Advertisement

Specific Palmitoyltransferases Associate with and Activate the Epithelial Sodium Channel*

  • Anindit Mukherjee
    Affiliations
    Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261
    Search for articles by this author
  • Zhijian Wang
    Affiliations
    Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261
    Search for articles by this author
  • Carol L. Kinlough
    Affiliations
    Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261
    Search for articles by this author
  • Paul A. Poland
    Affiliations
    Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261
    Search for articles by this author
  • Allison L. Marciszyn
    Affiliations
    Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261
    Search for articles by this author
  • Nicolas Montalbetti
    Affiliations
    Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261
    Search for articles by this author
  • Marcelo D. Carattino
    Affiliations
    Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261

    Department of Cell Biology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261
    Search for articles by this author
  • Michael B. Butterworth
    Affiliations
    Department of Cell Biology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261
    Search for articles by this author
  • Thomas R. Kleyman
    Correspondence
    To whom correspondence should be addressed: A919 Scaife Hall, 3550 Terrace St., Renal-Electrolyte Division, Dept. of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261. Tel.: 412-647-3121; .
    Affiliations
    Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261

    Department of Cell Biology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261

    Department of Pharmacology and Chemical Biology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261
    Search for articles by this author
  • Rebecca P. Hughey
    Affiliations
    Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261

    Department of Cell Biology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261
    Search for articles by this author
  • Author Footnotes
    * This work was supported by National Institutes of Health Grants R01 DK065161 (to T. R. K. and R. P. H.), R37 DK051391 (to T. R. K.), R01 DK102843 (to M. B. B.), and P30 DK079307 (to T. R. K.). The authors declare that they have no conflicts of interest with the contents of this article. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
    2 The abbreviations used are: ENaCepithelial sodium channelASDNaldosterone-sensitive distal nephronCCDcortical collecting ductDHHCpalmitoyltransferase2-BP2-bromopalmitateANOVAanalysis of varianceFRTFischer rat thyroidTERtransepithelial resistanceERendoplasmic reticulumIPimmunoprecipitatePFAparaformaldehyde.
Open AccessPublished:January 30, 2017DOI:https://doi.org/10.1074/jbc.M117.776146
      The epithelial sodium channel (ENaC) has an important role in regulating extracellular fluid volume and blood pressure, as well as airway surface liquid volume and mucociliary clearance. ENaC is a trimer of three homologous subunits (α, β, and γ). We previously reported that cytoplasmic residues on the β (βCys-43 and βCys-557) and γ (γCys-33 and γCys-41) subunits are palmitoylated. Mutation of Cys that blocked ENaC palmitoylation also reduced channel open probability. Furthermore, γ subunit palmitoylation had a dominant role over β subunit palmitoylation in regulating ENaC. To determine which palmitoyltransferases (termed DHHCs) regulate the channel, mouse ENaCs were co-expressed in Xenopus oocytes with each of the 23 mouse DHHCs. ENaC activity was significantly increased by DHHCs 1, 2, 3, 7, and 14. ENaC activation by DHHCs was lost when γ subunit palmitoylation sites were mutated, whereas DHHCs 1, 2, and 14 still activated ENaC lacking β subunit palmitoylation sites. β subunit palmitoylation was increased by ENaC co-expression with DHHC 7. Both wild type ENaC and channels lacking β and γ palmitoylation sites co-immunoprecipitated with the five activating DHHCs, suggesting that ENaC forms a complex with multiple DHHCs. RT-PCR revealed that transcripts for the five activating DHHCs were present in cultured mCCDcl1 cells, and DHHC 3 was expressed in aquaporin 2-positive principal cells of mouse aldosterone-sensitive distal nephron where ENaC is localized. Treatment of polarized mCCDcl1 cells with a general inhibitor of palmitoylation reduced ENaC-mediated Na+ currents within minutes. Our results indicate that specific DHHCs have a role in regulating ENaC.

      Introduction

      ENaCs
      The abbreviations used are: ENaC
      epithelial sodium channel
      ASDN
      aldosterone-sensitive distal nephron
      CCD
      cortical collecting duct
      DHHC
      palmitoyltransferase
      2-BP
      2-bromopalmitate
      ANOVA
      analysis of variance
      FRT
      Fischer rat thyroid
      TER
      transepithelial resistance
      ER
      endoplasmic reticulum
      IP
      immunoprecipitate
      PFA
      paraformaldehyde.
      are amiloride-sensitive Na+ channels that are found in high resistance epithelia and other tissues. In the aldosterone-sensitive distal nephron (ASDN), ENaC-dependent Na+ transport has an important role in the maintenance of extracellular fluid volume and blood pressure, as well as extracellular K+ homeostasis. In the lung, ENaC has a role in regulating airway surface fluid volume, mucociliary clearance, and alveolar fluid volume (
      • Rossier B.C.
      • Stutts M.J.
      Activation of the epithelial sodium channel (ENaC) by serine proteases.
      ,
      • Kashlan O.B.
      • Kleyman T.R.
      Epithelial Na+ channel regulation by cytoplasmic and extracellular factors.
      ,
      • Kellenberger S.
      • Schild L.
      International Union of Basic and Clinical Pharmacology: XCI. structure, function, and pharmacology of acid-sensing ion channels and the epithelial Na+ channel.
      ). The channels are composed of three homologous subunits (termed α, β, and γ), each with two transmembrane domains, a large extracellular loop and cytoplasmic N and C termini (
      • Kellenberger S.
      • Schild L.
      International Union of Basic and Clinical Pharmacology: XCI. structure, function, and pharmacology of acid-sensing ion channels and the epithelial Na+ channel.
      ,
      • Canessa C.M.
      • Merillat A.M.
      • Rossier B.C.
      Membrane topology of the epithelial sodium channel in intact cells.
      ,
      • Kashlan O.B.
      • Kleyman T.R.
      ENaC structure and function in the wake of a resolved structure of a family member.
      ).
      ENaCs are regulated by signaling pathways that modulate its membrane trafficking, residency on the plasma membrane, and degradation (
      • Bhalla V.
      • Hallows K.R.
      Mechanisms of ENaC regulation and clinical implications.
      ,
      • Eaton D.C.
      • Malik B.
      • Bao H.F.
      • Yu L.
      • Jain L.
      Regulation of epithelial sodium channel trafficking by ubiquitination.
      ,
      • Ronzaud C.
      • Staub O.
      Ubiquitylation and control of renal Na+ balance and blood pressure.
      ). ENaCs are also regulated by a variety of extracellular factors that affect its open probability (Po). These include extracellular cations (H+, Na+, and other metals), anions (Cl), laminar shear stress, and proteases that cleave ENaC subunits at specific sites and release embedded inhibitory tracts (
      • Rossier B.C.
      • Stutts M.J.
      Activation of the epithelial sodium channel (ENaC) by serine proteases.
      ,
      • Kashlan O.B.
      • Kleyman T.R.
      Epithelial Na+ channel regulation by cytoplasmic and extracellular factors.
      ,
      • Sheng S.
      • Bruns J.B.
      • Kleyman T.R.
      Extracellular histidine residues crucial for Na+ self-inhibition of epithelial Na+ channels.
      ,
      • Collier D.M.
      • Snyder P.M.
      Extracellular protons regulate human ENaC by modulating Na+ self-inhibition.
      ,
      • Collier D.M.
      • Snyder P.M.
      Extracellular chloride regulates the epithelial sodium channel.
      ,
      • Hughey R.P.
      • Mueller G.M.
      • Bruns J.B.
      • Kinlough C.L.
      • Poland P.A.
      • Harkleroad K.L.
      • Carattino M.D.
      • Kleyman T.R.
      Maturation of the epithelial Na+ channel involves proteolytic processing of the α- and γ-subunits.
      ,
      • Hughey R.P.
      • Bruns J.B.
      • Kinlough C.L.
      • Harkleroad K.L.
      • Tong Q.
      • Carattino M.D.
      • Johnson J.P.
      • Stockand J.D.
      • Kleyman T.R.
      Epithelial sodium channels are activated by furin-dependent proteolysis.
      ,
      • Ergonul Z.
      • Frindt G.
      • Palmer L.G.
      Regulation of maturation and processing of ENaC subunits in the rat kidney.
      ). Intracellular phosphorylation, inositol phospholipids, and cytoplasmic Cys palmitoylation also regulate ENaC Po (
      • Ma H.P.
      • Chou C.F.
      • Wei S.P.
      • Eaton D.C.
      Regulation of the epithelial sodium channel by phosphatidylinositides: experiments, implications, and speculations.
      ,
      • Yang L.M.
      • Rinke R.
      • Korbmacher C.
      Stimulation of the epithelial sodium channel (ENaC) by cAMP involves putative ERK phosphorylation sites in the C termini of the channel's β- and γ-subunit.
      ,
      • Pochynyuk O.
      • Tong Q.
      • Medina J.
      • Vandewalle A.
      • Staruschenko A.
      • Bugaj V.
      • Stockand J.D.
      Molecular determinants of PI(4,5)P2 and PI(3,4,5)P3 regulation of the epithelial Na+ channel.
      ,
      • Pochynyuk O.
      • Tong Q.
      • Staruschenko A.
      • Ma H.P.
      • Stockand J.D.
      Regulation of the epithelial Na+ channel (ENaC) by phosphatidylinositides.
      ,
      • Pochynyuk O.
      • Bugaj V.
      • Stockand J.D.
      Physiologic regulation of the epithelial sodium channel by phosphatidylinositides.
      ,
      • Mueller G.M.
      • Maarouf A.B.
      • Kinlough C.L.
      • Sheng N.
      • Kashlan O.B.
      • Okumura S.
      • Luthy S.
      • Kleyman T.R.
      • Hughey R.P.
      Cys palmitoylation of the β subunit modulates gating of the epithelial sodium channel.
      ,
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ).
      Cys palmitoylation of soluble and transmembrane proteins is a reversible post-translational modification that increases protein surface hydrophobicity, facilitating interactions with membranes and/or other proteins (
      • Shipston M.J.
      Ion channel regulation by protein palmitoylation.
      ,
      • Nadolski M.J.
      • Linder M.E.
      Protein lipidation.
      ,
      • Linder M.E.
      • Deschenes R.J.
      Palmitoylation: policing protein stability and traffic.
      ,
      • Yeste-Velasco M.
      • Linder M.E.
      • Lu Y.J.
      Protein S-palmitoylation and cancer.
      ,
      • Chamberlain L.H.
      • Shipston M.J.
      The physiology of protein S-acylation.
      ). Although there is no simple consensus sequence for palmitoylation, algorithms predict that more than 50% of human ion channels are palmitoylated (for reviews, see Refs.
      • Shipston M.J.
      Ion channel regulation by protein palmitoylation.
      ,
      • Chamberlain L.H.
      • Shipston M.J.
      The physiology of protein S-acylation.
      , and
      • Fukata Y.
      • Murakami T.
      • Yokoi N.
      • Fukata M.
      Local palmitoylation cycles and specialized membrane domain organization.
      ). Published studies have provided evidence for palmitoylation of numerous voltage-gated channels (e.g. NaV1.2, CaVβ2a, and KV1.1), ligand-gated channels (e.g. NMDA, P2X7, and GABAA), Ca2+-activated K+ channels (e.g. BK), and non-gated channels (e.g. AQP4, connexin, and ENaC) (
      • Mueller G.M.
      • Maarouf A.B.
      • Kinlough C.L.
      • Sheng N.
      • Kashlan O.B.
      • Okumura S.
      • Luthy S.
      • Kleyman T.R.
      • Hughey R.P.
      Cys palmitoylation of the β subunit modulates gating of the epithelial sodium channel.
      ,
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ,
      • Tian L.
      • Jeffries O.
      • McClafferty H.
      • Molyvdas A.
      • Rowe I.C.
      • Saleem F.
      • Chen L.
      • Greaves J.
      • Chamberlain L.H.
      • Knaus H.G.
      • Ruth P.
      • Shipston M.J.
      Palmitoylation gates phosphorylation-dependent regulation of BK potassium channels.
      ,
      • Stephens G.J.
      • Page K.M.
      • Bogdanov Y.
      • Dolphin A.C.
      The α1B Ca2+ channel amino terminus contributes determinants for β subunit-mediated voltage-dependent inactivation properties.
      ,
      • Locke D.
      • Koreen I.V.
      • Harris A.L.
      Isoelectric points and post-translational modifications of connexin26 and connexin32.
      ,
      • Jindal H.K.
      • Folco E.J.
      • Liu G.X.
      • Koren G.
      Posttranslational modification of voltage-dependent potassium channel Kv1.5: COOH-terminal palmitoylation modulates its biological properties.
      ,
      • Crane J.M.
      • Verkman A.S.
      Reversible, temperature-dependent supramolecular assembly of aquaporin-4 orthogonal arrays in live cell membranes.
      ). The loss of palmitoylation altered channel function by various mechanisms, including effects on channel biogenesis, stability, membrane trafficking, surface expression, and gating.
      Using a fatty acid-biotin exchange assay, we found that the β and γ subunits of mouse and human ENaC were Cys palmitoylated, whereas the α subunit was not (
      • Mueller G.M.
      • Maarouf A.B.
      • Kinlough C.L.
      • Sheng N.
      • Kashlan O.B.
      • Okumura S.
      • Luthy S.
      • Kleyman T.R.
      • Hughey R.P.
      Cys palmitoylation of the β subunit modulates gating of the epithelial sodium channel.
      ,
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ,
      • Mueller G.M.
      • Yan W.
      • Copelovitch L.
      • Jarman S.
      • Wang Z.
      • Kinlough C.L.
      • Tolino M.A.
      • Hughey R.P.
      • Kleyman T.R.
      • Rubenstein R.C.
      Multiple residues in the distal C terminus of the α-subunit have roles in modulating human epithelial sodium channel activity.
      ). Sites of cytoplasmic Cys palmitoylation included βCys-43 and βCys-557 in the N and C termini of the mouse β subunit, respectively, as well as γCys-33 and γCys-41 in the N terminus of the γ subunit (
      • Mueller G.M.
      • Maarouf A.B.
      • Kinlough C.L.
      • Sheng N.
      • Kashlan O.B.
      • Okumura S.
      • Luthy S.
      • Kleyman T.R.
      • Hughey R.P.
      Cys palmitoylation of the β subunit modulates gating of the epithelial sodium channel.
      ,
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ). Mutation of specific Cys palmitoylation sites to Ala reduced channel activity, whereas membrane trafficking and subunit proteolysis associated with activation were unchanged (
      • Mueller G.M.
      • Maarouf A.B.
      • Kinlough C.L.
      • Sheng N.
      • Kashlan O.B.
      • Okumura S.
      • Luthy S.
      • Kleyman T.R.
      • Hughey R.P.
      Cys palmitoylation of the β subunit modulates gating of the epithelial sodium channel.
      ,
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ). Cell-attached patch clamp analyses of Xenopus oocytes expressing channels with subunits lacking selected palmitoylation sites (αβC43A,C557Aγ or αβγC33A,C41A) revealed a significantly reduced Po, when compared with wild type ENaC, indicating that palmitoylation affected channel gating (
      • Mueller G.M.
      • Maarouf A.B.
      • Kinlough C.L.
      • Sheng N.
      • Kashlan O.B.
      • Okumura S.
      • Luthy S.
      • Kleyman T.R.
      • Hughey R.P.
      Cys palmitoylation of the β subunit modulates gating of the epithelial sodium channel.
      ,
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ). Comparison of the activities of channels lacking palmitoylation of one or both subunits (αβC43A,C557Aγ, αβγC33A,C41A, or αβC43A,C557A γC33A,C41A) showed that γ subunit palmitoylation had a dominant role in modulating ENaC activity (
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ).
      Protein palmitoylation is catalyzed by a family of 23 mammalian palmitoyltransferases that exhibit four or more transmembrane domains and a highly conserved cysteine-rich domain adjacent to a DHHC tract (Asp-His-His-Cys) within the active site of the enzyme (
      • Gorleku O.A.
      • Barns A.M.
      • Prescott G.R.
      • Greaves J.
      • Chamberlain L.H.
      Endoplasmic reticulum localization of DHHC palmitoyltransferases mediated by lysine-based sorting signals.
      ,
      • Fukata M.
      • Fukata Y.
      • Adesnik H.
      • Nicoll R.A.
      • Bredt D.S.
      Identification of PSD-95 palmitoylating enzymes.
      ). These palmitoyltransferases, referred to as DHHCs, differ in their relative size and in their cytoplasmic N and C termini, which exhibit protein-interacting motifs such as PDZ-binding domains or ankyrin repeats that likely have roles in subcellular localization and conferring substrate specificity (
      • Iwanaga T.
      • Tsutsumi R.
      • Noritake J.
      • Fukata Y.
      • Fukata M.
      Dynamic protein palmitoylation in cellular signaling.
      ,
      • Smotrys J.E.
      • Linder M.E.
      Palmitoylation of intracellular signaling proteins: regulation and function.
      ). We previously reported that DHHC 2 co-immunoprecipitates with ENaC when co-expressed in Madin-Darby canine kidney cells and that DHHC 2 enhances ENaC activity by 2.5-fold when co-expressed in Xenopus oocytes (
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ). Although ENaCs lacking β subunit palmitoylation had reduced activation by DHHC 2, ENaCs lacking γ subunit palmitoylation were not activated by DHHC 2 (
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ), consistent with the concept that γ subunit palmitoylation has a dominant role controlling ENaC Po. In the current study, we examined whether ENaC is regulated by any other of the 23 known DHHCs. We identified five that activate and co-immunoprecipitate with ENaC and three that enhance ENaC activity in a γ subunit-specific manner.

