Substitutions in PBP2b from β-Lactam-resistant Streptococcus pneumoniae Have Different Effects on Enzymatic Activity and Drug Reactivity*

  • Philippe Calvez
    Affiliations
    Institut de Biologie Structurale, Université Grenoble Alpes, CEA, CNRS, 38044 Grenoble, France
    Search for articles by this author
  • Eefjan Breukink
    Affiliations
    Department of Chemical Biology and Organic Chemistry, Institute of Biomembranes, Bijvoet Center for Biomolecular Research, Utrecht University, Utrecht 3584 CH, The Netherlands
    Search for articles by this author
  • David I. Roper
    Affiliations
    School of Life Sciences, University of Warwick, Coventry CV4 7AL, United Kingdom
    Search for articles by this author
  • Mélanie Dib
    Affiliations
    Institut de Biologie Structurale, Université Grenoble Alpes, CEA, CNRS, 38044 Grenoble, France
    Search for articles by this author
  • Carlos Contreras-Martel
    Affiliations
    Institut de Biologie Structurale, Université Grenoble Alpes, CEA, CNRS, 38044 Grenoble, France
    Search for articles by this author
  • André Zapun
    Correspondence
    To whom correspondence should be addressed: Institut de Biologie Structurale, 71 Ave. des Martyrs, 38044 Grenoble, France. Tel.: 33-4-57-42-85-43.
    Affiliations
    Institut de Biologie Structurale, Université Grenoble Alpes, CEA, CNRS, 38044 Grenoble, France
    Search for articles by this author
  • Author Footnotes
    * This work was supported by Grant ORBiMP ANR-14-CE14-0003-01 from the Agence Nationale de la Recherche and used the platforms of the Grenoble Instruct Center (UMS 3518 CNRS-CEA-UJF-EMBL) with support from FRISBI Grant ANR-10-INSB-05-02 and GRAL Grant ANR-10-LABX-49-01 within the Grenoble Partnership for Structural Biology. The authors declare that they have no conflicts of interest with the contents of this article.
      Pneumococcus resists β-lactams by expressing variants of its target enzymes, the penicillin-binding proteins (PBPs), with many amino acid substitutions. Up to 10% of the sequence can be modified. These altered PBPs have a much reduced reactivity with the drugs but retain their physiological activity of cross-linking the peptidoglycan, the major constituent of the bacterial cell wall. However, because β-lactams are chemical and structural mimics of the natural substrate, resistance mediated by altered PBPs raises the following paradox: how PBPs that react poorly with the drugs maintain a sufficient level of activity with the physiological substrate. This question is addressed for the first time in this study, which compares the peptidoglycan cross-linking activity of PBP2b from susceptible and resistant strains with their inhibition by different β-lactams. Unexpectedly, the enzymatic activity of the variants did not correlate with their antibiotic reactivity. This finding indicates that some of the numerous amino acid substitutions were selected to restore a viable level of enzymatic activity by a compensatory molecular mechanism.

      Introduction

      Penicillin and other β-lactams are arguably the most important drugs ever, having had a global impact on human health in seven decades of continuous use to fend off bacterial infection (
      • Kardos N.
      • Demain A.L.
      Penicillin: the medicine with the greatest impact on therapeutic outcomes.
      ). β-Lactams hamper formation of the peptidoglycan, which is the main constituent of the bacterial cell wall. Peptidoglycan is a giant polymer encasing the cell and consists of chains of tandemly repeated disaccharides cross-linked by peptide bridges. This cross-linking results from a transpeptidation reaction catalyzed by enzymes that are inhibited by β-lactams, which are mimics of the donor dipeptide of the transpeptidation reaction. The enzymes responsible for the peptidoglycan assembly are called penicillin-binding proteins (PBPs).
      The abbreviations used are: PBP
      penicillin-binding protein
      MIC
      minimal inhibitory concentration
      PDB
      Protein Data Bank.
      They all have a penicillin-binding domain that generally catalyzes the transpeptidation but can also act as a carboxypeptidase or endopeptidase in some cases (
      • Sauvage E.
      • Kerff F.
      • Terrak M.
      • Ayala J.A.
      • Charlier P.
      The penicillin-binding proteins: structure and role in peptidoglycan biosynthesis.
      ). Some PBPs have an additional transglycosylase domain that catalyze the elongation of the glycan strands. The bifunctional transpeptidase and transglycosylase PBPs constitute the class A, whereas the monofunctional transpeptidase PBPs are of class B.
      Resistance to antibiotics is recognized as a major threat to human health (
      Centers for Disease Control and Prevention
      Antibiotic resistance threats in the United States, 2013.
      ). Resistance to β-lactams, which are the most widely used antimicrobials, is particularly worrisome. A case in point is that of pneumococcus, a major human pathogen that causes otitis, pneumonia, and meningitis and that is estimated to cause over 1.5 million deaths per year (
      World Health Organization
      Pneumococcal vaccines.
      ). Pneumococcus and related oral streptococci resist β-lactams by expression of altered PBPs (
      • Zapun A.
      • Contreras-Martel C.
      • Vernet T.
      Penicillin-binding proteins and β-lactam resistance.
      ) encoded by mosaic genes that result from multiple events of homologous recombination with genes from close species combined with additional point mutations (
      • Hakenbeck R.
      • Balmelle N.
      • Weber B.
      • Gardès C.
      • Keck W.
      • de Saizieu A.
      Mosaic genes and mosaic chromosomes: intra- and interspecies genomic variation of Streptococcus pneumoniae.
      ). A similar mechanism of β-lactam resistance operates in Neisseria species (
      • Zapun A.
      • Morlot C.
      • Taha M.K.
      Resistance to β-lactams in Neisseria ssp. due to chromosomally encoded penicillin-binding proteins.
      ). Mosaic PBPs from resistant strains typically harbor tens of amino acid substitutions amounting to more than 10% of the primary sequence in some instances (
      • Zapun A.
      • Contreras-Martel C.
      • Vernet T.
      Penicillin-binding proteins and β-lactam resistance.
      ).
      Of the six PBPs in Streptococcus pneumoniae, three are commonly altered in β-lactam resistant strains: the two monofunctional transpeptidase PBP2b and PBP2x and the bifunctional PBP1a (
      • Zapun A.
      • Contreras-Martel C.
      • Vernet T.
      Penicillin-binding proteins and β-lactam resistance.
      ). The mechanisms responsible for the diminution of the reactivity with the drugs have been investigated biochemically and structurally to various degrees for the three PBPs. For PBPs from a β-lactam-susceptible strain, the common source has been the laboratory strain R6, which has a minimal inhibitory concentration (MIC) below 0.016 μg/ml for penicillin and cefotaxime. The most thoroughly characterized PBPs from resistant pneumococcus are from the highly resistant strain 5204 isolated in France in 1999, with MICs of 6 μg/ml for penicillin and 12 μg/ml for cefotaxime (
      • Chesnel L.
      • Carapito R.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Zapun A.
      Identical penicillin-binding domains in penicillin-binding proteins of Streptococcus pneumoniae clinical isolates with different levels of β-lactam resistance.
      ).
      The monofunctional transpeptidase PBP2x is the most studied of these PBPs. The role of important amino acid substitutions within the active site of PBP2x has been established by kinetics and structural studies. For example, a mutation two residues downstream of the active site serine found in highly resistant strains was shown to change the orientation of the hydroxyl group of the serine, thereby diminishing its reactivity with β-lactams (
      • Chesnel L.
      • Pernot L.
      • Lemaire D.
      • Champelovier D.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Zapun A.
      The structural modifications induced by the M339F substitution in PBP2x from Streptococcus pneumoniae further decreases the susceptibility to β-lactams of resistant strains.
      ). Two other substitutions common in resistant strains were shown to destabilize the structure of a loop that lines the active site (
      • Carapito R.
      • Chesnel L.
      • Vernet T.
      • Zapun A.
      Pneumococcal β-lactam resistance due to a conformational change in penicillin-binding protein 2x.
      ). A comprehensive study of all the substitutions in the transpeptidase domain of PBP2x from the highly resistant strain 5204 determined that only 6 of the 41 substitutions are important for reducing the reactivity with β-lactams (
      • Carapito R.
      • Chesnel L.
      • Vernet T.
      • Zapun A.
      Pneumococcal β-lactam resistance due to a conformational change in penicillin-binding protein 2x.
      ).
      The other monofunctional class B PBP2b has not been as extensively studied, although the crystal structure has been solved for the variants from the susceptible laboratory strain R6 and the clinical resistant strain 5204 (
      • Contreras-Martel C.
      • Dahout-Gonzalez C.
      • Martins Ados S.
      • Kotnik M.
      • Dessen A.
      PBP active site flexibility as the key mechanism for β-lactam resistance in pneumococci.
      ). Like in PBP2x, a loop forming one side or “lip” of the active site is flexible in the variant from the resistant strain. Sequence comparison identified the T446A substitution within the active site as critical for resistance, and an early biochemical study demonstrated that this mutation severely reduces the reactivity with β-lactams, although no reaction kinetics could be measured (
      • Pagliero E.
      • Chesnel L.
      • Hopkins J.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Di Guilmi A.M.
      Biochemical characterization of Streptococcus pneumoniae penicillin-binding protein 2b and its implication in β-lactam resistance.
      ).
      Likewise, the crystal structure of the transpeptidase domain of the class A PBP1a was solved for the susceptible strain R6 and the resistant strain 5204 (
      • Contreras-Martel C.
      • Job V.
      • Di Guilmi A.M.
      • Vernet T.
      • Dideberg O.
      • Dessen A.
      Crystal structure of penicillin-binding protein 1a (PBP1a) reveals a mutational hotspot implicated in β-lactam resistance in Streptococcus pneumoniae.
      ,
      • Job V.
      • Carapito R.
      • Vernet T.
      • Dessen A.
      • Zapun A.
      Common alterations in PBP1a from resistant Streptococcus pneumoniae decrease its reactivity toward β-lactams: structural insights.
      ). A mutation adjacent to the active site serine was found to modify its orientation, and the loop forming a lip of the active site was destabilized as in PBP2x and PBP2b by a stretch of four substitutions (
      • Job V.
      • Carapito R.
      • Vernet T.
      • Dessen A.
      • Zapun A.
      Common alterations in PBP1a from resistant Streptococcus pneumoniae decrease its reactivity toward β-lactams: structural insights.
      ).
      β-Lactams owe their tremendous medical success to their structural likeness to the terminal dipeptide d-Ala–d-Ala of the donor stem peptide in the transpeptidation reaction (
      • Tipper D.J.
      • Strominger J.L.
      Mechanism of action of penicillins: a proposal based on their structural similarity to acyl-d-alanyl-d-alanine.
      ). The carbonyl of the β-lactam ring that is attacked by the nucleophilic active site serine is analogous to the carbonyl of the peptide bond that links the two terminal d-alanine residues of the peptidoglycan stem peptide. Because of the similarity between the drugs and physiological substrate, we are facing the following paradox: PBP alterations that affect reaction with β-lactams, as briefly presented above, would be expected to impact negatively on their transpeptidase enzymatic function. To solve this paradox, compensatory mechanisms likely mitigate this problem. Compensation could take place at the cellular level to cope with the effectively reduced enzymatic activity of the PBPs in resistant strains. Alternatively, compensation could occur at the molecular level of the PBPs themselves if the consequences of some substitutions are different on the reactivity with the β-lactams and the transpeptidase activity. The two types of compensatory mechanisms are not mutually exclusive and could operate together.
      Investigating cellular mechanisms that could compensate for lower PBP activity is very difficult because the cascade of events that occur in the pneumococcus following β-lactam challenge remains largely mysterious (
      • Engel H.
      • Mika M.
      • Denapaite D.
      • Hakenbeck R.
      • Mühlemann K.
      • Heller M.
      • Hathaway L.J.
      • Hilty M.
      A low-affinity penicillin-binding protein 2x variant is required for heteroresistance in Streptococcus pneumoniae.
      ,
      • Filipe S.R.
      • Severina E.
      • Tomasz A.
      The murMN operon: a functional link between antibiotic resistance and antibiotic tolerance in Streptococcus pneumoniae.
      • Philippe J.
      • Gallet B.
      • Morlot C.
      • Denapaite D.
      • Hakenbeck R.
      • Chen Y.
      • Vernet T.
      • Zapun A.
      Mechanism of β-lactam action in Streptococcus pneumoniae: the piperacillin paradox.
      ). Demonstrating the existence of compensatory mechanism to maintain the enzymatic activity of mosaic PBPs of S. pneumoniae was not possible until recently because there was no assay to evaluate the transpeptidase activity in vitro. This hurdle was removed because the proper peptidoglycan precursor is now available. The nature of the stem pentapeptide of the membrane-linked precursor (lipid II) varies slightly in different bacterial species. In the pneumococcus, the second residue is a γ-d-iso-glutamine. The discovery of the amido transferase enzyme (MurT/GatD) that modifies the second residue γ-d-glutamate into γ-d-iso-glutamine (
      • Figueiredo T.A.
      • Sobral R.G.
      • Ludovice A.M.
      • Almeida J.M.
      • Bui N.K.
      • Vollmer W.
      • de Lencastre H.
      • Tomasz A.
      Identification of genetic determinants and enzymes involved with the amidation of glutamic acid residues in the peptidoglycan of Staphylococcus aureus.
      ,
      • Münch D.
      • Roemer T.
      • Lee S.H.
      • Engeser M.
      • Sahl H.G.
      • Schneider T.
      Identification and in vitro analysis of the GatD/MurT enzyme-complex catalyzing lipid II amidation in Staphylococcus aureus.
      ) has allowed the preparation of lipid II that can be used by pneumococcal PBPs to synthesize cross-linked peptidoglycan in vitro (
      • Zapun A.
      • Philippe J.
      • Abrahams K.A.
      • Signor L.
      • Roper D.I.
      • Breukink E.
      • Vernet T.
      In vitro reconstitution of peptidoglycan assembly from the Gram-positive pathogen Streptococcus pneumoniae.
      ).
      To investigate the paradox raised by PBP-based resistance and the structural similarity between β-lactams and the natural substrate of PBPs, we present here a comparison of four variants of PBP2b, (i) from the susceptible laboratory strain R6, (ii) from the clinical resistant strain 5204 (
      • Contreras-Martel C.
      • Dahout-Gonzalez C.
      • Martins Ados S.
      • Kotnik M.
      • Dessen A.
      PBP active site flexibility as the key mechanism for β-lactam resistance in pneumococci.
      ,
      • Pagliero E.
      • Chesnel L.
      • Hopkins J.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Di Guilmi A.M.
      Biochemical characterization of Streptococcus pneumoniae penicillin-binding protein 2b and its implication in β-lactam resistance.
      ), (iii) a hybrid form with the N terminus from strain 5204 and the C terminus of strain R6, and (iv) the T446A point mutant (FIGURE 1, FIGURE 2). 5204-PBP2b carries 56 substitutions, of which 43 are within the transpeptidase domain. Hybrid-PBP2b carries 28 substitutions, including 15 in the transpeptidase domain, and requires further presentation. The hybrid form was not designed but results from the transformation of the R6 strain with the pbp2b gene from strain 5204 and selection with piperacillin. S. pneumoniae is naturally competent and readily recombines foreign homologous DNA. An allele conferring a resistance can therefore easily be introduced and selected, provided that flanking regions are provided to allow recombination. With PBP2b, however, the whole gene could not be introduced because recombination repeatedly occurred within the coding region, resulting in a gene with the 5′-region from the resistant strain and the 3′-region retained from the susceptible strain (
      • Pagliero E.
      • Chesnel L.
      • Hopkins J.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Di Guilmi A.M.
      Biochemical characterization of Streptococcus pneumoniae penicillin-binding protein 2b and its implication in β-lactam resistance.
      ,
      • Philippe J.
      • Gallet B.
      • Morlot C.
      • Denapaite D.
      • Hakenbeck R.
      • Chen Y.
      • Vernet T.
      • Zapun A.
      Mechanism of β-lactam action in Streptococcus pneumoniae: the piperacillin paradox.
      ,
      • Sauerbier J.
      • Maurer P.
      • Rieger M.
      • Hakenbeck R.
      Streptococcus pneumoniae R6 interspecies transformation: genetic analysis of penicillin resistance determinants and genome-wide recombination events.
      ). Characterization of the resulting Hybrid-PBP2B might shed light on this incomplete incorporation of the 5204-pbp2b allele in the R6 strain. The T446A substitution, which is found in both 5204- and Hybrid-PBP2b, is the most commonly found in resistant strains and can confer some resistance alone (
      • Pagliero E.
      • Chesnel L.
      • Hopkins J.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Di Guilmi A.M.
      Biochemical characterization of Streptococcus pneumoniae penicillin-binding protein 2b and its implication in β-lactam resistance.
      ).
      Figure thumbnail gr1
      FIGURE 1Sequence alignment of PBP2b variants. The yellow band indicates the extent of the transpeptidase domain. The scissors indicate the site of truncation to produce the soluble extracellular domain. Conserved active site motifs are denoted by asterisks, and the corresponding residues are boxed in red, or green for the active site serine that undergoes acylation. Other boxed residues indicate positions that are substituted in 5204-PBP2b. The important T446A mutation is in orange and denoted by a triangle. The sequence from 5204-PBP2b is in gray, and that of R6-PBP2b is in blue. The sequence of hybrid-PBP2b is colored according to its two sequences of origin, with the junction positioned arbitrarily midway between unambiguous positions. Residues forming the upper lip of the active site (positions 619–629) are in a darker shade.
      Figure thumbnail gr2
      FIGURE 2Structural model of the extracellular domain of Hybrid-PBP2b. The model was constructed by combining the X-ray structures of R6- and 5204-PBP2b (PDB entries 2WAF and 2WAD). The positions of the active site residues and substitutions are shown by spheres. The color scheme is as in . Therefore, the substitutions shown in blue are present in 5204-PBP2b and absent in Hybrid-PBP2b.
      For the first time, both the in vitro transpeptidase activity and the reactivity with a panel of β-lactams were evaluated for a set of PBPs. We uncovered a new level of complexity because the impacts of substitutions on the transpeptidase activity and reactivity with β-lactams are not fully correlated, revealing that some substitutions have compensatory effects that restore enzymatic activity. We also discovered that variants of PBP2b can display β-lactamase activity that may contribute to the resistance to some β-lactams.

