Advertisement

FOXO3 Transcription Factor Is Essential for Protecting Hematopoietic Stem and Progenitor Cells from Oxidative DNA Damage*

  • Carolina L. Bigarella
    Footnotes
    Affiliations
    Department of Cell, Developmental and Regenerative Biology, Icahn School of Medicine at Mount Sinai, New York, New York 10029
    Search for articles by this author
  • Jianfeng Li
    Affiliations
    Department of Oncologic Sciences, University of South Alabama Mitchell Cancer Institute, Mobile, Alabama 36604
    Search for articles by this author
  • Pauline Rimmelé
    Affiliations
    Department of Cell, Developmental and Regenerative Biology, Icahn School of Medicine at Mount Sinai, New York, New York 10029
    Search for articles by this author
  • Raymond Liang
    Footnotes
    Affiliations
    Department of Cell, Developmental and Regenerative Biology, Icahn School of Medicine at Mount Sinai, New York, New York 10029

    Developmental and Stem Cell Biology Multidisciplinary Training Area, New York, New York 10029
    Search for articles by this author
  • Robert W. Sobol
    Footnotes
    Affiliations
    Department of Oncologic Sciences, University of South Alabama Mitchell Cancer Institute, Mobile, Alabama 36604
    Search for articles by this author
  • Saghi Ghaffari
    Correspondence
    To whom correspondence should be addressed: Dept. of Cell, Developmental and Regenerative Biology, Icahn School of Medicine at Mount Sinai, New York, NY 10029. Tel.: 212-659-8271; Fax: 212-80-6740.
    Affiliations
    Department of Cell, Developmental and Regenerative Biology, Icahn School of Medicine at Mount Sinai, New York, New York 10029

    Developmental and Stem Cell Biology Multidisciplinary Training Area, New York, New York 10029

    Department of Medicine, Division of Hematology and, Oncology, New York, New York 10029

    Black Family Stem Cell Institute, New York, New York 10029

    Tisch Cancer Institute, Icahn School of Medicine at Mount Sinai, New York, New York 10029
    Search for articles by this author
  • Author Footnotes
    * This work was supported in part by National Institutes of Health Grants CA148629 and ES025138 (to R. W. S.) and CA205975 and HL116365, Myeloproliferative Neoplasm Foundation, Tisch Cancer Institute, and American Society of Hematology (to S. G.). R. W. S. is a scientific consultant for Trevigen, Inc. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
    1 Supported in part by a Roche Translational and Clinical Research Center-Young Investigator award.
    2 Supported by National Institutes of Health Grant T32 GM08553-13 and an American Heart Association fellowship.
    3 An Abraham A. Mitchell Distinguished Investigator.
      Accumulation of damaged DNA in hematopoietic stem cells (HSC) is associated with chromosomal abnormalities, genomic instability, and HSC aging and might promote hematological malignancies with age. Despite this, the regulatory pathways implicated in the HSC DNA damage response have not been fully elucidated. One of the sources of DNA damage is reactive oxygen species (ROS) generated by both exogenous and endogenous insults. Balancing ROS levels in HSC requires FOXO3, which is an essential transcription factor for HSC maintenance implicated in HSC aging. Elevated ROS levels result in defective Foxo3−/− HSC cycling, among many other deficiencies. Here, we show that loss of FOXO3 leads to the accumulation of DNA damage in primitive hematopoietic stem and progenitor cells (HSPC), associated specifically with reduced expression of genes implicated in the repair of oxidative DNA damage. We provide further evidence that Foxo3−/− HSPC are defective in DNA damage repair. Specifically, we show that the base excision repair pathway, the main pathway utilized for the repair of oxidative DNA damage, is compromised in Foxo3−/− primitive hematopoietic cells. Treating mice in vivo with N-acetylcysteine reduces ROS levels, rescues HSC cycling defects, and partially mitigates HSPC DNA damage. These results indicate that DNA damage accrued as a result of elevated ROS in Foxo3−/− mutant HSPC is at least partially reversible. Collectively, our findings suggest that FOXO3 serves as a protector of HSC genomic stability and health.