      Results

      Five DHHCs Activate ENaC and Co-immunoprecipitate with the Channel

      To identify ENaC-activating DHHCs, the 23 mouse DHHCs with N-terminal HA epitope tags were individually co-expressed with wild type mouse αβγ ENaC in Xenopus oocytes. Amiloride-sensitive currents were measured after 36–48 h. Five DHHCs (DHHCs 1, 2, 3, 7, and 14) significantly increased ENaC activity ∼2-fold (ranging from 1.7 ± 0.9 to 2.5 ± 1.5-fold (means ± S.D.), p < 0.01, by one-way ANOVA), whereas the remaining 18 did not significantly alter ENaC activity (Fig. 1A). Because the expression levels of the 23 DHHCs have been variable when expressed in mammalian cells (
      • Greaves J.
      • Salaun C.
      • Fukata Y.
      • Fukata M.
      • Chamberlain L.H.
      Palmitoylation and membrane interactions of the neuroprotective chaperone cysteine-string protein.
      ,
      • Fukata Y.
      • Iwanaga T.
      • Fukata M.
      Systematic screening for palmitoyl transferase activity of the DHHC protein family in mammalian cells.
      ), we also assessed their expression in Xenopus oocytes by immunoblotting extracts of oocytes injected with cRNA encoding individual HA-DHHCs. Extracts of oocytes were subjected to immunoblotting with anti-HA antibodies and revealed bands of the expected size for each DHHC, except DHHC 21, although the β-actin signal by immunoblotting was relatively uniform for all the samples (Fig. 1B). The strongest signals were observed for DHHCs 7, 9, 14, and 25, but of these, only DHHC 7 and 14 were found to activate ENaC when co-expressed. Increased amounts of cRNA were required to obtain signals for DHHCs 4, 8, 11, and 13. Also, longer exposure of the immunoblot to film was needed to obtain signals for DHHCs 4, 6, 11, 20, and 23 (Fig. 1C).
      Figure thumbnail gr1
      FIGURE 1ENaC is activated by specific DHHCs when co-expressed in Xenopus oocytes. A, oocytes were injected with cRNAs for wild type αβγ alone (NA, no addition) or with one of the 23 DHHCs with an N-terminal HA epitope tag as indicated (numbered 1–25). Amiloride-sensitive currents were measured 36–48 h after cRNA injection (n = 11–50) and normalized to currents of wild type αβγ each day. The data are presented as box and whisker plots, with wild type αβγ set as 1 (n = 378, dashed line). Significant increases were found for DHHCs 1, 2, 3, 7, and 14 (gray boxes) (n = 17–24) when compared with αβγ expressed alone (p < 0.01, determined with one-way ANOVA followed by a Tukey test). Whiskers indicate the 10th and 90th percentiles. Median is indicated by a horizontal line, and the mean is indicated with a dot symbol within each box. B and C, oocytes were injected with cRNAs for each of the 23 HA-DHHCs or no DHHC (−), and detergent extracts of oocytes were subjected to SDS-PAGE and immunoblotting with anti-HA antibodies conjugated to HRP or anti-β-actin antibodies (as loading control). A band of the expected size (formula weight in kDa beneath each lane) was observed for all the DHHCs except DHHC 21. A representative immunoblot is shown in B, and a longer exposure is shown in C to enhance the faint signals for DHHCs 4, 6, 11, 20, and 23. The mobility of the Bio-Rad Precision Plus protein standards is shown to the left of each blot.
      To determine whether ENaC palmitoylation was increased when the channel was co-expressed with an activating DHHC, we transfected HEK293 cells with cDNA for ENaC including a β subunit with a C-terminal V5 epitope tag, in the presence or absence of DHHC 7. Palmitoylation of the β subunit was assessed with fatty acid exchange chemistry where palmitate is removed from Cys with hydroxylamine treatment, using Tris treatment as a negative control, and replaced with biotin as previously described (
      • Mueller G.M.
      • Maarouf A.B.
      • Kinlough C.L.
      • Sheng N.
      • Kashlan O.B.
      • Okumura S.
      • Luthy S.
      • Kleyman T.R.
      • Hughey R.P.
      Cys palmitoylation of the β subunit modulates gating of the epithelial sodium channel.
      ,
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ). We observed a significant 2.4-fold increase in β subunit palmitoylation when the channel was co-expressed with DHHC 7 (7.7% ± 2.6 (− DHHC 7) versus 18.7% ± 7.4 (+ DHHC 7), means ± S.D., p < 0.05) (Fig. 2).
      Figure thumbnail gr2
      FIGURE 2Palmitoylation of ENaC is increased by co-expression with the activating DHHC 7. HEK293 cells were transfected with αβγ ENaC with a C-terminal V5 epitope tag on the β subunit, with or without the activating DHHC 7 as indicated. Cys palmitoylation of the β subunit in anti-V5 IPs was assessed with fatty acid exchange chemistry where palmitate is removed from Cys with hydroxylamine treatment, using Tris treatment as a negative control, and replaced with biotin. A fraction of the IP (10%) was reserved to assess total β subunit in the initial IP, and biotinylated β subunit was recovered with avidin-conjugated beads (90%) for immunoblotting (IB) with anti-V5 antibodies. The percentage of palmitoylation was calculated from the difference in β subunit biotinylation after treatment with hydroxylamine (+) or Tris (−), relative to the β subunit recovered in the total IP. A, the percentage of β palmitoylation (means and S.D.) in the presence (n = 3, white bar and open circles) or absence (n = 4, black bar and closed circles) of DHHC 7 was statistically significantly different by Student's t test (p < 0.05). B, a representative immunoblot from a single experiment is shown, with the mobility of Bio-Rad Precision Plus protein standards to the right of each panel.
      To determine whether the five activating DHHCs associate with ENaC within a protein complex, we co-expressed αβγ (all subunits with C-terminal V5 tags) and individual DHHCs (DHHC 1, 2, 3, 7, or 14) bearing N-terminal GFP in Fischer rat thyroid (FRT) cells. Cell extracts were immunoprecipitated with anti-V5 antibodies and immunoblotted with anti-GFP antibodies. We found that each of the five DHHCs co-immunoprecipitated with ENaC (Fig. 3, A and B). V5-tagged channels bearing mutations of the four palmitoylation sites (αβCys43,557AγCys33,41A) also co-immunoprecipitated with the five palmitoyltransferases (Fig. 3, A and B). Based on the intensity of the bands, the most robust co-immunoprecipitating DHHCs were 1 and 7. These results also confirmed our previous findings that DHHC 2 activated and co-immunoprecipitated with ENaC (
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ). The blots were also reprobed with anti-V5 antibodies and showed similar band intensities of the three V5-tagged ENaC subunits (Fig. 3C), indicating that variations in DHHC co-immunoprecipitation were not due to differential expression or immunoprecipitation of ENaC. Anti-V5 immunoprecipitates from FRT cells expressing the five GFP-DHHCs in the absence of αβγENaC revealed no signal on an immunoblot for DHHCs 2, 3, 7, and 14 but a faint signal for DHHC 1 (Fig. 3, D and E). However, the signal for DHHC 1 in the anti-V5 immunoprecipitates was consistently enhanced by co-expression with V5-tagged αβγENaC (Fig. 3E). Interestingly, we also found that non-activating DHHC 11 and 23 were also present in anti-V5 immunoprecipitates when co-expressed with V5-tagged αβγENaC (Fig. 3, F and G), suggesting that the non-activating DHHCs may also be in complex with the activating DHHCs. Complexes of multiple DHHCs have been previously reported (
      • Fang C.
      • Deng L.
      • Keller C.A.
      • Fukata M.
      • Fukata Y.
      • Chen G.
      • Lüscher B.
      GODZ-mediated palmitoylation of GABA(A) receptors is required for normal assembly and function of GABAergic inhibitory synapses.
      ).
      Figure thumbnail gr3
      FIGURE 3ENaC co-immunoprecipitates with the five activating DHHCs. FRT cells were transfected with WT αβγ ENaC or ENaC with mutant subunits lacking sites for palmitoylation (αβCys43,557AγCys33,41A) either alone (−) or with DHHC 1, 2, 3, 7, or 14 as indicated. All DHHCs had an N-terminal GFP epitope-tag and all three ENaC subunits had a C-terminal V5 epitope tag. A, an aliquot of the cell extract (10% total extract) was retained for immunoblotting (IB) with anti-GFP antibodies. B, the remainder was incubated with anti-V5 antibodies. Total extract and IPs were subjected to immunoblotting with anti-GFP antibodies. C, immunoblots of the IP were stripped and probed with anti-V5 antibodies to assess expression of αβγ ENaC subunits. Mobility of Bio-Rad Precision Plus protein standards is indicated on the right of each blot. The co-immunoprecipitating DHHCs are noted in B with an arrowhead and correspond to the predicted Mr for GFP-tagged DHHC1 (77,978), DHHC2 (66,981), DHHC3 (59,041), DHHC7 (60,213), and DHHC14 (78,658). A nonspecific (ns) band was present in all lanes as indicated in B. The results are representative of three independent experiments. D and E, FRT cells expressing GFP-tagged DHHC 1, 2, 3, 7, and 14 were expressed in the absence of ENaC, whereas ENaC with three V5-tagged subunits was expressed alone (−) or with DHHC 1. Total cell extract (D) and anti-V5 IPs (E) were subjected to immunoblotting with anti-GFP antibodies. Note that the signal for DHHC1 in the IP was greatly enhanced by co-expression of ENaC (E). F and G, ENaC with a V5-tagged α subunit was co-expressed in FRT cells alone (−), with an HA-tagged activating DHHC (DHHC 7), or with an HA-tagged non-activating DHHC (DHHC 11 or 23). Cell extracts (F) and anti-V5 IPs (G) were immunoblotted with anti-HA antibodies conjugated to HRP. The results are representative of three independent experiments.

