Advertisement

Elevated Cyclin G2 Expression Intersects with DNA Damage Checkpoint Signaling and Is Required for a Potent G2/M Checkpoint Arrest Response to Doxorubicin*

  • Maike Zimmermann
    Affiliations
    Department of Pharmacology, University of California, Davis, California 95616

    Department of Pharmacology, University of Iowa, Iowa City, Iowa 52242
    Search for articles by this author
  • Aruni S. Arachchige-Don
    Footnotes
    Affiliations
    Department of Pharmacology, University of Iowa, Iowa City, Iowa 52242
    Search for articles by this author
  • Michaela S. Donaldson
    Affiliations
    Department of Pharmacology, University of California, Davis, California 95616
    Search for articles by this author
  • Robert F. Dallapiazza
    Footnotes
    Affiliations
    Department of Pharmacology, University of Iowa, Iowa City, Iowa 52242
    Search for articles by this author
  • Colleen E. Cowan
    Footnotes
    Affiliations
    Department of Pharmacology, University of Iowa, Iowa City, Iowa 52242
    Search for articles by this author
  • Mary C. Horne
    Correspondence
    To whom correspondence should be addressed: Dept. of Pharmacology, Tupper Hall, Rm. 2219B, 451 E. Health Sciences Drive, University of California, Davis, CA 95616-8636. Tel.: 530-752-7723; Fax: 530-752-7710;
    Affiliations
    Department of Pharmacology, University of California, Davis, California 95616

    Department of Pharmacology, University of Iowa, Iowa City, Iowa 52242
    Search for articles by this author
  • Author Footnotes
    * This work was supported, in whole or in part, by National Institutes of Health Grant P20CA103672 (University of Iowa Cancer and Aging Program's NIA/NCI program project (pilot grand sub-awarded to M. C. H.).
    This article contains supplemental Figs. S1–S10.
    1 Present address: Dept. of Pharmacology, Cancer Institute of New Jersey, UMDNJ-Robert Wood Johnson Medical School, Research Tower, Rm. 561, 675 Hoes Lane, Piscataway, NJ 08854.
    2 Present address: Dept. of Neurological Surgery, University of Virginia, Charlottesville, VA 900812.
    3 Present address: Rush University Medical Center, Chicago, Il 60612.
      To maintain genomic integrity DNA damage response (DDR), signaling pathways have evolved that restrict cellular replication and allow time for DNA repair. CCNG2 encodes an unconventional cyclin homolog, cyclin G2 (CycG2), linked to growth inhibition. Its expression is repressed by mitogens but up-regulated during cell cycle arrest responses to anti-proliferative signals. Here we investigate the potential link between elevated CycG2 expression and DDR signaling pathways. Expanding our previous finding that CycG2 overexpression induces a p53-dependent G1/S phase cell cycle arrest in HCT116 cells, we now demonstrate that this arrest response also requires the DDR checkpoint protein kinase Chk2. In accord with this finding we establish that ectopic CycG2 expression increases phosphorylation of Chk2 on threonine 68. We show that DNA double strand break-inducing chemotherapeutics stimulate CycG2 expression and correlate its up-regulation with checkpoint-induced cell cycle arrest and phospho-modification of proteins in the ataxia telangiectasia mutated (ATM) and ATM and Rad3-related (ATR) signaling pathways. Using pharmacological inhibitors and ATM-deficient cell lines, we delineate the DDR kinase pathway promoting CycG2 up-regulation in response to doxorubicin. Importantly, RNAi-mediated blunting of CycG2 attenuates doxorubicin-induced cell cycle checkpoint responses in multiple cell lines. Employing stable clones, we test the effect that CycG2 depletion has on DDR proteins and signals that enforce cell cycle checkpoint arrest. Our results suggest that CycG2 contributes to DNA damage-induced G2/M checkpoint by enforcing checkpoint inhibition of CycB1-Cdc2 complexes.
      Background: DNA damage triggers cell cycle checkpoints to halt cell division ahead of DNA repair.
      Results: Ectopic cyclin G2 (CycG2) induces a Chk2-dependent cell cycle arrest, and depletion of endogenous CycG2 attenuates doxorubicin-induced G2/M-phase cell cycle arrest.
      Conclusion: CycG2 influences checkpoint signaling and is required for G2/M arrest responses to genotoxic stress.
      Significance: Proper checkpoint function is important for genomic integrity and tumor suppression.

      Introduction

      Genomic DNA is continually subject to lesions induced by environmental radiation, chemical carcinogens, and reactive oxygen species generated by cellular metabolism (
      • Jackson S.P.
      • Bartek J.
      The DNA-damage response in human biology and disease.
      ). If damage to chromosomal DNA is not corrected, these insults will lead to genomic instability and cancer. The presence of a lesion is relayed within minutes of the genomic insult through DNA damage response (DDR)
      The abbreviations used are: DDR
      DNA damage response
      ATM
      ataxia telangiectasia mutated
      ATR
      ATM and Rad3-related
      DNA-PK
      DNA-dependent protein kinase
      DSB
      double strand break
      KD
      knock-down
      ANOVA
      analysis of variance
      NSC
      non-silencing control shRNA
      CycB1
      cyclin B1
      RFP
      red fluorescent protein
      PP2A
      protein phosphatase 2A
      Dox
      doxorubicin.
      signal-transduction pathways. Signaling cascades including sensor, transducer, and effector proteins carry out a particular response (e.g. induction of cell-cycle arrest, DNA repair or apoptosis) dependent on the type and extent of the damage. Damage sensors initiate distinct DDR signaling pathways to coordinate activation of one of the phosphoinositide 3-kinase-related kinases that plays central roles in maintenance of organismal longevity, ataxia telangiectasia mutated (ATM), ATM and Rad3-related (ATR), and DNA-dependent protein kinase (DNA-PK) (
      • Jackson S.P.
      • Bartek J.
      The DNA-damage response in human biology and disease.
      ,
      • Lovejoy C.A.
      • Cortez D.
      Common mechanisms of PIKK regulation.
      ). ATM kinase activation is primarily stimulated by blunt double-stranded DNA (dsDNA) ends such as the DNA double-strand breaks (DSBs) incurred through γ-irradiation (
      • Derheimer F.A.
      • Kastan M.B.
      Multiple roles of ATM in monitoring and maintaining DNA integrity.
      ), whereas ATR activation is most responsive to single-stranded DNA (ssDNA) like that presented by stalled DNA replication intermediates or resected DSB ends (
      • Shiotani B.
      • Zou L.
      ATR signaling at a glance.
      ). DNA-PK is a critical participant in the non-homologous end-joining pathway for repair of V(D)J recombination-induced DSBs but is also thought to serve a vital DNA repair function during genotoxic stress DDRs (
      • Hill R.
      • Lee P.W.
      The DNA-dependent protein kinase (DNA-PK). More than just a case of making ends meet?.
      ). However, growing evidence suggests that extensive cross-talk between the DNA damage-responsive phosphoinositide 3-kinase-related kinases exists, the summation of which determines cell fate (
      • Shiotani B.
      • Zou L.
      ATR signaling at a glance.
      ,
      • Hill R.
      • Lee P.W.
      The DNA-dependent protein kinase (DNA-PK). More than just a case of making ends meet?.
      ,
      • Stracker T.H.
      • Usui T.
      • Petrini J.H.
      Taking the time to make important decisions. The checkpoint effector kinases Chk1 and Chk2 and the DNA damage response.
      ).
      DNA DSBs pose the most significant problem for maintenance of genomic stability. ATM is critical for the initial response to DSBs (
      • Derheimer F.A.
      • Kastan M.B.
      Multiple roles of ATM in monitoring and maintaining DNA integrity.
      ). The Mre11-Rad50-Nbs1 sensor complex (MRN (Mre11-Rad50-Nbs1) complex) promotes ATM activation and recognition of DSBs (
      • Derheimer F.A.
      • Kastan M.B.
      Multiple roles of ATM in monitoring and maintaining DNA integrity.
      ). It facilitates trans-autophosphorylation of inactive ATM dimers on Ser-1981 and thereby ATM dissociation into catalytically active monomers (
      • Derheimer F.A.
      • Kastan M.B.
      Multiple roles of ATM in monitoring and maintaining DNA integrity.
      ). Activated ATM interacts with and phosphorylates numerous proteins to amplify and propagate the signal. Studies indicate ATR is also activated by DSBs and plays a role in the later phase of the response, the progressive resection of blunt end DSB junctions to single strand ends ultimately triggering ATR activation (
      • Shiotani B.
      • Zou L.
      ATR signaling at a glance.
      ,
      • Jazayeri A.
      • Falck J.
      • Lukas C.
      • Bartek J.
      • Smith G.C.
      • Lukas J.
      • Jackson S.P.
      ATM- and cell cycle-dependent regulation of ATR in response to DNA double-strand breaks.
      ). Once activated, ATM and ATR phospho-activate their respective target checkpoint kinases, Chk2 and Chk1. Chk1 and Chk2 in turn phosphorylate and modulate the activity of downstream effectors (Cdc25s A, B, and C; p53) to ultimately halt progression of cells through G1- and G2-phase checkpoints (
      • Derheimer F.A.
      • Kastan M.B.
      Multiple roles of ATM in monitoring and maintaining DNA integrity.
      ,
      • Shiotani B.
      • Zou L.
      ATR signaling at a glance.
      ,
      • Stracker T.H.
      • Usui T.
      • Petrini J.H.
      Taking the time to make important decisions. The checkpoint effector kinases Chk1 and Chk2 and the DNA damage response.
      ,
      • Lindqvist A.
      • Rodríguez-Bravo V.
      • Medema R.H.
      The decision to enter mitosis. Feedback and redundancy in the mitotic entry network.
      ). This blockade of cellular proliferation allows DNA repair to proceed, but if the DNA damage is irreparable, cell death via apoptosis will ensue.
      CCNG2 encodes cyclin G2 (CycG2), an unconventional cyclin homolog linked to cell cycle inhibition (
      • Martínez-Gac L.
      • Marqués M.
      • García Z.
      • Campanero M.R.
      • Carrera A.C.
      Control of cyclin G2 mRNA expression by forkhead transcription factors. Novel mechanism for cell cycle control by phosphoinositide 3-kinase and forkhead.
      ,
      • Chen J.
      • Yusuf I.
      • Andersen H.M.
      • Fruman D.A.
      FOXO transcription factors cooperate with δEF1 to activate growth suppressive genes in B lymphocytes.
      ,
      • Horne M.C.
      • Goolsby G.L.
      • Donaldson K.L.
      • Tran D.
      • Neubauer M.
      • Wahl A.F.
      Cyclin G1 and cyclin G2 comprise a new family of cyclins with contrasting tissue-specific and cell cycle-regulated expression.
      ,
      • Horne M.C.
      • Donaldson K.L.
      • Goolsby G.L.
      • Tran D.
      • Mulheisen M.
      • Hell J.W.
      • Wahl A.F.
      Cyclin G2 is up-regulated during growth inhibition and B cell antigen receptor-mediated cell cycle arrest.
      ,
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ,
      • Kim Y.
      • Shintani S.
      • Kohno Y.
      • Zhang R.
      • Wong D.T.
      Cyclin G2 dysregulation in human oral cancer.
      ,
      • Arachchige Don A.S.
      • Dallapiazza R.F.
      • Bennin D.A.
      • Brake T.
      • Cowan C.E.
      • Horne M.C.
      Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
      ,
      • Le X.F.
      • Arachchige-Don A.S.
      • Mao W.
      • Horne M.C.
      • Bast Jr., R.C.
      Roles of human epidermal growth factor receptor 2, c-Jun NH2-terminal kinase, phosphoinositide 3-kinase, and p70 S6 kinase pathways in regulation of cyclin G2 expression in human breast cancer cells.
      ,
      • Xu G.
      • Bernaudo S.
      • Fu G.
      • Lee D.Y.
      • Yang B.B.
      • Peng C.
      Cyclin G2 is degraded through the ubiquitin-proteasome pathway and mediates the antiproliferative effect of activin receptor-like kinase 7.
      ). CCNG2 mRNAs are moderately expressed in proliferating cells (peaking during the late S/early G2 phase) (
      • Martínez-Gac L.
      • Marqués M.
      • García Z.
      • Campanero M.R.
      • Carrera A.C.
      Control of cyclin G2 mRNA expression by forkhead transcription factors. Novel mechanism for cell cycle control by phosphoinositide 3-kinase and forkhead.
      ,
      • Horne M.C.
      • Goolsby G.L.
      • Donaldson K.L.
      • Tran D.
      • Neubauer M.
      • Wahl A.F.
      Cyclin G1 and cyclin G2 comprise a new family of cyclins with contrasting tissue-specific and cell cycle-regulated expression.
      ,
      • Horne M.C.
      • Donaldson K.L.
      • Goolsby G.L.
      • Tran D.
      • Mulheisen M.
      • Hell J.W.
      • Wahl A.F.
      Cyclin G2 is up-regulated during growth inhibition and B cell antigen receptor-mediated cell cycle arrest.
      ) but significantly up-regulated as cells exit the cell cycle in response to receptor-mediated negative signaling in B-lymphocytes and ovarian cancer cells (
      • Horne M.C.
      • Donaldson K.L.
      • Goolsby G.L.
      • Tran D.
      • Mulheisen M.
      • Hell J.W.
      • Wahl A.F.
      Cyclin G2 is up-regulated during growth inhibition and B cell antigen receptor-mediated cell cycle arrest.
      ,
      • Xu G.
      • Bernaudo S.
      • Fu G.
      • Lee D.Y.
      • Yang B.B.
      • Peng C.
      Cyclin G2 is degraded through the ubiquitin-proteasome pathway and mediates the antiproliferative effect of activin receptor-like kinase 7.
      ). Transcript data from a variety of studies indicate that CCNG2 expression is up-regulated during cell cycle arrest responses to diverse growth-inhibitory signals and strongly repressed by mitogens, suggesting a positive role for CycG2 in the promotion or maintenance of cell cycle arrest (
      • Horne M.C.
      • Donaldson K.L.
      • Goolsby G.L.
      • Tran D.
      • Mulheisen M.
      • Hell J.W.
      • Wahl A.F.
      Cyclin G2 is up-regulated during growth inhibition and B cell antigen receptor-mediated cell cycle arrest.
      ,
      • Tran H.
      • Brunet A.
      • Grenier J.M.
      • Datta S.R.
      • Fornace Jr., A.J.
      • DiStefano P.S.
      • Chiang L.W.
      • Greenberg M.E.
      DNA repair pathway stimulated by the forkhead transcription factor FOXO3a through the Gadd45 protein.
      ,
      • Grolleau A.
      • Bowman J.
      • Pradet-Balade B.
      • Puravs E.
      • Hanash S.
      • Garcia-Sanz J.A.
      • Beretta L.
      Global and specific translational control by rapamycin in T cells uncovered by microarrays and proteomics.
      ,
      • Frasor J.
      • Danes J.M.
      • Komm B.
      • Chang K.C.
      • Lyttle C.R.
      • Katzenellenbogen B.S.
      Profiling of estrogen up- and down-regulated gene expression in human breast cancer cells. Insights into gene networks and pathways underlying estrogenic control of proliferation and cell phenotype.
      ,
      • Oliver T.G.
      • Grasfeder L.L.
      • Carroll A.L.
      • Kaiser C.
      • Gillingham C.L.
      • Lin S.M.
      • Wickramasinghe R.
      • Scott M.P.
      • Wechsler-Reya R.J.
      Transcriptional profiling of the Sonic hedgehog response. A critical role for N-myc in proliferation of neuronal precursors.
      ,
      • Murray J.I.
      • Whitfield M.L.
      • Trinklein N.D.
      • Myers R.M.
      • Brown P.O.
      • Botstein D.
      Diverse and specific gene expression responses to stresses in cultured human cells.
      ,
      • Zhu X.
      • Hart R.
      • Chang M.S.
      • Kim J.W.
      • Lee S.Y.
      • Cao Y.A.
      • Mock D.
      • Ke E.
      • Saunders B.
      • Alexander A.
      • Grossoehme J.
      • Lin K.M.
      • Yan Z.
      • Hsueh R.
      • Lee J.
      • Scheuermann R.H.
      • Fruman D.A.
      • Seaman W.
      • Subramaniam S.
      • Sternweis P.
      • Simon M.I.
      • Choi S.
      Analysis of the major patterns of B cell gene expression changes in response to short-term stimulation with 33 single ligands.
      ,
      • Fang J.
      • Menon M.
      • Kapelle W.
      • Bogacheva O.
      • Bogachev O.
      • Houde E.
      • Browne S.
      • Sathyanarayana P.
      • Wojchowski D.M.
      EPO modulation of cell-cycle regulatory genes and cell division in primary bone marrow erythroblasts.
      ). CCNG2 transcripts are also increased in cells treated with the DNA damaging chemotherapeutics actinomycin D and ecteinascidin-743 (
      • Bates S.
      • Rowan S.
      • Vousden K.H.
      Characterization of human cyclin G1 and G2. DNA damage inducible genes.
      ,
      • Gajate C.
      • An F.
      • Mollinedo F.
      Differential cytostatic and apoptotic effects of ecteinascidin-743 in cancer cells. Transcription-dependent cell cycle arrest and transcription-independent JNK and mitochondrial mediated apoptosis.
      ). In contrast to CCNG1 (the gene encoding the CycG2 homolog CycG1 (
      • Okamoto K.
      • Beach D.
      Cyclin G is a transcriptional target of the p53 tumor suppressor protein.
      ,
      • Zauberman A.
      • Lupo A.
      • Oren M.
      Identification of p53 target genes through immune selection of genomic DNA. The cyclin G gene contains two distinct p53 binding sites.
      )), CCNG2 does not contain p53 binding sites (
      • Jensen M.R.
      • Audolfsson T.
      • Keck C.L.
      • Zimonjic D.B.
      • Thorgeirsson S.S.
      Gene structure and chromosomal localization of mouse cyclin G2 (Ccng2).
      ), but recent work showed that CCNG2 is a transcriptional target of the p53 homolog, p63 (
      • Adorno M.
      • Cordenonsi M.
      • Montagner M.
      • Dupont S.
      • Wong C.
      • Hann B.
      • Solari A.
      • Bobisse S.
      • Rondina M.B.
      • Guzzardo V.
      • Parenti A.R.
      • Rosato A.
      • Bicciato S.
      • Balmain A.
      • Piccolo S.
      A mutant-p53/Smad complex opposes p63 to empower TGFβ-induced metastasis.
      ). Importantly, suppressed CCNG2 mRNA expression has been linked to cancer, including thyroid, oral, and breast carcinomas (
      • Kim Y.
      • Shintani S.
      • Kohno Y.
      • Zhang R.
      • Wong D.T.
      Cyclin G2 dysregulation in human oral cancer.
      ,
      • Adorno M.
      • Cordenonsi M.
      • Montagner M.
      • Dupont S.
      • Wong C.
      • Hann B.
      • Solari A.
      • Bobisse S.
      • Rondina M.B.
      • Guzzardo V.
      • Parenti A.R.
      • Rosato A.
      • Bicciato S.
      • Balmain A.
      • Piccolo S.
      A mutant-p53/Smad complex opposes p63 to empower TGFβ-induced metastasis.
      ,
      • Ito Y.
      • Yoshida H.
      • Uruno T.
      • Nakano K.
      • Takamura Y.
      • Miya A.
      • Kobayashi K.
      • Yokozawa T.
      • Matsuzuka F.
      • Kuma K.
      • Miyauchi A.
      Decreased expression of cyclin G2 is significantly linked to the malignant transformation of papillary carcinoma of the thyroid.
      ).
      In previous work we determined that ectopic CycG2 expression inhibits DNA synthesis and induces a G1/S-phase arrest in a variety of cell lines (
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ,
      • Arachchige Don A.S.
      • Dallapiazza R.F.
      • Bennin D.A.
      • Brake T.
      • Cowan C.E.
      • Horne M.C.
      Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
      ,
      • Le X.F.
      • Arachchige-Don A.S.
      • Mao W.
      • Horne M.C.
      • Bast Jr., R.C.
      Roles of human epidermal growth factor receptor 2, c-Jun NH2-terminal kinase, phosphoinositide 3-kinase, and p70 S6 kinase pathways in regulation of cyclin G2 expression in human breast cancer cells.
      ). We showed that overexpression of CycG2 inhibits CDK2 activity and that the CycG2-mediated G1/S-phase cell cycle arrest is p53-dependent (
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ,
      • Arachchige Don A.S.
      • Dallapiazza R.F.
      • Bennin D.A.
      • Brake T.
      • Cowan C.E.
      • Horne M.C.
      Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
      ). Subsequent studies determined that even moderate up-regulation of ectopic CycG2 expression inhibits cellular proliferation (
      • Chen J.
      • Yusuf I.
      • Andersen H.M.
      • Fruman D.A.
      FOXO transcription factors cooperate with δEF1 to activate growth suppressive genes in B lymphocytes.
      ,
      • Le X.F.
      • Arachchige-Don A.S.
      • Mao W.
      • Horne M.C.
      • Bast Jr., R.C.
      Roles of human epidermal growth factor receptor 2, c-Jun NH2-terminal kinase, phosphoinositide 3-kinase, and p70 S6 kinase pathways in regulation of cyclin G2 expression in human breast cancer cells.
      ,
      • Fang J.
      • Menon M.
      • Kapelle W.
      • Bogacheva O.
      • Bogachev O.
      • Houde E.
      • Browne S.
      • Sathyanarayana P.
      • Wojchowski D.M.
      EPO modulation of cell-cycle regulatory genes and cell division in primary bone marrow erythroblasts.
      ). We found that exogenous and endogenously expressed CycG2 is a CRM1-dependent nucleocytoplasmic shuttling protein that localizes to the cytoplasmic-cytoskeletal compartment of replicating cells where it associates with centrosomes via AKAP450 (
      • Arachchige Don A.S.
      • Dallapiazza R.F.
      • Bennin D.A.
      • Brake T.
      • Cowan C.E.
      • Horne M.C.
      Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
      ). Here we examine CycG2 expression during cellular responses to treatment with the chemotherapeutic DNA DSB-inducing topoisomerase II poisons (
      • Nitiss J.L.
      Targeting DNA topoisomerase II in cancer chemotherapy.
      ), etoposide, and doxorubicin. We relate changes in CycG2 expression to the effects doxorubicin treatment has on cell cycle progression and induction of phospho-activated forms of ATM/ATR pathway DDR proteins. By using transient overexpression of recombinant CycG2 and shRNA-mediated RNAi to knockdown endogenous CycG2, we investigate the involvement of CycG2 with DDR signaling pathways and its contribution to DNA damage-induced cell cycle arrest.