      Results

       Transpeptidase Activity

      To meaningfully compare their transpeptidase activity, it was necessary to use equivalent amounts of the PBP2b variants. Impurities from Triton X-100 and traces of oxidized DTT prevented the accurate determination of the concentrations of the detergent-solubilized full-length proteins from their UV absorbance. Instead, protein amounts were determined in-gel after electrophoresis by quantifying the fluorescence of Bocillin-labeled PBP2b. The truncated soluble forms of PBP2b were used as standards because their concentrations could be determined from their UV absorbance. Care was taken to use a concentration of Bocillin FL and reaction time sufficient to completely label even the variants with lowest β-lactam reactivity. That this was achieved was shown by the fact that the ratio of fluorescence to subsequent Coomassie-staining was similar for all proteins. Because Bocillin binding implies a functional active site, this observation suggests that the proportion of active enzyme was the same in all cases.
      Peptidoglycan assembly was monitored using the polyacrylamide gel electrophoretic assay used previously and presented by a scheme in Fig. 3 (
      • Zapun A.
      • Philippe J.
      • Abrahams K.A.
      • Signor L.
      • Roper D.I.
      • Breukink E.
      • Vernet T.
      In vitro reconstitution of peptidoglycan assembly from the Gram-positive pathogen Streptococcus pneumoniae.
      ). The lipid II peptidoglycan precursor migrates at the front, glycan chains of various length migrate as a smear within the gel, whereas high molecular mass cross-linked peptidoglycan, the product of transpeptidation, remains at the top of the gel. A small amount of dansylated precursor (10%) is incorporated to allow in-gel fluorescence imaging under UV transillumination. The amount of fluorescent precursor is kept to a minimum as it cannot function as acceptor in the transpeptidation because the dansyl group is attached to the lysine side chain that normally takes part in the reaction. PBP2b is a monofunctional transpeptidase that does not cross-link lipid II stem peptides but requires polymerized glycan chains as substrate. Therefore, the S370A-PBP1a point mutant, which is devoid of transpeptidase activity but retains a functional transglycosylase domain, was included to synthesize glycan chains from lipid II.
      Figure thumbnail gr3
      FIGURE 3Scheme of the in vitro reaction of peptidoglycan synthesis performed and the gel system used for analysis. Transpeptidase inactivated S370A-PBP1a was used to elongate glycan chains by transglycosylation (TG) and PBP2b cross-linked chains by transpeptidation (TP). A small amount of fluorescent lipid II (denoted by a star) was incorporated to visualize the reagents and products after polyacrylamide gel electrophoresis.
      The transpeptidase activity of the PBP2b variants was assessed by comparing the amount of fluorescence present at the top of the electrophoretic gel (Fig. 4). In the end point experiment shown in Fig. 4A, R6-PBP2b produced more cross-linked peptidoglycan after 16 h of reaction than Hybrid-PBP2b, followed by 5204- and T446A-PBP2b. The PBP2b variants were present in the same amount as checked by SDS-PAGE analysis of the protein mixtures after reaction with Bocillin and subsequent staining with Coomassie Blue (Fig. 4B). Note that S370A-PBP1a did not react with Bocillin, as expected from the absence of the active site serine.
      Figure thumbnail gr4
      FIGURE 4In vitro transpeptidase activity of PBP2b variants. Reactions were carried out with 0.3 μm S370A-PBP1a to polymerize the glycan chains, without (control, Ctl) or with 1 μm of the different PBP2b variants, at pH 7.5, 30 °C and the presence of 0.02% Triton X-100, with 50 μm lipid II and 5 μm dansylated lipid II. The assay is depicted schematically in . A, SDS-PAGE analysis of peptidoglycan synthesis after overnight reaction. B, SDS-PAGE analysis of the protein mixes used in A after reaction with Bocillin. The PBP2b-bound Bocillin was revealed by UV transillumination (bottom panel), prior to Coomassie staining (top panel). C, time course of peptidoglycan synthesis reactions. Reactions were stopped after various time intervals by the addition of penicillin and moenomycin. The graph shows the quantification of the cross-linked peptidoglycan resulting from R6- (●), Hybrid- (■), 5204- (▴), and T446A-PBP2b (♦) activity as the fraction of fluorescent material remaining at the top of the gel, after subtraction of the amount measured in the control in the absence of PBP2b (Ctl).
      This crude assay does not measure the actual amount of peptide cross-links resulting from transpeptidation but only the overall amount of cross-linked peptidoglycan. Nevertheless, assuming a uniform density of cross-links and considering the amount of cross-linked peptidoglycan after 16 h of reaction, the relative activity of the PBP2b variants can be ranked as follows: R6 (100) > Hybrid (22 ± 3) > 5204 (11 ± 2) > T446A (9 ± 2). The numbers represent the amount of cross-linked peptidoglycan relative to that formed by R6-PBP2b. The error is the standard error to the mean of five independent experiments. Although the difference between the amount of cross-linked peptidoglycan produced by 5204- and T446A-PBP2b is small, the latter was smaller in all five experiments. A one-tailed paired t test of the data gave a p value of 0.035, indicating that the small difference is significant. A time course is shown in Fig. 4C. The transpeptidase activity of all PBP2b variants were inhibited with 1 mm penicillin G.
      The T446A mutant is the least active, despite having a single substitution that is also present in Hybrid- and 5204-PBP2b. This observation implies that some of the substitutions found in the latter sequences are compensatory and increase the transpeptidase activity that is severely impacted by the T446A mutation. Most interestingly, Hybrid-PBP2b, which is a laboratory selected chimeric sequence, has a better enzymatic activity than its parental clinical strain.

