Advertisement

Affinity Purification and Structural Features of the Yeast Vacuolar ATPase Vo Membrane Sector*

  • Sergio Couoh-Cardel
    Affiliations
    Department of Biochemistry and Molecular Biology, State University of New York Upstate Medical University, Syracuse, New York 13210
    Search for articles by this author
  • Elena Milgrom
    Affiliations
    Department of Biochemistry and Molecular Biology, State University of New York Upstate Medical University, Syracuse, New York 13210
    Search for articles by this author
  • Stephan Wilkens
    Correspondence
    To whom correspondence should be addressed. Tel.: 315-464-8703; Fax: 315-464-8705
    Affiliations
    Department of Biochemistry and Molecular Biology, State University of New York Upstate Medical University, Syracuse, New York 13210
    Search for articles by this author
  • Author Footnotes
    * This work was supported by National Institutes of Health Grant GM058600 (to S. W.). The authors declare that they have no conflicts of interest with the contents of this article.
      The membrane sector (Vo) of the proton pumping vacuolar ATPase (V-ATPase, V1Vo-ATPase) from Saccharomyces cerevisiae was purified to homogeneity, and its structure was characterized by EM of single molecules and two-dimensional crystals. Projection images of negatively stained Vo two-dimensional crystals showed a ring-like structure with a large asymmetric mass at the periphery of the ring. A cryo-EM reconstruction of Vo from single-particle images showed subunits a and d in close contact on the cytoplasmic side of the proton channel. A comparison of three-dimensional reconstructions of free Vo and Vo as part of holo V1Vo revealed that the cytoplasmic N-terminal domain of subunit a (aNT) must undergo a large conformational change upon enzyme disassembly or (re)assembly from Vo, V1, and subunit C. Isothermal titration calorimetry using recombinant subunit d and aNT revealed that the two proteins bind each other with a Kd of ∼5 μm. Treatment of the purified Vo sector with 1-palmitoyl-2-hydroxy-sn-glycero-3-[phospho-rac-(1-glycerol)] resulted in selective release of subunit d, allowing purification of a VoΔd complex. Passive proton translocation assays revealed that both Vo and VoΔd are impermeable to protons. We speculate that the structural change in subunit a upon release of V1 from Vo during reversible enzyme dissociation plays a role in blocking passive proton translocation across free Vo and that the interaction between aNT and d seen in free Vo functions to stabilize the Vo sector for efficient reassembly of V1Vo.