      EXPERIMENTAL PROCEDURES

       Cell Culture and Treatment

      U2OS, HCT116 parental, p53−/−, p21−/−, and Chk2−/− (kind Gift of Dr. B. Vogelstein) were cultured in high glucose DMEM (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (Atlanta Biologicals), 100 units/ml penicillin, 100 μg/ml streptomycin sulfate (Invitrogen), and 1 mm sodium pyruvate (Sigma). NIH3T3 cells were grown in DMEM supplemented with 10% heat-inactivated calf serum (Cellgro), 100 units/ml penicillin, and 100 μg/ml streptomycin sulfate. MCF7 cells were cultured in minimum essential medium with Earle's salts (Invitrogen) supplemented with 10% heat-inactivated FBS, 2 mm l-glutamine (Research Products International, IL), 1 mm sodium pyruvate, 100 units/ml penicillin, 100 μg/ml streptomycin sulfate, and 10 μg/ml bovine insulin (Sigma). MCF10a cells were cultured in DMEM/Ham's F-12 (1:1) (Invitrogen) supplemented with 5% heat-inactivated horse serum (Cellgro), 100 ng/ml cholera toxin (Calbiochem), 20 ng/ml EGF (Invitrogen), 10 μg/ml insulin, 500 ng/ml hydrocortisone (Sigma), 2 mm l-glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin. SV40-transformed normal (GM00637) and ATM-deficient (GM05849) human fibroblast cells were purchased from Coriell Cell Repositories (Camden, NJ) and cultured in minimum essential medium with Earle's salts, 10–15% heat-inactivated FBS, 2 mm l-glutamine, with a 2× concentration of essential and nonessential amino acids and vitamins. All cultures were plated at 20–30% and maintained at 50–90% confluency in a humidified chamber at 37 °C with 5% CO2. DNA damage was induced in the specified cultures by treatment with the chemotherapeutic agents (Sigma) doxorubicin hydrochloride (345 nm) or etoposide (30 μm) for the indicated time periods. Where indicated, cultures were preincubated with 3 mm caffeine (Sigma) or 10 μm KU55933 (Calbiochem) for 1 h before the addition of doxorubicin.

       shRNA Expression Constructs and Establishment of Stable Clones

      DNA constructs for expression of V5- and GFP-epitope tagged CycG2 fusion proteins in mammalian cells have been described (
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ,
      • Arachchige Don A.S.
      • Dallapiazza R.F.
      • Bennin D.A.
      • Brake T.
      • Cowan C.E.
      • Horne M.C.
      Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
      ). Selection of shRNA target sites was done following the guidelines provided on Ambion “siRNA Target Finder and Design Tool.” Efficacy and specificity of all CycG2-targeting and nonsilencing controls was verified via cotransfection assays (see supplemental Fig. S2). Generation of pSilencer-RFP constructs harboring targeting and control shRNAs was as follows. The CMV promoter-driven RFP-coding cassette was PCR-amplified from pDsRed2-C1 and subcloned into KpnI-linearized pSilencer 1.0-U6 (Ambion; Austin, TX). For each shRNA construct, the shRNA insert was prepared by PCR annealing forward and reverse oligonucleotides and ligating into the pSilencer-RFP vector that had been sequentially digested with ApaI and EcoRI. To the reverse oligonucleotide sequence, ApaI and EcoRI restriction endonuclease sites were engineered. The oligonucleotides were ordered from Integrated DNA Technologies (Coralville, IA). The oligonucleotide sequences are as follows (the stem-loop sequence is shown in capital letters, and the restriction site is shown in lowercase): Ex4.2 forward (5′-GCTACCACTGCCTTAAACTTTCAAGAGAAGTTTAAGGCAGTGGTAGCTTTTT-3′) and reverse (5′-aattAAAAAGCTACCACTGCCTTAAACTTCTCTTGAAAGTTTAAGGCAGTGGTAGCggcc-3′); NSC forward (5′-GCTCCCACCACCTTAAACTTTCAAGAGAAGTTTAAGGTGGTGGGAGCTTTTT-3′) and reverse (5′-aattAAAAAGCTCCCACCACCTTAAACTTCTCTTGAAAGTTTAAGGTGGTGGGAGCggcc-3′); sh 1-B forward (5′-GCTACTACTGCCTTAAACTTTCAAGAGAAGTTTAAGGCAGTAGTAGCTTTTT-3′) and reverse (5′-aattAAAAAGCTACTACTGCCTTAAACTTCTCTTGAAAGTTTAAGGCAGTAGTAGCggcc-3′). All constructs were verified by DNA sequencing. The pGeneClip hMGFP ID3 shRNA (stem-loop, CCCGGAGAATGATAACACTTTCTTCCTGTCAAAAGTGTTATCATTCTCCGGG) designed against a different target site and non-targeting NC control shRNA (stem-loop, GGAATCTCATTCGATGCATACCTTCCTGTCAGTATGCATCGAATGAGATTCC) were purchased from SABiosciences (Frederick, MD).
      For production of clonal population of cells stably expressing shRNAs, the vector pSuper.retro.puro (Oligoengine; Seattle, WA) encoding a puromycin resistance gene was used. The oligonucleotides annealed and subcloned into BglII/HindIII-digested pSuper.retro.puro were as follows (the stem-loop sequence is in capital letters, and the restriction site is in lowercase): sh ID3 forward (5′-gatcCCCGGAGAATGATAACACTTTCTTCCTGTCAAAAGTGTTATCATTCTCCGGGTTTTT-3′) and reverse (5′-agctAAAAACCCGGAGAATGATAACACTTTTGACAGGAAGAAAGTGTTATCATTCTCCGGG-3′); sh 1-B forward (5′-gatcGCTACTACTGCCTTAAACTTTCAAGAGAAGTTTAAGGCAGTAGTAGCTTTTT-3′) and reverse (5′-agctAAAAAGCTACTACTGCCTTAAACTTCTCTTGAAAGTTTAAGGCAGTAGTAGC-3′);NSC forward (5′gatcGCTCCCACCACCTTAAACTTTCAAGAGAAGTTTAAGGTGGTGGGAGCTTTTT-3′) and reverse (5′-agctAAAAAGCTCCCACCACCTTAAACTTCTCTTGAAAGTTTAAGGTGGTGGGAGC-3′). For selection of stable MCF7 clones, freshly established cultures were transfected with NdeI-linearized vector using Lipofectamine 2000 (Invitrogen). One day later cells were reseeded at different densities onto new dishes and plates. The following day selection for puromycin-resistant clones was started by an exchange of culture medium containing 3 μg/ml puromycin. Selected clonal populations were expanded and tested for their ability to suppress expression of exogenous and endogenous human CycG2 by immunoblot analysis (see supplemental Fig. S8).

       Antibodies (Source and Dilutions)

      Anti-α-tubulin (DM1A, MS-581, 1:10,000), anti-Chk2 (MS-1515, 1:2000), and anti-p53 (MS-186, 1:1000) mouse monoclonal antibodies were obtained from NeoMarkers. Mouse anti-GAPDH (MAB374, 1:200 000) was obtained from Millipore. Rabbit anti-phospho-Chk2(Thr-68) (#2661, 1:500), anti-phospho-Chk1(Ser-345) and -pChk1(Ser-296) (#2341 and #2349, each 1:500), anti-Chk1 (#2360, 1:4000), anti-phospho-ATM(Ser-1981) (#4526, 1:500), anti-ATM (#2873, 1:500), anti-phospho-SMC1(Ser-957) (#4805, 1:1000), anti-phospho-Cdc2(Tyr-15) (#9111, 1:1000), anti-cyclin B1 (#4138, 1:100), anti-Nbs1 (#3002, 1:500), and anti-β-actin (#4970, 1:4000) antibodies were purchased from Cell Signaling. Mouse anti-phospho-Nbs1(Ser-343) (NB100–92610, 1:500) antibodies were obtained from Novus Biologicals. The C-18 rabbit anti-CycG1 (sc-320, 1:150) and goat anti-lamin B (sc-6217, 1:80) and mouse anti-Cdc2 (sc-54, 1:1000) antibodies were purchased from Santa Cruz Biotechnology. Sheep anti-α-tubulin (ATN02, 1:100) and mouse anti-γ-tubulin (GTU-88, T6557, 1:400) were purchased from Cytoskeleton (Denver, CO) and Sigma, respectively. HRP-conjugated secondary antibodies against rabbit and mouse IgG (1:5000) were purchased from Bio-Rad and Jackson ImmunoResearch. Alexa 488-, 568-, and 660-conjugated secondary antibodies (1:1000) were purchased from Molecular Probes/Invitrogen. The CycG2-specific antibodies 68232 (1:300) and 68964 (1:500) produced in our laboratory were affinity-purified from rabbit anti-sera and tested for specificity toward CycG2 fusion proteins (see supplemental Fig. S1) essentially as described (
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ,
      • Arachchige Don A.S.
      • Dallapiazza R.F.
      • Bennin D.A.
      • Brake T.
      • Cowan C.E.
      • Horne M.C.
      Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
      ). The rabbit anti-CycG1 antibody 1133 (1:150) was generated against the peptide KLLHQLNALEQES corresponding to amino acids 12–24 of human CycG1, affinity-purified on resin-bound CycG1GST fusion proteins, and tested for sensitivity and specificity (see supplemental Fig. S1) as described (
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ,
      • Zhao L.
      • Samuels T.
      • Winckler S.
      • Korgaonkar C.
      • Tompkins V.
      • Horne M.C.
      • Quelle D.E.
      Cyclin G1 has growth inhibitory activity linked to the ARF-Mdm2-p53 and pRb tumor suppressor pathways.
      ).

       Immunoblot Analysis

      Cells were lysed in radioimmune precipitation assay buffer (10% glycerol, 1% Nonidet P-40, 0.4% deoxycholate, 0.05% SDS, 150 mm NaCl, 10 mm EDTA, 5 mm EGTA, 50 mm Tris, pH 7.4) containing protease inhibitors (pepstatin A (1 μg/ml), leupeptin (1 μg/ml), aprotinin (2 μg/ml), and phenylmethanesulfonyl fluoride (200 nm)) and phosphatase inhibitors (sodium fluoride (25 mm), sodium pyrophosphate (25 mm), p-nitrophenyl phosphate (1 mm), and microcystin (2 μm)). Cell lysates were centrifuged at 10,000 × g to remove insoluble material. Protein concentration was measured using BCA reagent (Pierce). Protein lysates were fractionated by SDS-PAGE, blotted onto PVDF membranes, and subjected to immunoblotting as previously described (
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ,
      • Arachchige Don A.S.
      • Dallapiazza R.F.
      • Bennin D.A.
      • Brake T.
      • Cowan C.E.
      • Horne M.C.
      Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
      ).