      Palmitoylation of the β and γ Subunits Are Necessary for Full DHHC-mediated ENaC Activation

      We previously reported that channels with mutations that block γ subunit palmitoylation (or both β and γ subunit palmitoylation) are not activated by DHHC 2, whereas channels that lack β subunit palmitoylation sites are activated by DHHC 2 (
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ). These results suggested that there was a degree of subunit specificity regarding channel activation by DHHC 2. We examined whether the other ENaC-activating DHHCs exhibited subunit specificity regarding channel activation. ENaCs lacking palmitoylation sites on either the β subunit, the γ subunit, or both subunits were expressed in oocytes with or without DHHC 1, 2, 3, 7, or 14. As expected, ENaCs lacking β and γ subunit palmitoylation sites (αβCys43,557AγCys33,41A) were not activated by these five DHHCs (Fig. 4A). Furthermore, ENaCs lacking γ subunit palmitoylation sites (αβγC33A,C41A) were not activated by the five DHHCs (Fig. 4B). However, channels lacking β subunit palmitoylation sites (αβC43A,C557Aγ) were significantly activated by DHHCs 1, 2, and 14 but not by DHHCs 3 and 7 (Fig. 4C). These data suggest that ENaC activation by DHHCs 1, 2, and 14 requires Cys palmitoylation of the γ subunit, whereas channel activation by DHHCs 3 and 7 requires Cys palmitoylation of both subunits. These data are also consistent with our earlier results suggesting that γ subunit palmitoylation has a dominant role in activating ENaC (
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ).
      Figure thumbnail gr4
      FIGURE 4ENaC-activating DHHCs exhibit β and γ subunit specificity. Xenopus oocytes were injected with cRNAs for wild type αβγ or mutant ENaCs lacking sites for palmitoylation on both subunits (αβCys43,557AγCys33,41A) (A), the γ subunit (αβγC33A,C41A) (B), or the β subunit (αβC43A,C557Aγ) (C). Mutant ENaCs were expressed alone (NA, no addition, n = 77–98) or co-expressed with DHHCs 1, 2, 3, 7, or 14 as indicated (n = 11–33). Amiloride-sensitive currents were measured 48 h after cRNA injection and normalized to wild type αβγ currents each day. The data are presented as box and whisker plots, with wild type αβγ set as 1 (dashed line, n = 73–115). Co-expression of DHHCs with ENaC lacking palmitoylation sites on both the β and γ subunit (A) or just the γ subunit (B) did not affect channel activity (p > 0.05 versus NA). C, co-expression of DHHCs 1, 2, or 14 with ENaC lacking β subunit palmitoylation sites significantly activated the channel (gray boxes) (p < 0.01 for DHHC 1 or 2 versus NA, p < 0.05 for DHHC14 versus NA, determined with one-way ANOVA followed by a Tukey test). Whiskers indicate the 10th and 90th percentiles. The median is indicated by a horizontal line, and the mean is indicated with a cross symbol within each bar.

      ENaC-activating DHHC 3 Is Expressed in the ASDN of the Kidney

      ENaC is expressed in the latter aspects of the ASDN. Deep sequencing of dissected rat renal tubules indicated that 18 DHHCs are expressed in the ASDN, including the five ENaC-activating DHHCs (
      • Lee J.W.
      • Chou C.L.
      • Knepper M.A.
      Deep sequencing in microdissected renal tubules identifies nephron segment-specific transcriptomes.
      ). We examined whether an ENaC-activating DHHC (DHHC 3) is expressed in principal cells of the mouse ASDN, where ENaC and aquaporin 2 are localized. We carried out immunofluorescence confocal microscopy with a rabbit anti-DHHC 3 antibody and a goat anti-aquaporin 2 antibody in paraformaldehyde (PFA)-fixed mouse kidney sections (Fig. 5, A–C). We observed staining with the two antibodies in the same cells, indicating that intracellular DHHC 3 is expressed in principal cells in mouse ASDN. DHHC 3 was also observed in adjacent aquaporin 2-negative cells, consistent with DHHC 3 expression in the intercalated cells of the ASDN. Notably, anti-DHHC 3 antibody staining was blocked by preincubation with the antigenic peptide (Fig. 5B). DHHC3 intracellular expression in principal cells was distinctly subapical, consistent with localization in intracellular vesicles (Fig. 5C). The anti-DHHC 3 antibody was also validated by immunoblot of extracts from FRT cells after transfection with the cDNA for either GFP or GFP-DHHC 3. We observed only a single band in the GFP transfected cells corresponding to the expected size of the endogenous DHHC 3 (Mr = 34 kDa) and a second band in the GFP-DHHC 3 transfected cells corresponding to the expected size of the GFP-tagged protein (62 kDa) (Fig. 5D). We also observed a single band in an immunoblot of kidney homogenates from three individual mice at a size expected for the mouse DHHC 3 (Mr = 34 kDa) that was blocked by antibody preincubation with the antigenic peptide (Fig. 5E).
      Figure thumbnail gr5
      FIGURE 5ENaC-activating DHHC 3 is expressed in mouse kidney ASDN. A, mouse kidneys were fixed in PFA, and cryosections were incubated with goat anti-aquaporin 2 antibodies as a marker of principal cells in the ASDN and rabbit anti-DHHC 3 antibodies, followed by a FITC-tagged anti-goat antibody (green) and a Cy3-tagged anti-rabbit antibody (red). Nuclei were counterstained with TO-PRO 3 (blue). B, preincubation of the anti-DHHC 3 antibody with the antigenic peptide selectively prevented staining (red) without interfering with staining for aquaporin 2 (green). Slides were imaged by confocal microscopy as described under “Experimental Procedures.” The white bar in the merged images is 10 μm. The results are representative of three independent experiments. C, the yellow box in the Merge panel in A is enlarged to emphasize the subapical intracellular staining for DHHC3 in principal cells with apical aquaporin 2 staining. Further validation of the anti-DHHC3 antibody is shown in D and E. D, FRT cells were transfected with either GFP or GFP-DHHC3, and cell extracts were immunoblotted (IB) with anti-DHHC3 antibodies. Bands for the endogenous DHHC 3 (34 kDa) and the transfected GFP-DHHC 3 (62 kDa) are indicated to the right of the panel. E, kidneys from three different mice were homogenized, and duplicate aliquots were immunoblotted with anti-DHHC 3 antibody preincubated with or without the antigenic peptide. D and E, blots were stripped and probed with anti-β-actin antibodies as a loading control. The mobility of the Bio-Rad Precision Plus protein standards is shown to the left of each panel.