       Reaction with Bocillin FL and Comparison between Full-length and Soluble Truncated PBP2bs

      It is easier to produce and manipulate soluble proteins than detergent-solubilized membrane proteins. Because we aimed to characterize the acylation of PBP2b by several β-lactams, it was highly desirable to use a truncated soluble form of the proteins in the absence of detergent. However, to ensure the relevance of such measurements, we first compared the reactivity of some detergent-solubilized full-length and soluble truncated PBP2bs with Bocillin FL monitored by polyacrylamide gel electrophoresis (Fig. 5).
      Figure thumbnail gr5
      FIGURE 5Reaction of full-length and soluble PBP2b variants with Bocillin FL at pH 7.5 and 25 °C. A, time course of the reaction of 1 μm Hybrid-PBP2b with 1 mm of Bocillin FL. The reaction was stopped after various time intervals by the addition of SDS-containing loading buffer and analyzed by SDS-PAGE. Ctl is the control of PBP2b inactivation by SDS where 1 mm of Bocillin FL was added to the loading buffer. BCN indicates the fluorescence of Bocillin FL, and CB indicates the Coomassie-stained protein. B, time course of the reaction of 1 μm R6-PBP2b with 5 (●), 10 (■), 15 (▴), and 20 μm (♦) of Bocillin FL. The procedure was as in A. The fluorescence of Bocillin FL weighted by the Coomassie protein signal of each sample was plotted versus time. The regression curves were calculated globally using a second order reaction model. C, comparison of the acylation efficiencies of full-length and soluble truncated forms of PBP2b, measured as in A and B. The error bars are the standard errors from the regressions.
      The reaction of PBPs with β-lactams can be described kinetically with the three-step model (
      • Ghuysen J.M.
      • Frère J.M.
      • Leyh-Bouille M.
      • Nguyen-Distèche M.
      • Coyette J.
      Active-site-serine d-alanyl-d-alanine-cleaving-peptidase-catalysed acyl-transfer reactions. Procedures for studying the penicillin-binding proteins of bacterial plasma membranes.
      ) (Equation 1). A non-covalent complex PBP·βL is formed between the enzyme and the inhibitor (βL), with the dissociation constant KD, from which acylation proceeds to form the covalent complex PBP-βL with the rate k2. PBP-βL is finally hydrolyzed with the rate k3 to regenerate the enzyme and an inactivated product P. The rate described by k3 is usually negligible on the time scale of a bacterial generation. The second order rate constant k2/KD is the efficiency of acylation, which allows calculation of the overall acylation rate at a given concentration of antibiotic. Note that the inhibitory potency of a particular β-lactam for a PBP is given by the c50, which is the antibiotic concentration resulting in the inhibition of half the PBP molecules at steady state (i.e. when the acylation and deacylation reactions proceed at the same rate). The value of c50 is equal to the ratio k3/(k2/KD).
      PBP+βLKD1PBP·βLk2PBP-βLk3PBP+P
      (Eq. 1)


      Purified recombinant PBP2b variants were incubated with various concentration of Bocillin FL (a fluorescently labeled penicillin V) in large excess. After various time intervals, aliquots were withdrawn, and the reaction was stopped by the addition of a denaturing solution (0.2% SDS final) and heating at 100 °C. Samples were analyzed by polyacrylamide gel electrophoresis, which allowed the separation of PBP2b-bound Bocillin from the free form (Fig. 5A). We checked that the inactivation procedure was effective by adding 1 mm Bocillin FL to the denaturing solution. Minimal labeling of PBP2b occurred in this way (Fig. 5A, sample Ctl). The in-gel fluorescence of PBP2b-bound Bocillin was quantified and normalized with respect to the amount of PBP2b in each sample, as quantified after subsequent Coomassie staining. The second order rate constant k2/KD was obtained from global fitting of the time course data at the different drug concentrations using a second order reaction model described in Equation 2 (Fig. 5B). With R6-PBP2b, which is highly reactive, using low drug concentrations in the same range as that of the protein was necessary to measure sufficiently slow reactions. For this reason, we fitted the data without making the usual first order approximation that is appropriate when the drug concentration is in large excess and can be considered constant.
      PBP+βL(k2/KD)βLPBP-βL
      (Eq. 2)


      The acylation efficiency of R6-PBP2b by Bocillin FL was found in the range of 104 m−1 s−1, which is similar to values reported with PBP3 from Acinetobacter baumanii and Pseudomonas aeruginosa (
      • Shapiro A.B.
      • Gu R.F.
      • Gao N.
      • Livchak S.
      • Thresher J.
      Continuous fluorescence anisotropy-based assay of BOCILLIN FL penicillin reaction with penicillin binding protein 3.
      ). Reaction with 5204-PBP2b was ∼200-fold slower, whereas it was reduced 1000-fold with Hybrid-PBP2b. It is surprising that Hybrid-PBP2b is even less reactive with Bocillin than 5204-PBP2b, despite the fact that it exhibits a better transpeptidase activity.
      No difference of reactivity with Bocillin was found between the full-length and truncated proteins (Fig. 5C). It was assumed to be true of all β-lactams and further kinetic data were obtained with the soluble forms only.

       Reaction with Nitrocefin and Competition with other β-Lactams

      In contrast to the other monofunctional PBP2x, the reaction of PBP2b with β-lactams has not been characterized in details, because of the absence of modification of the optical spectra upon acylation by the drugs (
      • Pagliero E.
      • Chesnel L.
      • Hopkins J.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Di Guilmi A.M.
      Biochemical characterization of Streptococcus pneumoniae penicillin-binding protein 2b and its implication in β-lactam resistance.
      ). To palliate this lack of data, we measured the acylation efficiency by several β-lactams by monitoring the chromogenic reaction with nitrocefin. The absorbance spectrum of nitrocefin changes upon opening of the β-lactam ring, and the reactions were followed by the rise in absorbance at 490 nm. With nitrocefin alone, the data collected at different drug concentrations could be globally fitted to a second order reaction model to extract the acylation efficiency k2/KD (Equation 3).
      PBP+NCF(k2/KD)NCFPBP-NCF
      (Eq. 3)


      With R6-, Hybrid-, and T446A-PBP2b, no further degradation of nitrocefin was detected, and reactions reached the expected stoichiometric plateau, unlike what had been observed in a study of Staphylococcus aureus PBP2a (
      • Graves-Woodward K.
      • Pratt R.F.
      Reaction of soluble penicillin-binding protein 2a of methicillin-resistant Staphylococcus aureus with β-lactams and acyclic substrates: kinetics in homogeneous solution.
      ). With 5204-PBP2b, a further linear increase of the absorbance was observed, which was interpreted as a hydrolysis turnover of nitrocefin. The data could be fitted if the deacylation reaction (Equation 4) was included in the model, which allowed measurement of the constant k3.
      PBP-NCF(k3)NCFPBP+P1
      (Eq. 4)


      To obtain the acylation efficiency for other non-chromogenic β-lactams, we performed competition experiments where each drug was added to PBP2b together with nitrocefin. Absorbance data, which measure the disappearance of nitrocefin, were fitted with a model that includes the two competing reactions described in Equations 2 and 3, while using the value of k2/KD for nitrocefin measured before. This was the case for R6- and T446A-PBP2b with amoxicillin, penicillin G, piperacillin, and cefotaxime, as well as Hybrid-PBP2b with penicillin. No reaction of 5204- and Hybrid-PBP2b was observed with cefotaxime.
      Following the first phase of the reaction with 5204-PBP2, a linear increase of the absorbance was observed with amoxicillin, penicillin G, and piperacillin, which was greater than with nitrocefin alone, indicating an additional hydrolysis turnover of these β-lactams. Data could be fitted with a model including the four reactions described in Equations 25, while introducing the k2/KD and k3 measured independently for nitrocefin.
      PBP-βL(k3)βLPBP+P2
      (Eq. 5)


