesion assays were performed in a 96-well CellCarrier (PerkinElmer Life Sciences) coated with FN (5 μg/ml) overnight. HeLa cells were pretreated with or without DOX (0.1 μg/ml) for 24 h. Cells were replated at a density of 104 cells/well in plates using serum-free DMEM with 0.1% BSA, followed by incubation at 37 °C for 20 min. Nonadherent cells were removed by washing three times with PBS. Cells were fixed with 4% formaldehyde and stained 4′,6-diamidino-2-phenylindole (Invitrogen) and were then imaged by fluorescent microscopy using an Operetta CLS (PerkinElmer Life Sciences). To count the number of nuclei in the each well, images were analyzed using Harmony software (PerkinElmer Life Sciences).

      Immunofluorescence

      Cells were plated onto FN-coated glass coverslips (MatTek Corp., Ashland, MA) for 1 h, washed with PBS, and fixed with 4% paraformaldehyde. For permeabilization, the cells were treated with 0.1% Triton X-100 in PBS. The cells were blocked with 0.1% Tween 20 and 3% BSA in PBS and then stained with paxillin, active β1 (HUTS-4), total β1 (P5D2), and OGT antibodies overnight at 4 °C. The samples were followed by incubation with anti-mouse Alexa Fluor 488–conjugated secondary antibody and were then incubated with TO-PRO-3. Images were acquired by sequential excitation using an Olympus FV1000 laser-scanning confocal microscope with an UPlanSApo ×60/1.35 oil objective and high-sensitivity gallium arsenide phosphide detector units operated by F10-ASW version 4.02 software. To count the number of FAs, we followed a protocol previously described using ImageJ (
      • Horzum U.
      • Ozdil B.
      • Pesen-Okvur D.
      Step-by-step quantitative analysis of focal adhesions.
      ), excluding focal adhesions that were less than 0.2 μm2, because these disappeared quickly (
      • Berginski M.E.
      • Vitriol E.A.
      • Hahn K.M.
      • Gomez S.M.
      High-resolution quantification of focal adhesion spatiotemporal dynamics in living cells.
      ). OGT-overexpressing cells were identified via co-immunostaining with OGT. The relative fluorescence intensities of active integrin β1 and total integrin β1 were quantified using ImageJ software.

      Video microscopy

      Glass-bottom dishes (Asahi Glass, Shizuoka, Japan) were precoated with FN (10 μg/ml) in PBS, let stand at 4 °C overnight, and were then blocked with 1% BSA. Ten thousand cells were suspended in 2 ml of DMEM containing 3% fetal bovine serum medium, which was then added to each FN-coated glass-bottom dish and monitored for 12 h using AxioVision equipment (Carl Zeiss, Oberkochen, Germany). Images were acquired using an inverted microscope (Axio Observer.D1, Carl Zeiss) every 10 min with 5% CO2 at 37 °C in a heated chamber equipped with temperature and CO2 controllers (Onpu-4 and CO2; AR BROWN, Tokyo, Japan) during time-lapse imaging. Cell motility was evaluated using an AxioVision Tracking module (Carl Zeiss).

      Chemoenzymatic labeling assay

      Chemoenzymatic labeling and biotinylation of proteins in cell lysates was carried out using the Click-iT O-GlcNAc enzymatic labeling system (Invitrogen). Briefly, the whole-cell lysate of 293T cells transfected with an expression plasmid for VSV-FAK or GFP-talin (500 μg) and HeLa cells were immunoprecipitated and then labeled with labeling enzyme GalT and UDP-GalNAz according to the Click-iT O-GlcNAc enzymatic labeling system protocol (Invitrogen). Labeled proteins were conjugated with an alkyne-biotin compound following the Click-iT protein analysis detection kit protocol (Invitrogen). Control experiments were performed in the absence of GalT and UDP-GalNAz. Biotinylated and control samples were then subjected to SDS-PAGE and transferred to a polyvinylidene difluoride membrane for further detection using an ABC kit (Vector Laboratories).

      Statistics

      All results shown are the results of at least two independent experiments and are shown as representative data. The values represent the mean ± S.E. p values were calculated using Welch’s correction t test using GraphPad Prism version 5 (*, p < 0.05; **, p < 0.01).

      Author contributions

      T. I. and J. G. designed the research; Z. X. and T. I. performed all experiments; T. F. and Y. W. assisted with experiments; T. I., T. F., Y. W., and J. G. analyzed and interpreted the data; Z. X., T. I., Y. W., and J. G. wrote and revised the manuscript; and all authors approved the final version of the manuscript.