      Palmitoylation Inhibitor 2-Bromopalmitate Blunts Transepithelial Na+ Transport in mCCDcl1 Cells

      We examined whether the five ENaC-activating DHHCs were expressed in cultures of a mouse CCD cell line (mCCDcl1 cells). Using RT-PCR, we identified amplified DNAs representing the expected size for all of the ENaC-activating DHHCs (1, 2, 3, 7, and 14) (Fig. 6). To determine whether palmitoylation has a role in activating endogenous ENaCs in mCCDcl1 cells, we treated polarized cultures of mCCDcl1 cells mounted in an Ussing chamber with either 2-bromopalmitate (2-BP), a general irreversible inhibitor of protein palmitoylation, or DMSO (vehicle control) (
      • Jennings B.C.
      • Nadolski M.J.
      • Ling Y.
      • Baker M.B.
      • Harrison M.L.
      • Deschenes R.J.
      • Linder M.E.
      2-Bromopalmitate and 2-(2-hydroxy-5-nitro-benzylidene)-benzo[b]thiophen-3-one inhibit DHHC-mediated palmitoylation in vitro.
      ,
      • Szkudelski T.
      • Szkudelska K.
      Short-term effects of palmitate and 2-bromopalmitate on the lipolytic activity of rat adipocytes.
      ,
      • Davda D.
      • El Azzouny M.A.
      • Tom C.T.
      • Hernandez J.L.
      • Majmudar J.D.
      • Kennedy R.T.
      • Martin B.R.
      Profiling targets of the irreversible palmitoylation inhibitor 2-bromopalmitate.
      ). We observed a significant decrease in short circuit current (Isc) within 5 min after apical addition of 2-BP that reached a new steady state Isc after 30 min (Fig. 7, A and B). The amiloride-sensitive Isc was 46.2 ± 7.2 μA/cm2 (n = 9) in vehicle-treated cells and 10.1 ± 3.2 μA/cm2 (n = 9) in 2-BP-treated cells (p < 0.001, by one-way ANOVA followed by a Tukey post hoc test). 2-BP treatment resulted in a significant decrease in transepithelial resistance (TER) after 30 min (pretreatment, 15.8 ± 2.4 kΩ × cm2 (n = 5, mean ± S.D.) versus post treatment, 2.9 ± 0.9 kΩ × cm2 (n = 5), p < 0.01, by one-way ANOVA followed by a Tukey post hoc test), whereas vehicle treatment increased resistance after 30 min (pretreatment, 17.2 ± 5.4 kΩ × cm2 (n = 6) versus post-treatment 21.9 ± 7.9 kΩ × cm2 (n = 6), p < 0.01, by one-way ANOVA followed by a Tukey post hoc test), suggesting that 2-BP is modifying tight junctions (Fig. 7, A and C). Apical treatment of mCCDcl1 cells with amphotericin B after amiloride washout acutely increased Isc in both vehicle-treated and 2-BP-treated cells (peak current was 87.6 ± 27.4 μA/cm2 for vehicle control (n = 6) and 37.5 ± 9.5 μA/cm2 for 2-BP-treated (n = 5), p < 0.01, by unpaired one-way ANOVA followed by a Tukey post hoc test), indicating that the 2-BP cells were viable (Fig. 7A). Steady state Isc following amphotericin addition for vehicle-treated and 2-BP-treated cells were similar (38.3 ± 10.8 μA/cm2 for vehicle-treated versus 34.6 ± 9.8 μA/cm2 for 2-BP treated, (n = 6), p > 0.05 by unpaired Student's t test).
      Figure thumbnail gr6
      FIGURE 6Transcripts for ENaC-activating DHHCs are expressed in mCCDcl1 cells. Single-stranded cDNA was generated from total RNA isolated from cultures of mCCDcl1 cells using reverse transcriptase (+ RT) and amplified using PCR with primer pairs specific for mouse DHHC 1, 2, 3, 7, or 14 that span at least one intron. The reactions without RT (−) were analyzed with PCR as a negative control. An aliquot of each PCR was analyzed on a 1% agarose gel as indicated and corresponded to the expected size of the amplified fragments (474 bp for DHHC1, 475 bp for DHHC2, 453 bp for DHHC3, 541 bp for DHHC7, and 420 bp for DHHC 14). A nonspecific band in the − RT lane for DHHC2 is noted by (>) and corresponds to the expected size of a product overlapping an intron. Mobility of lambda (λ) DNA digested with HindIII (562 bp) and low DNA mass ladder markers (LM, 200, 400, 800, and 1600 bp) are indicated on the left of the gel as standards (std, from Invitrogen). The results are representative of three independent experiments.
      Figure thumbnail gr7
      FIGURE 7ENaC activity in mCCDcl1 cells is reduced by an inhibitor of palmitoylation. A, polarized cultures of mCCDcl1 cells growing on permeable supports were placed in a Ussing chamber. Isc was monitored before and for 30 min after apical addition of DMSO (vehicle (1:2,000 dilution), top profile) or 25 μm 2-BP (bottom profile). The ENaC-dependent components of the Isc were determined by the addition of apical amiloride (Amil, 10 μm). After washing out amiloride, the integrity of the epithelium was assessed by apical addition of amphotericin B (120 μg/ml). B, amiloride-sensitive Isc (Iamil) prior to addition of DMSO or 2-BP (control) was compared with that of DMSO-treated (vehicle) and 2-BP-treated cells. The experiment was carried out 5–9 times, and the data are presented as box and whisker plots (gray box, p < 0.001 versus control, by one-way ANOVA). C, TER of pretreated cells of each group (Pre) was compared with that of cells at the end of 30 min treatment (Post) with either DMSO (vehicle) or 2-BP (gray boxes). p < 0.01, one-way ANOVA versus pretreatment control. Whiskers indicate the 10th and 90th percentiles. Median is indicated by a horizontal line, and the mean is indicated with a cross symbol within each box.