       Immunofluorescence Microscopy

      MCF10a cells were seeded at 1.5 × 105 cells/35-mm well onto a 22-mm-square glass coverslip coated with 10 mg/ml collagen and 1 μg/ml poly-l-lysine (Sigma) 14–18 h before treatment. Coverslips were removed 16 h after treatment, rinsed with PBS, and immediately fixed with ice-cold MeOH at −20 °C for 5 min. Specimens were stained and mounted, and images were collected by confocal microscopy as described (
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ).

       Cell Cycle Analysis by Flow Cytometry

      DNA content in untransfected cell cultures and stable MCF7 clones was assessed after fixation of cells with −20 °C 70% EtOH. Washed pellets of fixed cells were resuspended in PBS containing 0.25 mg/ml RNase A (Fermentas) and 50 μg/ml propidium iodide (Sigma) for 30 min at room temperature before DNA flow cytometry using a FACScan (BD Biosciences) as described (
      • Horne M.C.
      • Goolsby G.L.
      • Donaldson K.L.
      • Tran D.
      • Neubauer M.
      • Wahl A.F.
      Cyclin G1 and cyclin G2 comprise a new family of cyclins with contrasting tissue-specific and cell cycle-regulated expression.
      ,
      • Horne M.C.
      • Donaldson K.L.
      • Goolsby G.L.
      • Tran D.
      • Mulheisen M.
      • Hell J.W.
      • Wahl A.F.
      Cyclin G2 is up-regulated during growth inhibition and B cell antigen receptor-mediated cell cycle arrest.
      ,
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ). For cell cycle analysis of propidium iodide-stained DNA in GFP-expressing populations of transiently transfected HCT116, GM05849, and GM00637 cells, the GFP signal was retained by an initial 10-min fixation in PBS containing 0.5% paraformaldehyde and 10 mm EDTA before permeabilization and final fixation with −20 °C 100% methanol as described (
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ). In some experiments total DNA in live cells transiently expressing fluorescent marker proteins (e.g. GFP or RFP) was stained with Hoechst 33342, and DNA content in the unfixed fluorescent and non-fluorescent cell populations was assessed via flow cytometry using a quadruple laser LSR II flow cytometer (BD Biosciences) as described (
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ,
      • Arachchige Don A.S.
      • Dallapiazza R.F.
      • Bennin D.A.
      • Brake T.
      • Cowan C.E.
      • Horne M.C.
      Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
      ). In all cases assessment of DNA content distribution and cell cycle analysis was done using FlowJo 8.5 software. For statistical analysis, t tests and one-way analysis of variance tests (one-way ANOVA with the Tukey and Bonferroni post hoc tests) were done using Prism 4.0 software (GraphPad Software, Inc.). For indicated experiments, TOPRO negative cells were sorted on the basis of GFP expression with a MoFlo cell sorter (Beckman Coulter).

      RESULTS

       Cyclin G2-induced Cell Cycle Arrest Requires p53 and Chk2 but Is Only Partially p21-dependent

      We reported that CycG2 induces a p53-dependent cell cycle arrest in HCT116 cells (
      • Arachchige Don A.S.
      • Dallapiazza R.F.
      • Bennin D.A.
      • Brake T.
      • Cowan C.E.
      • Horne M.C.
      Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
      ). Here we examined the effect of ectopic GFP-tagged CycG2 versus GFP expression on cell cycle progression in HCT116 cells nullizygous for the DNA damage checkpoint protein Chk2 and compared the effects to those observed in similarly transfected p53 null, p21 null, and wild-type (WT) cells. As anticipated, ectopic expression of GFP alone had no discernable effect on cell cycle progression in any of the isogenic cell lines, the cell cycle profile of each transfected population being similar to the non-expressing controls (Fig. 1, A and C). Multiple experimental repeats indicated that the G1/S-phase cell cycle arrest induced by ectopic CycG2 expression requires both the presence of Chk2 and p53 (p values <0.001), whereas loss of the p53 target gene p21 had only a moderate effect on CycG2 inhibitory activity (Fig. 1, C and D). As Chk2/p53 checkpoint signaling is triggered by DNA damage-activated ATM, we tested whether ATM is required for the G1/S-phase cell cycle arrest induced by ectopic CycG2 expression (Fig. 1, B and C). Incubation of CycG2GFP-transfected cells with 10 μm of the ATM inhibitor KU55933 (
      • Hickson I.
      • Zhao Y.
      • Richardson C.J.
      • Green S.J.
      • Martin N.M.
      • Orr A.I.
      • Reaper P.M.
      • Jackson S.P.
      • Curtin N.J.
      • Smith G.C.
      Identification and characterization of a novel and specific inhibitor of the ataxia-telangiectasia mutated kinase ATM.
      ) did not block the CycG2-induced cell cycle arrest of WT HCT116 cells (Fig. 1, B and C). Moreover, in contrast to GFP alone, expression of GFP-tagged CycG2 in the ATM null cell line GM05849 triggered a similar decrease in the proportion of cells in S-phase and an increase in those in G1 phase (p values <0.01 and 0.001, respectively, Fig. 1, B and C, and supplemental Fig. S3). Together these results suggest that ectopic CycG2 expression induces a Chk2- and p53-dependent but ATM-independent G1-phase cell cycle arrest.
      Figure thumbnail gr1
      FIGURE 1Ectopic cyclin G2 expression induces a Chk2-dependent cell cycle arrest but does not require p21 or ATM. A, shown is a representative flow cytometry analysis of DNA content in live parental HCT116 (WT) and isogenic p21−/− and Chk2−/− cell cultures transiently transfected with expression plasmids for GFP-tagged CycG2 or control GFP. Histogram overlays of Hoechst 33342 stained DNA in non-expressing (red line) and GFP expressing (green area) cells from the same transfected culture. Numbers in the upper right of each histogram panel indicate the percentage of CycG2GFP- or control GFP-expressing (left, green type) and non-expressing (right, red type) cell populations in the G1- or S-phases of the cell cycle. B, shown is a representative flow cytometry analysis of DNA content in fixed ATM-deficient fibroblasts (lower panel, AT) or ATM inhibitor-treated WT HCT116 cells (upper panel) transiently transfected with expression plasmids for mCycG2GFP or control GFP. Shown are histogram overlays of propidium iodide (PI) stained DNA from KU55933 (KU)-treated mCycG2GFP-expressing (green area)- or non-expressing (red line) WT HCT116 cells in the same culture (top) and mCycG2GFP-expressing (green area) and GFP-expressing (blue line) AT cells bottom. The percentage of cells in G1 and S phases is shown in the upper right of each histogram panel. C, shown is a summary table of average percentage of population in G1, S, and G2/M phases of GFP expressing and non-expressing populations in the indicated transfected cultures (calculated from a minimum of three experimental repeats). Flow cytometry analysis of cells transfected with the indicated plasmids harvested 30–36 h (HCT116) or 48 h (ATM) post transfection. D, shown are a bar graph and statistical analysis of G1- and S-phase data presented in C using one way ANOVA with Tukey's post hoc test. Numbers embedded in each bar represent the number of experimental repeats. ***, p < 0.001; **, p < 0.01; ns indicates no significant difference found between encompassed groups.

       Ectopic Cyclin G2 Expression Induces Activation of Checkpoint Kinase Chk2

      We evaluated whether ectopic expression of CycG2 modulates Chk2 and other DDR signaling proteins. HCT116 wild-type and isogenic p53-null cells were transfected with either GFP or CycG2GFP expression vectors and assessed for expression of phospho-activated Chk2 and Chk1 (Fig. 2A). HCT116 cells treated with doxorubicin served as positive controls for induction of pChk1(Ser-345) and pChk2(Thr-68). We found in reproducible experiments that pChk2(Thr-68) expression was elevated in CycG2GFP compared with GFP-transfected cell lysates (Fig. 2A). Interestingly, pChk2(Thr-68) levels were most prominent in the p53 null cultures expressing CycG2GFP. In contrast to the pChk1(Ser-345) levels in doxorubicin treated cells, pChk1(Ser-345) expression was undetectable in transfected p53 null and WT HCT116 cell lysates. As p53 activation is downstream of Chk2 and promotes both cell cycle arrest and cell death, this finding suggests that CycG2GFP expression and the concomitant induction of Chk2 activation is better tolerated in p53 null HCT116 cells.
      Figure thumbnail gr2
      FIGURE 2Ectopic expression of CycG2 induces expression of phospho-activated forms of Chk2 and Nbs1 but not Chk1. A–C, shown are immunoblots of proteins in total lysates isolated from transiently transfected cultures of the specified cell lines probed with antibodies directed against the indicated proteins. A, expression of pChk2(Thr-68), pChk1(Ser-345), and p53 compared with total PP2A/C in transfected WT and p53−/− HCT116 cells is shown. Control immunoblots for checkpoint proteins in cell lysates from cultures treated for 24 h with (+) doxorubicin (Dox) or vehicle (−) are shown at the right. Protein loading was assessed by PP2A/C immunoblot, and total protein bands were labeled with Ponceau S (Ponce. S, bottom panel). B and C, expression levels of pNBS1(Ser-343), pChk2 (Thr-68), pChk1(Ser-296), and p53 were compared with total Chk2, Chk1, CycG2, PP2A/C, and β-actin in transiently transfected GFP-sorted WT and p53−/− (B) or WT and Chk2−/− (C) HCT116 cells. Expression levels in cells treated for 8 h with Dox served as positive controls. Protein loading was assessed by PP2A/C immunoblot and total protein bands were labeled with Ponceau S (bottom panel). -Fold increase of Chk2 phosphorylation is indicated under the figure.
      To further investigate this issue and control for differences in transfection efficiency, we repeated the immunoblot analysis on FACS-sorted cell populations of similarly transfected WT and p53 null HCT116 cultures (Fig. 2B). As before, the non-expressing populations isolated from CycG2GFP-transfected cultures did not show a modulation of phospho-Chk2 or phospho-Chk1 levels. However, lysates isolated from the sorted CycG2GFP-positive populations of both WT and p53 null cultures contained strongly increased levels of pChk2(Thr-68) and moderately elevated pNbs1(Ser-343) expression (Fig. 2B). Analogous to results shown in 2A, lysates of the CycG2GFP populations did not contain elevated levels of phospho-activated Chk1 (here pChk1(Ser-296); Fig. 2B). Repeated sorting experiments showed similar results and verified the specificity of the pChk2(Thr-68) immunosignal (Fig. 2C and supplemental Fig. S4). Again, pChk2(Thr-68) and pNbs1(Ser-343) levels were enhanced in CycG2GFP-transfected WT HCT116, but as expected pChk2(Thr-68) was absent in Chk2 null cell lysates (Fig. 2C). Moreover, as seen with lysates from unsorted GFP-transfected controls, GFP expression did not modulate pChk2(Thr-68) or pChk1(Ser-345) expression levels (supplemental Fig. S4). Similar results were found for lysates of unsorted U2OS cells transiently transfected with CycG2GFP expression constructs (supplemental Fig. S4). Together our results show that ectopic up-regulation of CycG2 levels triggers signals that induce expression of phospho-activated forms of Chk2 and Nbs1 but not phospho-Chk1.

       Endogenous Cyclin G2 Is Up-regulated during DNA Damage Responses Induced by Topoisomerase II Inhibitors and Accumulates in Nuclei of Doxorubicin-treated Cells

      Our observations prompted us to investigate CycG2 expression in cells initiating checkpoint signaling in response to chemotherapeutic agent-induced dsDNA breaks. Exposure of the immortalized non-transformed breast epithelial cell line MCF10a to either doxorubicin or etoposide up-regulated CycG2 expression up to 5-fold within the first 4 h of treatment and remained at elevated levels in cultures treated for 24 h (Fig. 3A). A comparable response was also observed in similarly treated MCF7 cells (Fig. 3B). A similar up-regulation in CycG2 expression (3–5-fold) was observed upon treatment of NIH3T3 and U2OS cells with doxorubicin (supplemental Fig. S5, A and B).
      Figure thumbnail gr3
      FIGURE 3Up-regulated expression and subcellular localization of endogenous CycG2 in cell lines responding to the dsDNA break inducing agents doxorubicin and etoposide. A and B, shown are anti-CycG2, GAPDH, and β-actin immunoblots of total protein lysates from doxorubicin (Dox), etoposide (ETP), or mock-treated (NT, −) cultures of MCF10a and MCF7 cells. A, shown is quantification of -fold up-regulation of CycG2 expression (numbers below lanes) induced by Dox and etoposide treatment relative to loading control (GAPDH) for the indicated time in MCF10a cells. B, quantification of CycG2 expression levels induced by Dox and etoposide treatment of MCF7 cells over the indicated time period is shown below each lane. C, shown is confocal immunofluorescence microscopy optical sections (0.3 μm) of Dox-treated (16 h) and non-treated (NT) MCF10a cells. MeOH-fixed cultures were stained with antibodies directed against CycG2 (G2, green), α-tubulin (α-Tub, red), and lamin B (LmB) or γ-tubulin (γ-Tub, blue). Shown are multichannel overlay images (pseudo-colored) at the top, with corresponding images of the single anti-CycG2 channel (in black and white) shown directly below. Note basal CycG2 immunosignals in NT cells and increased anti-CycG2 staining at centrosomes and within nuclei of Dox-treated cells.
      In unperturbed cells endogenous and exogenous CycG2 behave as centrosome-associated nucleocytoplasmic shuttling proteins (
      • Arachchige Don A.S.
      • Dallapiazza R.F.
      • Bennin D.A.
      • Brake T.
      • Cowan C.E.
      • Horne M.C.
      Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
      ). We examined the distribution of CycG2 in doxorubicin-treated cells. Confocal immunofluorescence microscopy of MCF10a cells showed that doxorubicin-induced up-regulation of CycG2 led to an accumulation of small bright puncta within the nuclei (39% increase in nuclear signal, p < 0.0001) of treated cells (Fig. 3C and supplement supplemental Fig. S5C). Moreover, doxorubicin treatment resulted in a 63% increase in CycG2 abundance at centrosomes (p = 0.0018) but as expected did not alter the signal intensity for the integral centrosomal protein γ-tubulin (Fig. 3C and supplemental Fig. S5C).
      To define CycG2 up-regulation in relation to activation of DDR proteins and cell cycle checkpoints, we exposed cultures of murine and human cell lines to 345 nm doxorubicin for up to 24 h, sampling the different cultures over the time course of treatment for immunoblot and cell cycle analysis. HCT116 cells are known to exhibit a minimal S-phase delay in response to DNA DSBs but do undergo a clear and potent DSB-induced G1- and G2-phase checkpoint arrest upon exposure to doxorubicin (Fig. 4A). A combination of immunoblot and cell cycle analysis of HCT116 and MCF7 cultures sampled over a time course of treatment determined that the doxorubicin-invoked increase in CycG2 levels trailed phosphorylation of the ATM/ATR target proteins, Chk2 and Chk1, but led the accumulation of cells at the G2/M boundary (Fig. 4, A and B). Although doxorubicin-induced DNA damage in U2OS and NIH3T3 cells initially results in an apparent delay in S-phase progression, the onset of a clear G2-phase checkpoint arrest was observed between 8 and 16 h of treatment. CycG2 expression was elevated in NIH3T3 cultures within 4 h of doxorubicin addition, about 2 h after the appearance of phospho-activated forms of ATM and its target SMC1, and remained at increased levels for at least 20 h (supplemental Fig. S6C). A similar analysis of CycG2, pNbs1(Ser-343) and pChk2(Thr-68) expression levels and cell cycle distribution in doxorubicin-treated U2OS cells was performed (supplemental Fig. S6D). Consistently CycG2 up-regulation followed the appearance of phospho-activated forms of early response DDR proteins by about 2 h but preceded the induction of G2-phase checkpoint arrest (Figs. 4 and supplemental Fig. S6).
      Figure thumbnail gr4
      FIGURE 4Doxorubicin-induced CycG2 up-regulation follows activation of the ATM signaling pathway but precedes accumulation of cells at the G2-phase checkpoint. A and B, top, shown are cell cycle profiles of doxorubicin (Dox)-treated HCT116 (A)and MCF7 (B) cultures. Bottom, shown is a corresponding immunoblot analysis of proteins induced in HCT116 and MCF7 cultures during the indicated time periods of Dox treatment. CycG2 expression relative to loading controls (β-actin, GAPDH, and Ponceau S) is compared with induction of pATM(Ser-1981), pNbs1(Ser-343), pChk2(Thr-68), and pChk1(Ser-296) expression and total protein levels for ATM, Nbs1, Chk2, and Chk1. Densitometry quantification of CycG2 expression relative to loading controls is shown below each lane.