      Introduction

      Vacuolar H+-ATPases (V-ATPases, V1Vo-ATPases)
      The abbreviations used are: V-ATPase
      vacuolar ATPase
      DDM
      dodecyl maltoside
      UnDM
      undecyl-β-d-maltoside
      LPPG
      1-palmitoyl-2-hydroxy-sn-glycero-3-[phospho-rac-(1-glycerol)]
      DOPC
      1,2-dioleoyl-sn-glycerol-3-phosphocholine
      TAP
      tandem affinity purification
      BME
      β-mercaptoethanol
      SAXS
      small-angle X-ray scattering
      MBP
      maltose binding protein
      ITC
      isothermal titration calorimetry
      PI(3,5)P2
      phosphatidylinositol 3,5-bisphosphate.
      are large, multisubunit protein complexes that are found in the endomembrane system of all eukaryotic organisms, where they function to acidify the lumen of intracellular organelles (
      • Forgac M.
      Vacuolar ATPases: rotary proton pumps in physiology and pathophysiology.
      ,
      • Kane P.M.
      The long physiological reach of the yeast vacuolar H+-ATPase.
      ,
      • Sun-Wada G.H.
      • Wada Y.
      • Futai M.
      Diverse and essential roles of mammalian vacuolar-type proton pump ATPase: toward the physiological understanding of inside acidic compartments.
      ). In specialized cells of higher eukaryotes, V-ATPases are also found in the plasma membrane, where the enzyme is pumping protons into the extracellular milieu (
      • Forgac M.
      Vacuolar ATPases: rotary proton pumps in physiology and pathophysiology.
      ,
      • Blake-Palmer K.G.
      • Karet F.E.
      Cellular physiology of the renal H+ATPase.
      ). Aberrant V-ATPase function has been shown to be associated with numerous widespread human conditions, including renal tubular acidosis (
      • Smith A.N.
      • Skaug J.
      • Choate K.A.
      • Nayir A.
      • Bakkaloglu A.
      • Ozen S.
      • Hulton S.A.
      • Sanjad S.A.
      • Al-Sabban E.A.
      • Lifton R.P.
      • Scherer S.W.
      • Karet F.E.
      Mutations in ATP6N1B, encoding a new kidney vacuolar proton pump 116-kD subunit, cause recessive distal renal tubular acidosis with preserved hearing.
      ), sensorineural deafness (
      • Karet F.E.
      • Finberg K.E.
      • Nelson R.D.
      • Nayir A.
      • Mocan H.
      • Sanjad S.A.
      • Rodriguez-Soriano J.
      • Santos F.
      • Cremers C.W.
      • Di Pietro A.
      • Hoffbrand B.I.
      • Winiarski J.
      • Bakkaloglu A.
      • Ozen S.
      • Dusunsel R.
      • Goodyer P.
      • Hulton S.A.
      • Wu D.K.
      • Skvorak A.B.
      • Morton C.C.
      • Cunningham M.J.
      • Jha V.
      • Lifton R.P.
      Mutations in the gene encoding B1 subunit of H+-ATPase cause renal tubular acidosis with sensorineural deafness.
      ), osteoporosis (
      • Thudium C.S.
      • Jensen V.K.
      • Karsdal M.A.
      • Henriksen K.
      Disruption of the V-ATPase functionality as a way to uncouple bone formation and resorption: a novel target for treatment of osteoporosis.
      ), diabetes (
      • Sun-Wada G.H.
      • Toyomura T.
      • Murata Y.
      • Yamamoto A.
      • Futai M.
      • Wada Y.
      The a3 isoform of V-ATPase regulates insulin secretion from pancreatic β-cells.
      ), microbial (
      • Wong D.
      • Bach H.
      • Sun J.
      • Hmama Z.
      • Av-Gay Y.
      Mycobacterium tuberculosis protein tyrosine phosphatase (PtpA) excludes host vacuolar-H+-ATPase to inhibit phagosome acidification.
      ) and viral infection (
      • Lu X.
      • Yu H.
      • Liu S.H.
      • Brodsky F.M.
      • Peterlin B.M.
      Interactions between HIV1 Nef and vacuolar ATPase facilitate the internalization of CD4.
      ), infertility (
      • Brown D.
      • Smith P.J.
      • Breton S.
      Role of V-ATPase-rich cells in acidification of the male reproductive tract.
      ), and cancer (
      • Sennoune S.R.
      • Bakunts K.
      • Martínez G.M.
      • Chua-Tuan J.L.
      • Kebir Y.
      • Attaya M.N.
      • Martínez-Zaguilán R.
      Vacuolar H+-ATPase in human breast cancer cells with distinct metastatic potential: distribution and functional activity.
      ). V-ATPase has therefore been deemed a valuable drug target (
      • Johnson R.M.
      • Allen C.
      • Melman S.D.
      • Waller A.
      • Young S.M.
      • Sklar L.A.
      • Parra K.J.