      Discussion

      Results from numerous studies indicate that ∼400 proteins in mammalian cells and tissues are palmitoylated. The identification of palmitoylated proteins has been a slow process. The first acylated proteins were described in 1979, whereas the first global analysis of palmitoylated yeast proteins and palmitoylated rat brain synaptosomal proteins were performed in 2006 and 2008, respectively (
      • Schmidt M.F.
      • Bracha M.
      • Schlesinger M.J.
      Evidence for covalent attachment of fatty acids to Sindbis virus glycoproteins.
      ,
      • Schmidt M.F.
      • Schlesinger M.J.
      Fatty acid binding to vesicular stomatitis virus glycoprotein: a new type of post-translational modification of the viral glycoprotein.
      ,
      • Roth A.F.
      • Wan J.
      • Bailey A.O.
      • Sun B.
      • Kuchar J.A.
      • Green W.N.
      • Phinney B.S.
      • Yates 3rd, J.R.
      • Davis N.G.
      Global analysis of protein palmitoylation in yeast.
      ,
      • Kang R.
      • Wan J.
      • Arstikaitis P.
      • Takahashi H.
      • Huang K.
      • Bailey A.O.
      • Thompson J.X.
      • Roth A.F.
      • Drisdel R.C.
      • Mastro R.
      • Green W.N.
      • Yates 3rd, J.R.
      • Davis N.G.
      • El-Husseini A.
      Neural palmitoyl-proteomics reveals dynamic synaptic palmitoylation.
      ). Palmitoylation was established by a variety of increasingly complex methodologies starting with radiolabeling with [3H]palmitate and moving on to acyl-biotin exchange protocols, acyl-resin-assisted capture with thiopropyl-Sepharose and click chemistry based on metabolic labeling with bioorthogonal palmitate analogs combined with quantitative mass spectroscopy (
      • Schmidt M.F.
      • Bracha M.
      • Schlesinger M.J.
      Evidence for covalent attachment of fatty acids to Sindbis virus glycoproteins.
      ,
      • Schmidt M.F.
      • Schlesinger M.J.
      Fatty acid binding to vesicular stomatitis virus glycoprotein: a new type of post-translational modification of the viral glycoprotein.
      ,
      • Forrester M.T.
      • Hess D.T.
      • Thompson J.W.
      • Hultman R.
      • Moseley M.A.
      • Stamler J.S.
      • Casey P.J.
      Site-specific analysis of protein S-acylation by resin-assisted capture.
      ,
      • Ren W.
      • Jhala U.S.
      • Du K.
      Proteomic analysis of protein palmitoylation in adipocytes.
      ).
      ENaCs are among the ∼50 ion channels known to be palmitoylated (for reviews, see Refs.
      • Shipston M.J.
      Ion channel regulation by protein palmitoylation.
      ,
      • Chamberlain L.H.
      • Shipston M.J.
      The physiology of protein S-acylation.
      , and
      • Shipston M.J.
      Ion channel regulation by protein S-acylation.
      ). We treated mCCDcl1 cells that express endogenous ENaC with an inhibitor of protein acylation (2-BP) and found a rapid reduction in ENaC currents consistent with the reduced activity of ENaC that we observed in heterologous systems when we expressed mutant ENaC lacking sites for Cys palmitoylation (
      • Mueller G.M.
      • Maarouf A.B.
      • Kinlough C.L.
      • Sheng N.
      • Kashlan O.B.
      • Okumura S.
      • Luthy S.
      • Kleyman T.R.
      • Hughey R.P.
      Cys palmitoylation of the β subunit modulates gating of the epithelial sodium channel.
      ,
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ). However, the reduced currents could also reflect changes in palmitoylation of additional proteins that either alter ENaC trafficking or gating. The palmitate analog 2-BP has been regularly used in cultured cells to inhibit palmitoylation of proteins, thereby providing a complementary in vivo approach to study the function of palmitate addition to specified proteins (
      • Davda D.
      • El Azzouny M.A.
      • Tom C.T.
      • Hernandez J.L.
      • Majmudar J.D.
      • Kennedy R.T.
      • Martin B.R.
      Profiling targets of the irreversible palmitoylation inhibitor 2-bromopalmitate.
      ,
      • Pedro M.P.
      • Vilcaes A.A.
      • Tomatis V.M.
      • Oliveira R.G.
      • Gomez G.A.
      • Daniotti J.L.
      2-Bromopalmitate reduces protein deacylation by inhibition of acyl-protein thioesterase enzymatic activities.
      ). Although 2-BP clearly inhibits the palmitoyltransferases, there is evidence that it inhibits the thioesterases as well (
      • Davda D.
      • El Azzouny M.A.
      • Tom C.T.
      • Hernandez J.L.
      • Majmudar J.D.
      • Kennedy R.T.
      • Martin B.R.
      Profiling targets of the irreversible palmitoylation inhibitor 2-bromopalmitate.
      ,
      • Pedro M.P.
      • Vilcaes A.A.
      • Tomatis V.M.
      • Oliveira R.G.
      • Gomez G.A.
      • Daniotti J.L.
      2-Bromopalmitate reduces protein deacylation by inhibition of acyl-protein thioesterase enzymatic activities.
      ,
      • Coleman R.A.
      • Rao P.
      • Fogelsong R.J.
      • Bardes E.S.
      2-Bromopalmitoyl-CoA and 2-bromopalmitate: promiscuous inhibitors of membrane-bound enzymes.
      ). 2-BP also inhibits metabolic enzymes, including fatty acid CoA ligase, which reduces the cellular content of the palmitoylation substrate palmitoyl-CoA (
      • Davda D.
      • El Azzouny M.A.
      • Tom C.T.
      • Hernandez J.L.
      • Majmudar J.D.
      • Kennedy R.T.
      • Martin B.R.
      Profiling targets of the irreversible palmitoylation inhibitor 2-bromopalmitate.
      ,
      • Pedro M.P.
      • Vilcaes A.A.
      • Tomatis V.M.
      • Oliveira R.G.
      • Gomez G.A.
      • Daniotti J.L.
      2-Bromopalmitate reduces protein deacylation by inhibition of acyl-protein thioesterase enzymatic activities.
      ,
      • Coleman R.A.
      • Rao P.
      • Fogelsong R.J.
      • Bardes E.S.
      2-Bromopalmitoyl-CoA and 2-bromopalmitate: promiscuous inhibitors of membrane-bound enzymes.
      ). We also observed a decrease in TER after treatment of mCCDcl1 cells with 2-BP, which may reflect reduced palmitoylation of claudins normally found within the tight junctions (
      • Heiler S.
      • Mu W.
      • Zöller M.
      • Thuma F.
      The importance of claudin-7 palmitoylation on membrane subdomain localization and metastasis-promoting activities.
      ,
      • Van Itallie C.M.
      • Gambling T.M.
      • Carson J.L.
      • Anderson J.M.
      Palmitoylation of claudins is required for efficient tight-junction localization.
      ,
      • Kiuchi-Saishin Y.
      • Gotoh S.
      • Furuse M.
      • Takasuga A.
      • Tano Y.
      • Tsukita S.
      Differential expression patterns of claudins, tight junction membrane proteins, in mouse nephron segments.
      ). Transcripts for 13 claudins were identified in dissected rat kidney CCDs by deep sequencing (
      • Lee J.W.
      • Chou C.L.
      • Knepper M.A.
      Deep sequencing in microdissected renal tubules identifies nephron segment-specific transcriptomes.
      ). A role of claudin palmitoylation in modifying TER was noted in studies of polarized Madin-Darby canine kidney cells, where TER was increased 5-fold after transfection with wild type claudin-14. However, TER was unchanged after transfection with claudin-14 lacking sites for palmitoylation because of reduced targeting to the tight junctions (
      • Van Itallie C.M.
      • Gambling T.M.
      • Carson J.L.
      • Anderson J.M.
      Palmitoylation of claudins is required for efficient tight-junction localization.
      ).
      Of the 23 mouse palmitoyltransferases, DHHCs 1, 2, 3, 7, and 14 activated ENaCs expressed in Xenopus oocytes. Analysis of gene expression data in the online Xenbase indicates that DHHCs 4, 6, 8, 14, and 16 are expressed in Xenopus laevis oocytes, whereas DHHCs 1, 2, 3, 7, 9, 15, 20, and 21 are not expressed. There are no data available for DHHCs 5, 11, 12, 13, 17, 23, 24, and 25. Although these data indicate that oocytes do express one ENaC-activating transferase (DHHC 14), overexpression of DHHC 14 further enhanced ENaC activity. These five activating DHHCs are expressed in the ASDN (
      • Lee J.W.
      • Chou C.L.
      • Knepper M.A.
      Deep sequencing in microdissected renal tubules identifies nephron segment-specific transcriptomes.
      ). ENaCs are expressed in principal cells in the latter aspect of the ASDN, and we found transcripts for all five ENaC-activating DHHCs in a cultured principal cell line (mCCDcl1) using RT-PCR. Furthermore, in mouse kidney sections DHHC 3 was localized in cells expressing aquaporin 2, a principal cell marker. At least three of the channel activating DHHCs (DHHCs 1, 2, and 3) are expressed in mouse airway epithelia (
      • Treutlein B.
      • Brownfield D.G.
      • Wu A.R.
      • Neff N.F.
      • Mantalas G.L.
      • Espinoza F.H.
      • Desai T.J.
      • Krasnow M.A.
      • Quake S.R.
      Reconstructing lineage hierarchies of the distal lung epithelium using single-cell RNA-seq.
      ), whereas analyses of DHHC expression in both human kidney and lung by RT-PCR revealed expression of 17 DHHCs (including DHHCs 1, 3, 7, and 14) (
      • Ohno Y.
      • Kihara A.
      • Sano T.
      • Igarashi Y.
      Intracellular localization and tissue-specific distribution of human and yeast DHHC cysteine-rich domain-containing proteins.
      ). Taken together, these data are consistent with a role for Cys palmitoylation in regulation of ENaC in both kidney and lung, because the relevant transferases are expressed at the appropriate sites in these tissues.
      Although the list of palmitoylated proteins continues to expand, it has been a challenge to identify physiologically relevant DHHC-substrate pairs as (i) there are numerous reports indicating that substrates are shared by multiple DHHCs, (ii) tissue and cell type expression of the DHHCs are highly variable, and (iii) the definitive subcellular distribution of each DHHC has been described in only a few cases (for review, see Refs.
      • Chamberlain L.H.
      • Shipston M.J.
      The physiology of protein S-acylation.
      and
      • Fukata Y.
      • Murakami T.
      • Yokoi N.
      • Fukata M.
      Local palmitoylation cycles and specialized membrane domain organization.
      ). Expression of epitope-tagged DHHCs in HEK293 cells coupled with immunofluorescence microscopy placed DHHCs 1, 2, 3, 6, 10, 11, 12, 13, 14, 16, 19, and 22 in the endoplasmic reticulum (ER); DHHCs 2, 3, 4, 7, 8, 12, 15, 17, 18, and 22 in the Golgi apparatus; and DHHCs 5, 20, and 21 at the plasma membrane (
      • Ohno Y.
      • Kihara A.
      • Sano T.
      • Igarashi Y.
      Intracellular localization and tissue-specific distribution of human and yeast DHHC cysteine-rich domain-containing proteins.
      ). Recent studies have confirmed DHHC 6 expression in the ER and DHHC 3 expression in the Golgi apparatus, whereas DHHCs 1, 2, and 11 were found in endosomes (
      • Lee J.W.
      • Chou C.L.
      • Knepper M.A.
      Deep sequencing in microdissected renal tubules identifies nephron segment-specific transcriptomes.
      ), and DHHCs 5 and 8 were found at the plasma membrane (reviewed in Ref.
      • Fukata Y.
      • Murakami T.
      • Yokoi N.
      • Fukata M.
      Local palmitoylation cycles and specialized membrane domain organization.
      ). It is now clear that DHHCs 4 and 6 are localized to the ER by conserved C-terminal lysine-based sorting signals (e.g. KXKXX and KKXX, where X is any amino acid) (
      • Gorleku O.A.
      • Barns A.M.
      • Prescott G.R.
      • Greaves J.
      • Chamberlain L.H.
      Endoplasmic reticulum localization of DHHC palmitoyltransferases mediated by lysine-based sorting signals.
      ). Not surprisingly, there are now several examples whereby subcellular localization of DHHC substrates (e.g. H/N-Ras and small G proteins Gαo and Gαs) are regulated by palmitoylation-depalmitoylation cycles based on the localization of DHHCs and putative depalmitoylating enzymes such as acyl-protein thioesterase 1 (
      • Fukata Y.
      • Fukata M.
      Protein palmitoylation in neuronal development and synaptic plasticity.
      ,
      • Rocks O.
      • Peyker A.
      • Bastiaens P.I.
      Spatio-temporal segregation of Ras signals: one ship, three anchors, many harbors.
      ).
      In summary, we have identified five ENaC-activating DHHCs and found that ENaC was present in a stable complex (or complexes) with DHHCs 1, 2, 3, 7, and 14. Additional non-activating DHHCs such as DHHC 11 and 23 are likely present in the complex (or complexes) because they were also found in ENaC immunoprecipitates when co-expressed in FRT cells. Complexes of heterogeneous DHHCs have been previously reported (
      • Fang C.
      • Deng L.
      • Keller C.A.
      • Fukata M.
      • Fukata Y.
      • Chen G.
      • Lüscher B.
      GODZ-mediated palmitoylation of GABA(A) receptors is required for normal assembly and function of GABAergic inhibitory synapses.
      ). It is also possible that ENaC could be activated by additional DHHCs in other cell types where unknown factors stabilize DHHC complexes. Because channel activating DHHCs are likely expressed at different sites in the biosynthetic pathway, including ER (for DHHCs 1, 2, 3, and 14), Golgi (DHHCs 2, 3, and 7) and endosomes (DHHCs 1 and 2), it is likely that ENaC is palmitoylated during transit through the biosynthetic pathway and during endocytic recycling at the apical cell surface.

      Experimental Procedures

      Plasmids

      cDNAs for wild type mouse α, β, and γ ENaC subunits and mutant subunits (βC43A,C557A and γC33A,C41A), with and without N-terminal HA and C-terminal V5 epitope tags, or an α subunit with only a C-terminal V5 tag were described previously (
      • Hughey R.P.
      • Mueller G.M.
      • Bruns J.B.
      • Kinlough C.L.
      • Poland P.A.
      • Harkleroad K.L.
      • Carattino M.D.
      • Kleyman T.R.
      Maturation of the epithelial Na+ channel involves proteolytic processing of the α- and γ-subunits.
      ,
      • Mueller G.M.
      • Maarouf A.B.
      • Kinlough C.L.
      • Sheng N.
      • Kashlan O.B.
      • Okumura S.
      • Luthy S.
      • Kleyman T.R.
      • Hughey R.P.
      Cys palmitoylation of the β subunit modulates gating of the epithelial sodium channel.
      ,
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ). The 23 cDNAs encoding individual mouse palmitoyltransferases with an N-terminal HA epitope tag (in pEF-Bos-HA) and with an N-terminal GFP tag (in pEGFP-C1) were a gift from Masaki Fukata (National Institute for Physiological Sciences, Okazaki, Japan) and were previously described (
      • Fukata M.
      • Fukata Y.
      • Adesnik H.
      • Nicoll R.A.
      • Bredt D.S.
      Identification of PSD-95 palmitoylating enzymes.
      ). Each HA-tagged DHHC cDNA was subcloned into pCDNA 3.1(−)neo, and corresponding cRNAs for oocyte injections were prepared using T7 mMESSAGE mMACHINE® kit (Ambion Invitrogen).

      Cell Culture and Co-immunoprecipitations

      The mCCDcl1 cells (kindly provided by B. Rossier and L. Schild, Université de Lausanne, Lausanne, Switzerland) were grown in 10-cm-diameter cell culture dishes (passages 30–40) in defined growth medium (DMEM supplemented with insulin (5 μg/ml), human apotransferrin (5 μg/ml), EGF (10 ng/ml), T3 (1 nm), dexamethasone (50 nm), sodium selenite (0.06 nm), penicillin (100 μg/ml), streptomycin (130 μg/ml), and 2% decomplemented FCS at 37 °C in 5% CO2 as described previously (
      • Gaeggeler H.P.
      • Gonzalez-Rodriguez E.
      • Jaeger N.F.
      • Loffing-Cueni D.
      • Norregaard R.
      • Loffing J.
      • Horisberger J.D.
      • Rossier B.C.
      Mineralocorticoid versus glucocorticoid receptor occupancy mediating aldosterone-stimulated sodium transport in a novel renal cell line.
      ,
      • Edinger R.S.
      • Bertrand C.A.
      • Rondandino C.
      • Apodaca G.A.
      • Johnson J.P.
      • Butterworth M.B.
      The epithelial sodium channel (ENaC) establishes a trafficking vesicle pool responsible for its regulation.
      ,
      • Edinger R.S.
      • Coronnello C.
      • Bodnar A.J.
      • Labarca M.
      • Bhalla V.
      • LaFramboise W.A.
      • Benos P.V.
      • Ho J.
      • Johnson J.P.
      • Butterworth M.B.
      Aldosterone regulates microRNAs in the cortical collecting duct to alter sodium transport.
      ). The medium was changed every 2–3 days. For all electrophysiology experiments, the mCCDcl1 cells were plated on permeable Snapwell filter supports for 3–5 days (0.4-μm pore size, 1.12-cm2 surface area; Corning, Lowell, MA). Formation of tight junctions by mCCDcl1 cells were verified by measuring TER before electrophysiological analysis in a Ussing chamber.
      FRT cells were provided by P. Snyder (University of Iowa) and cultured in DMEM/F-12 medium supplemented with 7.5% fetal bovine serum as previously described (
      • Heidrich E.
      • Carattino M.D.
      • Hughey R.P.
      • Pilewski J.M.
      • Kleyman T.R.
      • Myerburg M.M.
      Intracellular Na+ regulates epithelial Na+ channel maturation.
      ). The cells were transfected with cDNAs using Lipofectamine 2000 (Invitrogen Thermo Fisher) according to the manufacturer. FRT cells were transfected with 0.5 μg/subunit for ENaC and 0.5 μg for each GFP-tagged DHHC. For co-immunoprecipitation experiments, FRT cells were transfected with N-terminal HA and C-terminal V5 tagged WT αβγ or ENaC with mutant subunits lacking sites for palmitoylation (αβCys43,557AγCys33,41A) either alone or with N-terminal GFP tagged DHHC 1, 2, 3, 7, or 14 (cDNAs described below). The following day, detergent extracts of the cells were incubated with agarose-immobilized goat anti-V5 antibodies (Bethyl Laboratories, Inc., Montgomery, TX), and immunoprecipitates were subjected to SDS-PAGE and immunoblotting with either rabbit anti-GFP antibodies (at 2 μg/ml; Thermo Fisher Molecular Probes) or mouse monoclonal anti-V5 antibodies (at 1 μg/ml; Bio-Rad) as previously described (
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ). 10% of the detergent cell extracts was subjected to SDS-PAGE and immunoblotting with a rabbit anti-GFP antibody (at 2 μg/ml). Alternatively, co-immunoprecipitation experiments were carried out with HA-DHHCs 7, 11, or 23 and ENaC with non-tagged β and γ subunits and a C-terminal V5 epitope tagged α subunit. Anti-V5 immunoprecipitates or cell extracts were immunoblotted with rat monoclonal anti-HA antibodies conjugated to HRP at 0.05 μg/ml prepared as directed by the manufacturer (Roche Diagnostics).