       Transient Transfection of CCNG2-targeting shRNAs Blunts Doxorubicin-induced G2-phase DNA Damage Checkpoint Arrest Response in NIH3T3 and HCT116 Cells

      To test for the contribution of CycG2 to the doxorubicin-induced cell cycle checkpoint response, we generated and tested CCNG2-targeting shRNAs for their ability to knockdown (KD) CycG2 expression levels (supplemental Fig. S2). We transfected cultures with validated shRNA constructs (supplemental Fig. S2) and assayed the effect these shRNAs had on the cell cycle profile of asynchronous cultures grown in the presence or absence of doxorubicin (Fig. 5 and supplemental Fig. S7). NIH3T3 cultures were cotransfected with tracer amounts of GFP expression plasmids and either empty vector (pSilencer) or the pSilencer-Ex4.2 shRNA expression construct. After 48 h of growth, the cultures were treated with doxorubicin for 24 h. Cell cycle analysis of the GFP-expressing populations indicated that cells transfected with the Ex4.2 shRNA plasmid, in contrast to the empty vector control, did not exhibit a potent G2-phase cell cycle arrest response to doxorubicin (supplemental Fig. S7). This suggested a surprising block of the G2/M rather than the G1/S-checkpoint arrest response by CycG2 knockdown. Repeated experiments in NIH3T3 yielded similar results.
      Figure thumbnail gr5
      FIGURE 5shRNA-mediated knockdown of CycG2 inhibits doxorubicin-induced G2-phase cell cycle arrest. A, shown is a histogram overlay of DNA content in GFP-expressing populations of 24-h Dox-treated HCT116 cultures transfected 72 h earlier with control (NSC or empty vector) or CycG2 targeting (1-B) shRNA expression plasmids. Shown are non-expressing cells (blue-dotted line) and cells expressing specific shRNA 1-B (red line), the corresponding NSC (black dashed-line), or empty vector (vector, orange line). Hoechst staining of TOPRO negative cells was used to measure DNA content. The percentage of cells in each G2 phase is shown in the upper right corner in the corresponding histogram. B, shown is a bar graph of the percentage of cells in G1, S, and G2 phases of the cell cycle for cells transfected with either control (C) or shRNA 1-B (KD) plasmids. Statistical analysis (one-way ANOVA with Bonferroni's post hoc test) of data from three independent experiments is shown (*** indicates p < 0.001, ** indicates p < 0.01). ns, not significant. C, shown is comparative cell cycle analysis of vehicle control or Dox-treated HCT116 cells transfected with indicated plasmids. Shown is DNA content in non-expressing cells of each culture (blue-dotted line) and cells expressing the shRNA 1-B (red line) or shRNA ID3 (green line). Percentage of cells in each phase of the cell cycle is shown at the right of each overlay in color-coded type corresponding to the respective histogram.
      To determine whether the diminished G2/M checkpoint response in cells expressing CycG2-targeting shRNA is reproducible in human cell lines, analogous experiments with HCT116 cells were performed. HCT116 cultures were transfected with control (NSC or empty vector) or CCNG2-targeting (sh 1-B, ID3) shRNA vectors containing expression cassettes for marker fluorescent protein (RFP or GFP) and incubated for 72 h before the addition of doxorubicin or vehicle. After an additional 24-h incubation period, cultures were harvested for DNA flow cytometry (Fig. 5). As expected, shRNA-mediated repression of CycG2 did not alter the cell cycle profile of untreated asynchronous HCT116 cultures but did significantly blunt the G2/M checkpoint accumulation of doxorubicin-treated HCT116 cells (Fig. 5, A–C). In contrast to cells expressing sh 1-B, HCT116 cells transfected with expression vectors for the non-silencing control (NSC) shRNA did not exhibit an abrogation of the G2/M checkpoint (Fig. 5A). Cells transfected with empty vector also exhibited a potent G2/M checkpoint arrest response to doxorubicin (Fig. 5A). Statistical analyses indicated that KD of CycG2 in HCT116 cells results in a significant (p < 0.001) blunting of the drug-induced G2-phase arrest response (Fig. 5B). To determine whether the G2/M checkpoint attenuation by shRNAs targeting the conserved Ex4.2/1-B site could be reproduced with shRNAs targeting another CCNG2-specific site, we tested the effect that doxorubicin treatment had on HCT116 cells expressing the ID3 shRNA construct (Fig. 5C). As with expression of sh 1-B shRNA, suppression of CCNG2 via transient transfection with the ID3 shRNA construct did not alter the cell cycle distribution of untreated HCT116 cells but did potently repress the doxorubicin-induced accumulation of cells at the G2/M checkpoint (Fig. 5C). Taken together our results strongly suggested that loss of CycG2 alters the G2/M checkpoint arrest response of cells to doxorubicin.

       Stable Expression of CycG2-targeting shRNAs Attenuates Doxorubicin-induced G2-phase Checkpoint Responses in MCF7 Cells

      As CycG2 has been implicated as an important biomarker for breast cancers (
      • Le X.F.
      • Arachchige-Don A.S.
      • Mao W.
      • Horne M.C.
      • Bast Jr., R.C.
      Roles of human epidermal growth factor receptor 2, c-Jun NH2-terminal kinase, phosphoinositide 3-kinase, and p70 S6 kinase pathways in regulation of cyclin G2 expression in human breast cancer cells.
      ,
      • Frasor J.
      • Danes J.M.
      • Komm B.
      • Chang K.C.
      • Lyttle C.R.
      • Katzenellenbogen B.S.
      Profiling of estrogen up- and down-regulated gene expression in human breast cancer cells. Insights into gene networks and pathways underlying estrogenic control of proliferation and cell phenotype.
      ,
      • Adorno M.
      • Cordenonsi M.
      • Montagner M.
      • Dupont S.
      • Wong C.
      • Hann B.
      • Solari A.
      • Bobisse S.
      • Rondina M.B.
      • Guzzardo V.
      • Parenti A.R.
      • Rosato A.
      • Bicciato S.
      • Balmain A.
      • Piccolo S.
      A mutant-p53/Smad complex opposes p63 to empower TGFβ-induced metastasis.
      ), we sought to determine whether CycG2 contributes to the DNA damage checkpoint response of MCF7 breast cancer cells to doxorubicin. Puromycin-resistant clones of MCF7 cells stably harboring vectors encoding sh 1-B, NSC, and ID3 shRNAs were established and characterized (Fig. 6 and supplemental Fig. S8). Immunoblot analysis determined that both exogenous (supplemental Fig. S8A) and endogenous human (Fig. 6, A and B) CycG2 expression were strongly repressed in clones containing expression cassettes for the CycG2-targeting shRNAs sh 1-B and ID3 but not in clones harboring the NSC control shRNA vector (Fig. 6, A and B). Importantly, in contrast to NSC and wild-type MCF7 controls, those shRNA-expressing clones exhibiting significant (p < 0.001) repression of doxorubicin-induced CycG2 levels also showed an altered G2/M checkpoint arrest response to doxorubicin (Fig. 6, C and D, and supplemental Fig. S8B). This response was reproducible with multiple doxorubicin-treated CycG2 KD clones displaying a statistically significant (p values <0.01–0.001) reduction in the percentage of G2/M-arrested cells (Fig. 6D).
      Figure thumbnail gr6
      FIGURE 6Stable knockdown of CycG2 blunts the G2-phase checkpoint response of MCF7 cells to doxorubicin. A and B, shown is an immunoblot assessment of endogenous CycG2 levels relative to loading control. A, shown is endogenous CycG2 expression in the indicated cultures treated for 24 h (left) or 16 h (right) with doxorubicin (Dox, +) or vehicle alone (−). B, shown is a bar graph and statistical analysis (one-way ANOVA with Bonferroni's post hoc test) of -fold increase in CycG2 expression in cultures of MCF7 WT, NSC control, and CycG2 KD clones treated (+) with Dox or vehicle (−) for 16 h (left) or 24 h (right) (*** indicates p < 0.001, ** indicates p < 0.01). C, DNA flow cytometry analysis of cell cycle profiles in MCF7 WT, NCS control, and CycG2 KD clones after 24 h of exposure to Dox or mock (NT) treatments. D, statistical analysis of the average percentage of cells in G2/M phase of the indicated Dox treated (+) and non-treated (−) cultures (one-way ANOVA with Tukey's post hoc, ***, p < 0.001; **, p < 0.01).
      Because the closest homolog of CycG2, CycG1, is a DNA damage response protein linked to regulation of G2/M transition (
      • Shimizu A.
      • Nishida J.
      • Ueoka Y.
      • Kato K.
      • Hachiya T.
      • Kuriaki Y.
      • Wake N.
      CyclinG contributes to G2/M arrest of cells in response to DNA damage.
      ,
      • Kimura S.H.
      • Ikawa M.
      • Ito A.
      • Okabe M.
      • Nojima H.
      Cyclin G1 is involved in G2/M arrest in response to DNA damage and in growth control after damage recovery.
      ,
      • Kimura S.H.
      • Nojima H.
      Cyclin G1 associates with MDM2 and regulates accumulation and degradation of p53 protein.
      ), we assessed whether KD of CycG2 affected CycG1 expression (Fig. 7A). As predicted doxorubicin-induced DNA damage triggered up-regulation of CycG1 in MCF7 WT and NSC cells. Importantly, doxorubicin induction of CycG1 expression was maintained in all of the CycG2 KD clones (Fig. 7A and supplemental Fig. S9A). Given that ectopic CycG2-induced cell cycle arrest requires expression of Chk2 and p53 and promotes expression of the phospho-activated forms of Chk2 and Nbs1, we examined the effect CycG2 KD has on the expression of phospho-activated forms of these proteins (Fig. 7B). Notably, results indicated that, compared with the response in MCF7 WT and NSC control cells, depletion of CycG2 did not appreciably effect the DNA damage response induction of phospho-Nbs1 or -Chk2 in the KD clones (Fig. 7B). Passage from G2 phase into mitosis requires active CycB1-Cdc2 complexes, but once in mitosis cyclin B1 (CycB1) is targeted for proteasomal-mediated degradation (
      • Lindqvist A.
      • Rodríguez-Bravo V.
      • Medema R.H.
      The decision to enter mitosis. Feedback and redundancy in the mitotic entry network.
      ). Importantly, DNA damage-induced accumulation of CycB1 observed in the doxorubicin-treated WT and NSC control cells was much reduced in the CycG2-KD clones (Fig. 7C), consistent with the relative reduction in the amount of cells arrested at the G2/M boundary (Fig. 6, C and D). DNA damage signaling is known to inhibit CycB1-Cdc2 activation through maintenance of the Wee1- and Myt1 kinase-mediated inhibitory phosphorylation of Cdc2 on Thr-14 and Thr-15 (
      • Lindqvist A.
      • Rodríguez-Bravo V.
      • Medema R.H.
      The decision to enter mitosis. Feedback and redundancy in the mitotic entry network.
      ). Immunoblot analysis indicated that, in contrast to doxorubicin-treated cultures of control WT and NSC cells, Thr-15-phosphorylated Cdc2 levels were not strongly increased in drug-treated CycG2 KD clones (Fig. 7C and supplemental Fig. S9C).
      Figure thumbnail gr7
      FIGURE 7Inhibition of CycG2 expression limits doxorubicin-induced accumulation of phospho-inhibited cyclin B/Cdc2 complexes. A–D, shown is an immunoblot analysis of changes in protein expression induced by treatment of indicated MCF7 cultures with doxorubicin (Dox). A, expression of CycG1 compared with loading control GAPDH or α-tubulin (αTub) after 16 h (top) or 24 h (bottom) of Dox treatment (* denotes a nonspecific background band). B, expression of pATM(S1981), pNbs1(Ser-343), and pChk2(Thr-68) compared with total ATM, Nbs1, Chk2, and loading control α-tubulin in the indicated vehicle control (−) and Dox (+)-treated cultures. C, shown is CycB1 (top) and pCdc2(Tyr-15) (bottom) expression relative to loading control, α-tubulin, or total Cdc2 (bottom) and GAPDH in the indicated cell populations. -Fold change in protein expression compared with untreated (−) controls is indicated under brackets. D, shown is immunoblot detection of Cdc25B relative to GAPDH in designated cultures. -Fold decrease in expression level compared with untreated (−) controls is indicated under brackets.
      Activation of Cdc2 is largely promoted through dephosphorylation of its inhibitory sites by the dual specificity phosphatases Cdc25B and Cdc25C. Consistent with the known effects of genotoxic stress on Cdc25B expression levels (
      • Miyata H.
      • Doki Y.
      • Yamamoto H.
      • Kishi K.
      • Takemoto H.
      • Fujiwara Y.
      • Yasuda T.
      • Yano M.
      • Inoue M.
      • Shiozaki H.
      • Weinstein I.B.
      • Monden M.
      Overexpression of CDC25B overrides radiation-induced G2-M arrest and results in increased apoptosis in esophageal cancer cells.
      ,
      • Bansal P.
      • Lazo J.S.
      Induction of Cdc25B regulates cell cycle resumption after genotoxic stress.
      ,
      • Lemaire M.
      • Ducommun B.
      • Nebreda A.R.
      UV-induced down-regulation of the CDC25B protein in human cells.
      ), immunoblot analysis revealed reduced expression of Cdc25B in doxorubicin-treated, relative to untreated, MCF7 WT and NSC cells (Fig. 7D). Interestingly, extracts from doxorubicin-challenged CycG2 KD clones did not show a noticeable decrease in Cdc25B expression levels relative to the basal level in the respective undosed clone control (Fig. 7D). Rather, Cdc25B abundance in the doxorubicin-treated CycG2 KD clones appeared to be similar to or even increased above the level of its respective non-treated control. Although the basal level of Cdc25B in untreated cultures of CycG2 KD clones appeared lower than that in unperturbed MCF7 WT and NSC populations (Fig. 7D), the fact that this difference was not reflected by a respective increase in the percentage of CycG2 KD cells in G2/M (Fig. 6, C and D and supplemental Fig. S8B) suggests that the CycG2 KD clones have adapted to this lower basal level. Contrasting the difference in modulation of Cdc25B by doxorubicin that was observed between the CycG2-expressing and KD populations (the latter showing no decrease in Cdc25B levels), Wee1 abundance, induction of phospho-inhibited Cdc25C and modulation of Cdc25C levels were comparable among all drug-treated populations; the doxorubicin-dosed MCF7 WT, NSC, and CycG2 KD clones all exhibited a similar expression pattern (data not shown). Taken together these results suggest that blocking CycG2 up-regulation during a DNA damage response to DSBs promotes activation of CycB1-Cdc2 complexes by hindering the DDR-induced down-regulation of Cdc25B expression.