      In the cases of amoxicillin and piperacillin with Hybrid-PBP2b, a turnover of these antibiotics was also detected, and the absorbance data were fitted with a model that included the three reactions described by Equations 2, 3, and 5 introducing the known k2/KD for nitrocefin.
      Examples of the data and regression curves are given in Fig. 6. Note that in such competition assays between two reactants, of which only one can be monitored (such as nitrocefin in this case), the amplitude of the signal decreases, and the apparent acylation rate increases with increasing concentrations of the invisible competitor (
      • Graves-Woodward K.
      • Pratt R.F.
      Reaction of soluble penicillin-binding protein 2a of methicillin-resistant Staphylococcus aureus with β-lactams and acyclic substrates: kinetics in homogeneous solution.
      ). Values of acylation efficiencies k2/KD, and deacylation rate constant k3 are given in Table 1. Errors in Table 1 are standard errors from the regression, which do not include errors on the concentrations of drugs and proteins. Concentration of the β-lactams was calculated from the weighted mass of powder used to prepare stock solutions. Protein concentration was determined from the UV absorbance. Assuming an error of 10% on the concentration of reactants, the accuracy of the measured acylation efficiencies is ∼20%. With PBP2b, nitrocefin and Bocillin FL are the most reactive drugs of our panel, followed by amoxicillin, piperacillin, and penicillin G. Cefotaxime is much less reactive. R6-PBP2b has an efficiency of acylation by penicillin G of 930 m−1 s−1, which is 100-fold slower than the other monofunctional PBP2x (
      • Chesnel L.
      • Pernot L.
      • Lemaire D.
      • Champelovier D.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Zapun A.
      The structural modifications induced by the M339F substitution in PBP2x from Streptococcus pneumoniae further decreases the susceptibility to β-lactams of resistant strains.
      ). With cefotaxime, R6-PBP2b is 4 × 107-fold less reactive than PBP2x (
      • Chesnel L.
      • Pernot L.
      • Lemaire D.
      • Champelovier D.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Zapun A.
      The structural modifications induced by the M339F substitution in PBP2x from Streptococcus pneumoniae further decreases the susceptibility to β-lactams of resistant strains.
      ). Qualitatively, the reactivities measured in vitro here and in other studies for R6 PBPs (
      • Chesnel L.
      • Pernot L.
      • Lemaire D.
      • Champelovier D.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Zapun A.
      The structural modifications induced by the M339F substitution in PBP2x from Streptococcus pneumoniae further decreases the susceptibility to β-lactams of resistant strains.
      ,
      • Carapito R.
      • Chesnel L.
      • Vernet T.
      • Zapun A.
      Pneumococcal β-lactam resistance due to a conformational change in penicillin-binding protein 2x.
      ,
      • Job V.
      • Carapito R.
      • Vernet T.
      • Dessen A.
      • Zapun A.
      Common alterations in PBP1a from resistant Streptococcus pneumoniae decrease its reactivity toward β-lactams: structural insights.
      ) are in agreement with the acylations observed in vivo (
      • Philippe J.
      • Gallet B.
      • Morlot C.
      • Denapaite D.
      • Hakenbeck R.
      • Chen Y.
      • Vernet T.
      • Zapun A.
      Mechanism of β-lactam action in Streptococcus pneumoniae: the piperacillin paradox.
      ,
      • Kocaoglu O.
      • Tsui H.C.
      • Winkler M.E.
      • Carlson E.E.
      Profiling of β-lactam selectivity for penicillin-binding proteins in Streptococcus pneumoniae D39.
      ).
      Figure thumbnail gr6
      FIGURE 6Reaction of soluble PBP2b variants with nitrocefin, alone or in competition with amoxicillin, at pH 7.5 and 25 °C. The change in absorbance that occurs upon opening of the β-lactam ring of nitrocefin was recorded at 490 nm. A fraction of the data points is shown (between 5 and 20%). The solid lines are global fits to the data using the reaction models described in the text. Rate constants are given in . A, 18 μm of R6-PBP2b was incubated in the presence of 20 (●), 40 (■), 60 (▴), 80 (♦), and 100 (▾) μm of nitrocefin. B, 20 μm of T446A-PBP2b was incubated in the presence of 35 (●), 50 (■), 70 (▴), 85 (♦), and 100 (▾) μm of nitrocefin. C, 30 μm of Hybrid-PBP2b and 70 μm of nitrocefin were incubated in the presence of 0 (▾), 150 (♦), 300 (▴), 600 (■), and 1200 (●) μm of amoxicillin. D, 20 μm of 5204-PBP2b and 50 μm of nitrocefin were incubated with of 0 (▾), 75 (♦), 150 (▴), 300 (■), and 600 (●) μm of amoxicillin.
      TABLE 1Kinetic parameters of the reaction between β-lactams and PBP2 variants
      R6T446A5204Hybrid
      Nitrocefin
      k2/KD (m−1 s−1)12,700 ± 35074 ± 13230 ± 2120 ± 6
      k3 (s−1)NDND(8 ± 2) × 10−5ND
      c50 (m)3.5 × 10−7
      Amoxicillin
      k2/KD (m−1 s−1)3000 ± 130222 ± 1070 ± 240 ± 1
      k3 (s#x2212;1)NDND(6.2 ± 0.1) × 10−3(1.0 ± 0.2) × 10−4
      c50 (m)8.9 × 10−52.5 × 10−5
      Penicillin G
      k2/KD (m−1 s−1)930 ± 2533 ± 135 ± 119 ± 0.3
      k3 (s−1)NDND(2.0 ± 0.05) × 10−3ND
      c50> (m)5.7 10−5
      Piperacillin
      k2/KD (m−1 s−1)2400 ± 94280 ± 8190 ± 680 ± 2
      k3 (s−1)NDND(4.0 ± 0.2) × 10−4(7 ± 2) × 10−5
      c50 (m)2.1 × 10−69 × 10−7
      Cefotaxime
      k2/KD (m−1 s−1)(5 ± 2) × 10−3(1.0 ± 0.1) × 10−3<10−3<10−3
      k3 (s−1)NDNDNDND
      Bocillin FL
      k2/KD (m−1 s−1)13,700 ± 111ND68 ± 1112 ± 1
      The single T446A substitution accounts for most of the diminution in acylation efficiency with a 170–8-fold reduction with nitrocefin or piperacillin, respectively. The additional 55 substitutions in 5204-PBP2b collectively only modestly affect the reactivity, whereas removal of the 27 C-terminal substitutions, as in Hybrid-PBP2b, produces a further 2-fold reduction (Table 1).

       Amoxicillin Turnover Evidenced by Further Reaction with Bocillin FL

      Given the possible significance for resistance of the deacylation of 5204-PBP2b with several β-lactams and the indirect way it was measured with nitocefin, we conducted an alternative time course experiments with amoxicillin. Full-length R6- and 5204-PBP2b were first acylated by incubation with amoxicillin at a concentration sufficient to ensure full acylation. Then, at the start of the deacylation time course, a large excess of fluorescent Bocillin FL was added, at a concentration at which reaction can be considered instantaneous on the time scale of the experiment. Amoxicillin was still present, but its concentration was much lower than that of Bocillin FL. Reacylation by amoxicillin was therefore negligible, and the time course of labeling by Bocillin FL reflects the deacylation rate of the PBP2b-amoxicillin complex.
      A very slow deacylation of R6-PBP2b was detected. After 80 min, less than 25% of the enzyme had been regenerated and able to react with Bocillin FL (Fig. 7A). The data did not allow the determination of a reliable k3 but implied a value smaller than 6 × 10−5 s−1 or a half-life of the acyl-enzyme greater than 3 h. A comparable value of 3.8 × 10−5 s−1 has been reported for the deacylation of a radioactive penicillin G acyl-enzyme with a soluble form of R6-PBP2b (
      • Pagliero E.
      • Chesnel L.
      • Hopkins J.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Di Guilmi A.M.
      Biochemical characterization of Streptococcus pneumoniae penicillin-binding protein 2b and its implication in β-lactam resistance.
      ). Such rates are negligible on the bacterial generation time scale.
      Figure thumbnail gr7
      FIGURE 7Deacylation of the PBP2b-amoxicillin complex. A and B, full-length R6- (A) and 5204-PBP2b (B) were incubated at 1 μm for 15 min with 100 μm amoxicillin prior to the addition at time 0 of 1 mm of Bocillin FL. After various time intervals, the reaction was stopped by the addition of denaturing loading buffer, and samples were analyzed by SDS-PAGE. Fully Bocillin-labeled samples were prepared without amoxicillin (Ctl). Bocillin-labeled PBP2b was imaged and quantified under UV illumination. C, data for the labeling of 5204-PBP2B were fitted to a first order kinetic to extract the amoxicillin deacylation constant k3 = (10 ± 1) × 10−3 s−1. The error is the standard error from the regression.
      In contrast, a significant deacylation was measured with 5204-PBP2b (Fig. 7, B and C). Nearly complete turnover was observed after 4 min, which yielded the deacylation rate k3 = (10 ± 1) × 10−3 s−1 and a half-life of the inhibitory complex of 70 s. These values are clearly significant for growing bacteria. The value of k3 measured for full-length 5204-PBP2b by the time course of reacylation with Bocillin FL is in good agreement with the value of 6.2 × 10−3 s−1 measured by competition with nitrocefin for the soluble form of the protein (Table 1).

       Thermofluor Assay

      To gain insight on the interactions between the PBP2b variants and the various β-lactams that may account for the different kinetic behavior, we investigated the effect of the acylation on the thermal stability of the soluble proteins. The thermofluor assay measure the fluorescence emitted by a probe (SYPRO® Orange) that binds to hydrophobic surfaces exposed during protein unfolding induced by rising the temperature (
      • Lo M.C.
      • Aulabaugh A.
      • Jin G.
      • Cowling R.
      • Bard J.
      • Malamas M.
      • Ellestad G.
      Evaluation of fluorescence-based thermal shift assays for hit identification in drug discovery.
      ,
      • Pantoliano M.W.
      • Petrella E.C.
      • Kwasnoski J.D.
      • Lobanov V.S.
      • Myslik J.
      • Graf E.
      • Carver T.
      • Asel E.
      • Springer B.A.
      • Lane P.
      • Salemme F.R.
      High-density miniaturized thermal shift assays as a general strategy for drug discovery.
      ). Fluorescence of the probe is enhanced in the hydrophobic environment. Thermofluor data without or with penicillin or piperacillin are shown in Fig. 8. Three observations can be made from the melting temperatures (Tm) given in Table 2. First, acylation of R6-PBP2b by penams such as amoxicillin, penicillin G, and piperacillin stabilizes the protein, whereas acylation by the cephalosporin cefotaxime is destabilizing. Second, in the absence of bound antibiotic, R6-PBP2b is thermally less stable than its variants from resistant strains. 5204- and Hybrid-PBP2b have the same higher Tm. Third, on the contrary, variants from the resistant strains in their acylated form are less stable than acylated R6-PBP2b. This effect is more important for 5204- than for Hybrid-PBP2b. Note that this does not apply with cefotaxime, which presumably did not acylate the resistance variants at the concentration used (1 mm).
      Figure thumbnail gr8
      FIGURE 8Thermal denaturation of PBP2b variants in apo and acylated forms (Thermofluor). Soluble truncated R6- (A), Hybrid- (B), and 5204-PBP2b (C) were incubated without (continuous line) or with 1 mm penicillin (line with long dashes) or piperacillin (line with short dashes) prior to thermal denaturation in the presence of the fluorescent probe SYPRO® Orange. The first derivative of the fluorescence as a function of increasing temperature is shown.
      TABLE 2Melting temperatures (Tm) of PBP2b in the absence or presence of 1 mm β-lactam Tm (°C) were determined as the minimum of the first derivative of the melting curves. The mean of two experiments is given. Standard deviation was at most 0.5 °C
      NoneAMXPENPIPCTX
      R6-PBP2b49.559.057.559.546.0
      5204-PBP2b52.053.045.551.552.0
      Hybrid-PBP2b52.056.049.054.552.5