      Assay for Cys Palmitoylation in HEK293 Cells

      HEK293T cells (ATCC Cell Biology Collection) were cultured in DMEM/F-12 medium supplemented with 8% fetal bovine serum. The cells were plated in a 12-well size dish and transfected the next day with αβγ ENaC (β subunit with a C-terminal V5 epitope tag and non-tagged α and γ subunits), with or without DHHC 7 (with an N-terminal HA tag) using Lipofectamine 2000 according to the manufacturer. Cys palmitoylation of the β subunit in anti-V5 immunoprecipitates (IPs) was assessed with fatty acid exchange chemistry where palmitate is removed from Cys with hydroxylamine treatment, using Tris treatment as a negative control, and replaced with biotin as previously described (
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ). A fraction of the IP (10%) was reserved to assess total β subunit in the initial immunoprecipitate, and biotinylated β subunit was recovered with avidin-conjugated beads (90%) for immunoblotting with mouse anti-V5 antibodies at 4 μg/ml (Invitrogen; R96025). The percentage of palmitoylation was calculated from the difference in β subunit biotinylation after treatment with hydroxylamine or Tris, relative to the β subunit recovered in the total immunoprecipitate.

      Functional ENaC Expression in Xenopus Oocytes

      Two-electrode voltage clamp was performed as previously described (
      • Chen J.
      • Myerburg M.M.
      • Passero C.J.
      • Winarski K.L.
      • Sheng S.
      External Cu2+ inhibits human epithelial Na+ channels by binding at a subunit interface of extracellular domains.
      ,
      • Chen J.
      • Ray E.C.
      • Yates M.E.
      • Buck T.M.
      • Brodsky J.L.
      • Kinlough C.L.
      • Winarski K.L.
      • Hughey R.P.
      • Kleyman T.R.
      • Sheng S.
      Functional roles of clusters of hydrophobic and polar residues in the epithelial Na+ channel knuckle domain.
      ). Oocytes were injected with wild type or mutant α, β, and γ mouse ENaC subunit cRNAs (0.5–1 ng/subunit) and co-injected where noted with cRNAs for one of the 23 mouse DHHCs (3 ng). The oocytes were incubated at 18 °C in modified Barth's saline (88 mm NaCl, 1 mm KCl, 2.4 mm NaHCO3, 0.3 mm Ca(NO3)2, 0.41 mm CaCl2, 0.82 mm MgSO4, 15 mm HEPES, 10 μg/ml streptomycin sulfate, 100 μg/ml gentamycin sulfate, pH 7.4) for 36–48 h before electrophysiological recordings were performed at room temperature. Oocytes were placed in a recording chamber and perfused with a solution containing 110 mm NaCl, 2 mm KCl, 2 mm CaCl2, 10 mm HEPES, pH 7.4. Inward Na+ currents were measured at −100 mV in the absence and presence of amiloride (10 μm). The protocol for harvesting oocytes from X. laevis was approved by the University of Pittsburgh Institutional Animal Care and Use Committee.

      Immunoblotting of DHHCs Expressed in Xenopus Oocytes

      20 oocytes were injected with cRNAs (12 ng) for 1 of the 23 mouse DHHCs containing an N-terminal HA epitope tag. After 48 h, the oocytes were extracted in detergent for immunoblotting as described previously (
      • Mueller G.M.
      • Maarouf A.B.
      • Kinlough C.L.
      • Sheng N.
      • Kashlan O.B.
      • Okumura S.
      • Luthy S.
      • Kleyman T.R.
      • Hughey R.P.
      Cys palmitoylation of the β subunit modulates gating of the epithelial sodium channel.
      ,
      • Mukherjee A.
      • Mueller G.M.
      • Kinlough C.L.
      • Sheng N.
      • Wang Z.
      • Mustafa S.A.
      • Kashlan O.B.
      • Kleyman T.R.
      • Hughey R.P.
      Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
      ). Briefly, surviving oocytes (n = 5–17) were disrupted in homogenization buffer (100 mm NaCl, 50 mm Tris HCl, pH 7.4) including 1% protease inhibitor mixture III (EMD Millipore, Billerica, MA) using an allergy syringe (1 cc/ml, 27-gauge × 0.5-inch needle; Terumo Medical Corporation, Elkton, MD) in a 1.5-ml capped tube (15 μl buffer/oocyte). The homogenates were centrifuged twice at 200 × g for 10 min, and the supernatant was removed from the pellet of yolk proteins, nuclei, and cell debris to a clean tube. Each supernatant was adjusted to 1% Triton X-100 by addition of 1/3 volume of 4% Triton X-100 in homogenization buffer including protease inhibitors and incubated overnight on a rotating wheel at 4 °C before centrifugation at 15,300 × g at 4 °C to remove any insoluble material. An aliquot equivalent to 1.2 oocytes was subjected to immunoblotting with mouse anti-β-actin ascites (A5441 clone AC-15, diluted 1:1000; Sigma-Aldrich) or rat anti-HA antibodies conjugated to HRP (0.05 μg/ml; Roche Diagnostics). Signal for some DHHCs on immunoblots was observed only after increasing the amount of cRNA injected into oocytes (388 ng for DHHC 4, 46 ng for DHHC 8, 67 ng for DHHC 11, 79 ng for DHHC 13, and 67 ng for DHHC 23). No signal for DHHC21 was observed after injection of 20 ng.

      RNA Isolation and RT-PCR

      Total RNA was isolated from three 10-cm diameter cell culture dishes of mCCDcl1 cells using a PureLink RNA mini kit (Ambion). Single-stranded cDNA was generated from 1 μg of total RNA using the Superscript III (ThermoFisher) kit. The cDNA was amplified by PCR using primers designed against nucleotide sequences that are invariant between Xenopus, rat, mouse, and human ENaC-activating DHHCs: DHHC1 forward, CACGGATGTGTGGTTTGTGTT; DHHC1 reverse, AGACCTGGGCAATCTATACACTC: DHHC2 forward, GAAGATGGATCATCATTG; DHHC2 reverse, CACTGTTGAATTTAGTCC; DHHC3 forward, AAGCGGTGCATTCGCAAG; DHHC3 reverse CATACTGGTACGGGTCTG; DHHC7 forward, GCCACGAAGGAGTACATG; DHHC7 reverse, CTGAGTCGGAAGCCAACG; DHHC14 forward GACAGAAGAGGCTATGTCCAG; and DHHC14 reverse, GCATGGTACGGCTATGTG. Reactions were electrophoresed on a 1% agarose gel with low DNA mass ladder markers (Invitrogen) and visualized using GelReD stain (Biotium Inc., Hayward, CA) in a Bio-Rad molecular imager GelDoc XR+ imaging system. Expected PCR-amplified fragment sizes for DHHCs 1, 2, 3, 7, and 14 are 474, 475, 453, 541, and 420 bp, respectively.

      Immunostaining and Imaging of Mouse Kidneys

      The protocol for harvesting kidneys from mice was approved by the University of Pittsburgh Institutional Animal Care and Use Committee. Kidneys from C57BL/6 male mice were fixed in 4% PFA and embedded in Tissue-Tek optimal cutting temperature compound before staining 4–5-μm cryosections with goat anti-aquaporin 2 (C-17) (0.2 μg/ml Santa Cruz Biotechnology, sc-9882) and rabbit anti-DHHC3 (at 3.3 μg/ml; ab31837, Abcam, Cambridge, MA) antibodies, as previously described (
      • Al-bataineh M.M.
      • Gong F.
      • Marciszyn A.L.
      • Myerburg M.M.
      • Pastor-Soler N.M.
      Regulation of proximal tubule vacuolar H+-ATPase by PKA and AMP-activated protein kinase.
      ,
      • Gong F.
      • Alzamora R.
      • Smolak C.
      • Li H.
      • Naveed S.
      • Neumann D.
      • Hallows K.R.
      • Pastor-Soler N.M.
      Vacuolar H+-ATPase apical accumulation in kidney intercalated cells is regulated by PKA and AMP-activated protein kinase.
      ). Validation of the anti-DHHC 3 antibody is described below. Secondary antibodies (FITC-tagged donkey anti-goat IgG (at 7.5 μg/ml, catalog no. 705-095-147) and Cy3-tagged donkey anti-rabbit IgG (at 1.9 μg/ml, catalog no. 711-165-152)) were purchased from Jackson ImmunoResearch (West Grove, PA). The nuclei were counterstained with TO-PRO 3 (Thermo Fisher). Sections were imaged on a Leica TCS SP5 CW-STED confocal imaging system (without STED settings) with a 63× glycerol immersion lens with a 1.25 numerical aperture. The images were acquired with Leica proprietary software, and scale bars were generated with ImageJ. For the peptide competition immunofluorescence, anti-DHHC antibody (6.6 μg/ml) was preincubated with and without antigen peptide from Abcam (Human GODZ peptide ab31882 at 0.1 μg/ml) for 90 min at 4 °C with agitation and then combined with an equal volume of anti-aquaporin 2 antibody (0.4 μg/ml) before primary antibodies were applied to tissue.
      The anti-DHHC 3 antibody was further validated by immunoblotting. FRT cells were transfected with the cDNA for either GFP or DHHC 3 with an N-terminal GFP epitope tag using Lipofectamine 2000 (Invitrogen Thermo Fisher) according to the manufacturer. Cells were extracted in detergent, and an aliquot was subjected to immunoblotting with either mouse anti-β-actin ascites (A5441 clone AC-15, diluted 1:1000; Sigma-Aldrich) or rabbit anti-DHHC 3 antibody (1 μg/ml, ab31837; Abcam). Kidneys from three C57BL/6 mice were homogenized separately, and detergent extracts (30 μg) of the post-nuclear supernatant were subjected to immunoblotting on two identical blots with rabbit anti-DHHC 3 antibody (1 μg/ml, ab31837; Abcam) preincubated with and without the immunizing peptide in 10-fold excess (0.75 μg of antibody with 7.5 μg of peptide, ab31882;Abcam). Both blots were also immunoblotted with mouse anti-β-actin ascites (A5441 clone AC-15, diluted 1:1000; Sigma-Aldrich) as a loading control. Signal for DHHC 3 on immunoblots was detected using either BioMax MR film (Carestream Health, Inc., Rochester, NY) or a Bio-Rad ChemiDoc Touch imaging system.