      Identification of inhibitors of vacuolar proton-translocating ATPase pumps in yeast by high-throughput screening flow cytometry.
      ,
      • Kartner N.
      • Manolson M.F.
      Novel techniques in the development of osteoporosis drug therapy: the osteoclast ruffled-border vacuolar H+-ATPase as an emerging target.
      ,
      • Fais S.
      • De Milito A.
      • You H.
      • Qin W.
      Targeting vacuolar H+-ATPases as a new strategy against cancer.
      ). However, lack of detailed structural information has limited the application of structure-based drug discovery so far.
      V-ATPase can be divided into an ATP-hydrolyzing catalytic headpiece, V1, and a membrane-embedded proton-translocating sector, Vo. The subunit composition of the enzyme from the model organism Saccharomyces cerevisiae is A3B3(C)DE3FG3H for V1 (
      • Kitagawa N.
      • Mazon H.
      • Heck A.J.
      • Wilkens S.
      Stoichiometry of the peripheral stalk subunits E and G of yeast V1-ATPase determined by mass spectrometry.
      ) and ac8ccde for Vo (
      • Powell B.
      • Graham L.A.
      • Stevens T.H.
      Molecular characterization of the yeast vacuolar H+-ATPase proton pore.
      ,
      • Zhao J.
      • Benlekbir S.
      • Rubinstein J.L.
      Electron cryomicroscopy observation of rotational states in a eukaryotic V-ATPase.
      ). Crystal structures of the bacterial V1-ATPase from Enterococcus hirae show the three A and B subunits arranged in an alternating fashion around a central cavity within which are located the N- and C-terminal ends of subunit D (
      • Arai S.
      • Saijo S.
      • Suzuki K.
      • Mizutani K.
      • Kakinuma Y.
      • Ishizuka-Katsura Y.
      • Ohsawa N.
      • Terada T.
      • Shirouzu M.
      • Yokoyama S.
      • Iwata S.
      • Yamato I.
      • Murata T.
      Rotation mechanism of Enterococcus hirae V1-ATPase based on asymmetric crystal structures.
      ). The proton channel is formed at the interface of the ring of the c, c′, and c″ subunits (“proteolipid” ring) and the C-terminal domain of subunit a (aCT) (
      • Powell B.
      • Graham L.A.
      • Stevens T.H.
      Molecular characterization of the yeast vacuolar H+-ATPase proton pore.
      ,
      • Kawasaki-Nishi S.
      • Nishi T.
      • Forgac M.
      Arg-735 of the 100-kDa subunit a of the yeast V-ATPase is essential for proton translocation.
      ). V-ATPase is a member of the family of rotary molecular motor enzymes that, next to V-ATPase, includes F-ATP synthase, found in bacteria, mitochondria, and chloroplasts; archaeal A-ATP synthase; and bacterial A/V-like ATPase (
      • Muench S.P.
      • Trinick J.
      • Harrison M.A.
      Structural divergence of the rotary ATPases.
      ,
      • Wilkens S.
      Rotary molecular motors.
      ,
      • Stewart A.G.
      • Sobti M.
      • Harvey R.P.
      • Stock D.
      Rotary ATPases: models, machine elements and technical specifications.
      ). In eukaryotic V-ATPase, ATP hydrolysis taking place at three catalytic sites located at the interface of the A and B subunits on the membrane extrinsic V1 is coupled to proton translocation across the Vo via a central rotor formed by the DF heterodimer of the V1 and the subunit d-proteolipid ring subcomplex of the Vo. Three peripheral stalks, formed by subunit EG heterodimers together with the single-copy H and C subunits, form the stator that links the catalytic sector to the membrane-embedded proton channel via aNT, and that functions to withstand the torque generated during rotary catalysis (Fig. 1A). However, unlike the related F-, A- and bacterial V-type motors, eukaryotic vacuolar ATPase is regulated by a reversible disassembly and reassembly mechanism employed by the organism to modulate the activity of the complex in response to, e.g., nutrient availability or developmental state (
      • Sumner J.P.
      • Dow J.A.
      • Earley F.G.
      • Klein U.
      • Jäger D.
      • Wieczorek H.
      Regulation of plasma membrane V-ATPase activity by dissociation of peripheral subunits.
      ,
      • Kane P.M.
      Disassembly and reassembly of the yeast vacuolar H+-ATPase in vivo.
      ). The mechanism of reversible disassembly has been studied extensively in the yeast system, and it is known that V-ATPase dissociation results in a cytoplasmic V1 and a membrane-bound Vo, with the activity of the two sectors silenced (