      Discussion

      The properties of the PBP2b variants measured in vitro, both the transpeptidase activity and the reactivity with β-lactams, are consistent with the impossibility to introduce the full PBP2b sequence from a clinical resistant strain (5204) into the susceptible strain R6. Indeed, the Hybrid-PBP2b resulting from the splicing of the N-terminal part of 5204-PBP2b and the C-terminal part of R6-PBP2b has better enzymatic activity and lower drug reactivity than the full 5204-PBP2b. The biochemical properties of Hybrid-PBP2b explain why it is repeatedly selected by β-lactams in laboratory transformation experiments (
      • Pagliero E.
      • Chesnel L.
      • Hopkins J.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Di Guilmi A.M.
      Biochemical characterization of Streptococcus pneumoniae penicillin-binding protein 2b and its implication in β-lactam resistance.
      ,
      • Philippe J.
      • Gallet B.
      • Morlot C.
      • Denapaite D.
      • Hakenbeck R.
      • Chen Y.
      • Vernet T.
      • Zapun A.
      Mechanism of β-lactam action in Streptococcus pneumoniae: the piperacillin paradox.
      ,
      • Sauerbier J.
      • Maurer P.
      • Rieger M.
      • Hakenbeck R.
      Streptococcus pneumoniae R6 interspecies transformation: genetic analysis of penicillin resistance determinants and genome-wide recombination events.
      ). Note that if the c50 is considered, 5204-PBP2b is slightly less susceptible to β-lactam than Hybrid-PBP2b. The level of transpeptidase activity would therefore be the main factor favoring the selection of Hybrid-PBP2b instead of 5204-PBP2b by β-lactams.
      Examination of the modeled structure of Hybrid-PBP2b shows that the missing substitutions compared with 5204-PBP2b are distributed in the “upper lip” of the active site and at the “back” of the protein (Fig. 2). The “upper lip” substitutions A619G, D625G, Q628E, and T630N are the most likely to cause the severe diminution of transpeptidase activity of 5204-PBP2b because of their proximity to the active site residues at the entrance of the cleft. The region spanning these substitutions forms a loop connecting strands β3 and β4 that is mobile and not visible in the crystal structure of 5204-PBP2b (
      • Contreras-Martel C.
      • Dahout-Gonzalez C.
      • Martins Ados S.
      • Kotnik M.
      • Dessen A.
      PBP active site flexibility as the key mechanism for β-lactam resistance in pneumococci.
      ). However, the role of these substitutions in reducing the reactivity with the drugs is likely limited, contrary to what was thought previously (
      • Contreras-Martel C.
      • Dahout-Gonzalez C.
      • Martins Ados S.
      • Kotnik M.
      • Dessen A.
      PBP active site flexibility as the key mechanism for β-lactam resistance in pneumococci.
      ), because Hybrid-PBP2b with a probable “stiff upper lip” is even less reactive with β-lactams than the more “relaxed” 5204-PBP2b. In contrast, substitutions in the lower lip of the active site S412P, N422Y, T426Q, and Q427L likely contribute the most to the decrease in reactivity with the drugs. Interestingly and in agreement with the PBP2b observations, substitutions in the lower lip of PBP2x were found to reduce β-lactam reactivity, whereas substitutions in the β3-β4 upper lip had no effect or even increased the reactivity with the drug (
      • Carapito R.
      • Chesnel L.
      • Vernet T.
      • Zapun A.
      Pneumococcal β-lactam resistance due to a conformational change in penicillin-binding protein 2x.
      ). Note that the β3-β4 upper lip in PBP2x protrudes in the solvent and makes no contact with a bound cefuroxime molecule (
      • Gordon E.
      • Mouz N.
      • Duée E.
      • Dideberg O.
      The crystal structure of the penicillin-binding protein 2x from Streptococcus pneumoniae and its acyl-enzyme form: implication in drug resistance.
      ). The lower lip on the contrary is held tightly against the active site and contacts the bound antibiotic. Unfortunately, no crystal structure of PBP2b with bound antibiotic and no data on the transpeptidase activity of PBP2x variants are available to further compare both proteins.
      The deacylation rate (k3), which may also contribute to the resistance, is particularly elevated with 5204-PBP2b. It is possible that the flexibility of the upper lip and the replacement of Ala619 by a glycine very close to the active site Ser386 allow easier access of water to the acyl-enzyme bond.
      The T446A substitution is the most important to reduce the acylation by β-lactams (Table 1). Collectively, the 55 other substitutions in 5204-PBP2b cause only a modest additional reduction of the acylation rate (Table 1). Among these, the 27 substitutions at the C terminus must collectively have an opposite effect on the reactivity with β-lactams, because their absence in Hybrid-PBP2b further decreases the reactivity (Table 1). The T446A mutation, however, is very detrimental to the transpeptidase activity, the point mutant being the less active of the four variants (Fig. 3).
      Therefore, among the many substitutions found in mosaic PBPs from resistant strains, some substitutions play key roles in reducing the reactivity toward β-lactams, such as the T446A in PBP2b or the six substitutions identified among 41 in the transpeptidase domain of 5204-PBP2x (
      • Carapito R.
      • Chesnel L.
      • Vernet T.
      • Zapun A.
      Pneumococcal β-lactam resistance due to a conformational change in penicillin-binding protein 2x.
      ). Other substitutions are likely neutral and present solely by virtue of the “hitchhiking” effect resulting from the homologous recombination of long stretches of DNA. What is revealed in the present study is that some substitutions are compensatory and participate to the resistance not by restricting the reaction with the drugs but by restoring an acceptable level of physiological enzymatic activity, which would otherwise be severely impacted by mutations that hamper the reaction with β-lactams.
      The findings above raise the question of why is 5204-PBP2b present in a clinical resistant strain, since a sequence with fewer substitutions appears biochemically superior? A clue can be found in a laboratory study of the transfer of β-lactam resistance from Streptococcus mitis to S. pneumoniae (
      • Sauerbier J.
      • Maurer P.
      • Rieger M.
      • Hakenbeck R.
      Streptococcus pneumoniae R6 interspecies transformation: genetic analysis of penicillin resistance determinants and genome-wide recombination events.
      ). The full sequence of PBP2b from a resistant S. mitis strain, including the 16 substitutions at the C terminus following position 590, could be transformed and selected by benzylpenicillin in S. pneumoniae, only if the mosaic variant of the murM gene from the S. mitis was also introduced.
      The murMN operon encodes two cytoplasmic enzymes responsible for the “branching” of the stem peptides of the peptidoglycan (
      • Filipe S.R.
      • Severina E.
      • Tomasz A.
      The murMN operon: a functional link between antibiotic resistance and antibiotic tolerance in Streptococcus pneumoniae.
      ). The precursor of the peptidoglycan is synthesized with a pentapeptide, the third residue of which is a lysine in pneumococcus. The free amine of the lysine side chain of the donor peptide forms the peptide bond with the fourth residue (d-Ala) carboxyl group of the donor peptide to cross-link glycan chains. Alternatively, MurM and MurN can add successively two residues onto the lysine side chain to produce branched stem peptides with additional Ser-Ala or Ala-Ala dipeptides. It is then the N terminus of the dipeptide on the acceptor that forms the cross-linking peptide bond with the donor stem peptide. Strain R6 and its parental strain R36A were found to have ∼45 and 36% branched peptides, respectively (
      • Bui N.K.
      • Eberhardt A.
      • Vollmer D.
      • Kern T.
      • Bougault C.
      • Tomasz A.
      • Simorre J.P.
      • Vollmer W.
      Isolation and analysis of cell wall components from Streptococcus pneumoniae.
      ,
      • Filipe S.R.
      • Tomasz A.
      Inhibition of the expression of penicillin resistance in Streptococcus pneumoniae by inactivation of cell wall muropeptide branching genes.
      ). In clinical resistant strains that express a MurM variant from a mosaic allele, the proportion of branched stem peptide is increased up to 85% (
      • Filipe S.R.
      • Tomasz A.
      Inhibition of the expression of penicillin resistance in Streptococcus pneumoniae by inactivation of cell wall muropeptide branching genes.
      ), because of a greater enzymatic activity of the MurM variant (
      • Lloyd A.J.
      • Gilbey A.M.
      • Blewett A.M.
      • De Pascale G.
      • El Zoeiby A.
      • Levesque R.C.
      • Catherwood A.C.
      • Tomasz A.
      • Bugg T.D.
      • Roper D.I.
      • Dowson C.G.
      Characterization of tRNA-dependent peptide bond formation by MurM in the synthesis of Streptococcus pneumoniae peptidoglycan.
      ). In the absence of MurM, no branched peptides are detected, and the resistance is abolished despite the presence of altered PBPs (
      • Filipe S.R.
      • Tomasz A.
      Inhibition of the expression of penicillin resistance in Streptococcus pneumoniae by inactivation of cell wall muropeptide branching genes.
      ).
      To explain the special relationship between PBP2b and MurM in β-lactam resistance, two plausible explanations can be considered. More branched peptides may have a compensatory role (i) on the enzymatic activity of PBP2b or (ii) on the cell wall metabolism. (i) Branched stem peptides may be better substrates for altered PBP2bs than the linear form, either as donor or acceptor, thus compensating the decreased transpeptidase activity. It is highly desirable to test this hypothesis in vitro, but suitable substrates are unfortunately not available in sufficient amounts. However, the fact that in the absence of antibiotic challenge, a strain devoid of MurM and branched peptide grows normally with altered PBPs (
      • Filipe S.R.
      • Tomasz A.
      Inhibition of the expression of penicillin resistance in Streptococcus pneumoniae by inactivation of cell wall muropeptide branching genes.
      ) argues strongly against PBP2b simply discriminating between different peptide substrates. (ii) PBP2b participates in the elongation of the ovoid pneumococcal cell (
      • Tsui H.C.
      • Boersma M.J.
      • Vella S.A.
      • Kocaoglu O.
      • Kuru E.
      • Peceny J.K.
      • Carlson E.E.
      • VanNieuwenhze M.S.
      • Brun Y.V.
      • Shaw S.L.
      • Winkler M.E.
      Pbp2x localizes separately from Pbp2b and other peptidoglycan synthesis proteins during later stages of cell division of Streptococcus pneumoniae D39.
      ). Addition of peptidoglycan material to the cell wall during elongation requires concomitant opening of the existing peptidoglycan to permit insertion. A peptidoglycan lytic transglycosylase has recently been identified that likely works in concert with PBP2b during elongation of the pneumococcus (
      • Tsui H.C.
      • Zheng J.J.
      • Magallon A.N.
      • Ryan J.D.
      • Yunck R.
      • Rued B.E.
      • Bernhardt T.G.
      • Winkler M.E.
      Suppression of a deletion mutation in the gene encoding essential PBP2b reveals a new lytic transglycosylase involved in peripheral peptidoglycan synthesis in Streptococcus pneumoniae D39.
      ). A decreased transpeptidase activity of PBP2b might create an imbalance with the degradative activity of its associated lytic transglycosylase that may trigger full lysis with the participation of other peptidoglycan hydrolases such as the major autolysin LytA. The greater proportion of branched peptides caused by mosaic MurM may protect against lysis. Indeed, elevated level of branched peptides caused by expression of a mosaic hyperactive MurM also protects against cell lysis normally induced by non-β-lactam antibiotics (
      • Filipe S.R.
      • Severina E.
      • Tomasz A.
      The murMN operon: a functional link between antibiotic resistance and antibiotic tolerance in Streptococcus pneumoniae.
      ). Also, gradual depletion of PBP2b was found to be tolerated to a large extent due to an increased level of branched peptides. In the absence of MurM, and consequently of branched peptides, depletion of PBP2b was much less tolerated (
      • Berg K.H.
      • Stamsås G.A.
      • Straume D.
      • Håvarstein L.S.
      Effects of low PBP2b levels on cell morphology and peptidoglycan composition in Streptococcus pneumoniae R6.
      ).
      In conclusion, we propose that the deleterious effect of mutations that greatly diminish the reactivity of PBP2b with β-lactams, such as the T446A, is compensated by a combination of compensatory substitutions within PBP2b that maintain a minimal necessary transpeptidase activity, together with an alteration of the peptidoglycan composition that compensate for the reduced enzymatic activity.
      The reactivity with Bocillin FL of the extracellular domain of PBP2b was found to be the same as that of the full-length membrane proteins (Fig. 5). In contrast, the transpeptidase activity was severely impacted by the truncation of the transmembrane segment. Residual activity was detected only with soluble R6-PBP2b (not shown). An influence of the membrane anchor on the active site cannot be ruled out but is unlikely in the light of the reaction with β-lactams. Rather, the glycan chains and the full-length enzymes may be brought into close proximity by their common anchoring into detergent micelles. This efficient concentration effect is lost by truncation of the transmembrane segment. In any case, the in vitro transpeptidase activities reported here and previously are extremely weak and far from realistic physiologic rates. In the future, it will be necessary to study monofunctional PBPs in a membrane environment and/or in the presence of their protein partners (
      • Noirclerc-Savoye M.
      • Lantez V.
      • Signor L.
      • Philippe J.
      • Vernet T.
      • Zapun A.
      Reconstitution of membrane protein complexes involved in pneumococcal septal cell wall assembly.
      ), in particular SEDS proteins that act as transglycosylases (
      • Meeske A.J.
      • Riley E.P.
      • Robins W.P.
      • Uehara T.
      • Mekalanos J.J.
      • Kahne D.
      • Walker S.
      • Kruse A.C.
      • Bernhardt T.G.
      • Rudner D.Z.
      SEDS proteins are a widespread family of bacterial cell wall polymerases.
      ).
      Additional comments can be made by comparing of the reaction rates with different β-lactams. Cefotaxime does not react significantly with PBP2b, as reported previously (
      • Pagliero E.
      • Chesnel L.
      • Hopkins J.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Di Guilmi A.M.
      Biochemical characterization of Streptococcus pneumoniae penicillin-binding protein 2b and its implication in β-lactam resistance.
      ,
      • Kocaoglu O.
      • Tsui H.C.
      • Winkler M.E.
      • Carlson E.E.
      Profiling of β-lactam selectivity for penicillin-binding proteins in Streptococcus pneumoniae D39.
      ). This property is not general to cephalosporins, however, because nitrocefin was the most reactive drug of our panel. Examination of the structure of the different cephalosporins that fail to react with PBP2b (
      • Kocaoglu O.
      • Tsui H.C.
      • Winkler M.E.
      • Carlson E.E.
      Profiling of β-lactam selectivity for penicillin-binding proteins in Streptococcus pneumoniae D39.
      ,
      • Hakenbeck R.
      • Tornette S.
      • Adkinson N.F.
      Interaction of non-lytic β-lactams with penicillin-binding proteins in Streptococcus pneumoniae.
      ) suggests that the nature of the R2 substituent is important. Bulky and planar substituent in position R2 appear to prevent recognition by PBP2b, whereas smaller and tetrahedral substituent seem compatible. The unfavorable interaction between cefotaxime and PBP2b seems to persist once the β-lactam ring is open and the acyl-enzyme complex is formed, because the thermal stability of the protein is diminished (Table 2).
      It is remarkable that substitutions that lead to the thermal stabilization of the apo form of 5204- and Hybrid-PBP2b compared with the apo form of R6-PBP2b have the opposite effect on the acylated forms (Table 2). In the variants from the resistant strains, the covalently bound drugs must make unfavorable interactions with the proteins. Although the “open” forms of the antibiotics that are bound in the active site are different from the original β-lactams, they likely retain interactions that also occur in the preacylation complex or the transition state and may be relevant to the acylation and deacylation kinetics.
      Other than nitrocefin, which is not in clinical use, the most important diminution of reactivity measured for 5204-PBP2b compared with R6-PBP2b was with amoxicillin. It is also with amoxicillin that the greatest β-lactamase activity was measured for 5204-PBP2b (Table 1). Amoxicillin has long been a widely prescribed treatment for otitis media and sore throat, even when bacterial infection is not clearly diagnosed (
      • Lieberthal A.S.
      • Carroll A.E.
      • Chonmaitree T.
      • Ganiats T.G.
      • Hoberman A.
      • Jackson M.A.
      • Joffe M.D.
      • Miller D.T.
      • Rosenfeld R.M.
      • Sevilla X.D.
      • Schwartz R.H.
      • Thomas P.A.
      • Tunkel D.E.
      The diagnosis and management of acute otitis media.
      ,
      • Shulman S.T.
      • Bisno A.L.
      • Clegg H.W.
      • Gerber M.A.
      • Kaplan E.L.
      • Lee G.
      • Martin J.M.
      • Van Beneden C.
      Infectious Diseases Society of America
      Clinical practice guideline for the diagnosis and management of group A streptococcal pharyngitis: 2012 update by the Infectious Diseases Society of America.
      ). The nasopharyngeal flora, including S. pneumoniae has therefore been subjected to a severe selection pressure by amoxicillin, and it is possible that the substitutions found in 5204-PBP2b reflects the clinical practice. Strain 5204 exhibits the highest level of amoxicillin resistance (MIC 6 μg ml−1) in a panel of French clinical isolates, together with isolate 5268, which has a similar PBP2b sequence (
      • Chesnel L.
      • Carapito R.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Zapun A.
      Identical penicillin-binding domains in penicillin-binding proteins of Streptococcus pneumoniae clinical isolates with different levels of β-lactam resistance.
      ).
      The surprising finding that a laboratory selected PBP2b (Hybrid) performs better in vitro than its clinical parental variant (5204) indicates that β-lactam resistance in pneumococcus is a complex process that is not fully described by biochemical reconstitution experiments. Resistance to β-lactams must be considered as a complete physiological response with compensatory mechanisms at play. Such mechanisms should be studied in the future because they may offer novel therapeutic options.