      Isc Measurements

      mCCDcl1 cells were grown on Snapwell inserts (Corning Costar) until a confluent, high resistance monolayer was obtained. Monolayer resistances were greater than 1 kΩ × cm2 for all cell monolayers tested. Snapwells were mounted in Ussing sliders (P2302; Physiological Instruments, San Diego, CA) and inserted into the chambers of an EM-CSYS Ussing system (Physiologic Instruments) equipped with a heat block for temperature control. The apical and basolateral hemichambers contained 4 ml of Krebs buffer solution (110 mm NaCl, 25 mm NaHCO3, 5.8 mm KCl, 2 mm MgSO4, 1.2 mm K2HPO4, 2 mm CaCl2, and 11 mm glucose). The chamber temperature was maintained at 37 °C. The hemichambers were continuously bubbled with 95% O2, 5% CO2, which maintained the pH at 7.4. The apical and basolateral hemichambers were connected to Ag/AgCl electrodes via 5 m NaCl agar bridges for voltage sensing and current passing. The electrodes were connected to a VCC MC6 multichannel voltage/current clamp (Physiologic Instruments). The asymmetry of voltage-sensing Ag/AgCl electrodes and the liquid junction potentials were compensated using an offset removal circuit before tissue mounting. Isc and TER were measured under voltage clamp conditions. To calculate TER, a bipolar pulse of ± 10 mV with a duration of 0.5 s was applied every 60 s. The data were digitalized at 1 KHz using DigiData 1440A (Molecular Devices) and acquired with pClamp 10.3 software (Molecular Devices). After an equilibration period to achieve a stable Isc (∼30 min), the cells were treated with either 25 μm 2-BP (2-bromohexadecanoic acid (97% pure); Aldrich) or vehicle only (DMSO (1:2,000 dilution) in the apical hemi-chamber for 30 min. The amiloride-sensitive component of the Isc was then determined by adding 10 μm amiloride to the apical hemi-chamber. Typically, ≥90% of the total Isc was inhibited after amiloride addition. Average TER was calculated from five bipolar pulses of ± 10 mV prior to addition of DMSO or 2-BP and five pulses prior to addition of amiloride. After 5 min, amiloride was washed out, and the Isc was allowed to stabilize again. The apical membrane was then permeabilized by the addition of amphotericin B (120 μg/ml; Sigma).

      Data and Statistical Analyses

      The data are expressed as the means ± S.D. Box and whisker plots are used in figures to show the distribution of data: median (middle line); mean (cross or dot); 25th to 75th percentile (box); and 10th and 90th percentiles (whisker). Experiments were repeated with a minimum of two batches of oocytes obtained from different frogs. When appropriate, statistical comparisons were obtained from unpaired Student's t test or one-way ANOVA followed by a Tukey post hoc test. A p value of less than 0.05 was considered statistically different.

      Author Contributions

      T. R. K. and R. P. H. conceived and designed the study and wrote the paper. A. M. carried out studies in FRT cells and wrote the paper. A. M. and Z. W. carried out studies in Xenopus oocytes. A. M., N. M., M. B. B., and M. D. C. carried out studies with mCCDcl1 cells in Ussing chambers. A. L. M. prepared the mouse kidney slices and carried out the confocal microscopy. Z. W. and P. A. P. subcloned the 23 DHHCs into new vectors. C. L. K. carried out the fatty acid exchange chemistry assay for ENaC palmitoylation.

      Acknowledgments

      Plasmids encoding the 23 DHHCs were a gift from Masaki Fukata (National Institute for Physiological Sciences, Okazaki, Japan). The mCCDcl1 cells were kindly provided by B. Rossier and L. Schild (Université de Lausanne, Lausanne, Switzerland). Antibodies for immunostaining were provided by the lab of Gerard Apodaca (University of Pittsburgh) and the Pittsburgh Center for Kidney Research.