      Introduction

      The accumulation of damaged DNA compromises the genomic stability of hematopoietic stem cells (HSC)
      The abbreviations used are: HSC
      hematopoietic stem cell
      ROS
      reactive oxygen species
      HSPC
      hematopoietic stem and progenitor cell
      NAC
      N-acetylcysteine
      BER
      base excision repair
      NER
      nucleotide excision repair
      BM
      bone marrow
      8-OHdG
      8-hydroxyguanosine
      TBI
      total body irradiation
      Gy
      gray
      MEF
      mouse embryonic fibroblast
      pol
      polymerase
      QRT
      quantitative RT
      7-AAD
      7-aminoactinomycin D
      PE
      phycoerythrin
      IR
      ionizing radiation
      HR
      homologous recombination.
      (
      • Lombard D.B.
      • Chua K.F.
      • Mostoslavsky R.
      • Franco S.
      • Gostissa M.
      • Alt F.W.
      DNA repair, genome stability, and aging.
      ) and may promote hematological malignancies, specifically with age (
      • Rossi D.J.
      • Jamieson C.H.
      • Weissman I.L.
      Stems cells and the pathways to aging and cancer.
      ,
      • Bigarella C.L.
      • Liang R.
      • Ghaffari S.
      Stem cells and the impact of ROS signaling.
      ). Reactive oxygen species (ROS) are one of the major insults that induce DNA damage (
      • Commoner B.
      • Townsend J.
      • Pake G.E.
      Free radicals in biological materials.
      ), including in normal hematopoietic and leukemic stem cells. ROS are generated both endogenously by cell metabolism or expression of oncoproteins and exogenously by ionizing radiation and genotoxic drugs (
      • Lombard D.B.
      • Chua K.F.
      • Mostoslavsky R.
      • Franco S.
      • Gostissa M.
      • Alt F.W.
      DNA repair, genome stability, and aging.
      ,
      • Santos M.A.
      • Faryabi R.B.
      • Ergen A.V.
      • Day A.M.
      • Malhowski A.
      • Canela A.
      • Onozawa M.
      • Lee J.E.
      • Callen E.
      • Gutierrez-Martinez P.
      • Chen H.T.
      • Wong N.
      • Finkel N.
      • Deshpande A.
      • Sharrow S.
      • et al.
      DNA-damage-induced differentiation of leukaemic cells as an anti-cancer barrier.
      ,
      • Walter D.
      • Lier A.
      • Geiselhart A.
      • Thalheimer F.B.
      • Huntscha S.
      • Sobotta M.C.
      • Moehrle B.
      • Brocks D.
      • Bayindir I.
      • Kastutnig P.
      • Muedder K.
      • Klein C.E.
      • Jauch A.
      • Schroeder T.
      • Geiger H.
      • et al.
      Exit from dormancy provokes DNA-damage-induced attrition in haematopoietic stem cells.
      ). ROS induce single and double strand DNA breaks as well as various species of oxidized nucleotides and are implicated in the pathophysiology of hematological malignancies (
      • Marty C.
      • Lacout C.
      • Droin N.
      • Le Couédic J.P.
      • Ribrag V.
      • Solary E.
      • Vainchenker W.
      • Villeval J.L.
      • Plo I.
      A role for reactive oxygen species in JAK2 V617F myeloproliferative neoplasm progression.
      ). Thus, modulations of ROS may be used therapeutically (
      • Marty C.
      • Lacout C.
      • Droin N.
      • Le Couédic J.P.
      • Ribrag V.
      • Solary E.
      • Vainchenker W.
      • Villeval J.L.
      • Plo I.
      A role for reactive oxygen species in JAK2 V617F myeloproliferative neoplasm progression.
      ,
      • Lagadinou E.D.
      • Sach A.
      • Callahan K.
      • Rossi R.M.
      • Neering S.J.
      • Minhajuddin M.
      • Ashton J.M.
      • Pei S.
      • Grose V.
      • O'Dwyer K.M.
      • Liesveld J.L.
      • Brookes P.S.
      • Becker M.W.
      • Jordan C.T.
      BCL-2 inhibition targets oxidative phosphorylation and selectively eradicates quiescent human leukemia stem cells.
      ). Cells, with distinct kinetics, constantly repair oxidative damage using mainly the base excision repair (BER) pathway (
      • Svilar D.
      • Goellner E.M.
      • Almeida K.H.
      • Sobol R.W.
      Base excision repair and lesion-dependent subpathways for repair of oxidative DNA damage.
      ). The relatively low levels of endogenous ROS in HSC restrict damage to DNA (
      • Liang R.
      • Ghaffari S.
      Stem cells, redox signaling, and stem cell aging.
      ); however, the impact of increasing ROS levels on HSC DNA remains relatively unexplored (
      • Yahata T.
      • Takanashi T.
      • Muguruma Y.
      • Ibrahim A.A.
      • Matsuzawa H.
      • Uno T.
      • Sheng Y.
      • Onizuka M.
      • Ito M.
      • Kato S.
      • Ando K.
      Accumulation of oxidative DNA damage restricts the self-renewal capacity of human hematopoietic stem cells.
      ). Importantly, the mechanism of oxidative DNA damage repair in primitive hematopoietic cells remains poorly understood.
      The transcription factor FOXO3 of the Forkhead family with four (FOXO1, FOXO3, FOXO4, and FOXO6) related members maintains HSC quiescence by ensuring low levels of ROS (
      • Miyamoto K.
      • Araki K.Y.
      • Naka K.
      • Arai F.
      • Takubo K.
      • Yamazaki S.
      • Matsuoka S.
      • Miyamoto T.
      • Ito K.
      • Ohmura M.
      • Chen C.
      • Hosokawa K.
      • Nakauchi H.
      • Nakayama K.
      • Nakayama K.I.
      • et al.
      Foxo3a is essential for maintenance of the hematopoietic stem cell pool.
      ,
      • Yalcin S.
      • Zhang X.
      • Luciano J.P.
      • Mungamuri S.K.
      • Marinkovic D.
      • Vercherat C.
      • Sarkar A.
      • Grisotto M.
      • Taneja R.
      • Ghaffari S.
      Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
      ). FOXOs belong to an evolutionarily conserved family of transcription factors that exert critical functions in the regulation of aging and longevity, including humans (
      • Greer E.L.
      • Brunet A.
      FOXO transcription factors in ageing and cancer.
      ,
      • Eijkelenboom A.
      • Mokry M.
      • Smits L.M.
      • Nieuwenhuis E.E.
      • Burgering B.M.
      FOXO3 selectively amplifies enhancer activity to establish target gene regulation.
      ). FOXOs are phosphorylated and inhibited mainly by AKT kinase downstream of the PI3K-signaling pathway. In addition to phosphorylation by AKT and other kinases, FOXOs are modified by a variety of post-translational modifications that together determine FOXOs' functional output (
      • Greer E.L.
      • Brunet A.
      FOXO transcription factors in ageing and cancer.
      ). Notably, in hematopoietic stem and progenitor cells and in embryonic stem cells, AKT is not the dominant regulator of FOXO function (
      • Zhang X.
      • Yalcin S.
      • Lee D.F.
      • Yeh T.Y.
      • Lee S.M.
      • Su J.
      • Mungamuri S.K.
      • Rimmele P.
      • Kennedy M.
      • Sellers R.
      • Landthaler M.
      • Tuschl T.
      • Chi N.W.
      • Lemischka I.
      • Keller G.
      • Ghaffari S.
      FOXO1 is an essential regulator of pluripotency in human embryonic stem cells.
      • Lee J.Y.
      • Nakada D.
      • Yilmaz O.H.
      • Tothova Z.
      • Joseph N.M.
      • Lim M.S.
      • Gilliland D.G.
      • Morrison S.J.
      mTOR activation induces tumor suppressors that inhibit leukemogenesis and deplete hematopoietic stem cells after Pten deletion.
      ,
      • Ahn J.S.
      • Li J.
      • Chen E.
      • Kent D.G.
      • Park H.J.
      • Green A.R.
      JAK2V617F mediates resistance to DNA damage-induced apoptosis by modulating FOXO3A localization and Bcl-xL deamidation.
      ,
      • Liang R.
      • Rimmelé P.
      • Bigarella C.L.
      • Yalcin S.
      • Ghaffari S.
      Evidence for AKT-independent regulation of FOXO1 and FOXO3 in haematopoietic stem and progenitor cells.
      • Santo E.E.
      • Paik J.
      FOXO3a and haematopoietic stem cells: goodbye PI3K, hello SIRT1?.
      ). FOXOs are involved in an array of fundamental biological processes, including the regulation of metabolism and oxidative stress, cell cycle, apoptosis, and DNA repair (
      • Greer E.L.
      • Brunet A.
      FOXO transcription factors in ageing and cancer.
      ,
      • Eijkelenboom A.
      • Mokry M.
      • Smits L.M.
      • Nieuwenhuis E.E.
      • Burgering B.M.
      FOXO3 selectively amplifies enhancer activity to establish target gene regulation.
      ).
      Loss of FOXO3 results in oxidative stress-mediated myeloproliferation that does not progress, at least not rapidly enough to have been detected, toward leukemia (
      • Miyamoto K.
      • Araki K.Y.
      • Naka K.
      • Arai F.
      • Takubo K.
      • Yamazaki S.
      • Matsuoka S.
      • Miyamoto T.
      • Ito K.
      • Ohmura M.
      • Chen C.
      • Hosokawa K.
      • Nakauchi H.
      • Nakayama K.
      • Nakayama K.I.
      • et al.
      Foxo3a is essential for maintenance of the hematopoietic stem cell pool.
      ,
      • Yalcin S.
      • Zhang X.
      • Luciano J.P.
      • Mungamuri S.K.
      • Marinkovic D.
      • Vercherat C.
      • Sarkar A.
      • Grisotto M.
      • Taneja R.
      • Ghaffari S.
      Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
      ,
      • Yalcin S.
      • Marinkovic D.
      • Mungamuri S.K.
      • Zhang X.
      • Tong W.
      • Sellers R.
      • Ghaffari S.
      ROS-mediated amplification of AKT/mTOR signalling pathway leads to myeloproliferative syndrome in Foxo3(−/−) mice.
      ). FOXO3 is intimately involved in hematopoietic malignancies, as FOXO3 is found in chromosomal translocations of human acute myeloid leukemia (
      • Hillion J.
      • Le Coniat M.
      • Jonveaux P.
      • Berger R.
      • Bernard O.A.
      AF6q21, a novel partner of the MLL gene in t(6;11)(q21;q23), defines a forkhead transcriptional factor subfamily.
      ) and is inhibited in malignant hematopoietic cells (
      • Ahn J.S.
      • Li J.
      • Chen E.
      • Kent D.G.
      • Park H.J.
      • Green A.R.
      JAK2V617F mediates resistance to DNA damage-induced apoptosis by modulating FOXO3A localization and Bcl-xL deamidation.
      ,
      • Ghaffari S.
      • Jagani Z.
      • Kitidis C.
      • Lodish H.F.
      • Khosravi-Far R.
      Cytokines and BCR-ABL mediate suppression of TRAIL-induced apoptosis through inhibition of forkhead FOXO3a transcription factor.
      • Scheijen B.
      • Ngo H.T.
      • Kang H.
      • Griffin J.D.
      FLT3 receptors with internal tandem duplications promote cell viability and proliferation by signaling through Foxo proteins.
      ,
      • Gu T.L.
      • Tothova Z.
      • Scheijen B.
      • Griffin J.D.
      • Gilliland D.G.
      • Sternberg D.W.
      NPM-ALK fusion kinase of anaplastic large-cell lymphoma regulates survival and proliferative signaling through modulation of FOXO3a.
      ,
      • Chapuis N.
      • Park S.
      • Leotoing L.
      • Tamburini J.
      • Verdier F.
      • Bardet V.
      • Green A.S.
      • Willems L.
      • Agou F.
      • Ifrah N.
      • Dreyfus F.
      • Bismuth G.
      • Baud V.
      • Lacombe C.
      • Mayeux P.
      • Bouscary D.
      IκB kinase overcomes PI3K/Akt and ERK/MAPK to control FOXO3a activity in acute myeloid leukemia.
      ,
      • Santamaría C.M.
      • Chillón M.C.
      • García-Sanz R.
      • Pérez C.
      • Caballero M.D.
      • Ramos F.
      • de Coca A.G.
      • Alonso J.M.
      • Giraldo P.
      • Bernal T.
      • Queizán J.A.
      • Rodriguez J.N.
      • Fernández-Abellán P.
      • Bárez A.
      • Peñarrubia M.J.
      • et al.
      High FOXO3a expression is associated with a poorer prognosis in AML with normal cytogenetics.
      • Vandenberg C.J.
      • Motoyama N.
      • Cory S.
      FoxO3 suppresses Myc-driven lymphomagenesis.
      ). Despite these observations, FOXO3 is also required for the maintenance of both mouse and human leukemic stem cells (
      • Sykes S.M.
      • Lane S.W.
      • Bullinger L.
      • Kalaitzidis D.
      • Yusuf R.
      • Saez B.
      • Ferraro F.
      • Mercier F.
      • Singh H.
      • Brumme K.M.
      • Acharya S.S.
      • Schöll C.
      • Tothova Z.
      • Attar E.C.
      • Frohling S.
      • et al.
      AKT/FOXO signaling enforces reversible differentiation blockade in myeloid leukemias.
      ,
      • Naka K.
      • Hoshii T.
      • Muraguchi T.
      • Tadokoro Y.
      • Ooshio T.
      • Kondo Y.
      • Nakao S.
      • Motoyama N.
      • Hirao A.
      TGF-β-FOXO signalling maintains leukaemia-initiating cells in chronic myeloid leukaemia.
      • Pellicano F.
      • Scott M.T.
      • Helgason G.V.
      • Hopcroft L.E.
      • Allan E.K.
      • Aspinall-O'Dea M.
      • Copland M.
      • Pierce A.
      • Huntly B.J.
      • Whetton A.D.
      • Holyoake T.L.
      The antiproliferative activity of kinase inhibitors in chronic myeloid leukemia cells is mediated by FOXO transcription factors.
      ). In addition, FOXO3 is implicated in HSC aging (
      • Miyamoto K.
      • Miyamoto T.
      • Kato R.
      • Yoshimura A.
      • Motoyama N.
      • Suda T.
      FoxO3a regulates hematopoietic homeostasis through a negative feedback pathway in conditions of stress or aging.
      ,
      • Rimmelé P.
      • Bigarella C.L.
      • Liang R.
      • Izac B.
      • Dieguez-Gonzalez R.
      • Barbet G.
      • Donovan M.
      • Brugnara C.
      • Blander J.M.
      • Sinclair D.A.
      • Ghaffari S.
      Aging-like phenotype and defective lineage specification in SIRT1-deleted hematopoietic stem and progenitor cells.
      • Mehta A.
      • Zhao J.L.
      • Sinha N.
      • Marinov G.K.
      • Mann M.
      • Kowalczyk M.S.
      • Galimidi R.P.
      • Du X.
      • Erikci E.
      • Regev A.
      • Chowdhury K.
      • Baltimore D.
      The microRNA-132 and microRNA-212 cluster regulates hematopoietic stem cell maintenance and survival with age by buffering FOXO3 expression.
      ) and in stem cell pluripotency (
      • Zhang X.
      • Yalcin S.
      • Lee D.F.
      • Yeh T.Y.
      • Lee S.M.
      • Su J.
      • Mungamuri S.K.
      • Rimmele P.
      • Kennedy M.
      • Sellers R.
      • Landthaler M.
      • Tuschl T.
      • Chi N.W.
      • Lemischka I.
      • Keller G.
      • Ghaffari S.
      FOXO1 is an essential regulator of pluripotency in human embryonic stem cells.
      ). Given the importance of DNA damage response for aging and malignancies of stem cells, we sought to explore the potential FOXO3 function in the regulation of DNA damage response in HSC.
      Here, we show that FOXO3, which is essential for the regulation of oxidative stress in HSC (
      • Miyamoto K.
      • Araki K.Y.
      • Naka K.
      • Arai F.
      • Takubo K.
      • Yamazaki S.
      • Matsuoka S.
      • Miyamoto T.
      • Ito K.
      • Ohmura M.
      • Chen C.
      • Hosokawa K.
      • Nakauchi H.
      • Nakayama K.
      • Nakayama K.I.
      • et al.
      Foxo3a is essential for maintenance of the hematopoietic stem cell pool.
      ,
      • Yalcin S.
      • Zhang X.
      • Luciano J.P.
      • Mungamuri S.K.
      • Marinkovic D.
      • Vercherat C.
      • Sarkar A.
      • Grisotto M.
      • Taneja R.
      • Ghaffari S.
      Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
      ,
      • Yalcin S.
      • Marinkovic D.
      • Mungamuri S.K.
      • Zhang X.
      • Tong W.
      • Sellers R.
      • Ghaffari S.
      ROS-mediated amplification of AKT/mTOR signalling pathway leads to myeloproliferative syndrome in Foxo3(−/−) mice.
      ,
      • Zhang X.
      • Rielland M.
      • Yalcin S.
      • Ghaffari S.
      Regulation and function of FoxO transcription factors in normal and cancer stem cells: what have we learned?.
      ), is a key factor in the primitive hematopoietic cell DNA damage response, specifically in base excision repair, and it protects HSPC from oxidative DNA damage under homeostasis. These findings raise the possibility that DNA damage accrual as a result of loss of FOXO3 function, as may occur with age, promotes HSC aging (
      • Miyamoto K.
      • Miyamoto T.
      • Kato R.
      • Yoshimura A.
      • Motoyama N.
      • Suda T.
      FoxO3a regulates hematopoietic homeostasis through a negative feedback pathway in conditions of stress or aging.
      ,
      • Rimmelé P.
      • Bigarella C.L.
      • Liang R.
      • Izac B.
      • Dieguez-Gonzalez R.
      • Barbet G.
      • Donovan M.
      • Brugnara C.
      • Blander J.M.
      • Sinclair D.A.
      • Ghaffari S.
      Aging-like phenotype and defective lineage specification in SIRT1-deleted hematopoietic stem and progenitor cells.
      • Mehta A.
      • Zhao J.L.
      • Sinha N.
      • Marinov G.K.
      • Mann M.
      • Kowalczyk M.S.
      • Galimidi R.P.
      • Du X.
      • Erikci E.
      • Regev A.
      • Chowdhury K.
      • Baltimore D.
      The microRNA-132 and microRNA-212 cluster regulates hematopoietic stem cell maintenance and survival with age by buffering FOXO3 expression.
      ), predisposes HSPCs to premature aging, and/or contributes to hematopoietic stem cell malignant transformation (
      • Ahn J.S.
      • Li J.
      • Chen E.
      • Kent D.G.
      • Park H.J.
      • Green A.R.
      JAK2V617F mediates resistance to DNA damage-induced apoptosis by modulating FOXO3A localization and Bcl-xL deamidation.
      ,
      • Ghaffari S.
      • Jagani Z.
      • Kitidis C.
      • Lodish H.F.
      • Khosravi-Far R.
      Cytokines and BCR-ABL mediate suppression of TRAIL-induced apoptosis through inhibition of forkhead FOXO3a transcription factor.
      ,
      • Sykes S.M.
      • Lane S.W.
      • Bullinger L.
      • Kalaitzidis D.
      • Yusuf R.
      • Saez B.
      • Ferraro F.
      • Mercier F.
      • Singh H.
      • Brumme K.M.
      • Acharya S.S.
      • Schöll C.
      • Tothova Z.
      • Attar E.C.
      • Frohling S.
      • et al.
      AKT/FOXO signaling enforces reversible differentiation blockade in myeloid leukemias.
      ,
      • Naka K.
      • Hoshii T.
      • Muraguchi T.
      • Tadokoro Y.
      • Ooshio T.
      • Kondo Y.
      • Nakao S.
      • Motoyama N.
      • Hirao A.
      TGF-β-FOXO signalling maintains leukaemia-initiating cells in chronic myeloid leukaemia.
      ).