      Experimental Procedures

       Chemicals

      Lyophilized nitrocefin was purchased from Oxoid (catalog no. SR0112C), reconstituted at 2 mm in DMSO, and stored at −20 °C. Bocillin FL was from ThermoFischer Scientific (ref: B13233). Stock solutions were prepared in 50 mm HEPES, pH 7.5, 100 mm NaCl, 10 mm MgCl2 at 50 mm and stored at −20 °C. Amoxicillin (catalog no. A8523), cefotaxime (catalog no. C7912), penicillin G (catalog no. P3032), and piperacillin (catalog no. P8396) were from Sigma and solubilized at 100 mm in the same buffer and stored at −20 °C, except amoxicillin, which was solubilized with the addition of 1% NH4OH and kept for a maximum of 15 days at −80 °C.
      Lys-containing lipid II and dansylated lipid II were prepared as described previously (
      • Breukink E.
      • van Heusden H.E.
      • Vollmerhaus P.J.
      • Swiezewska E.
      • Brunner L.
      • Walker S.
      • Heck A.J.
      • de Kruijff B.
      Lipid II is an intrinsic component of the pore induced by nisin in bacterial membranes.
      ,
      • Helassa N.
      • Vollmer W.
      • Breukink E.
      • Vernet T.
      • Zapun A.
      The membrane anchor of penicillin-binding protein PBP2a from Streptococcus pneumoniae influences peptidoglycan chain length.
      ). Amidation of lipid II and subsequent purification was performed as described previously (
      • Zapun A.
      • Philippe J.
      • Abrahams K.A.
      • Signor L.
      • Roper D.I.
      • Breukink E.
      • Vernet T.
      In vitro reconstitution of peptidoglycan assembly from the Gram-positive pathogen Streptococcus pneumoniae.
      ).

       Structure Modeling

      The structural model of Hybrid-PBP2b was constructed by superposing the crystal structures of R6-PBP2b (PDB code 2WAF) from residues 518–682 onto that of 5204-PBP2b (PBD code 2WAD) using LSQ Superpose in COOT (
      • Emsley P.
      • Cowtan K.
      Coot: model-building tools for molecular graphics.
      ) from the CCP4 program suite (
      • Winn M.D.
      • Ballard C.C.
      • Cowtan K.D.
      • Dodson E.J.
      • Emsley P.
      • Evans P.R.
      • Keegan R.M.
      • Krissinel E.B.
      • Leslie A.G.
      • McCoy A.
      • McNicholas S.J.
      • Murshudov G.N.
      • Pannu N.S.
      • Potterton E.A.
      • Powell H.R.
      • et al.
      Overview of the CCP4 suite and current developments.
      ). The model structure was then created by replacing residues 518–682 in 5204-PBP2b by those from R6-PBP2b. Because examination of the model found no clash or other anomaly, a simple structure idealization was performed with REFMAC (
      • Murshudov G.N.
      • Skubák P.
      • Lebedev A.A.
      • Pannu N.S.
      • Steiner R.A.
      • Nicholls R.A.
      • Winn M.D.
      • Long F.
      • Vagin A.A.
      REFMAC5 for the refinement of macromolecular crystal structures.
      ).

       Expression Plasmids

      Full-length R6-PBP2b with a C-terminal Strep-tag was expressed from the modified pET-30 plasmid described before (
      • Zapun A.
      • Philippe J.
      • Abrahams K.A.
      • Signor L.
      • Roper D.I.
      • Breukink E.
      • Vernet T.
      In vitro reconstitution of peptidoglycan assembly from the Gram-positive pathogen Streptococcus pneumoniae.
      ). The gene encoding Hybrid-PBP2b was PCR-amplified from genomic DNA from laboratory strain R6 ΔlytA pbp2b5 (
      • Philippe J.
      • Gallet B.
      • Morlot C.
      • Denapaite D.
      • Hakenbeck R.
      • Chen Y.
      • Vernet T.
      • Zapun A.
      Mechanism of β-lactam action in Streptococcus pneumoniae: the piperacillin paradox.
      ) using primers Nde2b and 2bStopNheSpeBam (
      • Zapun A.
      • Philippe J.
      • Abrahams K.A.
      • Signor L.
      • Roper D.I.
      • Breukink E.
      • Vernet T.
      In vitro reconstitution of peptidoglycan assembly from the Gram-positive pathogen Streptococcus pneumoniae.
      ). The gene coding for 5204-PBP2b was amplified from DNA of the clinical strain 5204 (
      • Chesnel L.
      • Carapito R.
      • Croizé J.
      • Dideberg O.
      • Vernet T.
      • Zapun A.
      Identical penicillin-binding domains in penicillin-binding proteins of Streptococcus pneumoniae clinical isolates with different levels of β-lactam resistance.
      ) using primers Nde2b and 2b5204Bam (GGTCGACGGATCCATTCATTG GATGGTGTTGG). A NdeI internal site was silently mutated by PCR using primers 2b5204mutNdeFW (GTATAAATTGGCGTATGGATCTTTTC) and 2b5204mutNdeRV (GAAAAGATCCATACGCCAATTTATAC). The resulting PBP2b coding genes were introduced as NdeI/BamHI fragments into a modified pET-30 plasmid, which encodes a C-terminal Strep-tag.
      N-terminally truncated versions of the three PBP2b variants starting at residue Met39 were subcloned in the same modified pET-30 expression plasmid following PCR amplification from the parent plasmids encoding the full-length proteins, using primers Nde2bstar (GAGAATTCCATATGCAGGTTTTGAACAAGGATTTTTACG) and 2bStopNheSpeBam or 2b5204bam. All final coding sequences were checked.