       Doxorubicin-induced Up-regulation of Cyclin G2 Is ATM-independent

      To investigate the influence of ATM activity on CycG2 expression, we first tested whether pharmacological inhibition of ATM kinase activity blunts DNA damage-induced up-regulation of CycG2 levels (Fig. 8A). Consistent with previously reported effects of caffeine on ATM/ATR activity (
      • Sarkaria J.N.
      • Busby E.C.
      • Tibbetts R.S.
      • Roos P.
      • Taya Y.
      • Karnitz L.M.
      • Abraham R.T.
      Inhibition of ATM and ATR kinase activities by the radiosensitizing agent, caffeine.
      ) and their target checkpoint kinases (
      • Zhao H.
      • Piwnica-Worms H.
      ATR-mediated checkpoint pathways regulate phosphorylation and activation of human Chk1.
      ), treatment of MCF7 cultures with doxorubicin in the continual presence of 3 mm caffeine blunted the expression of pChk1(Ser-345) but not pChk2(Thr-68) (Fig. 8A). The later may be due to the ability of DNA-PK to phosphorylate Chk2 in the absence of ATM and ATR activity (
      • Li J.
      • Stern D.F.
      Regulation of CHK2 by DNA-dependent protein kinase.
      ,
      • McSherry T.D.
      • Mueller P.R.
      Xenopus Cds1 is regulated by DNA-dependent protein kinase and ATR during the cell cycle checkpoint response to double-stranded DNA ends.
      ). Importantly, we found that 3 mm caffeine also dampened the doxorubicin-induced elevation of CycG2 expression (Fig. 8A). Cotreatment of MCF7 cells with 10 μm of the more specific ATM inhibitor KU55933 (
      • Hickson I.
      • Zhao Y.
      • Richardson C.J.
      • Green S.J.
      • Martin N.M.
      • Orr A.I.
      • Reaper P.M.
      • Jackson S.P.
      • Curtin N.J.
      • Smith G.C.
      Identification and characterization of a novel and specific inhibitor of the ataxia-telangiectasia mutated kinase ATM.
      ) had no effect on doxorubicin-induced elevation of CycG2 expression but as expected (
      • Rainey M.D.
      • Charlton M.E.
      • Stanton R.V.
      • Kastan M.B.
      Transient inhibition of ATM kinase is sufficient to enhance cellular sensitivity to ionizing radiation.
      ,
      • Shiotani B.
      • Zou L.
      Single-stranded DNA orchestrates an ATM-to-ATR switch at DNA breaks.
      ) did reduce the expression of Thr-68-phosphorylated Chk2 (Fig. 8A). These results suggest that DNA damage-mediated up-regulation of CycG2 expression does not require ATM activity.
      Figure thumbnail gr8
      FIGURE 8Up-regulation of CycG2 during doxorubicin-induced DNA damage is caffeine-sensitive but does not require ATM. A, shown is the influence of phosphoinositide 3-kinase-related kinase/ATM inhibitors caffeine (Caff) and KU55933 (KU) on doxorubicin (Dox)-induced DDR regulation of CycG2 levels in MCF7 cells assessed by immunoblotting. Increase or decrease in CycG2 expression relative to untreated control is indicated by numbers below each lane. Ponc. S, Ponceau S. B, histogram overlay of propidium iodide-stained DNA in ATM-deficient (AT) human fibroblasts after 24 h of culture with doxorubicin (gray area) compared with untreated mock control cells (black line) is shown. The percentage of untreated (NT) and doxorubicin -treated AT cells in each phase of the cell cycle is indicated at the upper right. PI, propidium iodide. C and D, shown is an immunoblot assessment of CycG2 expression relative to pNBS1(Ser-343), pChk2(Thr-68), and the loading control proteins α-actinin (α-Act) and PP2A/C in WT and AT fibroblasts cultured over a time course + or − doxorubicin (C). D, shown is CyG2 expression relative to GAPDH loading control in WT and AT cells cultured for 6 h in the presence (+) or absence (−) of doxorubicin. Note that although there is a reduced phospho-modification of Chk2 and Nbs1 in doxorubicin-treated AT compared with WT cells, doxorubicin treatment increased CycG2 expression ∼2-fold over the respective basal level for each culture.
      To further investigate the relationship of CycG2 to ATM signaling, we tested the effects of doxorubicin on CycG2 expression and cell cycle progression in cells devoid of ATM function. Importantly, although ATM-deficient cells do not maintain a G1-phase cell cycle arrest upon induction of DSBs, ATM-independent G2/M checkpoint arrest responses to genotoxic stressors (including doxorubicin) do occur (
      • Théard D.
      • Coisy M.
      • Ducommun B.
      • Concannon P.
      • Darbon J.M.
      Etoposide and adriamycin but not genistein can activate the checkpoint kinase Chk2 independently of ATM/ATR.
      ,
      • Xu B.
      • Kim S.T.
      • Lim D.S.
      • Kastan M.B.
      Two molecularly distinct G2/M checkpoints are induced by ionizing irradiation.
      ,
      • Siu W.Y.
      • Lau A.
      • Arooz T.
      • Chow J.P.
      • Ho H.T.
      • Poon R.Y.
      Topoisomerase poisons differentially activate DNA damage checkpoints through ataxia-telangiectasia mutated-dependent and -independent mechanisms.
      ,
      • Arlander S.J.
      • Greene B.T.
      • Innes C.L.
      • Paules R.S.
      DNA protein kinase-dependent G2 checkpoint revealed following knockdown of ataxia-telangiectasia mutated in human mammary epithelial cells.
      ,
      • Tomimatsu N.
      • Mukherjee B.
      • Burma S.
      Distinct roles of ATR and DNA-PKcs in triggering DNA damage responses in ATM-deficient cells.
      ). As expected, culture of the ATM-deficient (AT) human fibroblast line GM05849 with doxorubicin for 24 h did not, in contrast to WT cells, arrest them in G1 phase (Fig. 8B and supplemental Fig. S10) but did provoke a potent G2/M checkpoint arrest response (Fig. 8B). To verify that doxorubicin-induced up-regulation of CycG2 is ATM-independent, WT and AT cells were cultured in the presence of 345 nm doxorubicin or vehicle control for 2, 4, or 6 h and assessed for activation of ATM pathway signaling and CycG2 expression (Fig. 8C). Immunoblot analysis of lysates from WT cultures indicated that, as expected, levels of phospho-activated forms of Nbs1 and Chk2 increased markedly within 2 h of doxorubicin treatment. As seen in other ATM competent cells (FIGURE 3, FIGURE 4 and supplemental Figs. S5 and S6), up-regulation of CycG2 expression in AT cells was detectable within 4 h of exposure to doxorubicin, increasing 2-fold by 6 h of treatment (Fig. 8, C and D). Doxorubicin induction of pChk2(Thr-68) and pNbs1(Ser-343) expression in AT cultures was, as expected, nearly undetectable during the first 6 h of treatment. However, in contrast to the obvious deficiencies in the AT cell DDR, CycG2 expression was still up-regulated within 4 h of treatment, increasing nearly 2-fold by 6 h of treatment (Fig. 8, C and D). Notably, the basal level of CycG2 in AT cells was higher than the basal level in the WT control (Fig. 8, C and D), indicating that increased basal expression of CycG2 is better tolerated in the absence of ATM. Nevertheless, doxorubicin did up-regulate CycG2 expression over basal levels to a similar degree in both WT and AT cells (Fig. 8, C and D). Collectively our results show that DDR induction of CycG2 expression is ATM-independent.