      Results

       Foxo3−/− Hematopoietic Stem and Progenitor Cells Accumulate Oxidative DNA Damage at the Steady State

      Foxo3−/− LSK cells (LinSca1+c-Kit+) enriched for HSC accumulate ROS under homeostasis (Fig. 1A) (
      • Miyamoto K.
      • Araki K.Y.
      • Naka K.
      • Arai F.
      • Takubo K.
      • Yamazaki S.
      • Matsuoka S.
      • Miyamoto T.
      • Ito K.
      • Ohmura M.
      • Chen C.
      • Hosokawa K.
      • Nakauchi H.
      • Nakayama K.
      • Nakayama K.I.
      • et al.
      Foxo3a is essential for maintenance of the hematopoietic stem cell pool.
      ,
      • Yalcin S.
      • Zhang X.
      • Luciano J.P.
      • Mungamuri S.K.
      • Marinkovic D.
      • Vercherat C.
      • Sarkar A.
      • Grisotto M.
      • Taneja R.
      • Ghaffari S.
      Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
      ) as a result of defective anti-oxidant enzyme expression and mitochondrial function (
      • Miyamoto K.
      • Araki K.Y.
      • Naka K.
      • Arai F.
      • Takubo K.
      • Yamazaki S.
      • Matsuoka S.
      • Miyamoto T.
      • Ito K.
      • Ohmura M.
      • Chen C.
      • Hosokawa K.
      • Nakauchi H.
      • Nakayama K.
      • Nakayama K.I.
      • et al.
      Foxo3a is essential for maintenance of the hematopoietic stem cell pool.
      ,
      • Yalcin S.
      • Zhang X.
      • Luciano J.P.
      • Mungamuri S.K.
      • Marinkovic D.
      • Vercherat C.
      • Sarkar A.
      • Grisotto M.
      • Taneja R.
      • Ghaffari S.
      Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
      ,
      • Rimmelé P.
      • Liang R.
      • Bigarella C.L.
      • Kocabas F.
      • Xie J.
      • Serasinghe M.N.
      • Chipuk J.
      • Sadek H.
      • Zhang C.C.
      • Ghaffari S.
      Mitochondrial metabolism in hematopoietic stem cells requires functional FOXO3.
      ). Elevated ROS are associated with loss of Foxo3−/− HSC quiescence (
      • Miyamoto K.
      • Araki K.Y.
      • Naka K.
      • Arai F.
      • Takubo K.
      • Yamazaki S.
      • Matsuoka S.
      • Miyamoto T.
      • Ito K.
      • Ohmura M.
      • Chen C.
      • Hosokawa K.
      • Nakauchi H.
      • Nakayama K.
      • Nakayama K.I.
      • et al.
      Foxo3a is essential for maintenance of the hematopoietic stem cell pool.
      ,
      • Yalcin S.
      • Zhang X.
      • Luciano J.P.
      • Mungamuri S.K.
      • Marinkovic D.
      • Vercherat C.
      • Sarkar A.
      • Grisotto M.
      • Taneja R.
      • Ghaffari S.
      Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
      ) and a delay at the G2/M cell cycle checkpoint (
      • Yalcin S.
      • Zhang X.
      • Luciano J.P.
      • Mungamuri S.K.
      • Marinkovic D.
      • Vercherat C.
      • Sarkar A.
      • Grisotto M.
      • Taneja R.
      • Ghaffari S.
      Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
      ). We evaluated whether elevated ROS result in defective DNA integrity that contributes to cell cycle abnormalities of Foxo3−/− HSC.
      Figure thumbnail gr1
      FIGURE 1Foxo3−/− hematopoietic stem and progenitor cells accumulate DNA damage at the steady state. A, ROS levels in WT versus Foxo3−/− LSK cells (fold change of FITC fluorescence geometric mean normalized to that of WT). B, representative images of WT and Foxo3−/− FACS-sorted LSK cells stained with an anti-γH2AX antibody (left panels) and quantification of the percentage of positive cells (foci number >6) (n ≥40 cells analyzed per condition, two independent experiments). **, p < 0.001. C, representative FACS plots for the gating strategy to analyze hematopoietic stem (LT and ST-HSC enriched in LinSca1+cKit+ (LSK) population) and progenitor (LincKit+) cells. SSC, side scatter; FSC, forward scatter. D, flow cytometry analysis of γH2AX positivity in gated nucleated BM cells, lineage negative (Lin−), LSK, and c-Kit+ myeloid progenitors, as well as in LT-HSC (LinSca1+c-Kit+Flk2CD34) and ST-HSC (Lin-Sca1+c-Kit+Flk2CD34+) (n ≥4 mice per group). E, comet assay of freshly isolated WT and Foxo3−/− LSK cells. % DNA in tail and Olive tail moment parameters were used to quantify the DNA breaks levels. Data expressed as mean ± S.D. (A, B, D, and E) Student's t test. *, p < 0.05; **, p < 0.001; ***, p < 0.0002; ****, p < 0.0001; ns, not significant.
      Under homeostatic conditions, a significantly higher fraction of freshly isolated Foxo3−/− LSK cells exhibited enhanced phosphorylation of histone H2AX variant (γH2AX) (Fig. 1B), a sensor of DNA double strand breaks (
      • Kuo L.J.
      • Yang L.X.
      Gamma-H2AX- a novel biomarker for DNA double-strand breaks.
      ). A highly elevated level of damaged DNA was detected in Foxo3−/− HSPC by both γH2AX immunofluorescence staining, in which cells with more than six nuclear foci were considered as positive, and the more sensitive flow cytometry assay, which enabled the quantification of the amount of damage (Fig. 1B, n > 40 cells analyzed per condition and Fig. 1C; n = 5, * p < 0.05). Damaged DNA accumulated in Foxo3−/− HSPC subpopulations, including long term repopulating HSC (LT-HSC; LSK Flk2CD34) and c-Kit+ (LinSca1c-Kit+) multipotent progenitor cells but not in Foxo3−/− total bone marrow (BM) control cells (Fig. 1,C for gating strategy, and D; n = 4 per genotype); although γH2AX was relatively increased in lineage negative cells depleted of mature blood cells and enriched for hematopoietic stem and progenitor cells, it did not reach significance in the samples evaluated. Using alkaline single-cell gel electrophoresis (comet assay), we further visualized the damage to single strand DNA and quantified an approximate 3-fold increased damage level in FACS-sorted Foxo3−/− versus wild type (WT) LSK cells by the use of (
      • Beerman I.
      • Seita J.
      • Inlay M.A.
      • Weissman I.L.
      • Rossi D.J.
      Quiescent hematopoietic stem cells accumulate DNA damage during aging that is repaired upon entry into cell cycle.
      ) % of DNA in Tail and Olive tail moment parameters (Fig. 1E; n = 6). These results confirmed the increased amount of damaged DNA in Foxo3−/− HSPC.
      To evaluate whether ROS were involved in the accumulation of DNA damage in Foxo3−/− HSPC, we used the FLARE hOGG1 comet assay that specifically detects oxidative DNA damage. This approach showed that oxidative DNA damage is significantly increased in freshly isolated Foxo3−/− versus WT HSPC (Fig. 2A and B, representative comet images and quantification). Using a specific probe that detects the main DNA oxidation lesion, 8-hydroxyguanosine (8-OHdG), by flow cytometry, we noted 8-OHdG levels were increased in Foxo3−/− LSK cells as compared with WT cells (Fig. 2C), although the difference did not reach significance in the replicates analyzed (n = 3). Altogether, these results indicate that Foxo3−/− HSPC DNA accumulates high levels of oxidative insults.
      Figure thumbnail gr2
      FIGURE 2DNA damage accumulation in Foxo3−/− HSPC is from oxidative origin. A, representative images of WT cells submitted to comet assay without hOGG1 (−hOGG1) or treated with hOGG1 (FLARE comet assay). B, FLARE-hOGG1 comet assay in freshly isolated LSK cells. C, 8-OHdG levels were analyzed by FACS in WT and Foxo3−/− LSK cells (n = 3; geometric mean of fluorescence values ( × 103) are shown). Data are expressed as mean ± S.D. Student's t test. *, p < 0.05; **, p < 0.001.

       Scavenging ROS by NAC Decreases Foxo3−/− HSPC DNA Damage and Corrects the G2/M Delay

      To investigate whether ROS have any functional role in the accumulation of DNA damage, mice were treated in vivo with NAC (100 mg/kg/day), a source of glutathione for 14 days (Fig. 3A, schematic). As anticipated, NAC treatment normalized ROS levels in Foxo3−/− LSK cells without any significant impact on WT cells (Fig. 3B) (
      • Yalcin S.
      • Zhang X.
      • Luciano J.P.
      • Mungamuri S.K.
      • Marinkovic D.
      • Vercherat C.
      • Sarkar A.
      • Grisotto M.
      • Taneja R.
      • Ghaffari S.
      Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
      ). Notably, NAC treatment led to a 2-fold decrease of γH2AX levels in Foxo3−/−-treated as compared with non-treated LSK cells (n = 3 per group; p < 0.05) (Fig. 3C). In addition, the levels of DNA breaks in Foxo3−/− LSK cells, as quantified by the % Tail DNA and the Olive tail moment, were significantly reduced (2-fold) in response to NAC (Fig. 3D, quantification in the right panel). Despite normalized ROS levels (Fig. 3B), the % Tail DNA (p < 0.0007) and the Olive tail moment (p < 0.00001) remained significantly higher in NAC-treated Foxo3−/− LSK cells as compared with WT controls (Fig. 3D), raising the possibility that not all damage to Foxo3−/− LSK DNA resulted from elevated ROS.
      Figure thumbnail gr3
      FIGURE 3NAC treatment reduces DNA damage accumulation in Foxo3−/− HSPC. A, schematic representation of the NAC treatment to which WT and Foxo3−/− mice were submitted for 14 days. IP, intraperitoneal. B, analysis of dichlorofluorescein staining of WT and Foxo3−/− LSK cells isolated from mice that were treated with NAC for 14-days (geometric mean values normalized to that of WT). C, γH2AX levels were analyzed by FACS after NAC treatment (n = 6 per group, two independent experiments). D, alkaline comet assay analysis of FACS-sorted LSK cells from control and NAC-treated animals (n ≥100 cells analyzed per group, two independent experiments). Representative images (left panels) and DNA break levels quantification by %DNA in Tail and Olive tail moment (right panels). Data are expressed as mean ± S.D. Student's t test. *, p < 0.05; **, p < 0.001; ***, p < 0.0002; ****, p < 0.0001.
      In addition to reducing DNA damage, NAC treatment normalized the defective Foxo3−/− cell cycle parameters (Fig. 4). Increased numbers of LSK cells isolated from NAC-treated Foxo3−/− mice were in the G0 and G1 phases of the cell cycle and released from the G2/M delay. The decreased frequencies of Foxo3−/− LSK cells that incorporated BrdU in vivo (Fig. 4, A and B) and of Foxo3−/− LT-HSC (LSK-CD34) Ki67-positive were comparable (Fig. 4, C and D). These combined results suggest that the block of cell cycle progression, G2/M delay, in Foxo3−/− HSPC is due to ROS-mediated DNA damage.
      Figure thumbnail gr4
      FIGURE 4NAC treatment corrects the defective cell cycle of Foxo3−/− HSPC. Cell cycle analysis on freshly isolated BM cells from WT and Foxo3−/− mice treated for 14 days with NAC. A, representative FACS plots of BrdU staining, and B quantification of the percentage of LSK cells from control (vehicle) and NAC-treated mice in G0-G1, S, or G2-M cell cycle phases. C, representative FACS plots of Ki67-DAPI staining on gated LSK-CD34 cells; D, quantification of the percentage of cells in G0, G1, or S-G2-M cell cycle phases. n = 6 per group, two independent experiments. Data expressed as mean ± S.D. Student's t test .*, p < 0.05.