      References

        • Zachara N.E.
        • Hart G.W.
        Cell signaling, the essential role of O-GlcNAc!.
        Biochim. Biophys. Acta. 2006; 1761 (16781888): 599-617
        • Vosseller K.
        • Sakabe K.
        • Wells L.
        • Hart G.W.
        Diverse regulation of protein function by O-GlcNAc: a nuclear and cytoplasmic carbohydrate post-translational modification.
        Curr. Opin. Chem. Biol. 2002; 6 (12470741): 851-857
        • Tan E.P.
        • Duncan F.E.
        • Slawson C.
        The sweet side of the cell cycle.
        Biochem. Soc. Trans. 2017; 45 (28408472): 313-322
        • Singh J.P.
        • Zhang K.
        • Wu J.
        • Yang X.
        O-GlcNAc signaling in cancer metabolism and epigenetics.
        Cancer Lett. 2015; 356 (24769077): 244-250
        • Itkonen H.M.
        • Minner S.
        • Guldvik I.J.
        • Sandmann M.J.
        • Tsourlakis M.C.
        • Berge V.
        • Svindland A.
        • Schlomm T.
        • Mills I.G.
        O-GlcNAc transferase integrates metabolic pathways to regulate the stability of c-MYC in human prostate cancer cells.
        Cancer Res. 2013; 73 (23720054): 5277-5287
        • Slawson C.
        • Hart G.W.
        O-GlcNAc signalling: implications for cancer cell biology.
        Nat. Rev. Cancer. 2011; 11 (21850036): 678-684
        • Copeland R.J.
        • Han G.
        • Hart G.W.
        O-GlcNAcomics: revealing roles of O-GlcNAcylation in disease mechanisms and development of potential diagnostics.
        Proteomics Clin. Appl. 2013; 7 (23640805): 597-606
        • Zhang X.
        • Qiao Y.
        • Wu Q.
        • Chen Y.
        • Zou S.
        • Liu X.
        • Zhu G.
        • Zhao Y.
        • Chen Y.
        • Yu Y.
        • Pan Q.
        • Wang J.
        • Sun F.
        The essential role of YAP O-GlcNAcylation in high-glucose-stimulated liver tumorigenesis.
        Nat. Commun. 2017; 8 (28474680)15280
        • Mi W.
        • Gu Y.
        • Han C.
        • Liu H.
        • Fan Q.
        • Zhang X.
        • Cong Q.
        • Yu W.
        O-GlcNAcylation is a novel regulator of lung and colon cancer malignancy.
        Biochim. Biophys. Acta. 2011; 1812 (21255644): 514-519
        • Gu Y.
        • Mi W.
        • Ge Y.
        • Liu H.
        • Fan Q.
        • Han C.
        • Yang J.
        • Han F.
        • Lu X.
        • Yu W.
        GlcNAcylation plays an essential role in breast cancer metastasis.
        Cancer Res. 2010; 70 (20610629): 6344-6351
        • Caldwell S.A.
        • Jackson S.R.
        • Shahriari K.S.
        • Lynch T.P.
        • Sethi G.
        • Walker S.
        • Vosseller K.
        • Reginato M.J.
        Nutrient sensor O-GlcNAc transferase regulates breast cancer tumorigenesis through targeting of the oncogenic transcription factor FoxM1.
        Oncogene. 2010; 29 (20190804): 2831-2842
        • Yang W.H.
        • Kim J.E.
        • Nam H.W.
        • Ju J.W.
        • Kim H.S.
        • Kim Y.S.
        • Cho J.W.
        Modification of p53 with O-linked N-acetylglucosamine regulates p53 activity and stability.
        Nat. Cell Biol. 2006; 8 (16964247): 1074-1083
        • Ferrer C.M.
        • Lynch T.P.
        • Sodi V.L.
        • Falcone J.N.
        • Schwab L.P.
        • Peacock D.L.
        • Vocadlo D.J.
        • Seagroves T.N.
        • Reginato M.J.
        O-GlcNAcylation regulates cancer metabolism and survival stress signaling via regulation of the HIF-1 pathway.
        Mol. Cell. 2014; 54 (24857547): 820-831
        • Rao X.
        • Duan X.
        • Mao W.
        • Li X.
        • Li Z.
        • Li Q.
        • Zheng Z.
        • Xu H.
        • Chen M.
        • Wang P.G.
        • Wang Y.
        • Shen B.
        • Yi W.