      DISCUSSION

      CCNG2 expression is up-regulated as cells undergo cell cycle arrest in response to a variety of growth inhibitory signals (
      • Martínez-Gac L.
      • Marqués M.
      • García Z.
      • Campanero M.R.
      • Carrera A.C.
      Control of cyclin G2 mRNA expression by forkhead transcription factors. Novel mechanism for cell cycle control by phosphoinositide 3-kinase and forkhead.
      ,
      • Chen J.
      • Yusuf I.
      • Andersen H.M.
      • Fruman D.A.
      FOXO transcription factors cooperate with δEF1 to activate growth suppressive genes in B lymphocytes.
      ,
      • Horne M.C.
      • Donaldson K.L.
      • Goolsby G.L.
      • Tran D.
      • Mulheisen M.
      • Hell J.W.
      • Wahl A.F.
      Cyclin G2 is up-regulated during growth inhibition and B cell antigen receptor-mediated cell cycle arrest.
      ,
      • Le X.F.
      • Arachchige-Don A.S.
      • Mao W.
      • Horne M.C.
      • Bast Jr., R.C.
      Roles of human epidermal growth factor receptor 2, c-Jun NH2-terminal kinase, phosphoinositide 3-kinase, and p70 S6 kinase pathways in regulation of cyclin G2 expression in human breast cancer cells.
      ,
      • Xu G.
      • Bernaudo S.
      • Fu G.
      • Lee D.Y.
      • Yang B.B.
      • Peng C.
      Cyclin G2 is degraded through the ubiquitin-proteasome pathway and mediates the antiproliferative effect of activin receptor-like kinase 7.
      ,
      • Tran H.
      • Brunet A.
      • Grenier J.M.
      • Datta S.R.
      • Fornace Jr., A.J.
      • DiStefano P.S.
      • Chiang L.W.
      • Greenberg M.E.
      DNA repair pathway stimulated by the forkhead transcription factor FOXO3a through the Gadd45 protein.
      ,
      • Grolleau A.
      • Bowman J.
      • Pradet-Balade B.
      • Puravs E.
      • Hanash S.
      • Garcia-Sanz J.A.
      • Beretta L.
      Global and specific translational control by rapamycin in T cells uncovered by microarrays and proteomics.
      ,
      • Murray J.I.
      • Whitfield M.L.
      • Trinklein N.D.
      • Myers R.M.
      • Brown P.O.
      • Botstein D.
      Diverse and specific gene expression responses to stresses in cultured human cells.
      ,
      • Fang J.
      • Menon M.
      • Kapelle W.
      • Bogacheva O.
      • Bogachev O.
      • Houde E.
      • Browne S.
      • Sathyanarayana P.
      • Wojchowski D.M.
      EPO modulation of cell-cycle regulatory genes and cell division in primary bone marrow erythroblasts.
      ,
      • Bates S.
      • Rowan S.
      • Vousden K.H.
      Characterization of human cyclin G1 and G2. DNA damage inducible genes.
      ,
      • Gajate C.
      • An F.
      • Mollinedo F.
      Differential cytostatic and apoptotic effects of ecteinascidin-743 in cancer cells. Transcription-dependent cell cycle arrest and transcription-independent JNK and mitochondrial mediated apoptosis.
      ). We previously showed that unscheduled CycG2 expression inhibits DNA synthesis, blunts CDK2 (but not CDK4) activity (
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ), and induces a p53-dependent G1-phase cell cycle arrest (
      • Arachchige Don A.S.
      • Dallapiazza R.F.
      • Bennin D.A.
      • Brake T.
      • Cowan C.E.
      • Horne M.C.
      Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
      ). Similar results have since been replicated by others using various epitope-tagged forms of CycG2 in several cell lines (
      • Chen J.
      • Yusuf I.
      • Andersen H.M.
      • Fruman D.A.
      FOXO transcription factors cooperate with δEF1 to activate growth suppressive genes in B lymphocytes.
      ,
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ,
      • Kim Y.
      • Shintani S.
      • Kohno Y.
      • Zhang R.
      • Wong D.T.
      Cyclin G2 dysregulation in human oral cancer.
      ,
      • Le X.F.
      • Arachchige-Don A.S.
      • Mao W.
      • Horne M.C.
      • Bast Jr., R.C.
      Roles of human epidermal growth factor receptor 2, c-Jun NH2-terminal kinase, phosphoinositide 3-kinase, and p70 S6 kinase pathways in regulation of cyclin G2 expression in human breast cancer cells.
      ,
      • Fang J.
      • Menon M.
      • Kapelle W.
      • Bogacheva O.
      • Bogachev O.
      • Houde E.
      • Browne S.
      • Sathyanarayana P.
      • Wojchowski D.M.
      EPO modulation of cell-cycle regulatory genes and cell division in primary bone marrow erythroblasts.
      ). Here we show that the potent cell cycle arrest response of HCT116 cells to exogenous CycG2 requires intact alleles for Chk2 and p53 (Fig. 1). That loss of p21 only partially reduces CycG2-medited cell cycle inhibition suggests that additional effectors downstream of Chk2 or p53 are involved. Thr-68 phosphorylation of Chk2 by activated ATM triggers Chk2-mediated G1 checkpoint arrest responses to DNA DSBs (
      • Stracker T.H.
      • Usui T.
      • Petrini J.H.
      Taking the time to make important decisions. The checkpoint effector kinases Chk1 and Chk2 and the DNA damage response.
      ,
      • Chen Y.
      • Poon R.Y.
      The multiple checkpoint functions of CHK1 and CHK2 in maintenance of genome stability.
      ). However, the G1-phase cell cycle arrest response induced by ectopic CycG2 does not require ATM (Fig. 1). Consistent with the Chk2-dependent arrest, ectopic elevation of CycG2 also promoted the expression of the Thr-68 phospho-activated form of Chk2 (Fig. 2). Because phosphorylation of p53 by Chk2 is known to promote G1-phase checkpoint arrest (
      • Chehab N.H.
      • Malikzay A.
      • Appel M.
      • Halazonetis T.D.
      Chk2/hCds1 functions as a DNA damage checkpoint in G1 by stabilizing p53.
      ), and pChk2(Thr-68), but not pChk1(Ser-345) levels, were robustly elevated in CycG2-overexpressing WT and p53-deficient HCT116 cells (Fig. 2), the p53-dependent G1-phase arrest induced by ectopic CycG2 is likely downstream of activated Chk2.
      Unscheduled enforced expression of CycG2 in the absence of coordinated dsDNA DDR signaling ultimately has more profound effects on G1/S compared to G2/M transition. It is however unclear how CycG2 overexpression promotes expression of Thr-68 phospho-activated Chk2. As the CycG2-induced cell cycle arrest was independent of ATM, the effects of ectopic CycG2 on Chk2 are likely ATM-independent. That phosphorylation of the ATR target Chk1 was not promoted by ectopic CycG2 expression suggests that CycG2 overexpression did not activate ATR. Recent work indicates that pChk2(Thr-68) serves a DNA damage-independent function during mitosis to ensure proper spindle assembly and maintain chromosomal stability (
      • Stolz A.
      • Ertych N.
      • Kienitz A.
      • Vogel C.
      • Schneider V.
      • Fritz B.
      • Jacob R.
      • Dittmar G.
      • Weichert W.
      • Petersen I.
      • Bastians H.
      The CHK2-BRCA1 tumorsuppressor pathway ensures chromosomal stability in human somatic cells.
      ,
      • Chabalier-Taste C.
      • Racca C.
      • Dozier C.
      • Larminat F.
      BRCA1 is regulated by Chk2 in response to spindle damage.
      ). The kinases PLK1, TTK/hMps1, and DNA-PK can each interact with and phosphorylate Chk2 on Thr-68 and play DDR-independent roles in regulating mitosis and spindle assembly checkpoints (
      • Li J.
      • Stern D.F.
      Regulation of CHK2 by DNA-dependent protein kinase.
      ,
      • Chen Y.
      • Poon R.Y.
      The multiple checkpoint functions of CHK1 and CHK2 in maintenance of genome stability.
      ,
      • Tsvetkov L.
      • Xu X.
      • Li J.
      • Stern D.F.
      Polo-like kinase 1 and Chk2 interact and co-localize to centrosomes and the midbody.
      ,
      • Wei J.H.
      • Chou Y.F.
      • Ou Y.H.
      • Yeh Y.H.
      • Tyan S.W.
      • Sun T.P.
      • Shen C.Y.
      • Shieh S.Y.
      TTK/hMps1 participates in the regulation of DNA damage checkpoint response by phosphorylating CHK2 on threonine 68.
      ,
      • Lee K.J.
      • Lin Y.F.
      • Chou H.Y.
      • Yajima H.
      • Fattah K.R.
      • Lee S.C.
      • Chen B.P.
      Involvement of DNA-dependent protein kinase in normal cell cycle progression through mitosis.
      ). Because ectopic CycG2 expression promotes formation of nocodazole-resistant microtubules and aberrant nuclei (
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ), its overexpression may trigger a defective mitosis that provokes Chk2 activation through one of these kinases. As cells exit mitosis this stress response could ultimately result in a G1-phase arrest. Alternatively, as CycG2 can interact and form complexes with PP2A B56 and C subunits (
      • Bennin D.A.
      • Don A.S.
      • Brake T.
      • McKenzie J.L.
      • Rosenbaum H.
      • Ortiz L.
      • DePaoli-Roach A.A.
      • Horne M.C.
      Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
      ,
      • Rual J.F.
      • Venkatesan K.
      • Hao T.
      • Hirozane-Kishikawa T.
      • Dricot A.
      • Li N.
      • Berriz G.F.
      • Gibbons F.D.
      • Dreze M.
      • Ayivi-Guedehoussou N.
      • Klitgord N.
      • Simon C.
      • Boxem M.
      • Milstein S.
      • Rosenberg J.
      • Goldberg D.S.
      • Zhang L.V.
      • Wong S.L.
      • Franklin G.
      • Li S.
      • Albala J.S.
      • Lim J.
      • Fraughton C.
      • Llamosas E.
      • Cevik S.
      • Bex C.
      • Lamesch P.
      • Sikorski R.S.
      • Vandenhaute J.
      • Zoghbi H.Y.
      • Smolyar A.
      • Bosak S.
      • Sequerra R.
      • Doucette-Stamm L.
      • Cusick M.E.
      • Hill D.E.
      • Roth F.P.
      • Vidal M.
      Toward a proteome-scale map of the human protein-protein interaction network.
      ) and phosphorylation of Chk2 on Thr-68 is negatively regulated by B56 isoforms of PP2A (
      • Freeman A.K.
      • Dapic V.
      • Monteiro A.N.
      Negative regulation of CHK2 activity by protein phosphatase 2A is modulated by DNA damage.
      ,
      • Carlessi L.
      • Buscemi G.
      • Fontanella E.
      • Delia D.
      A protein phosphatase feedback mechanism regulates the basal phosphorylation of Chk2 kinase in the absence of DNA damage.
      ), it is possible that in otherwise unperturbed cells, overexpressed CycG2 acts as a PP2A sink and in so doing inhibits PP2A-mediated dephosphorylation of Chk2. In this context it is notable that CycG2, PP2A, and Chk2 all associate with centrosomes (
      • Arachchige Don A.S.
      • Dallapiazza R.F.
      • Bennin D.A.
      • Brake T.
      • Cowan C.E.
      • Horne M.C.
      Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
      ,
      • Bollen M.
      • Gerlich D.W.
      • Lesage B.
      Mitotic phosphatases. From entry guards to exit guides.
      ,
      • Golan A.
      • Pick E.
      • Tsvetkov L.
      • Nadler Y.
      • Kluger H.
      • Stern D.F.
      Centrosomal Chk2 in DNA damage responses and cell cycle progression.
      ).
      We explored the possibility that CycG2 contributes to cell cycle control during genotoxic stress-induced DDRs. Genotoxic topoisomerase II poisons (
      • Nitiss J.L.
      Targeting DNA topoisomerase II in cancer chemotherapy.
      ) play a central role in cancer chemotherapies. Although doxorubicin and etoposide belong to distinctly different classes of chemotherapeutics (
      • Jackson S.P.
      • Bartek J.
      The DNA-damage response in human biology and disease.
      ,
      • Nitiss J.L.
      Targeting DNA topoisomerase II in cancer chemotherapy.
      ), both induce DNA DSBs by trapping topoisomerase II-DNA intermediates and provoke a potent G2-phase checkpoint arrest in treated cells (
      • Jackson S.P.
      • Bartek J.
      The DNA-damage response in human biology and disease.
      ,
      • Nitiss J.L.
      Targeting DNA topoisomerase II in cancer chemotherapy.
      ). We found that endogenous CycG2 expression is increased up to 8-fold when cancer cells are cultured with doxorubicin or etoposide (FIGURE 3, FIGURE 4 and supplemental Figs. S5 and S6). Concordant with the idea that CycG2 is up-regulated in response to activation of DNA DSB signaling pathways, previous studies indicated significant elevation of CCNG2 mRNAs upon γ-irradiation-induced DNA damage (
      • Tsai M.H.
      • Chen X.
      • Chandramouli G.V.
      • Chen Y.
      • Yan H.
      • Zhao S.
      • Keng P.
      • Liber H.L.
      • Coleman C.N.
      • Mitchell J.B.
      • Chuang E.Y.
      Transcriptional responses to ionizing radiation reveal that p53R2 protects against radiation-induced mutagenesis in human lymphoblastoid cells.
      ). Because the doxorubicin-stimulated increase in CycG2 levels is clearly detectable within 4 h of dosing, well before an obvious arrest at the G2/M boundary (Fig. 4 and supplemental Figs. S5 and S6), this likely reflects a DDR pathway triggered up-regulation of CycG2 and not the simple accumulation of a cell cycle phase-dependent protein. That the continuous rise in CycG2 levels followed activation of ATM signaling by several hours and persisted for up to 24 h suggested that CycG2 may play a role in the maintenance of G2/M checkpoint arrest. Indeed, through transient and stable transfection of CycG2-targeting shRNA expression constructs, we determined that CycG2 contributes to the doxorubicin-induced G2/M checkpoint arrest response of NIH3T3, HCT116, and MCF7 cells (FIGURE 5, FIGURE 6, FIGURE 7 and supplemental Figs. S7 and S8).
      Doxorubicin-induced DNA damage triggers ATM and ATR activation (
      • Jackson S.P.
      • Bartek J.
      The DNA-damage response in human biology and disease.
      ,
      • Nitiss J.L.
      Targeting DNA topoisomerase II in cancer chemotherapy.
      ). Although ATR and ATM both enforce the DSB DDR delay in M-phase entry, ATR activity is thought to regulate the majority of the late (2–9 h post γ-irradiation) phase of the checkpoint response (
      • Shiotani B.
      • Zou L.
      ATR signaling at a glance.
      ,
      • Shiotani B.
      • Zou L.
      Single-stranded DNA orchestrates an ATM-to-ATR switch at DNA breaks.
      ,
      • Brown E.J.
      • Baltimore D.
      Essential and dispensable roles of ATR in cell cycle arrest and genome maintenance.
      ). In the absence of ATM, both ATR and DNA-PK regulate DNA DSB G2/M checkpoint responses (
      • Arlander S.J.
      • Greene B.T.
      • Innes C.L.
      • Paules R.S.
      DNA protein kinase-dependent G2 checkpoint revealed following knockdown of ataxia-telangiectasia mutated in human mammary epithelial cells.
      ,
      • Tomimatsu N.
      • Mukherjee B.
      • Burma S.
      Distinct roles of ATR and DNA-PKcs in triggering DNA damage responses in ATM-deficient cells.
      ). We showed (Fig. 8A) that doxorubicin induction of CycG2 (and Chk1 phosphorylation) in MCF7 cells is not blocked by 10 μm of the ATM inhibitor KU55933 (ATM IC50 = 13 nm, ATR IC50 > 100 μm (
      • Hickson I.
      • Zhao Y.
      • Richardson C.J.
      • Green S.J.
      • Martin N.M.
      • Orr A.I.
      • Reaper P.M.
      • Jackson S.P.
      • Curtin N.J.
      • Smith G.C.
      Identification and characterization of a novel and specific inhibitor of the ataxia-telangiectasia mutated kinase ATM.
      )) but is blunted by 3 mm caffeine (ATM IC50 = 0.2 mm, ATR IC50 = 1.1 mm). Moreover, we determined that this genotoxic stress elevates CycG2 expression to a similar degree in WT and ATM-deficient fibroblasts (Fig. 8, B and C). Thus, doxorubicin-triggered CycG2 up-regulation does not require early ATM-initiated signaling.
      The concentration of caffeine that repressed CycG2 expression is within the IC50 range for ATR (1.1 mm) and mTOR (0.4 mm) but severalfold lower than the IC50 for DNA-PK (10 mm) (
      • Sarkaria J.N.
      • Busby E.C.
      • Tibbetts R.S.
      • Roos P.
      • Taya Y.
      • Karnitz L.M.
      • Abraham R.T.
      Inhibition of ATM and ATR kinase activities by the radiosensitizing agent, caffeine.