       Defective DNA Repair Machinery in Foxo3−/− HSPC Contributes to DNA Damage Accumulation

      A number of key genes of BER, including DNA polymerase β (polB), X-ray repair cross-complementing protein 1 (Xrcc1), and DNA Ligase 1 (Lig1), were significantly down-regulated in Foxo3−/− LSK cells (Fig. 5A). Other genes implicated in nucleotide excision repair (NER), were also significantly reduced in Foxo3−/− LSK cells (Fig. 5A). Altogether, these results raise the possibility that the key pathways implicated in oxidative DNA damage repair may also be compromised in Foxo3−/− HSPC.
      Figure thumbnail gr5
      FIGURE 5Defective DNA repair machinery in Foxo3−/− HSPC contributes to DNA damage accumulation. A, QRT-PCR analysis of expression of oxidative DNA repair (BER and NER) genes in freshly isolated HSPC. Actnb was used as internal control, and expression was normalized to the WT samples. B, schematic of FACS-sorted WT and Foxo3−/− LSK cells treated ex vivo with 100 μm H2O2. Cells were analyzed by alkaline comet assay (C) and comet FLARE-OGG1 (D) at the indicated time points shown by green arrows (1, 2, or 4 h after treatment). E, flow cytometry analysis of apoptosis using annexin V-binding in freshly isolated LSK cells treated for 1 h with 100 μm H2O2. F, schematic representation of the OGG1 activity assay with BER molecular beacon; G, quantification of the assay performed using lineage negative cells extracts from WT and Foxo3−/− bone marrow (plot of mean ± S.D. of the normalized fluorescence signals) (n = 6; two independent experiments). Data expressed as mean ± S.D. Student's t test. *, p < 0.05; **, p < 0.001; ***, p < 0.0002; ****, p < 0.0001; ns, not significant.
      To address whether DNA in LSK cells that lack FOXO3 were preferentially susceptible to ROS elevation, we exposed these cells to 100 μm hydrogen peroxide for 1 h (Fig. 5B, schematic). This treatment led to significantly higher DNA breaks in Foxo3-deficient LSK cells as compared with their WT counterparts. The results were relatively similar when analyzed by either the standard or the FLARE hOGG1 comet assays (Figs. 5, C and D); the FLARE assay detected a more exacerbated DNA damage (Fig. 5D), suggesting increased sensitivity to removal of base damage such as those removed by the OGG1 DNA glycosylase. These findings indicate that the repair of oxidative DNA insults might be compromised in Foxo3−/− LSK cells. Despite the increase in oxidative stress-mediated accumulation of damaged DNA (Fig. 2) and consistent with mitochondrial defects observed in Foxo3-null HSPC (
      • Rimmelé P.
      • Liang R.
      • Bigarella C.L.
      • Kocabas F.
      • Xie J.
      • Serasinghe M.N.
      • Chipuk J.
      • Sadek H.
      • Zhang C.C.
      • Ghaffari S.
      Mitochondrial metabolism in hematopoietic stem cells requires functional FOXO3.
      ), apoptosis was increased only mildly but significantly in in vitro hydrogen peroxide-treated Foxo3−/− LSK cells, suggesting that Foxo3−/− LSK cells might exhibit some resistance to oxidative stress-mediated apoptosis (Fig. 5E).
      To address a possible DNA repair defect, we used a recently developed (
      • Svilar D.
      • Vens C.
      • Sobol R.W.
      Quantitative, real-time analysis of base excision repair activity in cell lysates utilizing lesion-specific molecular beacons.
      ) BER molecular beacon assay to quantitatively evaluate APE1 endonuclease activity and OGG1-mediated glycosylase activity for removal of the 8-oxo-dG lesion in an 8-oxo-dG/A base pair (Fig. 5F, schematic). Using this fluorescent real time quantitative assay, we found no difference in the APE1 endonuclease activity of WT and Foxo3−/− primitive hematopoietic cells (data not shown). However, compared with WT controls, the glycosylase activity of OGG1 in Foxo3−/− primitive hematopoietic cells was significantly reduced (Fig. 5G, n = 6, p = 0.003).
      Despite using three different commercial (goat, rabbit, and mouse) anti-mouse OGG1 antibodies probing wild type and OGG1-deficient mouse embryonic fibroblasts (MEFs), we were unable to confirm their specific binding to OGG1 protein (data not shown). Using the same approach, we confirmed that anti-DNA Polβ and anti-XRCC1 antibodies specifically bind to their targets in wild type MEF but not in pol β−/− and XRCC1−/− MEFs, respectively (Fig. 6A). We further showed that whereas the expression of pol β is increased, the expression of XRCC1 is significantly reduced in HSPC in the absence of Foxo3 (Fig. 6, B–C). XRCC1 is an essential element of base excision repair (
      • Caldecott K.W.
      XRCC1 and DNA strand break repair.
      ). Loss of FOXO3 may lead to discrepancies between mRNA and protein expressions (
      • Liang R.
      • Campreciós G.
      • Kou Y.
      • McGrath K.
      • Nowak R.
      • Catherman S.
      • Bigarella C.L.
      • Rimmelé P.
      • Zhang X.
      • Gnanapragasam M.N.
      • Bieker J.J.
      • Papatsenko D.
      • Ma'ayan A.
      • Bresnick E.
      • Fowler
      • et al.
      A systems approach identifies essential FOXO3 functions at key steps of terminal erythropoiesis.
      ,
      • Zhang X.
      • Campreciós G.
      • Rimmelé P.
      • Liang R.
      • Yalcin S.
      • Mungamuri S.K.
      • Barminko J.
      • D'Escamard V.
      • Baron M.H.
      • Brugnara C.
      • Papatsenko D.
      • Rivella S.
      • Ghaffari S.
      FOXO3-mTOR metabolic cooperation in the regulation of erythroid cell maturation and homeostasis.
      ). Given the critical OGG1-XRCC1 interaction for BER, it is likely that reduced expression of XRRC1 mediates the defective OGG1 activity (
      • Ghosh S.
      • Canugovi C.
      • Yoon J.S.
      • Wilson 3rd, D.M.
      • Croteau D.L.
      • Mattson M.P.
      • Bohr V.A.
      Partial loss of the DNA repair scaffolding protein, Xrcc1, results in increased brain damage and reduced recovery from ischemic stroke in mice.
      ,
      • Campalans A.
      • Moritz E.
      • Kortulewski T.
      • Biard D.
      • Epe B.
      • Radicella J.P.
      Interaction with OGG1 is required for efficient recruitment of XRCC1 to base excision repair and maintenance of genetic stability after exposure to oxidative stress.
      • Janik J.
      • Swoboda M.
      • Janowska B.
      • Ciesla J.M.
      • Gackowski D.
      • Kowalewski J.
      • Olinski R.
      • Tudek B.
      • Speina E.
      8-Oxoguanine incision activity is impaired in lung tissues of NSCLC patients with the polymorphism of OGG1 and XRCC1 genes.
      ). Together with XRCC1 requirement for recruiting pol β to damaged DNA (
      • Fang Q.
      • Inanc B.
      • Schamus S.
      • Wang X.H.
      • Wei L.
      • Brown A.R.
      • Svilar D.
      • Sugrue K.F.
      • Goellner E.M.
      • Zeng X.
      • Yates N.A.
      • Lan L.
      • Vens C.
      • Sobol R.W.
      HSP90 regulates DNA repair via the interaction between XRCC1 and DNA polymerase β.
      ), these results support the notion that BER-mediated DNA repair in HSPC is dependent on FOXO3.
      Figure thumbnail gr6
      FIGURE 6Reduced expression of XRCC1 in the absence of Foxo3. A, Western blotting analysis of pol β and XRCC1 in wild type (WT) and pol β−/− and XRCC1−/− MEFs, respectively. B, Western blotting analysis of pol β and XRCC1 in Foxo3+/+ and Foxo3−/− lineage-negative bone marrow cells. C, protein quantification of pol β and XRCC1 relative to the level of expression in WT cells in Foxo3−/− lineage-negative bone marrow cells.

       Foxo3−/− Hematopoietic Stem and Progenitor Cells Respond Normally to Ionizing Radiation Insult

      To investigate Foxo3−/−HSPC response to additional insults, we used ionizing radiation (IR). LSK cells freshly isolated from WT and Foxo3−/− mice and kept in vitro displayed similar numbers of γH2AX nuclear foci 2 h after 10 Gy IR (Fig. 7A). In addition, WT and Foxo3−/− c-Kit+ hematopoietic progenitor cells responded similarly to 4 Gy IR, a dose to which HSPC are relatively tolerant (Fig. 7B) (
      • Mohrin M.
      • Bourke E.
      • Alexander D.
      • Warr M.R.
      • Barry-Holson K.
      • Le Beau M.M.
      • Morrison C.G.
      • Passegué E.
      Hematopoietic stem cell quiescence promotes error-prone DNA repair and mutagenesis.
      ). More precise quantitative analysis by FACS 2 h after LSK and c-Kit+ multipotent progenitor cells were submitted to a 4 Gy IR dose confirmed that the capacity of Foxo3−/− HSPC in accumulating γH2AX is similar to WT cells (Fig. 7B). Similar results were obtained by in vivo total body irradiation (TBI). WT and Foxo3−/− LSK cells isolated 6 or 24 h after a 4 Gy TBI showed similar levels of DNA breaks (Fig. 7, C and D). Interestingly, although the expression of genes involved in homologous recombination (HR), such as Brca1, Brca2, and Rad51, was not modulated by the loss of FOXO3 in HSPC, genes implicated in the error-prone non-homologous end-joining pathway, which is the main repair mechanism of damaged DNA in HSPC (
      • Mohrin M.
      • Bourke E.
      • Alexander D.
      • Warr M.R.
      • Barry-Holson K.
      • Le Beau M.M.
      • Morrison C.G.
      • Passegué E.
      Hematopoietic stem cell quiescence promotes error-prone DNA repair and mutagenesis.
      ) were significantly up-regulated in Foxo3−/− HSPC (Fig. 7E). Although the increased expression of XRCC6 (Ku70) (and possibly XRCC5 (Ku80)) might be part of a compensatory response (
      • Brenkman A.B.
      • van den Broek N.J.
      • de Keizer P.L.
      • van Gent D.C.
      • Burgering B.M.
      The DNA damage repair protein Ku70 interacts with FOXO4 to coordinate a conserved cellular stress response.
      ), the source of this increase is unclear. These results suggest that loss of FOXO3 does not exacerbate ionizing radiation-induced DNA damage or alternatively does not compromise the DNA damage response machinery in response to ionizing radiation.
      Figure thumbnail gr7
      FIGURE 7Foxo3−/− hematopoietic stem and progenitor cells respond normally to ionizing radiation insult. A, γH2AX staining on WT and Foxo3−/− LSK cells that were submitted to 10 Gy of ionizing radiation, kept in culture, and analyzed after 2 h. B, quantification of γH2AX levels by flow cytometry in WT and Foxo3−/− c-Kit+ and LSK cells 2 h after 4 Gy ionizing radiation dose (n ≥3 per group). Plot presents geometric mean values of FITC fluorescence that were normalized to basal WT levels. C, representative comet assay pictures of LSK cells isolated from control (C) or 4 Gy irradiated (IR) WT and Foxo3−/− animals after 6 or 24 h and comet assay quantification (D). E, QRT-PCR analysis of DNA breaks repair genes involved in HR (Brca1, Brca2, and Rad51) or non-homologous end-joining (Xrcc5 and Xrcc6) in Foxo3−/− c-Kit+ or LSK cells under homeostatic conditions. Actnb was used as an internal control, and expression was normalized to that of WT samples. Data are expressed as mean ± S.D. Student's t test. *, p < 0.05; **, p < 0.001 ; ***, p < 0.0002; ns, not significant.
      Altogether, our data identify FOXO3 as a regulator of DNA damage repair in HSPC under homeostasis and suggest that the observed DNA breaks (Figs. 1, B, D, and E, 2, 3, and 5G) are due to both an increase in endogenous ROS levels and a deficiency in oxidative DNA repair machinery in Foxo3−/− HSPCs (Fig. 8, Model).
      Figure thumbnail gr8
      FIGURE 8Model of FOXO3 modulation of genomic integrity in hematopoietic stem and progenitor cells. In normal HSPC, FOXO3 guards genome integrity by maintaining a gene expression program that represses ROS accumulation (anti-oxidant genes), promotes DNA repair (BER and NER genes), and sustains mitochondrial metabolism. Foxo3−/− HSPC accumulates defective mitochondria and elevates ROS and DNA damage leading to cell cycle impairment and potential genomic instability.