        O-GlcNAcylation of G6PD promotes the pentose phosphate pathway and tumor growth.
        Nat. Commun. 2015; 6 (26399441)8468
        • Xu W.
        • Zhang X.
        • Wu J.L.
        • Fu L.
        • Liu K.
        • Liu D.
        • Chen G.G.
        • Lai P.B.
        • Wong N.
        • Yu J.
        O-GlcNAc transferase promotes fatty liver-associated liver cancer through inducing palmitic acid and activating endoplasmic reticulum stress.
        J. Hepatol. 2017; 67 (28347804): 310-320
        • Franz C.M.
        • Jones G.E.
        • Ridley A.J.
        Cell migration in development and disease.
        Dev. Cell. 2002; 2 (11832241): 153-158
        • Hood J.D.
        • Cheresh D.A.
        Role of integrins in cell invasion and migration.
        Nat. Rev. Cancer. 2002; 2 (12635172): 91-100
        • Guo W.
        • Giancotti F.G.
        Integrin signalling during tumour progression.
        Nat. Rev. Mol. Cell Biol. 2004; 5 (15459662): 816-826
        • Parsons J.T.
        • Horwitz A.R.
        • Schwartz M.A.
        Cell adhesion: integrating cytoskeletal dynamics and cellular tension.
        Nat. Rev. Mol. Cell Biol. 2010; 11 (20729930): 633-643
        • Webb D.J.
        • Parsons J.T.
        • Horwitz A.F.
        Adhesion assembly, disassembly and turnover in migrating cells: over and over and over again.
        Nat. Cell Biol. 2002; 4 (11944043): E97-E100
        • Kwak T.K.
        • Kim H.
        • Jung O.
        • Lee S.A.
        • Kang M.
        • Kim H.J.
        • Park J.M.
        • Kim S.H.
        • Lee J.W.
        Glucosamine treatment-mediated O-GlcNAc modification of paxillin depends on adhesion state of rat insulinoma INS-1 cells.
        J. Biol. Chem. 2010; 285 (20829364): 36021-36031
        • Hagmann J.
        • Grob M.
        • Burger M.M.
        The cytoskeletal protein talin is O-glycosylated.
        J. Biol. Chem. 1992; 267 (1629228): 14424-14428
        • Ji S.
        • Kang J.G.
        • Park S.Y.
        • Lee J.
        • Oh Y.J.
        • Cho J.W.
        O-GlcNAcylation of tubulin inhibits its polymerization.
        Amino Acids. 2011; 40 (20665223): 809-818
        • Ding M.
        • Vandré D.D.
        High molecular weight microtubule-associated proteins contain O-linked-N-acetylglucosamine.
        J. Biol. Chem. 1996; 271 (8647865): 12555-12561
        • Ferrer C.M.
        • Lu T.Y.
        • Bacigalupa Z.A.
        • Katsetos C.D.
        • Sinclair D.A.
        • Reginato M.J.
        O-GlcNAcylation regulates breast cancer metastasis via SIRT1 modulation of FOXM1 pathway.
        Oncogene. 2017; 36 (27345396): 559-569
        • Jiang M.
        • Xu B.
        • Li X.
        • Shang Y.
        • Chu Y.
        • Wang W.
        • Chen D.
        • Wu N.
        • Hu S.
        • Zhang S.
        • Li M.
        • Wu K.
        • Yang X.
        • Liang J.
        • Nie Y.
        • Fan D.
        O-GlcNAcylation promotes colorectal cancer metastasis via the miR-101-O-GlcNAc/EZH2 regulatory feedback circuit.
        Oncogene. 2018; (in press) (30093632)
        • Giancotti F.G.
        • Ruoslahti E.
        Integrin signaling.
        Science. 1999; 285 (10446041): 1028-1032
        • Chen H.C.
        • Appeddu P.A.
        • Parsons J.T.
        • Hildebrand J.D.
        • Schaller M.D.
        • Guan J.L.
        Interaction of focal adhesion kinase with cytoskeletal protein talin.
        J. Biol. Chem. 1995; 270 (7622520): 16995-16999
        • Valdembri D.
        • Serini G.
        Regulation of adhesion site dynamics by integrin traffic.
        Curr. Opin. Cell Biol. 2012; 24 (22981739): 582-591
        • Askari J.A.
        • Tynan C.J.
        • Webb S.E.
        • Martin-Fernandez M.L.
        • Ballestrem C.
        • Humphries M.J.
        Focal adhesions are sites of integrin extension.