      References

        • Rossier B.C.
        • Stutts M.J.
        Activation of the epithelial sodium channel (ENaC) by serine proteases.
        Annu. Rev. Physiol. 2009; 71: 361-379
        • Kashlan O.B.
        • Kleyman T.R.
        Epithelial Na+ channel regulation by cytoplasmic and extracellular factors.
        Exp. Cell Res. 2012; 318: 1011-1019
        • Kellenberger S.
        • Schild L.
        International Union of Basic and Clinical Pharmacology: XCI. structure, function, and pharmacology of acid-sensing ion channels and the epithelial Na+ channel.
        Pharmacol. Rev. 2015; 67: 1-35
        • Canessa C.M.
        • Merillat A.M.
        • Rossier B.C.
        Membrane topology of the epithelial sodium channel in intact cells.
        Am. J. Physiol. 1994; 267: C1682-C1690
        • Kashlan O.B.
        • Kleyman T.R.
        ENaC structure and function in the wake of a resolved structure of a family member.
        Am. J. Physiol. Renal Physiol. 2011; 301: F684-F696
        • Bhalla V.
        • Hallows K.R.
        Mechanisms of ENaC regulation and clinical implications.
        J. Am. Soc. Nephrol. 2008; 19: 1845-1854
        • Eaton D.C.
        • Malik B.
        • Bao H.F.
        • Yu L.
        • Jain L.
        Regulation of epithelial sodium channel trafficking by ubiquitination.
        Proc. Am. Thorac. Soc. 2010; 7: 54-64
        • Ronzaud C.
        • Staub O.
        Ubiquitylation and control of renal Na+ balance and blood pressure.
        Physiology (Bethesda). 2014; 29: 16-26
        • Sheng S.
        • Bruns J.B.
        • Kleyman T.R.
        Extracellular histidine residues crucial for Na+ self-inhibition of epithelial Na+ channels.
        J. Biol. Chem. 2004; 279: 9743-9749
        • Collier D.M.
        • Snyder P.M.
        Extracellular protons regulate human ENaC by modulating Na+ self-inhibition.
        J. Biol. Chem. 2009; 284: 792-798
        • Collier D.M.
        • Snyder P.M.
        Extracellular chloride regulates the epithelial sodium channel.
        J. Biol. Chem. 2009; 284: 29320-29325
        • Hughey R.P.
        • Mueller G.M.
        • Bruns J.B.
        • Kinlough C.L.
        • Poland P.A.
        • Harkleroad K.L.
        • Carattino M.D.
        • Kleyman T.R.
        Maturation of the epithelial Na+ channel involves proteolytic processing of the α- and γ-subunits.
        J. Biol. Chem. 2003; 278: 37073-37082
        • Hughey R.P.
        • Bruns J.B.
        • Kinlough C.L.
        • Harkleroad K.L.
        • Tong Q.
        • Carattino M.D.
        • Johnson J.P.
        • Stockand J.D.
        • Kleyman T.R.
        Epithelial sodium channels are activated by furin-dependent proteolysis.
        J. Biol. Chem. 2004; 279: 18111-18114
        • Ergonul Z.
        • Frindt G.
        • Palmer L.G.
        Regulation of maturation and processing of ENaC subunits in the rat kidney.
        Am. J. Physiol. Renal Physiol. 2006; 291: F683-F693
        • Ma H.P.
        • Chou C.F.
        • Wei S.P.
        • Eaton D.C.
        Regulation of the epithelial sodium channel by phosphatidylinositides: experiments, implications, and speculations.
        Pflugers Arch. 2007; 455: 169-180
        • Yang L.M.
        • Rinke R.
        • Korbmacher C.
        Stimulation of the epithelial sodium channel (ENaC) by cAMP involves putative ERK phosphorylation sites in the C termini of the channel's β- and γ-subunit.
        J. Biol. Chem. 2006; 281: 9859-9868
        • Pochynyuk O.
        • Tong Q.
        • Medina J.
        • Vandewalle A.
        • Staruschenko A.
        • Bugaj V.
        • Stockand J.D.
        Molecular determinants of PI(4,5)P2 and PI(3,4,5)P3 regulation of the epithelial Na+ channel.
        J. Gen. Physiol. 2007; 130: 399-413
        • Pochynyuk O.
        • Tong Q.
        • Staruschenko A.
        • Ma H.P.
        • Stockand J.D.
        Regulation of the epithelial Na+ channel (ENaC) by phosphatidylinositides.
        Am. J. Physiol. Renal Physiol. 2006; 290: F949-F957
        • Pochynyuk O.
        • Bugaj V.
        • Stockand J.D.
        Physiologic regulation of the epithelial sodium channel by phosphatidylinositides.
        Curr. Opin. Nephrol. Hypertens. 2008; 17: 533-540
        • Mueller G.M.
        • Maarouf A.B.
        • Kinlough C.L.
        • Sheng N.
        • Kashlan O.B.
        • Okumura S.
        • Luthy S.
        • Kleyman T.R.
        • Hughey R.P.
        Cys palmitoylation of the β subunit modulates gating of the epithelial sodium channel.
        J. Biol. Chem. 2010; 285: 30453-30462
        • Mukherjee A.
        • Mueller G.M.
        • Kinlough C.L.
        • Sheng N.
        • Wang Z.
        • Mustafa S.A.
        • Kashlan O.B.
        • Kleyman T.R.
        • Hughey R.P.
        Cysteine palmitoylation of the γ subunit has a dominant role in modulating activity of the epithelial sodium channel.
        J. Biol. Chem. 2014; 289: 14351-14359
        • Shipston M.J.
        Ion channel regulation by protein palmitoylation.
        J. Biol. Chem. 2011; 286: 8709-8716
        • Nadolski M.J.
        • Linder M.E.
        Protein lipidation.
        FEBS J. 2007; 274: 5202-5210
        • Linder M.E.
        • Deschenes R.J.
        Palmitoylation: policing protein stability and traffic.
        Nat. Rev. Mol. Cell Biol. 2007; 8: 74-84
        • Yeste-Velasco M.
        • Linder M.E.
        • Lu Y.J.
        Protein S-palmitoylation and cancer.
        Biochim. Biophys. Acta. 2015; 1856: 107-120
        • Chamberlain L.H.
        • Shipston M.J.
        The physiology of protein S-acylation.
        Physiol. Rev. 2015; 95: 341-376
        • Fukata Y.
        • Murakami T.
        • Yokoi N.
        • Fukata M.
        Local palmitoylation cycles and specialized membrane domain organization.
        Curr. Top. Membr. 2016; 77: 97-141
        • Tian L.
        • Jeffries O.
        • McClafferty H.
        • Molyvdas A.
        • Rowe I.C.
        • Saleem F.
        • Chen L.
        • Greaves J.
        • Chamberlain L.H.
        • Knaus H.G.
        • Ruth P.
        • Shipston M.J.
        Palmitoylation gates phosphorylation-dependent regulation of BK potassium channels.
        Proc. Natl. Acad. Sci. U.S.A. 2008; 105: 21006-21011
        • Stephens G.J.
        • Page K.M.
        • Bogdanov Y.
        • Dolphin A.C.
        The α1B Ca2+ channel amino terminus contributes determinants for β subunit-mediated voltage-dependent inactivation properties.
        J. Physiol. 2000; 525: 377-390
        • Locke D.
        • Koreen I.V.
        • Harris A.L.
        Isoelectric points and post-translational modifications of connexin26 and connexin32.
        FASEB J. 2006; 20: 1221-1223
        • Jindal H.K.
        • Folco E.J.
        • Liu G.X.
        • Koren G.
        Posttranslational modification of voltage-dependent potassium channel Kv1.5: COOH-terminal palmitoylation modulates its biological properties.
        Am. J. Physiol. Heart Circ. Physiol. 2008; 294: H2012-H2021
        • Crane J.M.
        • Verkman A.S.
        Reversible, temperature-dependent supramolecular assembly of aquaporin-4 orthogonal arrays in live cell membranes.
        Biophys. J. 2009; 97: 3010-3018
        • Mueller G.M.
        • Yan W.
        • Copelovitch L.
        • Jarman S.
        • Wang Z.
        • Kinlough C.L.
        • Tolino M.A.
        • Hughey R.P.
        • Kleyman T.R.
        • Rubenstein R.C.
        Multiple residues in the distal C terminus of the α-subunit have roles in modulating human epithelial sodium channel activity.
        Am. J. Physiol. Renal Physiol. 2012; 303: F220-F228
        • Gorleku O.A.
        • Barns A.M.
        • Prescott G.R.
        • Greaves J.
        • Chamberlain L.H.
        Endoplasmic reticulum localization of DHHC palmitoyltransferases mediated by lysine-based sorting signals.
        J. Biol. Chem. 2011; 286: 39573-39584
        • Fukata M.
        • Fukata Y.
        • Adesnik H.
        • Nicoll R.A.
        • Bredt D.S.
        Identification of PSD-95 palmitoylating enzymes.
        Neuron. 2004; 44: 987-996
        • Iwanaga T.
        • Tsutsumi R.
        • Noritake J.
        • Fukata Y.
        • Fukata M.
        Dynamic protein palmitoylation in cellular signaling.
        Prog. Lipid Res. 2009; 48: 117-127
        • Smotrys J.E.
        • Linder M.E.
        Palmitoylation of intracellular signaling proteins: regulation and function.
        Annu. Rev. Biochem. 2004; 73: 559-587
        • Greaves J.
        • Salaun C.
        • Fukata Y.
        • Fukata M.
        • Chamberlain L.H.
        Palmitoylation and membrane interactions of the neuroprotective chaperone cysteine-string protein.
        J. Biol. Chem. 2008; 283: 25014-25026
        • Fukata Y.
        • Iwanaga T.
        • Fukata M.
        Systematic screening for palmitoyl transferase activity of the DHHC protein family in mammalian cells.
        Methods. 2006; 40: 177-182
        • Fang C.
        • Deng L.
        • Keller C.A.
        • Fukata M.
        • Fukata Y.
        • Chen G.
        • Lüscher B.
        GODZ-mediated palmitoylation of GABA(A) receptors is required for normal assembly and function of GABAergic inhibitory synapses.
        J. Neurosci. 2006; 26: 12758-12768
        • Lee J.W.
        • Chou C.L.
        • Knepper M.A.
        Deep sequencing in microdissected renal tubules identifies nephron segment-specific transcriptomes.
        J. Am. Soc. Nephrol. 2015; 26: 2669-2677
        • Jennings B.C.
        • Nadolski M.J.
        • Ling Y.
        • Baker M.B.
        • Harrison M.L.
        • Deschenes R.J.
        • Linder M.E.
        2-Bromopalmitate and 2-(2-hydroxy-5-nitro-benzylidene)-benzo[b]thiophen-3-one inhibit DHHC-mediated palmitoylation in vitro.
        J. Lipid Res. 2009; 50: 233-242
        • Szkudelski T.
        • Szkudelska K.
        Short-term effects of palmitate and 2-bromopalmitate on the lipolytic activity of rat adipocytes.
        Life Sci. 2011; 89: 450-455
        • Davda D.
        • El Azzouny M.A.
        • Tom C.T.
        • Hernandez J.L.
        • Majmudar J.D.
        • Kennedy R.T.
        • Martin B.R.
        Profiling targets of the irreversible palmitoylation inhibitor 2-bromopalmitate.
        ACS Chem. Biol. 2013; 8: 1912-1917
        • Schmidt M.F.
        • Bracha M.
        • Schlesinger M.J.
        Evidence for covalent attachment of fatty acids to Sindbis virus glycoproteins.
        Proc. Natl. Acad. Sci. U.S.A. 1979; 76: 1687-1691
        • Schmidt M.F.
        • Schlesinger M.J.
        Fatty acid binding to vesicular stomatitis virus glycoprotein: a new type of post-translational modification of the viral glycoprotein.
        Cell. 1979; 17: 813-819
        • Roth A.F.
        • Wan J.
        • Bailey A.O.
        • Sun B.
        • Kuchar J.A.
        • Green W.N.
        • Phinney B.S.
        • Yates 3rd, J.R.
        • Davis N.G.
        Global analysis of protein palmitoylation in yeast.
        Cell. 2006; 125: 1003-1013
        • Kang R.
        • Wan J.
        • Arstikaitis P.
        • Takahashi H.
        • Huang K.
        • Bailey A.O.
        • Thompson J.X.
        • Roth A.F.
        • Drisdel R.C.
        • Mastro R.
        • Green W.N.
        • Yates 3rd, J.R.
        • Davis N.G.
        • El-Husseini A.
        Neural palmitoyl-proteomics reveals dynamic synaptic palmitoylation.
        Nature. 2008; 456: 904-909
        • Forrester M.T.
        • Hess D.T.
        • Thompson J.W.
        • Hultman R.
        • Moseley M.A.
        • Stamler J.S.
        • Casey P.J.
        Site-specific analysis of protein S-acylation by resin-assisted capture.
        J. Lipid Res. 2011; 52: 393-398
        • Ren W.
        • Jhala U.S.
        • Du K.
        Proteomic analysis of protein palmitoylation in adipocytes.
        Adipocyte. 2013; 2: 17-28
        • Shipston M.J.
        Ion channel regulation by protein S-acylation.
        J. Gen. Physiol. 2014; 143: 659-678
        • Pedro M.P.
        • Vilcaes A.A.
        • Tomatis V.M.
        • Oliveira R.G.
        • Gomez G.A.
        • Daniotti J.L.
        2-Bromopalmitate reduces protein deacylation by inhibition of acyl-protein thioesterase enzymatic activities.
        PLoS One. 2013; 8: e75232
        • Coleman R.A.
        • Rao P.
        • Fogelsong R.J.
        • Bardes E.S.
        2-Bromopalmitoyl-CoA and 2-bromopalmitate: promiscuous inhibitors of membrane-bound enzymes.
        Biochim. Biophys. Acta. 1992; 1125: 203-209
        • Heiler S.
        • Mu W.
        • Zöller M.
        • Thuma F.
        The importance of claudin-7 palmitoylation on membrane subdomain localization and metastasis-promoting activities.
        Cell Commun. Signal. 2015; 13: 29
        • Van Itallie C.M.
        • Gambling T.M.
        • Carson J.L.
        • Anderson J.M.
        Palmitoylation of claudins is required for efficient tight-junction localization.
        J. Cell Sci. 2005; 118: 1427-1436
        • Kiuchi-Saishin Y.
        • Gotoh S.
        • Furuse M.
        • Takasuga A.
        • Tano Y.
        • Tsukita S.
        Differential expression patterns of claudins, tight junction membrane proteins, in mouse nephron segments.
        J. Am. Soc. Nephrol. 2002; 13: 875-886
        • Treutlein B.
        • Brownfield D.G.
        • Wu A.R.
        • Neff N.F.
        • Mantalas G.L.
        • Espinoza F.H.
        • Desai T.J.
        • Krasnow M.A.
        • Quake S.R.
        Reconstructing lineage hierarchies of the distal lung epithelium using single-cell RNA-seq.
        Nature. 2014; 509: 371-375
        • Ohno Y.
        • Kihara A.
        • Sano T.
        • Igarashi Y.
        Intracellular localization and tissue-specific distribution of human and yeast DHHC cysteine-rich domain-containing proteins.
        Biochim. Biophys. Acta. 2006; 1761: 474-483
        • Fukata Y.
        • Fukata M.
        Protein palmitoylation in neuronal development and synaptic plasticity.
        Nat. Rev. Neurosci. 2010; 11: 161-175
        • Rocks O.
        • Peyker A.
        • Bastiaens P.I.
        Spatio-temporal segregation of Ras signals: one ship, three anchors, many harbors.
        Curr. Opin. Cell Biol. 2006; 18: 351-357
        • Gaeggeler H.P.
        • Gonzalez-Rodriguez E.
        • Jaeger N.F.
        • Loffing-Cueni D.
        • Norregaard R.
        • Loffing J.
        • Horisberger J.D.
        • Rossier B.C.
        Mineralocorticoid versus glucocorticoid receptor occupancy mediating aldosterone-stimulated sodium transport in a novel renal cell line.
        J. Am. Soc. Nephrol. 2005; 16: 878-891
        • Edinger R.S.
        • Bertrand C.A.
        • Rondandino C.
        • Apodaca G.A.
        • Johnson J.P.
        • Butterworth M.B.
        The epithelial sodium channel (ENaC) establishes a trafficking vesicle pool responsible for its regulation.
        PLoS One. 2012; 7: e46593
        • Edinger R.S.
        • Coronnello C.
        • Bodnar A.J.
        • Labarca M.
        • Bhalla V.
        • LaFramboise W.A.
        • Benos P.V.
        • Ho J.
        • Johnson J.P.
        • Butterworth M.B.
        Aldosterone regulates microRNAs in the cortical collecting duct to alter sodium transport.
        J. Am. Soc. Nephrol. 2014; 25: 2445-2457
        • Heidrich E.
        • Carattino M.D.
        • Hughey R.P.
        • Pilewski J.M.
        • Kleyman T.R.
        • Myerburg M.M.
        Intracellular Na+ regulates epithelial Na+ channel maturation.
        J. Biol. Chem. 2015; 290: 11569-11577
        • Chen J.
        • Myerburg M.M.
        • Passero C.J.
        • Winarski K.L.
        • Sheng S.
        External Cu2+ inhibits human epithelial Na+ channels by binding at a subunit interface of extracellular domains.
        J. Biol. Chem. 2011; 286: 27436-27446
        • Chen J.
        • Ray E.C.
        • Yates M.E.
        • Buck T.M.
        • Brodsky J.L.
        • Kinlough C.L.
        • Winarski K.L.
        • Hughey R.P.
        • Kleyman T.R.
        • Sheng S.
        Functional roles of clusters of hydrophobic and polar residues in the epithelial Na+ channel knuckle domain.
        J. Biol. Chem. 2015; 290: 25140-25150
        • Al-bataineh M.M.
        • Gong F.
        • Marciszyn A.L.
        • Myerburg M.M.
        • Pastor-Soler N.M.
        Regulation of proximal tubule vacuolar H+-ATPase by PKA and AMP-activated protein kinase.
        Am. J. Physiol. Renal Physiol. 2014; 306: F981-F995
        • Gong F.
        • Alzamora R.
        • Smolak C.
        • Li H.
        • Naveed S.
        • Neumann D.
        • Hallows K.R.
        • Pastor-Soler N.M.
        Vacuolar H+-ATPase apical accumulation in kidney intercalated cells is regulated by PKA and AMP-activated protein kinase.
        Am. J. Physiol. Renal Physiol. 2010; 298: F1162-F1169