      Discussion

      We showed here that Foxo3−/− HSPCs accumulate damaged DNA under homeostatic conditions. We also showed that the damaged DNA in homeostatic Foxo3−/− HSPCs is mediated by both elevated endogenous ROS and a defective base excision DNA repair program. Additionally, our data suggest that the Foxo3−/− HSC G2/M delay is mediated primarily by elevated ROS. These results are consistent with and extend the scope of known FOXO3 (FOXO) functions in DNA damage response pathways (
      • Greer E.L.
      • Brunet A.
      FOXO transcription factors in ageing and cancer.
      ,
      • Brenkman A.B.
      • van den Broek N.J.
      • de Keizer P.L.
      • van Gent D.C.
      • Burgering B.M.
      The DNA damage repair protein Ku70 interacts with FOXO4 to coordinate a conserved cellular stress response.
      ,
      • Huang H.
      • Regan K.M.
      • Lou Z.
      • Chen J.
      • Tindall D.J.
      CDK2-dependent phosphorylation of FOXO1 as an apoptotic response to DNA damage.
      • Tran H.
      • Brunet A.
      • Grenier J.M.
      • Datta S.R.
      • Fornace Jr, A.J.
      • Di Stefano P.S.
      • Chiang L.W.
      • Greenberg M.E.
      DNA repair pathway stimulated by the forkhead transcription factor FOXO3a through the Gadd45 protein.
      ).
      Our findings show that FOXO3 modulates a gene network related to BER and NER oxidative DNA repair, because a number of related genes are down-regulated in Foxo3−/− LSK cells (Fig. 5A). We were able to reveal oxidative DNA damage in Foxo3−/− hematopoietic stem and progenitor cells using the FLARE hOGG1 assay, in which the human OGG1 glycosylase is introduced into the comet assay to induce DNA breaks at locations of oxidative base lesions (Fig. 2). Furthermore, the hyper-sensitive BER molecular beacon assay that we recently developed (
      • Svilar D.
      • Vens C.
      • Sobol R.W.
      Quantitative, real-time analysis of base excision repair activity in cell lysates utilizing lesion-specific molecular beacons.
      ) enabled us to show that OGG1-mediated glycosylase activity, which mediates the removal of the 8-oxo-dG lesion, is reduced in a population of Foxo3−/− hematopoietic cells enriched for stem and progenitor cells (Fig. 5, F and G). The reduction in OGG1 glycosylase activity in Foxo3−/− LSK was despite similar Ogg1 transcript expression in Foxo3−/− as compared with WT LSK cells (Fig. 5A). Furthermore, we found that the expression of the XRCC1 protein, which is critical for BER, is highly reduced in Foxo3−/− Lin cells (Fig. 6, B and C). Interestingly, despite the reduction in transcript expression of both XRCC1 and Polβ, only the XRCC1 protein was reduced in Foxo3−/− LSK cells (Fig. 6). As we had noted previously, the transcript expression in primary Foxo3−/− hematopoietic cells may not always fully correlate with the protein expression (
      • Liang R.
      • Campreciós G.
      • Kou Y.
      • McGrath K.
      • Nowak R.
      • Catherman S.
      • Bigarella C.L.
      • Rimmelé P.
      • Zhang X.
      • Gnanapragasam M.N.
      • Bieker J.J.
      • Papatsenko D.
      • Ma'ayan A.
      • Bresnick E.
      • Fowler
      • et al.
      A systems approach identifies essential FOXO3 functions at key steps of terminal erythropoiesis.
      ,
      • Zhang X.
      • Campreciós G.
      • Rimmelé P.
      • Liang R.
      • Yalcin S.
      • Mungamuri S.K.
      • Barminko J.
      • D'Escamard V.
      • Baron M.H.
      • Brugnara C.
      • Papatsenko D.
      • Rivella S.
      • Ghaffari S.
      FOXO3-mTOR metabolic cooperation in the regulation of erythroid cell maturation and homeostasis.
      ). These results together implicate FOXO3 in the regulation of BER in hematopoietic stem and progenitor cells.
      These combined findings raise the possibility that compromised FOXO3 function, as it might occur in aging stem cells (
      • Rimmelé P.
      • Bigarella C.L.
      • Liang R.
      • Izac B.
      • Dieguez-Gonzalez R.
      • Barbet G.
      • Donovan M.
      • Brugnara C.
      • Blander J.M.
      • Sinclair D.A.
      • Ghaffari S.
      Aging-like phenotype and defective lineage specification in SIRT1-deleted hematopoietic stem and progenitor cells.
      ,
      • Mehta A.
      • Zhao J.L.
      • Sinha N.
      • Marinov G.K.
      • Mann M.
      • Kowalczyk M.S.
      • Galimidi R.P.
      • Du X.
      • Erikci E.
      • Regev A.
      • Chowdhury K.
      • Baltimore D.
      The microRNA-132 and microRNA-212 cluster regulates hematopoietic stem cell maintenance and survival with age by buffering FOXO3 expression.
      ) or in the context of stem cell malignancies, is likely to sustain damaged DNA and mitochondrial defects (
      • Rimmelé P.
      • Liang R.
      • Bigarella C.L.
      • Kocabas F.
      • Xie J.
      • Serasinghe M.N.
      • Chipuk J.
      • Sadek H.
      • Zhang C.C.
      • Ghaffari S.
      Mitochondrial metabolism in hematopoietic stem cells requires functional FOXO3.
      ) and further contribute to stem cell aging and/or malignancy (
      • Ahn J.S.
      • Li J.
      • Chen E.
      • Kent D.G.
      • Park H.J.
      • Green A.R.
      JAK2V617F mediates resistance to DNA damage-induced apoptosis by modulating FOXO3A localization and Bcl-xL deamidation.
      ,
      • Ghaffari S.
      • Jagani Z.
      • Kitidis C.
      • Lodish H.F.
      • Khosravi-Far R.
      Cytokines and BCR-ABL mediate suppression of TRAIL-induced apoptosis through inhibition of forkhead FOXO3a transcription factor.
      ,
      • Sykes S.M.
      • Lane S.W.
      • Bullinger L.
      • Kalaitzidis D.
      • Yusuf R.
      • Saez B.
      • Ferraro F.
      • Mercier F.
      • Singh H.
      • Brumme K.M.
      • Acharya S.S.
      • Schöll C.
      • Tothova Z.
      • Attar E.C.
      • Frohling S.
      • et al.
      AKT/FOXO signaling enforces reversible differentiation blockade in myeloid leukemias.
      ,
      • Naka K.
      • Hoshii T.
      • Muraguchi T.
      • Tadokoro Y.
      • Ooshio T.
      • Kondo Y.
      • Nakao S.
      • Motoyama N.
      • Hirao A.
      TGF-β-FOXO signalling maintains leukaemia-initiating cells in chronic myeloid leukaemia.
      ,
      • Miyamoto K.
      • Miyamoto T.
      • Kato R.
      • Yoshimura A.
      • Motoyama N.
      • Suda T.
      FoxO3a regulates hematopoietic homeostasis through a negative feedback pathway in conditions of stress or aging.
      ,
      • Rimmelé P.
      • Bigarella C.L.
      • Liang R.
      • Izac B.
      • Dieguez-Gonzalez R.
      • Barbet G.
      • Donovan M.
      • Brugnara C.
      • Blander J.M.
      • Sinclair D.A.
      • Ghaffari S.
      Aging-like phenotype and defective lineage specification in SIRT1-deleted hematopoietic stem and progenitor cells.
      • Mehta A.
      • Zhao J.L.
      • Sinha N.
      • Marinov G.K.
      • Mann M.
      • Kowalczyk M.S.
      • Galimidi R.P.
      • Du X.
      • Erikci E.
      • Regev A.
      • Chowdhury K.
      • Baltimore D.
      The microRNA-132 and microRNA-212 cluster regulates hematopoietic stem cell maintenance and survival with age by buffering FOXO3 expression.
      ,
      • Rimmelé P.
      • Liang R.
      • Bigarella C.L.
      • Kocabas F.
      • Xie J.
      • Serasinghe M.N.
      • Chipuk J.
      • Sadek H.
      • Zhang C.C.
      • Ghaffari S.
      Mitochondrial metabolism in hematopoietic stem cells requires functional FOXO3.
      ). In agreement with this, FOXO3 inactivation is proposed to be one of the early events in the evolution of myeloid and perhaps other malignancies (
      • Ahn J.S.
      • Li J.
      • Chen E.
      • Kent D.G.
      • Park H.J.
      • Green A.R.
      JAK2V617F mediates resistance to DNA damage-induced apoptosis by modulating FOXO3A localization and Bcl-xL deamidation.
      ,
      • Bigarella C.
      • Rimmele P.
      • Dieguez Gonzalez R.
      • Liang R.
      • Izac B.
      • Donovan M.
      • Papatsenko D.
      • Ghaffari S.
      Loss of p53 rescues the defective function of Foxo3−/− hematopoietic stem Cells but enhances their predisposition to malignancy.
      ). One of the implications of these combined results (
      • Rimmelé P.
      • Liang R.
      • Bigarella C.L.
      • Kocabas F.
      • Xie J.
      • Serasinghe M.N.
      • Chipuk J.
      • Sadek H.
      • Zhang C.C.
      • Ghaffari S.
      Mitochondrial metabolism in hematopoietic stem cells requires functional FOXO3.
      ) is that elevated ROS, as a result of both mitochondrial defects and reduced anti-oxidant enzyme expression, contribute significantly to some, specifically to enhanced myeloproliferation, but not all of the main Foxo3−/− HSC defects. They also suggest that ROS-mediated Foxo3−/− HSC DNA damage may constitute a partially reversible phase in this process, because NAC treatment decreased DNA break levels and rescued HSPC from the cell cycle G2/M delay (FIGURE 3, FIGURE 4). However, potential clinical applications of these findings warrant careful consideration. As FOXO3 loss negatively affects the BER pathway (Fig. 5), the normalization of HSC cycling and G2/M correction that followed antioxidant therapy (Fig. 4) might constitute only a transient response, in agreement with our recent report showing that NAC treatment is unable to rescue the long term reconstitution ability of Foxo3−/− HSC (
      • Rimmelé P.
      • Liang R.
      • Bigarella C.L.
      • Kocabas F.
      • Xie J.
      • Serasinghe M.N.
      • Chipuk J.
      • Sadek H.
      • Zhang C.C.
      • Ghaffari S.
      Mitochondrial metabolism in hematopoietic stem cells requires functional FOXO3.
      ).
      Data presented here, combined with published work (
      • Rimmelé P.
      • Bigarella C.L.
      • Liang R.
      • Izac B.
      • Dieguez-Gonzalez R.
      • Barbet G.
      • Donovan M.
      • Brugnara C.
      • Blander J.M.
      • Sinclair D.A.
      • Ghaffari S.
      Aging-like phenotype and defective lineage specification in SIRT1-deleted hematopoietic stem and progenitor cells.
      ,
      • Mehta A.
      • Zhao J.L.
      • Sinha N.
      • Marinov G.K.
      • Mann M.
      • Kowalczyk M.S.
      • Galimidi R.P.
      • Du X.
      • Erikci E.
      • Regev A.
      • Chowdhury K.
      • Baltimore D.
      The microRNA-132 and microRNA-212 cluster regulates hematopoietic stem cell maintenance and survival with age by buffering FOXO3 expression.
      ,
      • Rimmelé P.
      • Liang R.
      • Bigarella C.L.
      • Kocabas F.
      • Xie J.
      • Serasinghe M.N.
      • Chipuk J.
      • Sadek H.
      • Zhang C.C.
      • Ghaffari S.
      Mitochondrial metabolism in hematopoietic stem cells requires functional FOXO3.
      ,
      • Li J.
      • Du W.
      • Maynard S.
      • Andreassen P.R.
      • Pang Q.
      Oxidative stress-specific interaction between FANCD2 and FOXO3a.
      ,
      • Li X.
      • Li J.
      • Wilson A.
      • Sipple J.
      • Schick J.
      • Pang Q.
      Fancd2 is required for nuclear retention of foxo3a in hematopoietic stem cell maintenance.
      ), depict FOXO3 as a molecular node that wires together mitochondrial metabolism (
      • Rimmelé P.
      • Liang R.
      • Bigarella C.L.
      • Kocabas F.
      • Xie J.
      • Serasinghe M.N.
      • Chipuk J.
      • Sadek H.
      • Zhang C.C.
      • Ghaffari S.
      Mitochondrial metabolism in hematopoietic stem cells requires functional FOXO3.
      ), ROS signaling, and DNA damage repair mechanisms for the maintenance of healthy HSPC. These collective findings join growing evidence in support of the notion that FOXO3 serves as a barrier to genomic instability in HSPC (
      • Li J.
      • Du W.
      • Maynard S.
      • Andreassen P.R.
      • Pang Q.
      Oxidative stress-specific interaction between FANCD2 and FOXO3a.
      ,
      • Li X.
      • Li J.
      • Wilson A.
      • Sipple J.
      • Schick J.
      • Pang Q.
      Fancd2 is required for nuclear retention of foxo3a in hematopoietic stem cell maintenance.
      ).