        J. Cell Biol. 2010; 188 (20231384): 891-903
        • Collins C.
        • Nelson W.J.
        Running with neighbors: coordinating cell migration and cell-cell adhesion.
        Curr. Opin. Cell Biol. 2015; 36 (26201843): 62-70
        • Wolfram T.
        • Spatz J.P.
        • Burgess R.W.
        Cell adhesion to agrin presented as a nanopatterned substrate is consistent with an interaction with the extracellular matrix and not transmembrane adhesion molecules.
        BMC Cell Biol. 2008; 9 (19055842): 64
        • Parsons J.T.
        • Martin K.H.
        • Slack J.K.
        • Taylor J.M.
        • Weed S.A.
        Focal adhesion kinase: a regulator of focal adhesion dynamics and cell movement.
        Oncogene. 2000; 19 (11114741): 5606-5613
        • Ilić D.
        • Furuta Y.
        • Kanazawa S.
        • Takeda N.
        • Sobue K.
        • Nakatsuji N.
        • Nomura S.
        • Fujimoto J.
        • Okada M.
        • Yamamoto T.
        Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK-deficient mice.
        Nature. 1995; 377 (7566154): 539-544
        • Hang Q.
        • Isaji T.
        • Hou S.
        • Wang Y.
        • Fukuda T.
        • Gu J.
        A key regulator of cell adhesion: identification and characterization of important N-glycosylation sites on integrin α5 for cell migration.
        Mol. Cell. Biol. 2017; 37 (28167607): e00516-e00558
        • Quizi J.L.
        • Baron K.
        • Al-Zahrani K.N.
        • O'Reilly P.
        • Sriram R.K.
        • Conway J.
        • Laurin A.A.
        • Sabourin L.A.
        SLK-mediated phosphorylation of paxillin is required for focal adhesion turnover and cell migration.
        Oncogene. 2013; 32 (23128389): 4656-4663
        • Anthis N.J.
        • Campbell I.D.
        The tail of integrin activation.
        Trends Biochem. Sci. 2011; 36 (21216149): 191-198
        • Wolfenson H.
        • Lavelin I.
        • Geiger B.
        Dynamic regulation of the structure and functions of integrin adhesions.
        Dev. Cell. 2013; 24 (23484852): 447-458
        • Shattil S.J.
        • Kim C.
        • Ginsberg M.H.
        The final steps of integrin activation: the end game.
        Nat. Rev. Mol. Cell Biol. 2010; 11 (20308986): 288-300
        • Comer F.I.
        • Hart G.W.
        O-Glycosylation of nuclear and cytosolic proteins: dynamic interplay between O-GlcNAc and O-phosphate.
        J. Biol. Chem. 2000; 275 (10924527): 29179-29182
        • Yang X.
        • Qian K.
        Protein O-GlcNAcylation: emerging mechanisms and functions.
        Nat. Rev. Mol. Cell Biol. 2017; 18 (28488703): 452-465
        • Mitra S.K.
        • Hanson D.A.
        • Schlaepfer D.D.
        Focal adhesion kinase: in command and control of cell motility.
        Nat. Rev. Mol. Cell Biol. 2005; 6 (15688067): 56-68
        • Xie Z.
        • Sanada K.
        • Samuels B.A.
        • Shih H.
        • Tsai L.H.
        Serine 732 phosphorylation of FAK by Cdk5 is important for microtubule organization, nuclear movement, and neuronal migration.
        Cell. 2003; 114 (12941275): 469-482
        • Bianchi M.
        • De Lucchini S.
        • Marin O.
        • Turner D.L.
        • Hanks S.K.
        • Villa-Moruzzi E.
        Regulation of FAK Ser-722 phosphorylation and kinase activity by GSK3 and PP1 during cell spreading and migration.
        Biochem. J. 2005; 391 (15975092): 359-370
        • Ma A.
        • Richardson A.
        • Schaefer E.M.
        • Parsons J.T.
        Serine phosphorylation of focal adhesion kinase in interphase and mitosis: a possible role in modulating binding to p130Cas.
        Mol. Biol. Cell. 2001; 12 (11160818): 1-12
        • Sakabe K.
        • Hart G.W.