      • Parra K.J.
      • Keenan K.L.
      • Kane P.M.
      The H subunit (Vma13p) of the yeast V-ATPase inhibits the ATPase activity of cytosolic V1 complexes.
      ,
      • Gräf R.
      • Harvey W.R.
      • Wieczorek H.
      Purification and properties of a cytosolic V1-ATPase.
      ) (Fig. 1B). In isolated V1, magnesium ATPase activity is silenced by subunit H, possibly together with inhibitory magnesium ADP (
      • Parra K.J.
      • Keenan K.L.
      • Kane P.M.
      The H subunit (Vma13p) of the yeast V-ATPase inhibits the ATPase activity of cytosolic V1 complexes.
      ,
      • Diab H.
      • Ohira M.
      • Liu M.
      • Cobb E.
      • Kane P.M.
      Subunit interactions and requirements for inhibition of the yeast V1-ATPase.
      ). The mechanism of blocking passive proton translocation across isolated Vo, however, is less well understood, in part because of a lack of detailed structural information for the eukaryotic V-ATPase membrane sector.
      Figure thumbnail gr1
      FIGURE 1Yeast V-ATPase subunit architecture and regulation by reversible disassembly. A, schematic of yeast V-ATPase subunit architecture. B, V-ATPaseis regulated by nutrient-dependent reversible disassembly, resulting in V1 and Vo sectors that have no magnesium ATPase and passive proton translocation activity, respectively. The rotor is shown in green, the stator in red/orange, the catalytic core in cyan/blue, and subunit H in purple.
      Previously, we obtained three-dimensional reconstructions of free Vo (
      • Wilkens S.
      • Forgac M.
      Three-dimensional structure of the vacuolar ATPase proton channel by electron microscopy.
      ) and holo V-ATPase from bovine brain clathrin-coated vesicles (
      • Wilkens S.
      • Inoue T.
      • Forgac M.
      Three-dimensional structure of the vacuolar ATPase: localization of subunit H by difference imaging and chemical cross-linking.
      ) and yeast vacuoles (
      • Zhang Z.
      • Zheng Y.
      • Mazon H.
      • Milgrom E.
      • Kitagawa N.
      • Kish-Trier E.
      • Heck A.J.
      • Kane P.M.
      • Wilkens S.
      Structure of the yeast vacuolar ATPase.
      ), and, by fitting available crystal structures into the EM density, we were able to generate a pseudo-atomic model of the enzyme from yeast (
      • Zhang Z.
      • Zheng Y.
      • Mazon H.
      • Milgrom E.
      • Kitagawa N.
      • Kish-Trier E.
      • Heck A.J.
      • Kane P.M.
      • Wilkens S.
      Structure of the yeast vacuolar ATPase.
      ). Recent intermediate-resolution cryo-EM reconstructions of yeast (
      • Zhao J.
      • Benlekbir S.
      • Rubinstein J.L.
      Electron cryomicroscopy observation of rotational states in a eukaryotic V-ATPase.
      ,
      • Benlekbir S.
      • Bueler S.A.
      • Rubinstein J.L.
      Structure of the vacuolar-type ATPase from Saccharomyces cerevisiae at 11-A resolution.
      ) and insect (
      • Rawson S.
      • Phillips C.
      • Huss M.
      • Tiburcy F.
      • Wieczorek H.
      • Trinick J.
      • Harrison M.A.
      • Muench S.P.
      Structure of the vacuolar H+-ATPase rotary motor reveals new mechanistic insights.
      ) V-ATPase provided additional structural detail and allowed a first view “inside” the membrane sector of the complex.
      Here we developed a procedure for purifying the yeast Vo sector amenable for biochemical and biophysical characterization. Electron microscopy of Vo single particles and two-dimensional crystals showed a ring-like structure with additional protein densities at the periphery and cytoplasmic side of the ring. A comparison of the structure of free versus holo V-ATPase-bound Vo revealed that enzyme regulation by reversible disassembly involves a large structural rearrangement of aNT from a peripheral position seen in V1Vo (where aNT interacts with subunit C and the peripheral stator EG2) to a position in free Vo where aNT binds subunit d. We speculate that the conformational change in aNT that accompanies V-ATPase dissociation plays a role in activity-silencing in the isolated Vo sector and that the interaction between subunit d and aNT seen only in free Vo stabilizes the membrane sector to ensure efficient reassembly of the holo enzyme.