      Experimental Procedures

       Mice

      All mice were from the C57BL/6 genetic background and were 10–12 weeks old (
      • Yalcin S.
      • Zhang X.
      • Luciano J.P.
      • Mungamuri S.K.
      • Marinkovic D.
      • Vercherat C.
      • Sarkar A.
      • Grisotto M.
      • Taneja R.
      • Ghaffari S.
      Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
      ). Protocols were approved by the Institutional Animal Care and Use Committee of the Icahn School of Medicine at Mount Sinai. NAC treatment was performed as described previously (
      • Yalcin S.
      • Zhang X.
      • Luciano J.P.
      • Mungamuri S.K.
      • Marinkovic D.
      • Vercherat C.
      • Sarkar A.
      • Grisotto M.
      • Taneja R.
      • Ghaffari S.
      Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
      ,
      • Yalcin S.
      • Marinkovic D.
      • Mungamuri S.K.
      • Zhang X.
      • Tong W.
      • Sellers R.
      • Ghaffari S.
      ROS-mediated amplification of AKT/mTOR signalling pathway leads to myeloproliferative syndrome in Foxo3(−/−) mice.
      ).

       Flow Cytometry and Hematopoietic Stem Cell Isolation

      Antibody staining and bone marrow cell preparation for FACS sorting were performed as described previously (
      • Yalcin S.
      • Zhang X.
      • Luciano J.P.
      • Mungamuri S.K.
      • Marinkovic D.
      • Vercherat C.
      • Sarkar A.
      • Grisotto M.
      • Taneja R.
      • Ghaffari S.
      Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
      ,
      • Yalcin S.
      • Marinkovic D.
      • Mungamuri S.K.
      • Zhang X.
      • Tong W.
      • Sellers R.
      • Ghaffari S.
      ROS-mediated amplification of AKT/mTOR signalling pathway leads to myeloproliferative syndrome in Foxo3(−/−) mice.
      ,
      • Rimmelé P.
      • Bigarella C.L.
      • Liang R.
      • Izac B.
      • Dieguez-Gonzalez R.
      • Barbet G.
      • Donovan M.
      • Brugnara C.
      • Blander J.M.
      • Sinclair D.A.
      • Ghaffari S.
      Aging-like phenotype and defective lineage specification in SIRT1-deleted hematopoietic stem and progenitor cells.
      ). Briefly, for isolation of LSK and c-Kit+ cells, freshly isolated bone marrow cells were stained with biotinylated hematopoietic multiple lineage monoclonal antibody mixture (Stem Cell Technologies), PE-Sca-1, APC-c-Kit (BD Biosciences), and incubated with Pacific BlueTM streptavidin secondary antibody. In addition to LSK staining and to isolate the long term HSC (LSK-Flk2CD34), total bone marrow cells were stained with FITC-CD34 (eBioscience) and PE-Cy5-Flk2 (BD Biosciences) antibodies. Analyses and FACS sorting were performed at the Flow Cytometry Core at Icahn School of Medicine at Mount Sinai.

       QRT-PCR

      RNA from FACS-sorted c-Kit+ or LSK cells was extracted using the EasySep MicroPlus RNA extraction kit (Qiagen). RNA was retro-transcribed using SuperscriptII (Invitrogen) and cDNA corresponding to 300 cells was used per well for QRT-PCRs with specific primers (Table 1). QRT-PCRs were run on an ABI7900 thermal cycler (Applied Biosystems).
      TABLE 1Mouse primer sequences
      GeneForward primer (5′ → 3′)Reverse primer (5′ → 3′)
      Apex1TTATGGCATTGGCGAGGAAGACCAACGCTGTCGGTATTCCA
      Brca1TTGGAACTGATCAAAGAACCTGTACATTGTGAAGGCCCTTTCTT
      Brca2GGGAGTTGAAGTGGATCCTGGGAGAGTCAGCAGGCGTTAC
      Fen1CACTGCTAGCTGCTTAAGGCTGGAGCAATGGCTTCTTCCTACC
      Lig1GACGCCTGCTATCAATCGGTATCAGTTGTACCTTTTCCCTGGC
      Lig3CTTTTCAGCAGCAAAACCCAACGGAACTCTCGTAGCAGACA
      Nthl1CAAGATGGCACACTTGGCTACTCTTCTGGGGTCTTGGTCA
      Ogg1ATTCCAAGGTGTGAGACTGCTATGAGTCGAGGTCCAAAGGC
      Parp1CTTGAGCAGATGCCCTCCAACTCTTCGTCCTGGCCATAGTC
      PolBTCTGTCAAAGGGTGAAACAAAGGATCTTTGGGGATCAACCTG
      Pole3CCCGAGGACCTAAATCTGCCTTGCGAAGTTATTGGCACAGG
      Rad51AACCCATTGGAGGGAACATCAGATTCTGGTCTCCCCTCTTCC
      XpaAAAGCTACAGGTGGTAAAGCGGCTTCTTATTGCTCGCCGC
      XpcGTGGGCTGAGACCTTGAGACTGCACGCAATCCCTGGAATA
      Xrcc1TCTGTGGTCCTACAGTTGGAGAAAAATGCGAACACGGTTGGG
      Xrcc5TTGGTGTAGCCTTCCCTTACAGTATTGCCGCAAGTCTTCCA
      Xrcc6ACATGATGGAGTCGGAGCAAACTCATCTGCCAGGGAACC

       In Vitro Hydrogen Peroxide (H2O2) Treatment of LSK Cells

      FACS-sorted WT and Foxo3−/− LSK cells were incubated in StemSpan SFEM (Stem Cell Technology) and treated with or without 100 μm of H2O2, washed extensively after 1 h, and either analyzed immediately (1 h) or cultured for further analyses at the indicated (2 and 4 h) time points by comet assay.

       TBI

      Mice were submitted to total body irradiation (4 Gy) (Icahn School of Medicine at Mount Sinai Irradiator Shared Resource Facility). Mice were sacrificed, and bone marrow cells were collected from non-irradiated controls or after 6 or 24 h post-TBI, and live LSK cells were FACS sorted and submitted immediately to comet assay.

       Measurement of Intracellular ROS

      ROS measurements were performed on freshly isolated bone marrow cells using 3 μm 2′,7′-dichlorofluorescein diacetate (Molecular Probes), as described previously (
      • Yalcin S.
      • Zhang X.
      • Luciano J.P.
      • Mungamuri S.K.
      • Marinkovic D.
      • Vercherat C.
      • Sarkar A.
      • Grisotto M.
      • Taneja R.
      • Ghaffari S.
      Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
      ,
      • Yalcin S.
      • Marinkovic D.
      • Mungamuri S.K.
      • Zhang X.
      • Tong W.
      • Sellers R.
      • Ghaffari S.
      ROS-mediated amplification of AKT/mTOR signalling pathway leads to myeloproliferative syndrome in Foxo3(−/−) mice.
      ,
      • Rimmelé P.
      • Bigarella C.L.
      • Liang R.
      • Izac B.
      • Dieguez-Gonzalez R.
      • Barbet G.
      • Donovan M.
      • Brugnara C.
      • Blander J.M.
      • Sinclair D.A.
      • Ghaffari S.
      Aging-like phenotype and defective lineage specification in SIRT1-deleted hematopoietic stem and progenitor cells.
      ).

       Cell Cycle Analysis

      Freshly isolated (2 × 106) bone marrow cells from in vivo BrdU-injected mice (one pulse, 19 h before sacrifice) were stained for LSK, fixed, permeabilized, and incubated with anti-BrdU antibody (Pharmingen) and co-stained with 7-AAD, following the manufacturer's instructions. Samples were immediately analyzed by flow cytometry. To measure the percentage of quiescent cells (G0 phase), freshly isolated (2 × 106) bone marrow cells were stained for LT-HSC (LSK-CD34), fixed, permeabilized, incubated with anti-Ki67-PE-conjugated antibody (Pharmingen), and co-stained with 4′,6-diamidino-2-phenylindole (DAPI) (1 μg/ml).

       Apoptosis Assay

      Freshly FACS-sorted control and/or 1 h of H2O2-treated LSK cells were suspended in 1× annexin V-binding buffer containing 2.5 μl of annexin V-APC. Samples were co-stained with 7-AAD, following the manufacturer's instructions (BD Biosciences), and analyzed immediately by FACS.

       γH2AX Analysis by Immunofluorescence Staining and Flow Cytometry

      WT and Foxo3−/− FACS-sorted LSK cells were cytospun onto glass slides. γH2AX nuclear foci were analyzed by immunofluorescence staining using a rabbit polyclonal anti-phospho H2AX (Ser-139) (Millipore) and imaged on a Leica DMRA2 fluorescence microscope using ×400 oil immersion objective. Freshly isolated bone marrow cells stained for HSPC were fixed in 2% paraformaldehyde and stained overnight at 4 °C with 1:100 mouse monoclonal anti-H2AX pS139 FITC conjugate (Millipore) (or anti-H2AX pS139 APC conjugate, Biolegend) in BLOCK9 solution as described previously (
      • Muslimovic A.
      • Ismail I.H.
      • Gao Y.
      • Hammarsten O.
      An optimized method for measurement of gamma-H2AX in blood mononuclear and cultured cells.
      ). The samples were next diluted into PBS, 2% FBS and analyzed by FACS.