        O-GlcNAc transferase regulates mitotic chromatin dynamics.
        J. Biol. Chem. 2010; 285 (20805223): 34460-34468
        • Grigera P.R.
        • Jeffery E.D.
        • Martin K.H.
        • Shabanowitz J.
        • Hunt D.F.
        • Parsons J.T.
        FAK phosphorylation sites mapped by mass spectrometry.
        J. Cell Sci. 2005; 118 (16254240): 4931-4935
        • Luk C.T.
        • Shi S.Y.
        • Cai E.P.
        • Sivasubramaniyam T.
        • Krishnamurthy M.
        • Brunt J.J.
        • Schroer S.A.
        • Winer D.A.
        • Woo M.
        FAK signalling controls insulin sensitivity through regulation of adipocyte survival.
        Nat. Commun. 2017; 8 (28165007)14360
        • Rondas D.
        • Tomas A.
        • Halban P.A.
        Focal adhesion remodeling is crucial for glucose-stimulated insulin secretion and involves activation of focal adhesion kinase and paxillin.
        Diabetes. 2011; 60 (21357465): 1146-1157
        • Lachén-Montes M.
        • González-Morales A.
        • de Morentin X.M.
        • Pérez-Valderrama E.
        • Ausín K.
        • Zelaya M.V.
        • Serna A.
        • Aso E.
        • Ferrer I.
        • Fernández-Irigoyen J.
        • Santamaría E.
        An early dysregulation of FAK and MEK/ERK signaling pathways precedes the β-amyloid deposition in the olfactory bulb of APP/PS1 mouse model of Alzheimer’s disease.
        J. Proteomics. 2016; 148 (27498392): 149-158
        • Grace E.A.
        • Busciglio J.
        Aberrant activation of focal adhesion proteins mediates fibrillar amyloid β-induced neuronal dystrophy.
        J. Neurosci. 2003; 23 (12533609): 493-502
        • Franco S.J.
        • Rodgers M.A.
        • Perrin B.J.
        • Han J.
        • Bennin D.A.
        • Critchley D.R.
        • Huttenlocher A.
        Calpain-mediated proteolysis of talin regulates adhesion dynamics.
        Nat. Cell Biol. 2004; 6 (15448700): 977-983
        • Segarra M.
        • Vilardell C.
        • Matsumoto K.
        • Esparza J.
        • Lozano E.
        • Serra-Pages C.
        • Urbano-Márquez A.
        • Yamada K.M.
        • Cid M.C.
        Dual function of focal adhesion kinase in regulating integrin-induced MMP-2 and MMP-9 release by human T lymphoid cells.
        FASEB J. 2005; 19 (16260653): 1875-1877
        • Isaji T.
        • Im S.
        • Gu W.
        • Wang Y.
        • Hang Q.
        • Lu J.
        • Fukuda T.
        • Hashii N.
        • Takakura D.
        • Kawasaki N.
        • Miyoshi H.
        • Gu J.
        An oncogenic protein Golgi phosphoprotein 3 up-regulates cell migration via sialylation.
        J. Biol. Chem. 2014; 289 (24895123): 20694-20705
        • Du J.
        • Chen X.
        • Liang X.
        • Zhang G.
        • Xu J.
        • He L.
        • Zhan Q.
        • Feng X.Q.
        • Chien S.
        • Yang C.
        Integrin activation and internalization on soft ECM as a mechanism of induction of stem cell differentiation by ECM elasticity.
        Proc. Natl. Acad. Sci. U.S.A. 2011; 108 (21593411): 9466-9471
        • McFarlane S.
        • McFarlane C.
        • Montgomery N.
        • Hill A.
        • Waugh D.J.
        CD44-mediated activation of α5β1-integrin, cortactin and paxillin signaling underpins adhesion of basal-like breast cancer cells to endothelium and fibronectin-enriched matrices.
        Oncotarget. 2015; 6 (26447611): 36762-36773
        • Horzum U.
        • Ozdil B.
        • Pesen-Okvur D.
        Step-by-step quantitative analysis of focal adhesions.
        MethodsX. 2014; 1 (26150935): 56-59
        • Berginski M.E.
        • Vitriol E.A.
        • Hahn K.M.
        • Gomez S.M.
        High-resolution quantification of focal adhesion spatiotemporal dynamics in living cells.
        PLoS One. 2011; 6 (21779367)e22025