       Protein Expression and Purification

      Full-length S370A-PBP1a with an N-terminal His tag was produced and purified as described (
      • Abrahams K.A.
      The Enzymology of Streptococcus pneumoniae Peptidoglycan Polymerization.
      ). The preparation of PBP2bs were as detailed in the supporting information of previous work (
      • Zapun A.
      • Philippe J.
      • Abrahams K.A.
      • Signor L.
      • Roper D.I.
      • Breukink E.
      • Vernet T.
      In vitro reconstitution of peptidoglycan assembly from the Gram-positive pathogen Streptococcus pneumoniae.
      ). Briefly, all pneumococcal proteins were produced in Escherichia coli BL21 (DE3) star. Full-length variants were purified from Triton X-100-solubilized membranes, whereas soluble truncated forms were purified from the soluble fraction of cell lysates. All variants harboring a C-terminal Strep-tag were purified by Strep-Tactin affinity chromatography in 50 mm HEPES, pH 7.5, 150 mm NaCl, 10 mm MgCl2. Proteins were eluted with 2.5 mm desthiobiotin. Full-length protein solutions also contained 0.02% Triton X-100 and 1 mm DTT because the PBP2bs contain a cysteine residue near the N terminus.

       Peptidoglycan Synthesis

      Unlabeled iso-glutamine-containing lipid II and dansylated lipid II in CHCl3:methanol (1:1) were mixed in a 10:1 ratio and dried under nitrogen flow. The dried lipid II mix was then redissolved to a final concentration of 55 μm in the reaction mix typically containing 50 mm HEPES, pH 7.5, 150 mm NaCl, 10 mm MgCl2, 25% (v/v) DMSO, and 0.02% (w/v) Triton X-100, and the PBPs were investigated. The concentrations of buffer, salts, and particularly of detergent contributed by the protein stocks were taken into account. The concentrations of S370A-PBP1a and PBP2bs were 0.3 and 1 μm, respectively. Penicillin G (1 mm) was included as required. The reactions were left to proceed overnight at 30 °C unless otherwise stated. For time course experiments, aliquots were withdrawn after various time intervals, and the reaction was stopped by the addition of penicillin G (1 mm) and moenomycin (Flavomycin, Hoechst, 0.5 mm). Samples were analyzed by SDS-PAGE (
      • Zapun A.
      • Philippe J.
      • Abrahams K.A.
      • Signor L.
      • Roper D.I.
      • Breukink E.
      • Vernet T.
      In vitro reconstitution of peptidoglycan assembly from the Gram-positive pathogen Streptococcus pneumoniae.
      ) and visualized with blue transillumination using the GelDoc ChemiDoc MP imager (Bio-Rad). Quantification was performed on unsaturated images using the Image Lab software (Bio-Rad).

       Kinetics of PBP2b Reaction with Bocillin FL

      Full-length and truncated soluble variants of PBP2b were incubated in the presence of various concentrations of Bocillin FL at 20 °C in 50 mm HEPES, pH 7.5, 150 mm NaCl, 10 mm MgCl2, and 0.02% (w/v) Triton X-100 for the full-length proteins. The ranges of Bocillin FL concentrations were 5–20 μm for R6-PBP2bs or 0.25–1 mm for Hybrid- and 5204-PBP2bs. Aliquots were withdrawn after various time intervals, and the reaction was stopped by the addition of loading buffer (0.2% (w/v) SDS final concentration) and a heat shock (100 °C, 5 min). The fluorescence of Bocillin-PBP2b complexes was recorded under blue transillumination. Fluorescence data were corrected for the relative amount of PBP2b in each sample after subsequent quantification of Coomassie-stained protein bands. Imaging and quantification were performed using a GelDoc ChemiDoc MP imager and the Image Lab software (Bio-Rad). The data were fitted globally with the DynaFit software (
      • Kuzmic P.
      Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase.
      ) (Biokine) using a second order reaction model.

       Amoxicillin Deacylation Kinetics

      Full-length R6- or 5204-PBP2b were incubated at 1 μm for 15 min at 20 °C with 100 μm amoxicillin in 50 mm HEPES, pH 7.5, 150 mm NaCl, 10 mm MgCl2, and 0.02% (w/v) Triton X-100, prior to addition of 1 mm Bocillin FL at time 0 of the deacylation time course. After various time intervals, the reaction was stopped, and samples were analyzed as above. The data for the fraction (f) of Bocillin-labeled protein were fitted to a first order kinetic (f = 1 − exp(−k3t)) using the Kaleidagraph software (Synergy).

       Kinetics of PBP2b Reaction with Nitrocefin and Other β-Lactams

      The different soluble PBP2b variants were incubated with either various concentrations of nitrocefin or a fixed concentration nitrocefin and varying concentrations of other β-lactams, in 50 mm HEPES, pH 7.5, 150 mm NaCl, 10 mm MgCl2. Absorbance at 490 nm was recorded at 25 °C in an OPTIMA FLUOstar plate reader where 150 μl of protein solution were automatically injected onto 100 μl of antibiotic solution in a Greiner 96-well plate. PBP2b and drug concentrations were as follows. With 18 μm R6-PBP2b, nitrocefin was varied alone from 20 to 100 μm, whereas it was kept at 10 μm while amoxicillin ranged from 0 to 25 μm, penicillin G from 0 to 800 μm, piperacillin from 0 to 80 μm, and cefotaxime from 0 to 5 mm. With 20 μm 5204-PBP2b, nitrocefin was varied alone from 100 to 500 μm, whereas it was kept at 150 μm while amoxicillin and penicillin G ranged from 0 to 2.5 mm, and piperacillin from 0 to 800 μm. With 30 μm Hybrid-PBP2b, nitrocefin was varied alone from 200 to 800 μm, whereas it was kept at 70 μm while amoxicillin ranged from 0 to 1.2 mm, penicillin G from 0 to 2 mm and piperacillin from 0 to 150 μm. With 20 μm T446A-PBP2b, nitrocefin was varied alone from 70 to 200 μm, whereas it was kept at 35 μm while amoxicillin ranged from 0 to 625 μm, penicillin G from 0 to 2.4 mm, piperacillin from 0 to 300 μm, and cefotaxime from 0 to 4.5 mm. For each PBP2b variant, the data for a range of β-lactam concentrations were fitted globally with the DynaFit software (
      • Kuzmic P.
      Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase.
      ) (Biokine) using second order reaction models for the acylations and first order model for the deacylation, as described under “Results.”

       Thermofluor Assay

      Soluble PBP2b variants at a final concentration of 0.5 mg/ml (∼6 μm) were incubated with or without 1 mm of amoxicillin, penicillin G, piperacillin, or cefotaxime in 50 mm HEPES, pH 7.5, 150 mm NaCl, and 10 mm MgCl2 for 5 min at room temperature prior to the addition of SYPRO® Orange (12× final concentration) on ice. Fluorescence melting curves were recorded in the SYBR channel in a CFX Connect instrument (Bio-Rad) with a 20–100 °C temperature ramp (0.5 °C steps of 7.2 s) and analyzed with the CFX Manager software.

      Author Contributions

      P. C. and A. Z. designed and conducted most of the experiments and analyzed the results. E. B. synthesized lipid II. D. I. R. purified PBP1a. M. D. performed the thermal shift assays. C. C.-M. modeled the protein structure. A. Z. wrote the manuscript.

      Acknowledgments

      We thank Anne-Marie Villard for performing site-directed mutagenesis and Thierry Vernet and Max Maurin for critical discussion of the results.