       Single Cell Gel Electrophoresis (Comet Assay) and FLARETM Assay

      FACS-sorted LSK cells were submitted to alkaline comet assay using the Trevigen® CometAssay® kit following the manufacturer's instructions. Briefly, cells were mixed in melted agarose, placed in glass slides, and allowed to jellify at 4 °C for 30 min. After that, slides were subsequently immersed in lysis and unwinding solutions and immediately submitted to electrophoresis at 4 °C in an alkaline electrophoresis solution, pH 13. Finally, slides were dehydrated in 70% ethanol and allowed to dry before analysis.
      For the FLARE hOGG1 assay, prior to the alkaline electrophoresis step, cells in agarose were incubated with a 1:2 dilution of human OGG1 glycosylase for 1 h at 37 °C to convert all oxidized bases into DNA breaks. Slides were analyzed on a Leica DMRA2 fluorescence microscope (×100 objective). Comet parameters were quantified using the CometScore software (TriTek Corp). The parameter percentage (%) of DNA in tail corresponds to the amount of pixels in the comet tail (migrated DNA), whereas the Olive tail moment (Olive et al., (
      • Olive P.L.
      • Banáth J.P.
      • Durand R.E.
      Heterogeneity in radiation-induced DNA damage and repair in tumor and normal-cells measured using the comet assay.
      )) corresponds to the product of the tail length and the fraction of DNA in the tail (intensity of the DNA in the tail).

       DNA Oxidation Analysis

      FACS-sorted LSK cells were incubated in the kit staining solution containing 1:20 dilution of a specific FITC-conjugated probe to 8-OHdG, in accordance with the manufacturer's instructions (OxyDNA assay kit, Calbiochem®).

       Cell Pellet and Lysate Preparation for BER Molecular Beacon Assay

      Approximately 6 × 106 lineage-negative (Lin−) cells from WT and Foxo3−/− mice (six mice per group) were collected and pelleted at 228 × g for 5 min. The cell pellets were washed once with PBS and then flash-frozen and kept at −80 °C. Whole cell lysates were prepared by a freeze-thaw method. Briefly, cells were resuspended in 150 μl of the BER molecular beacon reaction buffer (HEPES 25 mm, pH 7.8, KCl 150 mm, EDTA 0.5 mm, glycerol 1%, DTT 0.5 mm, 1× protease inhibitor (Pierce, catalog no. 539131)). The cell suspension was then frozen on dry ice for 5 min and then thawed in a 37 °C water bath for 5 min followed by vortexing at the maximum speed for 30 s. Cells were frozen and thawed for three cycles and then centrifuged at 16,400 rpm for 5 min to remove cellular debris. The protein concentration of each cell lysate was measured. Lysates were diluted with BER molecular beacon reaction buffer to a final concentration of 0.4 mg/ml and immediately used for the activity assay as detailed below (
      • Svilar D.
      • Vens C.
      • Sobol R.W.
      Quantitative, real-time analysis of base excision repair activity in cell lysates utilizing lesion-specific molecular beacons.
      ).

       BER Molecular Beacon Assay and Data Analysis

      OGG1-mediated glycosylase activity was measured by a BER molecular beacon assay, essentially as we have described previously (
      • Svilar D.
      • Vens C.
      • Sobol R.W.
      Quantitative, real-time analysis of base excision repair activity in cell lysates utilizing lesion-specific molecular beacons.
      ). Briefly, an OGG1 substrate (the 8-oxo-dG/A beacon, 5 μl, 200 nm) was added to the whole cell lysate (20 μl) that was prepared in BER molecular beacon reaction buffer (above). The reaction was performed at 37 °C using a StepOnePlus QRT-PCR machine (Applied Biosystems). Fluorescence was measured for three technical replicates every 20 s for 1 h and normalized to the signal from the completely denatured beacon within each well, as in previously published methods (
      • Svilar D.
      • Vens C.
      • Sobol R.W.
      Quantitative, real-time analysis of base excision repair activity in cell lysates utilizing lesion-specific molecular beacons.
      ).

       Western Blotting Analysis

      Lineage-negative bone marrow depleted of mature cells and enriched for HSPC were lysed into 2× Laemmli buffer with 100 mm DTT. Proteins were resolved on SDS-PAGE, transferred to nitrocellulose membranes, and incubated with anti-POLB (1:3000) (Thermo Fisher, MA5-13899), anti-XRCC1 (1:3000; Bethyl, A300-065A), or anti-tubulin (1:1000; Calbiochem, CP06) replicates every 20 s for 1 h, normalized to the signal from the completely denatured beacon within each well, as in methods published previously (
      • Svilar D.
      • Vens C.
      • Sobol R.W.
      Quantitative, real-time analysis of base excision repair activity in cell lysates utilizing lesion-specific molecular beacons.
      ).

      Author Contributions

      C. L. B. and S. G. conceived and designed the study, analyzed the data, and wrote the manuscript. C. L. B. performed the experiments with assistance from R. L. and P. R. J. L. performed and J. L. and R. W. S. designed and analyzed the experiments in Figs. 5G and 6 and contributed to the manuscript preparation.

      Acknowledgment

      We thank Valentina d'Escamard for technical help, the Flow Cytometry Core, and the Irradiator Shared Resource Facilities at the Icahn School of Medicine at Mount Sinai.