      ). Because direct inhibition of mTOR (via rapamycin) promotes rather than represses CycG2 expression (
      • Le X.F.
      • Arachchige-Don A.S.
      • Mao W.
      • Horne M.C.
      • Bast Jr., R.C.
      Roles of human epidermal growth factor receptor 2, c-Jun NH2-terminal kinase, phosphoinositide 3-kinase, and p70 S6 kinase pathways in regulation of cyclin G2 expression in human breast cancer cells.
      ,
      • Grolleau A.
      • Bowman J.
      • Pradet-Balade B.
      • Puravs E.
      • Hanash S.
      • Garcia-Sanz J.A.
      • Beretta L.
      Global and specific translational control by rapamycin in T cells uncovered by microarrays and proteomics.
      ,
      • Zhou J.
      • Su P.
      • Wang L.
      • Chen J.
      • Zimmermann M.
      • Genbacev O.
      • Afonja O.
      • Horne M.C.
      • Tanaka T.
      • Duan E.
      • Fisher S.J.
      • Liao J.
      • Chen J.
      • Wang F.
      mTOR supports long term self-renewal and suppresses mesoderm and endoderm activities of human embryonic stem cells.
      ), the ability of 3 mm caffeine to repress doxorubicin-induced up-regulation of CycG2 is most likely independent of its effects on mTOR. In contrast to KU55933, caffeine did not diminish pChk2(Thr-68) levels in doxorubicin-treated MCF7 cells. However, caffeine-insensitive DNA damage induction of Chk2 phosphorylation has been reported by others (
      • Théard D.
      • Coisy M.
      • Ducommun B.
      • Concannon P.
      • Darbon J.M.
      Etoposide and adriamycin but not genistein can activate the checkpoint kinase Chk2 independently of ATM/ATR.
      ,
      • Darbon J.M.
      • Penary M.
      • Escalas N.
      • Casagrande F.
      • Goubin-Gramatica F.
      • Baudouin C.
      • Ducommun B.
      Distinct Chk2 activation pathways are triggered by genistein and DNA-damaging agents in human melanoma cells.
      ,
      • Wang X.Q.
      • Stanbridge E.J.
      • Lao X.
      • Cai Q.
      • Fan S.T.
      • Redpath J.L.
      p53-dependent Chk1 phosphorylation is required for maintenance of prolonged G2 arrest.
      ,
      • Landsverk K.S.
      • Patzke S.
      • Rein I.D.
      • Stokke C.
      • Lyng H.
      • De Angelis P.M.
      • Stokke T.
      Three independent mechanisms for arrest in G2 after ionizing radiation.
      ). DNA-PK activity is sensitive to KU55933 (IC50 = 2.5 μm), but 10 μm KU55933 did not blunt doxorubicin-induced CycG2 expression, suggesting that this response is DNA-PK-independent. The late-phase DDR increase in CycG2 levels coupled with its ATM independence and caffeine sensitivity, suggests that doxorubicin-induced CycG2 up-regulation is ATR-dependent; however, we cannot exclude DNA-PK involvement.
      The CCNG1 gene encoding the closest CycG2 homolog, CycG1, is a direct transcriptional target of p53, and its transcript levels increase severalfold in response to DNA damage (
      • Bates S.
      • Rowan S.
      • Vousden K.H.
      Characterization of human cyclin G1 and G2. DNA damage inducible genes.
      ,
      • Okamoto K.
      • Beach D.
      Cyclin G is a transcriptional target of the p53 tumor suppressor protein.
      ,
      • Zauberman A.
      • Lupo A.
      • Oren M.
      Identification of p53 target genes through immune selection of genomic DNA. The cyclin G gene contains two distinct p53 binding sites.
      ,
      • Okamoto K.
      • Prives C.
      A role of cyclin G in the process of apoptosis.
      ). Predictably, CycG1 expression was significantly up-regulated in doxorubicin-treated MCF7 cells (Figs. 7A and supplemental Fig. S9). Importantly we found that doxorubicin-induced DDR elevation of endogenous CycG1 expression was unaffected by shRNA-mediated KD of CycG2, further indicating the specificity of our CCNG2-targeting shRNA constructs. CycG1 has been linked to G2/M checkpoint control (
      • Shimizu A.
      • Nishida J.
      • Ueoka Y.
      • Kato K.
      • Hachiya T.
      • Kuriaki Y.
      • Wake N.
      CyclinG contributes to G2/M arrest of cells in response to DNA damage.
      ,
      • Kimura S.H.
      • Ikawa M.
      • Ito A.
      • Okabe M.
      • Nojima H.
      Cyclin G1 is involved in G2/M arrest in response to DNA damage and in growth control after damage recovery.
      ,
      • Kimura S.H.
      • Nojima H.
      Cyclin G1 associates with MDM2 and regulates accumulation and degradation of p53 protein.
      ); however, whether it promotes or inhibits either cell cycle arrest or cell death in response to DNA damage is controversial (
      • Shimizu A.
      • Nishida J.
      • Ueoka Y.
      • Kato K.
      • Hachiya T.
      • Kuriaki Y.
      • Wake N.
      CyclinG contributes to G2/M arrest of cells in response to DNA damage.
      ,
      • Kimura S.H.
      • Ikawa M.
      • Ito A.
      • Okabe M.
      • Nojima H.
      Cyclin G1 is involved in G2/M arrest in response to DNA damage and in growth control after damage recovery.
      ,
      • Kimura S.H.
      • Nojima H.
      Cyclin G1 associates with MDM2 and regulates accumulation and degradation of p53 protein.
      ,
      • Okamoto K.
      • Prives C.
      A role of cyclin G in the process of apoptosis.
      ,
      • Ohtsuka T.
      • Jensen M.R.
      • Kim H.G.
      • Kim K.T.
      • Lee S.W.
      The negative role of cyclin G in ATM-dependent p53 activation.
      ,
      • Seo H.R.
      • Lee D.H.
      • Lee H.J.
      • Baek M.
      • Bae S.
      • Soh J.W.
      • Lee S.J.
      • Kim J.
      • Lee Y.S.
      Cyclin G1 overcomes radiation-induced G2 arrest and increases cell death through transcriptional activation of cyclin B1.
      ). Because CycG2 depleted cells exhibited a reduced G2/M checkpoint despite the rise in CycG1 levels suggests that CycG1 does not compensate for loss of CycG2 and that these two homologs do not serve fully redundant functions.
      In variance with the effects of ectopic CycG2 expression on Chk2, shRNA-mediated blunting of CycG2 in MCF7 cells had no affect on the DDR-induced elevation of pChk2(Thr-68) (Fig. 7B). CycB1 expression levels are normally increased as cells enter G2 phase and decreased as cells proceed through mitosis (
      • Lindqvist A.
      • Rodríguez-Bravo V.
      • Medema R.H.
      The decision to enter mitosis. Feedback and redundancy in the mitotic entry network.
      ). As predicted, the doxorubicin-triggered G2/M checkpoint led to accumulation of CycB1 levels in WT and shRNA control cultures. In contrast, CycG2 KD clones did not show increased CycB1 expression under the same conditions (Fig. 7C). In accord with their blunted G2/M checkpoint arrest response, doxorubicin-treated CycG2 KD clones also exhibited diminished levels of phospho-inhibited Cdc2 when compared with treated WT and shRNA controls (Fig. 7C). Inhibitory phosphorylation of Cdc2 on Thr-14 and Thr-15 by the Myt1 and Wee1 kinases is counterbalanced by the Cdc25 phosphatases that dephosphorylate these sites (
      • Stracker T.H.
      • Usui T.
      • Petrini J.H.
      Taking the time to make important decisions. The checkpoint effector kinases Chk1 and Chk2 and the DNA damage response.
      ,
      • Lindqvist A.
      • Rodríguez-Bravo V.
      • Medema R.H.
      The decision to enter mitosis. Feedback and redundancy in the mitotic entry network.
      ). During DDR signaling the dual specificity phosphatases Cdc25B and Cdc25C are themselves subject to Chk1 and Chk2 inhibitory phosphorylation that promotes Cdc25 degradation and/or restricted subcellular localization (
      • Lindqvist A.
      • Rodríguez-Bravo V.
      • Medema R.H.
      The decision to enter mitosis. Feedback and redundancy in the mitotic entry network.
      ). Although Cdc25B expression is not required for G2/M transition in otherwise unperturbed somatic cell populations, it is essential for resumption of cell cycle progression after DNA damage-induced checkpoint arrest (
      • Lindqvist A.
      • Rodríguez-Bravo V.
      • Medema R.H.
      The decision to enter mitosis. Feedback and redundancy in the mitotic entry network.
      ). We found that Cdc25B levels were diminished in doxorubicin-treated compared with mock-treated WT and NSC cells, but no such doxorubicin-induced decrease from base-line levels was apparent for the CycG2 KD clones. Given that increasing Cdc25B expression levels even moderately impairs G2/M checkpoint control (
      • Bansal P.
      • Lazo J.S.
      Induction of Cdc25B regulates cell cycle resumption after genotoxic stress.
      ,
      • Bugler B.
      • Quaranta M.
      • Aressy B.
      • Brezak M.C.
      • Prevost G.
      • Ducommun B.
      Genotoxic-activated G2-M checkpoint exit is dependent on CDC25B phosphatase expression.
      ,
      • Aressy B.
      • Bugler B.
      • Valette A.
      • Biard D.
      • Ducommun B.
      Moderate variations in CDC25B protein levels modulate the response to DNA damaging agents.
      ), our results (FIGURE 6, FIGURE 7) suggest that the weakened G2/M checkpoint arrest in CycG2 KD cells is due to a disruption of the regulatory circuit controlling Cdc25B expression. Thus, CycG2 may contribute to G2/M checkpoint enforcement by constraining the Cdc25B/CycB1-Cdc2 axis.
      CCNG2 transcripts are up-regulated during G1-phase cell cycle arrest responses to a variety of DDR-independent anti-mitogenic signaling cascades (
      • Martínez-Gac L.
      • Marqués M.
      • García Z.
      • Campanero M.R.
      • Carrera A.C.
      Control of cyclin G2 mRNA expression by forkhead transcription factors. Novel mechanism for cell cycle control by phosphoinositide 3-kinase and forkhead.
      ,
      • Horne M.C.
      • Donaldson K.L.
      • Goolsby G.L.
      • Tran D.
      • Mulheisen M.
      • Hell J.W.
      • Wahl A.F.
      Cyclin G2 is up-regulated during growth inhibition and B cell antigen receptor-mediated cell cycle arrest.
      ,
      • Le X.F.
      • Arachchige-Don A.S.
      • Mao W.
      • Horne M.C.
      • Bast Jr., R.C.
      Roles of human epidermal growth factor receptor 2, c-Jun NH2-terminal kinase, phosphoinositide 3-kinase, and p70 S6 kinase pathways in regulation of cyclin G2 expression in human breast cancer cells.
      ,
      • Xu G.
      • Bernaudo S.
      • Fu G.
      • Lee D.Y.
      • Yang B.B.
      • Peng C.
      Cyclin G2 is degraded through the ubiquitin-proteasome pathway and mediates the antiproliferative effect of activin receptor-like kinase 7.
      ). RNAi KD of CCNG2 has been shown to blunt the G1-phase arrest response to some of these growth inhibitory signals (
      • Kim Y.
      • Shintani S.
      • Kohno Y.
      • Zhang R.
      • Wong D.T.
      Cyclin G2 dysregulation in human oral cancer.
      ,
      • Xu G.
      • Bernaudo S.
      • Fu G.
      • Lee D.Y.
      • Yang B.B.
      • Peng C.
      Cyclin G2 is degraded through the ubiquitin-proteasome pathway and mediates the antiproliferative effect of activin receptor-like kinase 7.
      ). Given these observations and the effects that ectopic CycG2 expression has on G1/S phase transition, the diminished G2/M checkpoint arrest response of CycG2 KD cells to doxorubicin was somewhat surprising. However, such seemingly contradictory findings are not unprecedented for cell cycle inhibitors and have been described for both p53 and p21 (
      • Harper J.W.
      • Adami G.R.
      • Wei N.
      • Keyomarsi K.
      • Elledge S.J.
      The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases.
      ,
      • Waldman T.
      • Kinzler K.W.
      • Vogelstein B.
      p21 is necessary for the p53-mediated G1 arrest in human cancer cells.
      ,
      • Bunz F.
      • Dutriaux A.
      • Lengauer C.
      • Waldman T.
      • Zhou S.
      • Brown J.P.
      • Sedivy J.M.
      • Kinzler K.W.
      • Vogelstein B.
      Requirement for p53 and p21 to sustain G2 arrest after DNA damage.
      ,
      • Lee J.
      • Kim J.A.
      • Barbier V.
      • Fotedar A.
      • Fotedar R.
      DNA damage triggers p21WAF1-dependent Emi1 down-regulation that maintains G2 arrest.
      ,
      • Cazzalini O.
      • Scovassi A.I.
      • Savio M.
      • Stivala L.A.
      • Prosperi E.
      Multiple roles of the cell cycle inhibitor p21(CDKN1A) in the DNA damage response.
      ). Although most of the evidence in the literature supports a role for CycG2 in limiting G1/S-phase transition, there are indications that CycG2 could participate in G2/M regulation (
      • Adorno M.
      • Cordenonsi M.
      • Montagner M.
      • Dupont S.
      • Wong C.
      • Hann B.
      • Solari A.
      • Bobisse S.
      • Rondina M.B.
      • Guzzardo V.
      • Parenti A.R.
      • Rosato A.
      • Bicciato S.
      • Balmain A.
      • Piccolo S.
      A mutant-p53/Smad complex opposes p63 to empower TGFβ-induced metastasis.
      ,
      • Shimada M.
      • Nakadai T.
      • Tamura T.A.
      TATA-binding protein-like protein (TLP/TRF2/TLF) negatively regulates cell cycle progression and is required for the stress-mediated G2 checkpoint.
      ,
      • Suenaga Y.
      • Ozaki T.
      • Tanaka Y.
      • Bu Y.
      • Kamijo T.
      • Tokuhisa T.
      • Nakagawara A.
      • Tamura T.A.
      TATA-binding protein (TBP)-like protein is engaged in etoposide-induced apoptosis through transcriptional activation of human TAp63 gene.
      ,
      • Welcsh P.L.
      • Lee M.K.
      • Gonzalez-Hernandez R.M.
      • Black D.J.
      • Mahadevappa M.
      • Swisher E.M.
      • Warrington J.A.
      • King M.C.
      BRCA1 transcriptionally regulates genes involved in breast tumorigenesis.
      ,
      • Bae I.
      • Fan S.
      • Meng Q.
      • Rih J.K.
      • Kim H.J.
      • Kang H.J.
      • Xu J.
      • Goldberg I.D.
      • Jaiswal A.K.
      • Rosen E.M.
      BRCA1 induces antioxidant gene expression and resistance to oxidative stress.
      ). The idea that CycG2 has a regulatory function in G2/M-phase transition is also supported by the discovery that CycG2 is a substrate of the anaphase promoting complex (APC), being both ubiquitinated and degraded in mitotic cell extracts enriched with APC-Cdc20 complexes (
      • Merbl Y.
      • Kirschner M.W.
      Large scale detection of ubiquitination substrates using cell extracts and protein microarrays.
      ). Consistent with the notion that CycG2 helps restrict G2/M transition, we show for the first time that 1) a caffeine-sensitive but KU55933-insensitive and ATM-independent DDR pathway promotes CycG2 up-regulation during the late phase of doxorubicin-induced G2/M checkpoint and 2) that CycG2 depletion attenuates G2/M checkpoint-induced down-regulation of Cdc25B, inhibitory phosphorylation of Cdc2, and accumulation of CycB1. Given the report that elevated CycG1 expression promotes transcriptional activation of CycB1 and abrogation of G2/M checkpoint arrest (
      • Seo H.R.
      • Lee D.H.
      • Lee H.J.
      • Baek M.
      • Bae S.
      • Soh J.W.
      • Lee S.J.
      • Kim J.
      • Lee Y.S.
      Cyclin G1 overcomes radiation-induced G2 arrest and increases cell death through transcriptional activation of cyclin B1.
      ), it is possible that there is a Yin and Yang relationship between these two G-type cyclins and that CycG2 acts to restrict CycG1-associated activity during DNA damage responses. The single CycG homolog in Drosophila is an essential protein for embryonic development that restricts cell proliferation and growth (
      • Faradji F.
      • Bloyer S.
      • Dardalhon-Cuménal D.
      • Randsholt N.B.
      • Peronnet F.
      Drosophila melanogaster cyclin G coordinates cell growth and cell proliferation.
      ). Whether the two mammalian CycG paralogs evolved to serve opposing or complementary functions is an open question. Future studies will be needed to determine the exact mechanism by which CycG2 modulates the Cdc25B-Cdc2/CycB1 regulatory loop during G2/M checkpoint.