      References

        • Kardos N.
        • Demain A.L.
        Penicillin: the medicine with the greatest impact on therapeutic outcomes.
        Appl. Microbiol. Biotechnol. 2011; 92: 677-687
        • Sauvage E.
        • Kerff F.
        • Terrak M.
        • Ayala J.A.
        • Charlier P.
        The penicillin-binding proteins: structure and role in peptidoglycan biosynthesis.
        FEMS Microbiol. Rev. 2008; 32: 234-258
        • Centers for Disease Control and Prevention
        Antibiotic resistance threats in the United States, 2013.
        CDC, Atlanta, Georgia2015
        • World Health Organization
        Pneumococcal vaccines.
        Weekly Epidemiol. Record. 2003; 78: 110-119
        • Zapun A.
        • Contreras-Martel C.
        • Vernet T.
        Penicillin-binding proteins and β-lactam resistance.
        FEMS Microbiol. Rev. 2008; 32: 361-385
        • Hakenbeck R.
        • Balmelle N.
        • Weber B.
        • Gardès C.
        • Keck W.
        • de Saizieu A.
        Mosaic genes and mosaic chromosomes: intra- and interspecies genomic variation of Streptococcus pneumoniae.
        Infect. Immun. 2001; 69: 2477-2486
        • Zapun A.
        • Morlot C.
        • Taha M.K.
        Resistance to β-lactams in Neisseria ssp. due to chromosomally encoded penicillin-binding proteins.
        Antibiotics. 2016; 5: E35
        • Chesnel L.
        • Carapito R.
        • Croizé J.
        • Dideberg O.
        • Vernet T.
        • Zapun A.
        Identical penicillin-binding domains in penicillin-binding proteins of Streptococcus pneumoniae clinical isolates with different levels of β-lactam resistance.
        Antimicrob. Agents Chemother. 2005; 49: 2895-2902
        • Chesnel L.
        • Pernot L.
        • Lemaire D.
        • Champelovier D.
        • Croizé J.
        • Dideberg O.
        • Vernet T.
        • Zapun A.
        The structural modifications induced by the M339F substitution in PBP2x from Streptococcus pneumoniae further decreases the susceptibility to β-lactams of resistant strains.
        J. Biol. Chem. 2003; 278: 44448-44456
        • Carapito R.
        • Chesnel L.
        • Vernet T.
        • Zapun A.
        Pneumococcal β-lactam resistance due to a conformational change in penicillin-binding protein 2x.
        J. Biol. Chem. 2006; 281: 1771-1777
        • Contreras-Martel C.
        • Dahout-Gonzalez C.
        • Martins Ados S.
        • Kotnik M.
        • Dessen A.
        PBP active site flexibility as the key mechanism for β-lactam resistance in pneumococci.
        J. Mol. Biol. 2009; 387: 899-909
        • Pagliero E.
        • Chesnel L.
        • Hopkins J.
        • Croizé J.
        • Dideberg O.
        • Vernet T.
        • Di Guilmi A.M.
        Biochemical characterization of Streptococcus pneumoniae penicillin-binding protein 2b and its implication in β-lactam resistance.
        Antimicrob. Agents Chemother. 2004; 48: 1848-1855
        • Contreras-Martel C.
        • Job V.
        • Di Guilmi A.M.
        • Vernet T.
        • Dideberg O.
        • Dessen A.
        Crystal structure of penicillin-binding protein 1a (PBP1a) reveals a mutational hotspot implicated in β-lactam resistance in Streptococcus pneumoniae.
        J. Mol. Biol. 2006; 355: 684-696
        • Job V.
        • Carapito R.
        • Vernet T.
        • Dessen A.
        • Zapun A.
        Common alterations in PBP1a from resistant Streptococcus pneumoniae decrease its reactivity toward β-lactams: structural insights.
        J. Biol. Chem. 2008; 283: 4886-4894
        • Tipper D.J.
        • Strominger J.L.
        Mechanism of action of penicillins: a proposal based on their structural similarity to acyl-d-alanyl-d-alanine.
        Proc. Natl. Acad. Sci. U.S.A. 1965; 54: 1133-1141
        • Engel H.
        • Mika M.
        • Denapaite D.
        • Hakenbeck R.
        • Mühlemann K.
        • Heller M.
        • Hathaway L.J.
        • Hilty M.
        A low-affinity penicillin-binding protein 2x variant is required for heteroresistance in Streptococcus pneumoniae.
        Antimicrob. Agents Chemother. 2014; 58: 3934-3941
        • Filipe S.R.
        • Severina E.
        • Tomasz A.
        The murMN operon: a functional link between antibiotic resistance and antibiotic tolerance in Streptococcus pneumoniae.
        Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 1550-1555
        • Philippe J.
        • Gallet B.
        • Morlot C.
        • Denapaite D.
        • Hakenbeck R.
        • Chen Y.
        • Vernet T.
        • Zapun A.
        Mechanism of β-lactam action in Streptococcus pneumoniae: the piperacillin paradox.
        Antimicrob. Agents Chemother. 2015; 59: 609-621
        • Figueiredo T.A.
        • Sobral R.G.
        • Ludovice A.M.
        • Almeida J.M.
        • Bui N.K.
        • Vollmer W.
        • de Lencastre H.
        • Tomasz A.
        Identification of genetic determinants and enzymes involved with the amidation of glutamic acid residues in the peptidoglycan of Staphylococcus aureus.
        PLoS Pathog. 2012; 8: e1002508
        • Münch D.
        • Roemer T.
        • Lee S.H.
        • Engeser M.
        • Sahl H.G.
        • Schneider T.
        Identification and in vitro analysis of the GatD/MurT enzyme-complex catalyzing lipid II amidation in Staphylococcus aureus.
        PLoS Pathog. 2012; 8: e1002509
        • Zapun A.
        • Philippe J.
        • Abrahams K.A.
        • Signor L.
        • Roper D.I.
        • Breukink E.
        • Vernet T.
        In vitro reconstitution of peptidoglycan assembly from the Gram-positive pathogen Streptococcus pneumoniae.
        ACS Chem. Biol. 2013; 8: 2688-2696
        • Sauerbier J.
        • Maurer P.
        • Rieger M.
        • Hakenbeck R.
        Streptococcus pneumoniae R6 interspecies transformation: genetic analysis of penicillin resistance determinants and genome-wide recombination events.
        Mol. Microbiol. 2012; 86: 692-706
        • Ghuysen J.M.
        • Frère J.M.
        • Leyh-Bouille M.
        • Nguyen-Distèche M.
        • Coyette J.
        Active-site-serine d-alanyl-d-alanine-cleaving-peptidase-catalysed acyl-transfer reactions. Procedures for studying the penicillin-binding proteins of bacterial plasma membranes.
        Biochem. J. 1986; 235: 159-165
        • Shapiro A.B.
        • Gu R.F.
        • Gao N.
        • Livchak S.
        • Thresher J.
        Continuous fluorescence anisotropy-based assay of BOCILLIN FL penicillin reaction with penicillin binding protein 3.
        Anal. Biochem. 2013; 439: 37-43
        • Graves-Woodward K.
        • Pratt R.F.
        Reaction of soluble penicillin-binding protein 2a of methicillin-resistant Staphylococcus aureus with β-lactams and acyclic substrates: kinetics in homogeneous solution.
        Biochem. J. 1998; 332: 755-761
        • Kocaoglu O.
        • Tsui H.C.
        • Winkler M.E.
        • Carlson E.E.
        Profiling of β-lactam selectivity for penicillin-binding proteins in Streptococcus pneumoniae D39.
        Antimicrob. Agents Chemother. 2015; 59: 3548-3555
        • Lo M.C.
        • Aulabaugh A.
        • Jin G.
        • Cowling R.
        • Bard J.
        • Malamas M.
        • Ellestad G.
        Evaluation of fluorescence-based thermal shift assays for hit identification in drug discovery.
        Anal. Biochem. 2004; 332: 153-159
        • Pantoliano M.W.
        • Petrella E.C.
        • Kwasnoski J.D.
        • Lobanov V.S.
        • Myslik J.
        • Graf E.
        • Carver T.
        • Asel E.
        • Springer B.A.
        • Lane P.
        • Salemme F.R.
        High-density miniaturized thermal shift assays as a general strategy for drug discovery.
        J. Biomol. Screen. 2001; 6: 429-440
        • Gordon E.
        • Mouz N.
        • Duée E.
        • Dideberg O.
        The crystal structure of the penicillin-binding protein 2x from Streptococcus pneumoniae and its acyl-enzyme form: implication in drug resistance.
        J. Mol. Biol. 2000; 299: 477-485
        • Bui N.K.
        • Eberhardt A.
        • Vollmer D.
        • Kern T.
        • Bougault C.
        • Tomasz A.
        • Simorre J.P.
        • Vollmer W.
        Isolation and analysis of cell wall components from Streptococcus pneumoniae.
        Anal. Biochem. 2012; 421: 657-666
        • Filipe S.R.
        • Tomasz A.
        Inhibition of the expression of penicillin resistance in Streptococcus pneumoniae by inactivation of cell wall muropeptide branching genes.
        Proc. Natl. Acad. Sci. U.S.A. 2000; 97: 4891-4896
        • Lloyd A.J.
        • Gilbey A.M.
        • Blewett A.M.
        • De Pascale G.
        • El Zoeiby A.
        • Levesque R.C.
        • Catherwood A.C.
        • Tomasz A.
        • Bugg T.D.
        • Roper D.I.
        • Dowson C.G.
        Characterization of tRNA-dependent peptide bond formation by MurM in the synthesis of Streptococcus pneumoniae peptidoglycan.
        J. Biol. Chem. 2008; 283: 6402-6417
        • Tsui H.C.
        • Boersma M.J.
        • Vella S.A.
        • Kocaoglu O.
        • Kuru E.
        • Peceny J.K.
        • Carlson E.E.
        • VanNieuwenhze M.S.
        • Brun Y.V.
        • Shaw S.L.
        • Winkler M.E.
        Pbp2x localizes separately from Pbp2b and other peptidoglycan synthesis proteins during later stages of cell division of Streptococcus pneumoniae D39.
        Mol. Microbiol. 2014; 94: 21-40
        • Tsui H.C.
        • Zheng J.J.
        • Magallon A.N.
        • Ryan J.D.
        • Yunck R.
        • Rued B.E.
        • Bernhardt T.G.
        • Winkler M.E.
        Suppression of a deletion mutation in the gene encoding essential PBP2b reveals a new lytic transglycosylase involved in peripheral peptidoglycan synthesis in Streptococcus pneumoniae D39.
        Mol. Microbiol. 2016; 100: 1039-1065
        • Berg K.H.
        • Stamsås G.A.
        • Straume D.
        • Håvarstein L.S.
        Effects of low PBP2b levels on cell morphology and peptidoglycan composition in Streptococcus pneumoniae R6.
        J. Bacteriol. 2013; 195: 4342-4354
        • Noirclerc-Savoye M.
        • Lantez V.
        • Signor L.
        • Philippe J.
        • Vernet T.
        • Zapun A.
        Reconstitution of membrane protein complexes involved in pneumococcal septal cell wall assembly.
        PLoS One. 2013; 8: e75522
        • Meeske A.J.
        • Riley E.P.
        • Robins W.P.
        • Uehara T.
        • Mekalanos J.J.
        • Kahne D.
        • Walker S.
        • Kruse A.C.
        • Bernhardt T.G.
        • Rudner D.Z.
        SEDS proteins are a widespread family of bacterial cell wall polymerases.
        Nature. 2016; 537: 634-638
        • Hakenbeck R.
        • Tornette S.
        • Adkinson N.F.
        Interaction of non-lytic β-lactams with penicillin-binding proteins in Streptococcus pneumoniae.
        J. Gen. Microbiol. 1987; 133: 755-760
        • Lieberthal A.S.
        • Carroll A.E.
        • Chonmaitree T.
        • Ganiats T.G.
        • Hoberman A.
        • Jackson M.A.
        • Joffe M.D.
        • Miller D.T.
        • Rosenfeld R.M.
        • Sevilla X.D.
        • Schwartz R.H.
        • Thomas P.A.
        • Tunkel D.E.
        The diagnosis and management of acute otitis media.
        Pediatrics. 2013; 131: e964-e999
        • Shulman S.T.
        • Bisno A.L.
        • Clegg H.W.
        • Gerber M.A.
        • Kaplan E.L.
        • Lee G.
        • Martin J.M.
        • Van Beneden C.
        • Infectious Diseases Society of America
        Clinical practice guideline for the diagnosis and management of group A streptococcal pharyngitis: 2012 update by the Infectious Diseases Society of America.
        Clin. Infect. Dis. 2012; 55: e86-e102
        • Breukink E.
        • van Heusden H.E.
        • Vollmerhaus P.J.
        • Swiezewska E.
        • Brunner L.
        • Walker S.
        • Heck A.J.
        • de Kruijff B.
        Lipid II is an intrinsic component of the pore induced by nisin in bacterial membranes.
        J. Biol. Chem. 2003; 278: 19898-19903
        • Helassa N.
        • Vollmer W.
        • Breukink E.
        • Vernet T.
        • Zapun A.
        The membrane anchor of penicillin-binding protein PBP2a from Streptococcus pneumoniae influences peptidoglycan chain length.
        FEBS J. 2012; 279: 2071-2081
        • Emsley P.
        • Cowtan K.
        Coot: model-building tools for molecular graphics.
        Acta Crystallogr. D Biol. Crystallogr. 2004; 60: 2126-2132
        • Winn M.D.
        • Ballard C.C.
        • Cowtan K.D.
        • Dodson E.J.
        • Emsley P.
        • Evans P.R.
        • Keegan R.M.
        • Krissinel E.B.
        • Leslie A.G.
        • McCoy A.
        • McNicholas S.J.
        • Murshudov G.N.
        • Pannu N.S.
        • Potterton E.A.
        • Powell H.R.
        • et al.
        Overview of the CCP4 suite and current developments.
        Acta Crystallogr. D Biol. Crystallogr. 2011; 67: 235-242
        • Murshudov G.N.
        • Skubák P.
        • Lebedev A.A.
        • Pannu N.S.
        • Steiner R.A.
        • Nicholls R.A.
        • Winn M.D.
        • Long F.
        • Vagin A.A.
        REFMAC5 for the refinement of macromolecular crystal structures.
        Acta Crystallogr. D Biol. Crystallogr. 2011; 67: 355-367
        • Abrahams K.A.
        The Enzymology of Streptococcus pneumoniae Peptidoglycan Polymerization.
        University of Warwick, Coventry, UK2011 (Ph. D. thesis)
        • Kuzmic P.
        Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase.
        Anal. Biochem. 1996; 237: 260-273