      References

        • Lombard D.B.
        • Chua K.F.
        • Mostoslavsky R.
        • Franco S.
        • Gostissa M.
        • Alt F.W.
        DNA repair, genome stability, and aging.
        Cell. 2005; 120: 497-512
        • Rossi D.J.
        • Jamieson C.H.
        • Weissman I.L.
        Stems cells and the pathways to aging and cancer.
        Cell. 2008; 132: 681-696
        • Bigarella C.L.
        • Liang R.
        • Ghaffari S.
        Stem cells and the impact of ROS signaling.
        Development. 2014; 141: 4206-4218
        • Commoner B.
        • Townsend J.
        • Pake G.E.
        Free radicals in biological materials.
        Nature. 1954; 174: 689-691
        • Santos M.A.
        • Faryabi R.B.
        • Ergen A.V.
        • Day A.M.
        • Malhowski A.
        • Canela A.
        • Onozawa M.
        • Lee J.E.
        • Callen E.
        • Gutierrez-Martinez P.
        • Chen H.T.
        • Wong N.
        • Finkel N.
        • Deshpande A.
        • Sharrow S.
        • et al.
        DNA-damage-induced differentiation of leukaemic cells as an anti-cancer barrier.
        Nature. 2014; 514: 107-111
        • Walter D.
        • Lier A.
        • Geiselhart A.
        • Thalheimer F.B.
        • Huntscha S.
        • Sobotta M.C.
        • Moehrle B.
        • Brocks D.
        • Bayindir I.
        • Kastutnig P.
        • Muedder K.
        • Klein C.E.
        • Jauch A.
        • Schroeder T.
        • Geiger H.
        • et al.
        Exit from dormancy provokes DNA-damage-induced attrition in haematopoietic stem cells.
        Nature. 2015; 520: 549-552
        • Marty C.
        • Lacout C.
        • Droin N.
        • Le Couédic J.P.
        • Ribrag V.
        • Solary E.
        • Vainchenker W.
        • Villeval J.L.
        • Plo I.
        A role for reactive oxygen species in JAK2 V617F myeloproliferative neoplasm progression.
        Leukemia. 2013; 27: 2187-2195
        • Lagadinou E.D.
        • Sach A.
        • Callahan K.
        • Rossi R.M.
        • Neering S.J.
        • Minhajuddin M.
        • Ashton J.M.
        • Pei S.
        • Grose V.
        • O'Dwyer K.M.
        • Liesveld J.L.
        • Brookes P.S.
        • Becker M.W.
        • Jordan C.T.
        BCL-2 inhibition targets oxidative phosphorylation and selectively eradicates quiescent human leukemia stem cells.
        Cell Stem Cell. 2013; 12: 329-341
        • Svilar D.
        • Goellner E.M.
        • Almeida K.H.
        • Sobol R.W.
        Base excision repair and lesion-dependent subpathways for repair of oxidative DNA damage.
        Antioxid Redox Signal. 2011; 14: 2491-2507
        • Liang R.
        • Ghaffari S.
        Stem cells, redox signaling, and stem cell aging.
        Antioxid. Redox Signal. 2014; 20: 1902-1916
        • Yahata T.
        • Takanashi T.
        • Muguruma Y.
        • Ibrahim A.A.
        • Matsuzawa H.
        • Uno T.
        • Sheng Y.
        • Onizuka M.
        • Ito M.
        • Kato S.
        • Ando K.
        Accumulation of oxidative DNA damage restricts the self-renewal capacity of human hematopoietic stem cells.
        Blood. 2011; 118: 2941-2950
        • Miyamoto K.
        • Araki K.Y.
        • Naka K.
        • Arai F.
        • Takubo K.
        • Yamazaki S.
        • Matsuoka S.
        • Miyamoto T.
        • Ito K.
        • Ohmura M.
        • Chen C.
        • Hosokawa K.
        • Nakauchi H.
        • Nakayama K.
        • Nakayama K.I.
        • et al.
        Foxo3a is essential for maintenance of the hematopoietic stem cell pool.
        Cell Stem Cell. 2007; 1: 101-112
        • Yalcin S.
        • Zhang X.
        • Luciano J.P.
        • Mungamuri S.K.
        • Marinkovic D.
        • Vercherat C.
        • Sarkar A.
        • Grisotto M.
        • Taneja R.
        • Ghaffari S.
        Foxo3 is essential for the regulation of ataxia telangiectasia mutated and oxidative stress-mediated homeostasis of hematopoietic stem cells.
        J. Biol. Chem. 2008; 283: 25692-25705
        • Greer E.L.
        • Brunet A.
        FOXO transcription factors in ageing and cancer.
        Acta Physiol. 2008; 192: 19-28
        • Eijkelenboom A.
        • Mokry M.
        • Smits L.M.
        • Nieuwenhuis E.E.
        • Burgering B.M.
        FOXO3 selectively amplifies enhancer activity to establish target gene regulation.
        Cell Rep. 2013; 5: 1664-1678
        • Zhang X.
        • Yalcin S.
        • Lee D.F.
        • Yeh T.Y.
        • Lee S.M.
        • Su J.
        • Mungamuri S.K.
        • Rimmele P.
        • Kennedy M.
        • Sellers R.
        • Landthaler M.
        • Tuschl T.
        • Chi N.W.
        • Lemischka I.
        • Keller G.
        • Ghaffari S.
        FOXO1 is an essential regulator of pluripotency in human embryonic stem cells.
        Nat. Cell Biol. 2011; 13: 1092-1099
        • Lee J.Y.
        • Nakada D.
        • Yilmaz O.H.
        • Tothova Z.
        • Joseph N.M.
        • Lim M.S.
        • Gilliland D.G.
        • Morrison S.J.
        mTOR activation induces tumor suppressors that inhibit leukemogenesis and deplete hematopoietic stem cells after Pten deletion.
        Cell Stem Cell. 2010; 7: 593-605
        • Ahn J.S.
        • Li J.
        • Chen E.
        • Kent D.G.
        • Park H.J.
        • Green A.R.
        JAK2V617F mediates resistance to DNA damage-induced apoptosis by modulating FOXO3A localization and Bcl-xL deamidation.
        Oncogene. 2016; 35: 2235-2246
        • Liang R.
        • Rimmelé P.
        • Bigarella C.L.
        • Yalcin S.
        • Ghaffari S.
        Evidence for AKT-independent regulation of FOXO1 and FOXO3 in haematopoietic stem and progenitor cells.
        Cell Cycle. 2016; 15: 861-867
        • Santo E.E.
        • Paik J.
        FOXO3a and haematopoietic stem cells: goodbye PI3K, hello SIRT1?.
        Cell Cycle. 2016; 15: 879-880
        • Yalcin S.
        • Marinkovic D.
        • Mungamuri S.K.
        • Zhang X.
        • Tong W.
        • Sellers R.
        • Ghaffari S.
        ROS-mediated amplification of AKT/mTOR signalling pathway leads to myeloproliferative syndrome in Foxo3(−/−) mice.
        EMBO J. 2010; 29: 4118-4131
        • Hillion J.
        • Le Coniat M.
        • Jonveaux P.
        • Berger R.
        • Bernard O.A.
        AF6q21, a novel partner of the MLL gene in t(6;11)(q21;q23), defines a forkhead transcriptional factor subfamily.
        Blood. 1997; 90: 3714-3719
        • Ghaffari S.
        • Jagani Z.
        • Kitidis C.
        • Lodish H.F.
        • Khosravi-Far R.
        Cytokines and BCR-ABL mediate suppression of TRAIL-induced apoptosis through inhibition of forkhead FOXO3a transcription factor.
        Proc. Natl. Acad. Sci. U.S.A. 2003; 100: 6523-6528
        • Scheijen B.
        • Ngo H.T.
        • Kang H.
        • Griffin J.D.
        FLT3 receptors with internal tandem duplications promote cell viability and proliferation by signaling through Foxo proteins.
        Oncogene. 2004; 23: 3338-3349
        • Gu T.L.
        • Tothova Z.
        • Scheijen B.
        • Griffin J.D.
        • Gilliland D.G.
        • Sternberg D.W.
        NPM-ALK fusion kinase of anaplastic large-cell lymphoma regulates survival and proliferative signaling through modulation of FOXO3a.
        Blood. 2004; 103: 4622-4629
        • Chapuis N.
        • Park S.
        • Leotoing L.
        • Tamburini J.
        • Verdier F.
        • Bardet V.
        • Green A.S.
        • Willems L.
        • Agou F.
        • Ifrah N.
        • Dreyfus F.
        • Bismuth G.
        • Baud V.
        • Lacombe C.
        • Mayeux P.
        • Bouscary D.
        IκB kinase overcomes PI3K/Akt and ERK/MAPK to control FOXO3a activity in acute myeloid leukemia.
        Blood. 2010; 116: 4240-4250
        • Santamaría C.M.
        • Chillón M.C.
        • García-Sanz R.
        • Pérez C.
        • Caballero M.D.
        • Ramos F.
        • de Coca A.G.
        • Alonso J.M.
        • Giraldo P.
        • Bernal T.
        • Queizán J.A.
        • Rodriguez J.N.
        • Fernández-Abellán P.
        • Bárez A.
        • Peñarrubia M.J.
        • et al.
        High FOXO3a expression is associated with a poorer prognosis in AML with normal cytogenetics.
        Leuk Res. 2009; 33: 1706-1709
        • Vandenberg C.J.
        • Motoyama N.
        • Cory S.
        FoxO3 suppresses Myc-driven lymphomagenesis.
        Cell Death & Dis. 2016; 6: e2046
        • Sykes S.M.
        • Lane S.W.
        • Bullinger L.
        • Kalaitzidis D.
        • Yusuf R.
        • Saez B.
        • Ferraro F.
        • Mercier F.
        • Singh H.
        • Brumme K.M.
        • Acharya S.S.
        • Schöll C.
        • Tothova Z.
        • Attar E.C.
        • Frohling S.
        • et al.
        AKT/FOXO signaling enforces reversible differentiation blockade in myeloid leukemias.
        Cell. 2011; 146: 697-708
        • Naka K.
        • Hoshii T.
        • Muraguchi T.
        • Tadokoro Y.
        • Ooshio T.
        • Kondo Y.
        • Nakao S.
        • Motoyama N.
        • Hirao A.
        TGF-β-FOXO signalling maintains leukaemia-initiating cells in chronic myeloid leukaemia.
        Nature. 2010; 463: 676-680
        • Pellicano F.
        • Scott M.T.
        • Helgason G.V.
        • Hopcroft L.E.
        • Allan E.K.
        • Aspinall-O'Dea M.
        • Copland M.
        • Pierce A.
        • Huntly B.J.
        • Whetton A.D.
        • Holyoake T.L.
        The antiproliferative activity of kinase inhibitors in chronic myeloid leukemia cells is mediated by FOXO transcription factors.
        Stem Cells. 2014; 32: 2324-2337
        • Miyamoto K.
        • Miyamoto T.
        • Kato R.
        • Yoshimura A.
        • Motoyama N.
        • Suda T.
        FoxO3a regulates hematopoietic homeostasis through a negative feedback pathway in conditions of stress or aging.
        Blood. 2008; 112: 4485-4493
        • Rimmelé P.
        • Bigarella C.L.
        • Liang R.
        • Izac B.
        • Dieguez-Gonzalez R.
        • Barbet G.
        • Donovan M.
        • Brugnara C.
        • Blander J.M.
        • Sinclair D.A.
        • Ghaffari S.
        Aging-like phenotype and defective lineage specification in SIRT1-deleted hematopoietic stem and progenitor cells.
        Stem Cell Reports. 2014; 3: 44-59
        • Mehta A.
        • Zhao J.L.
        • Sinha N.
        • Marinov G.K.
        • Mann M.
        • Kowalczyk M.S.
        • Galimidi R.P.
        • Du X.
        • Erikci E.
        • Regev A.
        • Chowdhury K.
        • Baltimore D.
        The microRNA-132 and microRNA-212 cluster regulates hematopoietic stem cell maintenance and survival with age by buffering FOXO3 expression.
        Immunity. 2015; 42: 1021-1032
        • Zhang X.
        • Rielland M.
        • Yalcin S.
        • Ghaffari S.
        Regulation and function of FoxO transcription factors in normal and cancer stem cells: what have we learned?.
        Curr. Drug Targets. 2011; 12: 1267-1283
        • Rimmelé P.
        • Liang R.
        • Bigarella C.L.
        • Kocabas F.
        • Xie J.
        • Serasinghe M.N.
        • Chipuk J.
        • Sadek H.
        • Zhang C.C.
        • Ghaffari S.
        Mitochondrial metabolism in hematopoietic stem cells requires functional FOXO3.
        EMBO Rep. 2015; 16: 1164-1176
        • Kuo L.J.
        • Yang L.X.
        Gamma-H2AX- a novel biomarker for DNA double-strand breaks.
        In Vivo. 2008; 22: 305-309
        • Beerman I.
        • Seita J.
        • Inlay M.A.
        • Weissman I.L.
        • Rossi D.J.
        Quiescent hematopoietic stem cells accumulate DNA damage during aging that is repaired upon entry into cell cycle.
        Cell Stem Cell. 2014; 15: 37-50
        • Svilar D.
        • Vens C.
        • Sobol R.W.
        Quantitative, real-time analysis of base excision repair activity in cell lysates utilizing lesion-specific molecular beacons.
        JoVE. 2012; : e4168
        • Caldecott K.W.
        XRCC1 and DNA strand break repair.
        DNA Repair. 2003; 2: 955-969
        • Liang R.
        • Campreciós G.
        • Kou Y.
        • McGrath K.
        • Nowak R.
        • Catherman S.
        • Bigarella C.L.
        • Rimmelé P.
        • Zhang X.
        • Gnanapragasam M.N.
        • Bieker J.J.
        • Papatsenko D.
        • Ma'ayan A.
        • Bresnick E.
        • Fowler
        • et al.
        A systems approach identifies essential FOXO3 functions at key steps of terminal erythropoiesis.
        PLoS Genet. 2015; 11: e1005526
        • Zhang X.
        • Campreciós G.
        • Rimmelé P.
        • Liang R.
        • Yalcin S.
        • Mungamuri S.K.
        • Barminko J.
        • D'Escamard V.
        • Baron M.H.
        • Brugnara C.
        • Papatsenko D.
        • Rivella S.
        • Ghaffari S.
        FOXO3-mTOR metabolic cooperation in the regulation of erythroid cell maturation and homeostasis.
        Am. J. Hematol. 2014; 89: 954-963
        • Ghosh S.
        • Canugovi C.
        • Yoon J.S.
        • Wilson 3rd, D.M.
        • Croteau D.L.
        • Mattson M.P.
        • Bohr V.A.
        Partial loss of the DNA repair scaffolding protein, Xrcc1, results in increased brain damage and reduced recovery from ischemic stroke in mice.
        Neurobiol. Aging. 2015; 36: 2319-2330
        • Campalans A.
        • Moritz E.
        • Kortulewski T.
        • Biard D.
        • Epe B.
        • Radicella J.P.
        Interaction with OGG1 is required for efficient recruitment of XRCC1 to base excision repair and maintenance of genetic stability after exposure to oxidative stress.
        Mol. Cell. Biol. 2015; 35: 1648-1658
        • Janik J.
        • Swoboda M.
        • Janowska B.
        • Ciesla J.M.
        • Gackowski D.
        • Kowalewski J.
        • Olinski R.
        • Tudek B.
        • Speina E.
        8-Oxoguanine incision activity is impaired in lung tissues of NSCLC patients with the polymorphism of OGG1 and XRCC1 genes.
        Mutat Res. 2011; 709–710: 21-31
        • Fang Q.
        • Inanc B.
        • Schamus S.
        • Wang X.H.
        • Wei L.
        • Brown A.R.
        • Svilar D.
        • Sugrue K.F.
        • Goellner E.M.
        • Zeng X.
        • Yates N.A.
        • Lan L.
        • Vens C.
        • Sobol R.W.
        HSP90 regulates DNA repair via the interaction between XRCC1 and DNA polymerase β.
        Nat. Commun. 2014; 5: 5513
        • Mohrin M.
        • Bourke E.
        • Alexander D.
        • Warr M.R.
        • Barry-Holson K.
        • Le Beau M.M.
        • Morrison C.G.
        • Passegué E.
        Hematopoietic stem cell quiescence promotes error-prone DNA repair and mutagenesis.
        Cell Stem Cell. 2010; 7: 174-185
        • Brenkman A.B.
        • van den Broek N.J.
        • de Keizer P.L.
        • van Gent D.C.
        • Burgering B.M.
        The DNA damage repair protein Ku70 interacts with FOXO4 to coordinate a conserved cellular stress response.
        FASEB J. 2010; 24: 4271-4280
        • Huang H.
        • Regan K.M.
        • Lou Z.
        • Chen J.
        • Tindall D.J.
        CDK2-dependent phosphorylation of FOXO1 as an apoptotic response to DNA damage.
        Science. 2006; 314: 294-297
        • Tran H.
        • Brunet A.
        • Grenier J.M.
        • Datta S.R.
        • Fornace Jr, A.J.
        • Di Stefano P.S.
        • Chiang L.W.
        • Greenberg M.E.
        DNA repair pathway stimulated by the forkhead transcription factor FOXO3a through the Gadd45 protein.
        Science. 2002; 296: 530-534
        • Bigarella C.
        • Rimmele P.
        • Dieguez Gonzalez R.
        • Liang R.
        • Izac B.
        • Donovan M.
        • Papatsenko D.
        • Ghaffari S.
        Loss of p53 rescues the defective function of Foxo3−/− hematopoietic stem Cells but enhances their predisposition to malignancy.
        Blood. 2013; 122: 4199
        • Li J.
        • Du W.
        • Maynard S.
        • Andreassen P.R.
        • Pang Q.
        Oxidative stress-specific interaction between FANCD2 and FOXO3a.
        Blood. 2010; 115: 1545-1548
        • Li X.
        • Li J.
        • Wilson A.
        • Sipple J.
        • Schick J.
        • Pang Q.
        Fancd2 is required for nuclear retention of foxo3a in hematopoietic stem cell maintenance.
        J. Biol. Chem. 2015; 290: 2715-2727
        • Muslimovic A.
        • Ismail I.H.
        • Gao Y.
        • Hammarsten O.
        An optimized method for measurement of gamma-H2AX in blood mononuclear and cultured cells.
        Nat. Protoc. 2008; 3: 1187-1193
        • Olive P.L.
        • Banáth J.P.
        • Durand R.E.
        Heterogeneity in radiation-induced DNA damage and repair in tumor and normal-cells measured using the comet assay.
        Radiation Res. 1990; 122: 86-94