      Acknowledgments

      We thank Dr. Bert Vogelstein (Johns Hopkins University) for the mutant HCT116 cell lines and Dr. Ashok Venkitaraman (Hutchison/MRC Research Centre, Cambridge, UK) for human cyclin G1 plasmids. We express our gratitude to Dr. Lucas Matt (University of California, Davis) for assistance with Image J software data analysis, to Justin Fishbaugh and Gene Hess of the Holden Comprehensive Cancer Center Flow Cytometry Facility (University of Iowa), and Carol Oxford of the UC Davis Cancer Center Flow Cytometry Facility for expert technical support. We thank Drs. Johannes Hell and Xinbin Chen (University of California, Davis) for critical reading of the manuscript.

      Supplementary Material

      REFERENCES

        • Jackson S.P.
        • Bartek J.
        The DNA-damage response in human biology and disease.
        Nature. 2009; 461: 1071-1078
        • Lovejoy C.A.
        • Cortez D.
        Common mechanisms of PIKK regulation.
        DNA Repair. 2009; 8: 1004-1008
        • Derheimer F.A.
        • Kastan M.B.
        Multiple roles of ATM in monitoring and maintaining DNA integrity.
        FEBS Lett. 2010; 584: 3675-3681
        • Shiotani B.
        • Zou L.
        ATR signaling at a glance.
        J. Cell Sci. 2009; 122: 301-304
        • Hill R.
        • Lee P.W.
        The DNA-dependent protein kinase (DNA-PK). More than just a case of making ends meet?.
        Cell Cycle. 2010; 9: 3460-3469
        • Stracker T.H.
        • Usui T.
        • Petrini J.H.
        Taking the time to make important decisions. The checkpoint effector kinases Chk1 and Chk2 and the DNA damage response.
        DNA Repair. 2009; 8: 1047-1054
        • Jazayeri A.
        • Falck J.
        • Lukas C.
        • Bartek J.
        • Smith G.C.
        • Lukas J.
        • Jackson S.P.
        ATM- and cell cycle-dependent regulation of ATR in response to DNA double-strand breaks.
        Nat. Cell Biol. 2006; 8: 37-45
        • Lindqvist A.
        • Rodríguez-Bravo V.
        • Medema R.H.
        The decision to enter mitosis. Feedback and redundancy in the mitotic entry network.
        J. Cell Biol. 2009; 185: 193-202
        • Martínez-Gac L.
        • Marqués M.
        • García Z.
        • Campanero M.R.
        • Carrera A.C.
        Control of cyclin G2 mRNA expression by forkhead transcription factors. Novel mechanism for cell cycle control by phosphoinositide 3-kinase and forkhead.
        Mol. Cell. Biol. 2004; 24: 2181-2189
        • Chen J.
        • Yusuf I.
        • Andersen H.M.
        • Fruman D.A.
        FOXO transcription factors cooperate with δEF1 to activate growth suppressive genes in B lymphocytes.
        J. Immunol. 2006; 176: 2711-2721
        • Horne M.C.
        • Goolsby G.L.
        • Donaldson K.L.
        • Tran D.
        • Neubauer M.
        • Wahl A.F.
        Cyclin G1 and cyclin G2 comprise a new family of cyclins with contrasting tissue-specific and cell cycle-regulated expression.
        J. Biol. Chem. 1996; 271: 6050-6061
        • Horne M.C.
        • Donaldson K.L.
        • Goolsby G.L.
        • Tran D.
        • Mulheisen M.
        • Hell J.W.
        • Wahl A.F.
        Cyclin G2 is up-regulated during growth inhibition and B cell antigen receptor-mediated cell cycle arrest.
        J. Biol. Chem. 1997; 272: 12650-12661
        • Bennin D.A.
        • Don A.S.
        • Brake T.
        • McKenzie J.L.
        • Rosenbaum H.
        • Ortiz L.
        • DePaoli-Roach A.A.
        • Horne M.C.
        Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.
        J. Biol. Chem. 2002; 277: 27449-27467
        • Kim Y.
        • Shintani S.
        • Kohno Y.
        • Zhang R.
        • Wong D.T.
        Cyclin G2 dysregulation in human oral cancer.
        Cancer Res. 2004; 64: 8980-8986
        • Arachchige Don A.S.
        • Dallapiazza R.F.
        • Bennin D.A.
        • Brake T.
        • Cowan C.E.
        • Horne M.C.
        Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest.
        Exp. Cell Res. 2006; 312: 4181-4204
        • Le X.F.
        • Arachchige-Don A.S.
        • Mao W.
        • Horne M.C.
        • Bast Jr., R.C.
        Roles of human epidermal growth factor receptor 2, c-Jun NH2-terminal kinase, phosphoinositide 3-kinase, and p70 S6 kinase pathways in regulation of cyclin G2 expression in human breast cancer cells.
        Mol. Cancer Ther. 2007; 6: 2843-2857
        • Xu G.
        • Bernaudo S.
        • Fu G.
        • Lee D.Y.
        • Yang B.B.
        • Peng C.
        Cyclin G2 is degraded through the ubiquitin-proteasome pathway and mediates the antiproliferative effect of activin receptor-like kinase 7.
        Mol. Biol. Cell. 2008; 19: 4968-4979
        • Tran H.
        • Brunet A.
        • Grenier J.M.
        • Datta S.R.
        • Fornace Jr., A.J.
        • DiStefano P.S.
        • Chiang L.W.
        • Greenberg M.E.
        DNA repair pathway stimulated by the forkhead transcription factor FOXO3a through the Gadd45 protein.
        Science. 2002; 296: 530-534
        • Grolleau A.
        • Bowman J.
        • Pradet-Balade B.
        • Puravs E.
        • Hanash S.
        • Garcia-Sanz J.A.
        • Beretta L.
        Global and specific translational control by rapamycin in T cells uncovered by microarrays and proteomics.
        J. Biol. Chem. 2002; 277: 22175-22184
        • Frasor J.
        • Danes J.M.
        • Komm B.
        • Chang K.C.
        • Lyttle C.R.
        • Katzenellenbogen B.S.
        Profiling of estrogen up- and down-regulated gene expression in human breast cancer cells. Insights into gene networks and pathways underlying estrogenic control of proliferation and cell phenotype.
        Endocrinology. 2003; 144: 4562-4574
        • Oliver T.G.
        • Grasfeder L.L.
        • Carroll A.L.
        • Kaiser C.
        • Gillingham C.L.
        • Lin S.M.
        • Wickramasinghe R.
        • Scott M.P.
        • Wechsler-Reya R.J.
        Transcriptional profiling of the Sonic hedgehog response. A critical role for N-myc in proliferation of neuronal precursors.
        Proc. Natl. Acad. Sci. U.S.A. 2003; 100: 7331-7336
        • Murray J.I.
        • Whitfield M.L.
        • Trinklein N.D.
        • Myers R.M.
        • Brown P.O.
        • Botstein D.
        Diverse and specific gene expression responses to stresses in cultured human cells.
        Mol. Biol. Cell. 2004; 15: 2361-2374
        • Zhu X.
        • Hart R.
        • Chang M.S.
        • Kim J.W.
        • Lee S.Y.
        • Cao Y.A.
        • Mock D.
        • Ke E.
        • Saunders B.
        • Alexander A.
        • Grossoehme J.
        • Lin K.M.
        • Yan Z.
        • Hsueh R.
        • Lee J.
        • Scheuermann R.H.
        • Fruman D.A.
        • Seaman W.
        • Subramaniam S.
        • Sternweis P.
        • Simon M.I.
        • Choi S.
        Analysis of the major patterns of B cell gene expression changes in response to short-term stimulation with 33 single ligands.
        J. Immunol. 2004; 173: 7141-7149
        • Fang J.
        • Menon M.
        • Kapelle W.
        • Bogacheva O.
        • Bogachev O.
        • Houde E.
        • Browne S.
        • Sathyanarayana P.
        • Wojchowski D.M.
        EPO modulation of cell-cycle regulatory genes and cell division in primary bone marrow erythroblasts.
        Blood. 2007; 110: 2361-2370
        • Bates S.
        • Rowan S.
        • Vousden K.H.
        Characterization of human cyclin G1 and G2. DNA damage inducible genes.
        Oncogene. 1996; 13: 1103-1109
        • Gajate C.
        • An F.
        • Mollinedo F.
        Differential cytostatic and apoptotic effects of ecteinascidin-743 in cancer cells. Transcription-dependent cell cycle arrest and transcription-independent JNK and mitochondrial mediated apoptosis.
        J. Biol. Chem. 2002; 277: 41580-41589
        • Okamoto K.
        • Beach D.
        Cyclin G is a transcriptional target of the p53 tumor suppressor protein.
        EMBO J. 1994; 13: 4816-4822
        • Zauberman A.
        • Lupo A.
        • Oren M.
        Identification of p53 target genes through immune selection of genomic DNA. The cyclin G gene contains two distinct p53 binding sites.
        Oncogene. 1995; 10: 2361-2366
        • Jensen M.R.
        • Audolfsson T.
        • Keck C.L.
        • Zimonjic D.B.
        • Thorgeirsson S.S.
        Gene structure and chromosomal localization of mouse cyclin G2 (Ccng2).
        Gene. 1999; 230: 171-180
        • Adorno M.
        • Cordenonsi M.
        • Montagner M.
        • Dupont S.
        • Wong C.
        • Hann B.
        • Solari A.
        • Bobisse S.
        • Rondina M.B.
        • Guzzardo V.
        • Parenti A.R.
        • Rosato A.
        • Bicciato S.
        • Balmain A.
        • Piccolo S.
        A mutant-p53/Smad complex opposes p63 to empower TGFβ-induced metastasis.
        Cell. 2009; 137: 87-98
        • Ito Y.
        • Yoshida H.
        • Uruno T.
        • Nakano K.
        • Takamura Y.
        • Miya A.
        • Kobayashi K.
        • Yokozawa T.
        • Matsuzuka F.
        • Kuma K.
        • Miyauchi A.
        Decreased expression of cyclin G2 is significantly linked to the malignant transformation of papillary carcinoma of the thyroid.
        Anticancer Res. 2003; 23: 2335-2338
        • Nitiss J.L.
        Targeting DNA topoisomerase II in cancer chemotherapy.
        Nat. Rev. Cancer. 2009; 9: 338-350
        • Zhao L.
        • Samuels T.
        • Winckler S.
        • Korgaonkar C.
        • Tompkins V.
        • Horne M.C.
        • Quelle D.E.
        Cyclin G1 has growth inhibitory activity linked to the ARF-Mdm2-p53 and pRb tumor suppressor pathways.
        Mol. Cancer Res. 2003; 1: 195-206
        • Hickson I.
        • Zhao Y.
        • Richardson C.J.
        • Green S.J.
        • Martin N.M.
        • Orr A.I.
        • Reaper P.M.
        • Jackson S.P.
        • Curtin N.J.
        • Smith G.C.
        Identification and characterization of a novel and specific inhibitor of the ataxia-telangiectasia mutated kinase ATM.
        Cancer Res. 2004; 64: 9152-9159
        • Shimizu A.
        • Nishida J.
        • Ueoka Y.
        • Kato K.
        • Hachiya T.
        • Kuriaki Y.
        • Wake N.
        CyclinG contributes to G2/M arrest of cells in response to DNA damage.
        Biochem. Biophys. Res. Commun. 1998; 242: 529-533
        • Kimura S.H.
        • Ikawa M.
        • Ito A.
        • Okabe M.
        • Nojima H.
        Cyclin G1 is involved in G2/M arrest in response to DNA damage and in growth control after damage recovery.
        Oncogene. 2001; 20: 3290-3300
        • Kimura S.H.
        • Nojima H.
        Cyclin G1 associates with MDM2 and regulates accumulation and degradation of p53 protein.
        Genes Cells. 2002; 7: 869-880
        • Miyata H.
        • Doki Y.
        • Yamamoto H.
        • Kishi K.
        • Takemoto H.
        • Fujiwara Y.
        • Yasuda T.
        • Yano M.
        • Inoue M.
        • Shiozaki H.
        • Weinstein I.B.
        • Monden M.
        Overexpression of CDC25B overrides radiation-induced G2-M arrest and results in increased apoptosis in esophageal cancer cells.
        Cancer Res. 2001; 61: 3188-3193
        • Bansal P.
        • Lazo J.S.
        Induction of Cdc25B regulates cell cycle resumption after genotoxic stress.
        Cancer Res. 2007; 67: 3356-3363
        • Lemaire M.
        • Ducommun B.
        • Nebreda A.R.
        UV-induced down-regulation of the CDC25B protein in human cells.
        FEBS Lett. 2010; 584: 1199-1204
        • Sarkaria J.N.
        • Busby E.C.
        • Tibbetts R.S.
        • Roos P.
        • Taya Y.
        • Karnitz L.M.
        • Abraham R.T.
        Inhibition of ATM and ATR kinase activities by the radiosensitizing agent, caffeine.
        Cancer Res. 1999; 59: 4375-4382
        • Zhao H.
        • Piwnica-Worms H.
        ATR-mediated checkpoint pathways regulate phosphorylation and activation of human Chk1.
        Mol. Cell. Biol. 2001; 21: 4129-4139
        • Li J.
        • Stern D.F.
        Regulation of CHK2 by DNA-dependent protein kinase.
        J. Biol. Chem. 2005; 280: 12041-12050
        • McSherry T.D.
        • Mueller P.R.
        Xenopus Cds1 is regulated by DNA-dependent protein kinase and ATR during the cell cycle checkpoint response to double-stranded DNA ends.
        Mol. Cell. Biol. 2004; 24: 9968-9985
        • Rainey M.D.
        • Charlton M.E.
        • Stanton R.V.
        • Kastan M.B.
        Transient inhibition of ATM kinase is sufficient to enhance cellular sensitivity to ionizing radiation.
        Cancer Res. 2008; 68: 7466-7474
        • Shiotani B.
        • Zou L.
        Single-stranded DNA orchestrates an ATM-to-ATR switch at DNA breaks.
        Mol. Cell. 2009; 33: 547-558
        • Théard D.
        • Coisy M.
        • Ducommun B.
        • Concannon P.
        • Darbon J.M.
        Etoposide and adriamycin but not genistein can activate the checkpoint kinase Chk2 independently of ATM/ATR.
        Biochem. Biophys. Res. Commun. 2001; 289: 1199-1204
        • Xu B.
        • Kim S.T.
        • Lim D.S.
        • Kastan M.B.
        Two molecularly distinct G2/M checkpoints are induced by ionizing irradiation.
        Mol. Cell. Biol. 2002; 22: 1049-1059
        • Siu W.Y.
        • Lau A.
        • Arooz T.
        • Chow J.P.
        • Ho H.T.
        • Poon R.Y.
        Topoisomerase poisons differentially activate DNA damage checkpoints through ataxia-telangiectasia mutated-dependent and -independent mechanisms.
        Mol. Cancer Ther. 2004; 3: 621-632
        • Arlander S.J.
        • Greene B.T.
        • Innes C.L.
        • Paules R.S.
        DNA protein kinase-dependent G2 checkpoint revealed following knockdown of ataxia-telangiectasia mutated in human mammary epithelial cells.
        Cancer Res. 2008; 68: 89-97
        • Tomimatsu N.
        • Mukherjee B.
        • Burma S.
        Distinct roles of ATR and DNA-PKcs in triggering DNA damage responses in ATM-deficient cells.
        EMBO Rep. 2009; 10: 629-635
        • Chen Y.
        • Poon R.Y.
        The multiple checkpoint functions of CHK1 and CHK2 in maintenance of genome stability.
        Front Biosci. 2008; 13: 5016-5029
        • Chehab N.H.
        • Malikzay A.
        • Appel M.
        • Halazonetis T.D.
        Chk2/hCds1 functions as a DNA damage checkpoint in G1 by stabilizing p53.
        Genes Dev. 2000; 14: 278-288
        • Stolz A.
        • Ertych N.
        • Kienitz A.
        • Vogel C.
        • Schneider V.
        • Fritz B.
        • Jacob R.
        • Dittmar G.
        • Weichert W.
        • Petersen I.
        • Bastians H.
        The CHK2-BRCA1 tumorsuppressor pathway ensures chromosomal stability in human somatic cells.
        Nat. Cell Biol. 2010; 12: 492-499
        • Chabalier-Taste C.
        • Racca C.
        • Dozier C.
        • Larminat F.
        BRCA1 is regulated by Chk2 in response to spindle damage.
        Biochim. Biophys. Acta. 2008; 1783: 2223-2233
        • Tsvetkov L.
        • Xu X.
        • Li J.
        • Stern D.F.
        Polo-like kinase 1 and Chk2 interact and co-localize to centrosomes and the midbody.
        J. Biol. Chem. 2003; 278: 8468-8475
        • Wei J.H.
        • Chou Y.F.
        • Ou Y.H.
        • Yeh Y.H.
        • Tyan S.W.
        • Sun T.P.
        • Shen C.Y.
        • Shieh S.Y.
        TTK/hMps1 participates in the regulation of DNA damage checkpoint response by phosphorylating CHK2 on threonine 68.
        J. Biol. Chem. 2005; 280: 7748-7757
        • Lee K.J.
        • Lin Y.F.
        • Chou H.Y.
        • Yajima H.
        • Fattah K.R.
        • Lee S.C.
        • Chen B.P.
        Involvement of DNA-dependent protein kinase in normal cell cycle progression through mitosis.
        J. Biol. Chem. 2011; 286: 12796-12802
        • Rual J.F.
        • Venkatesan K.
        • Hao T.
        • Hirozane-Kishikawa T.
        • Dricot A.
        • Li N.
        • Berriz G.F.
        • Gibbons F.D.
        • Dreze M.
        • Ayivi-Guedehoussou N.
        • Klitgord N.
        • Simon C.
        • Boxem M.
        • Milstein S.
        • Rosenberg J.
        • Goldberg D.S.
        • Zhang L.V.
        • Wong S.L.
        • Franklin G.
        • Li S.
        • Albala J.S.
        • Lim J.
        • Fraughton C.
        • Llamosas E.
        • Cevik S.
        • Bex C.
        • Lamesch P.
        • Sikorski R.S.
        • Vandenhaute J.
        • Zoghbi H.Y.
        • Smolyar A.
        • Bosak S.
        • Sequerra R.
        • Doucette-Stamm L.
        • Cusick M.E.
        • Hill D.E.
        • Roth F.P.
        • Vidal M.
        Toward a proteome-scale map of the human protein-protein interaction network.
        Nature. 2005; 437: 1173-1178
        • Freeman A.K.
        • Dapic V.
        • Monteiro A.N.
        Negative regulation of CHK2 activity by protein phosphatase 2A is modulated by DNA damage.
        Cell Cycle. 2010; 9: 736-747
        • Carlessi L.
        • Buscemi G.
        • Fontanella E.
        • Delia D.
        A protein phosphatase feedback mechanism regulates the basal phosphorylation of Chk2 kinase in the absence of DNA damage.
        Biochim. Biophys. Acta. 2010; 1803: 1213-1223
        • Bollen M.
        • Gerlich D.W.
        • Lesage B.
        Mitotic phosphatases. From entry guards to exit guides.
        Trends Cell Biol. 2009; 19: 531-541
        • Golan A.
        • Pick E.
        • Tsvetkov L.
        • Nadler Y.
        • Kluger H.
        • Stern D.F.
        Centrosomal Chk2 in DNA damage responses and cell cycle progression.
        Cell Cycle. 2010; 9: 2647-2656
        • Tsai M.H.
        • Chen X.
        • Chandramouli G.V.
        • Chen Y.
        • Yan H.
        • Zhao S.
        • Keng P.
        • Liber H.L.
        • Coleman C.N.
        • Mitchell J.B.
        • Chuang E.Y.
        Transcriptional responses to ionizing radiation reveal that p53R2 protects against radiation-induced mutagenesis in human lymphoblastoid cells.
        Oncogene. 2006; 25: 622-632
        • Brown E.J.
        • Baltimore D.
        Essential and dispensable roles of ATR in cell cycle arrest and genome maintenance.
        Genes Dev. 2003; 17: 615-628
        • Zhou J.
        • Su P.
        • Wang L.
        • Chen J.
        • Zimmermann M.
        • Genbacev O.
        • Afonja O.
        • Horne M.C.
        • Tanaka T.
        • Duan E.
        • Fisher S.J.
        • Liao J.
        • Chen J.
        • Wang F.
        mTOR supports long term self-renewal and suppresses mesoderm and endoderm activities of human embryonic stem cells.
        Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 7840-7845
        • Darbon J.M.
        • Penary M.
        • Escalas N.
        • Casagrande F.
        • Goubin-Gramatica F.
        • Baudouin C.
        • Ducommun B.
        Distinct Chk2 activation pathways are triggered by genistein and DNA-damaging agents in human melanoma cells.
        J. Biol. Chem. 2000; 275: 15363-15369
        • Wang X.Q.
        • Stanbridge E.J.
        • Lao X.
        • Cai Q.
        • Fan S.T.
        • Redpath J.L.
        p53-dependent Chk1 phosphorylation is required for maintenance of prolonged G2 arrest.
        Radiat. Res. 2007; 168: 706-715
        • Landsverk K.S.
        • Patzke S.
        • Rein I.D.
        • Stokke C.
        • Lyng H.
        • De Angelis P.M.
        • Stokke T.
        Three independent mechanisms for arrest in G2 after ionizing radiation.
        Cell Cycle. 2011; 10: 819-829
        • Okamoto K.
        • Prives C.
        A role of cyclin G in the process of apoptosis.
        Oncogene. 1999; 18: 4606-4615
        • Ohtsuka T.
        • Jensen M.R.
        • Kim H.G.
        • Kim K.T.
        • Lee S.W.
        The negative role of cyclin G in ATM-dependent p53 activation.
        Oncogene. 2004; 23: 5405-5408
        • Seo H.R.
        • Lee D.H.
        • Lee H.J.
        • Baek M.
        • Bae S.
        • Soh J.W.
        • Lee S.J.
        • Kim J.
        • Lee Y.S.
        Cyclin G1 overcomes radiation-induced G2 arrest and increases cell death through transcriptional activation of cyclin B1.
        Cell Death Differ. 2006; 13: 1475-1484
        • Bugler B.
        • Quaranta M.
        • Aressy B.
        • Brezak M.C.
        • Prevost G.
        • Ducommun B.
        Genotoxic-activated G2-M checkpoint exit is dependent on CDC25B phosphatase expression.
        Mol. Cancer Ther. 2006; 5: 1446-1451
        • Aressy B.
        • Bugler B.
        • Valette A.
        • Biard D.
        • Ducommun B.
        Moderate variations in CDC25B protein levels modulate the response to DNA damaging agents.
        Cell Cycle. 2008; 7: 2234-2240
        • Harper J.W.
        • Adami G.R.
        • Wei N.
        • Keyomarsi K.
        • Elledge S.J.
        The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases.
        Cell. 1993; 75: 805-816
        • Waldman T.
        • Kinzler K.W.
        • Vogelstein B.
        p21 is necessary for the p53-mediated G1 arrest in human cancer cells.
        Cancer Res. 1995; 55: 5187-5190
        • Bunz F.
        • Dutriaux A.
        • Lengauer C.
        • Waldman T.
        • Zhou S.
        • Brown J.P.
        • Sedivy J.M.
        • Kinzler K.W.
        • Vogelstein B.
        Requirement for p53 and p21 to sustain G2 arrest after DNA damage.
        Science. 1998; 282: 1497-1501
        • Lee J.
        • Kim J.A.
        • Barbier V.
        • Fotedar A.
        • Fotedar R.
        DNA damage triggers p21WAF1-dependent Emi1 down-regulation that maintains G2 arrest.
        Mol. Biol. Cell. 2009; 20: 1891-1902
        • Cazzalini O.
        • Scovassi A.I.
        • Savio M.
        • Stivala L.A.
        • Prosperi E.
        Multiple roles of the cell cycle inhibitor p21(CDKN1A) in the DNA damage response.
        Mutat. Res. 2010; 704: 12-20
        • Shimada M.
        • Nakadai T.
        • Tamura T.A.
        TATA-binding protein-like protein (TLP/TRF2/TLF) negatively regulates cell cycle progression and is required for the stress-mediated G2 checkpoint.
        Mol. Cell. Biol. 2003; 23: 4107-4120
        • Suenaga Y.
        • Ozaki T.
        • Tanaka Y.
        • Bu Y.
        • Kamijo T.
        • Tokuhisa T.
        • Nakagawara A.
        • Tamura T.A.
        TATA-binding protein (TBP)-like protein is engaged in etoposide-induced apoptosis through transcriptional activation of human TAp63 gene.
        J. Biol. Chem. 2009; 284: 35433-35440
        • Welcsh P.L.
        • Lee M.K.
        • Gonzalez-Hernandez R.M.
        • Black D.J.
        • Mahadevappa M.
        • Swisher E.M.
        • Warrington J.A.
        • King M.C.
        BRCA1 transcriptionally regulates genes involved in breast tumorigenesis.
        Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 7560-7565
        • Bae I.
        • Fan S.
        • Meng Q.
        • Rih J.K.
        • Kim H.J.
        • Kang H.J.
        • Xu J.
        • Goldberg I.D.
        • Jaiswal A.K.
        • Rosen E.M.
        BRCA1 induces antioxidant gene expression and resistance to oxidative stress.
        Cancer Res. 2004; 64: 7893-7909
        • Merbl Y.
        • Kirschner M.W.
        Large scale detection of ubiquitination substrates using cell extracts and protein microarrays.
        Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 2543-2548
        • Faradji F.
        • Bloyer S.
        • Dardalhon-Cuménal D.
        • Randsholt N.B.
        • Peronnet F.
        Drosophila melanogaster cyclin G coordinates cell growth and cell proliferation.
        Cell Cycle. 2011; 10: 805-818