      Experimental Procedures

       Reagents

      Dodecyl maltoside (DDM), undecyl-β-d-maltoside (UnDM), and CHAPS were from Anatrace. 1-palmitoyl-2-hydroxy-sn-glycero-3-[phospho-rac-(1-glycerol)] (LPPG), phosphatidylcholine, phosphatidic acid, and 1,2-dioleoyl-sn-glycerol-3-phosphocholine (DOPC) were obtained from Avanti. Calmodulin-Sepharose beads were from GE Healthcare or Agilent, and 9-amino-6-chloro-2-methoxyacridine dye was from Invitrogen. The anti-TAP tag polyclonal antibody directed against the amino acid sequence upstream of the tobacco etch virus protease cleavage site was from GenScript. All other reagents were of analytical grade.

       Yeast Strains and Growth

      Yeast strain YSC1178-7502926 with a TAP tag fused at the C terminus of subunit a (aTAP) was from Open Biosystems. To disrupt the subunit B (Vma2p) gene in YSC1178-7502926, a fragment of genomic DNA containing the NAT1 fragment was amplified by PCR from genomic DNA of strain BY4741 vma2Δ::nat1 using oligonucleotides vma2-840 5′-GAATCGGCTAGAGATTACAAC-3′ and vma2-c4 5′-CATGTTCTTCGAGACCGGGTTG G-3′. The resulting 1.2-kb product was used to transform YSC1178-7502926. Transformed colonies were selected on yeast extract (10 g/liter), peptone (20 g/liter), dextrose (20 g/liter) plates supplemented with 100 μg/ml ClonNat (nourseothricin, Werner BioAgents). Colonies were further selected on the basis of their ability to grow on yeast extract, peptone, dextrose buffered to pH 5.0 but not on yeast extract, peptone, dextrose buffered to pH 7.5 + 60 mm CaCl2. Western blot analysis of whole-cell lysates using anti-TAP and anti-subunit B antibodies were performed to confirm the presence and absence of aTAP and subunit B, respectively. The resulting strain was grown in yeast extract, peptone, dextrose supplemented with 50 mm KH2PO4 and 50 mm succinic acid (pH 5). For large-scale biomass production, cells from 8–10 liters of flask culture (A600 ∼7) were collected by centrifugation, transferred to a 10-liter fermenter, and grown to the second diauxic log phase. Cells were harvested by centrifugation, washed once with distilled water, and stored at −80 °C until use. Final cell weight was 8–10 g/liter of culture.

       Isolation of Membranes

      All steps were performed at 4 °C unless noted otherwise. Cells were resuspended in lysis buffer (20 mm Tris-HCl, 150 mm NaCl (pH 7.4) (TBS) supplemented with 8% sucrose, 2% sorbitol, and 2% glucose), and an inhibitor mixture was added to a final concentration of 2 μg/ml leupeptin, 2 μg/ml pepstatin A, 0.5 μg/ml chymostatin, and 1 mm PMSF. 1 mm EDTA was added before disrupting cells in a homemade bead beater using 0.5 mm Zirconia beads (BioSpec), keeping the temperature below 14 °C inside the chamber. Cell debris was removed by low-speed centrifugation (1200 × g, 10 min), and crude membranes were collected by ultracentrifugation at 130,000 × g for 1 h and washed once in lysis buffer. The final membrane pellet was resuspended in the presence of the inhibitor mixture mentioned above. Protein concentration was measured, and membranes were frozen at −80 °C until use.

       Vo Purification

      Isolated membranes were diluted to a final concentration of 10 mg/ml in lysis buffer, and inhibitor mixture was added. Extraction was carried out by adding DDM from a 20% stock solution in water to a final concentration of 2 mg of detergent/1 mg of protein, followed by gentle stirring for 1 h. Extracted membranes were cleared by ultracentrifugation at 106,000 × g for 1 h, and the pellet was discarded. The supernatant was collected carefully, avoiding the upper lipid layer, and CaCl2 was added to a final concentration of 4 mm. The mixture was incubated with 4 ml of Calmodulin beads for 1 h at 4 °C under gentle agitation. The beads were collected in a chromatography column and washed with 20 column volumes of 10 mm Tris-HCl (pH 8), 10 mm β-mercaptoethanol (BME), 2 mm CaCl2, 0.1% DDM, 150 mm NaCl, and 20 column volumes of the same buffer without NaCl. The column was eluted with 10 mm Tris-HCl (pH 8), 10 mm BME, 0.5 mm EGTA, and 0.1% DDM. Fractions were analyzed by 13% SDS-PAGE, and fractions containing Vo were pooled and concentrated in a 100-kDa Vivaspin concentrator (Sartorius Stedim Biotech).

       Glycerol Gradient Centrifugation and Removal of Subunit d

      1 mg of purified Vo was applied to the top of a discontinuous glycerol gradient (15–35% (v/v), 10 mm Tris-HCl (pH 8), 10 mm BME, 0.5 mm EGTA, and 0.01% phosphatidylcholine:phosphatidic acid (19:1)) and centrifuged at 200,000 × g for 16 h at 4 °C. For removal of subunit d, 0.05% LPPG was included in the gradient. Otherwise, 0.5% CHAPS was used. Fractions were collected from the bottom and analyzed by SDS-PAGE.

       Reconstitution in Liposomes

      200 μg of Vo (in CHAPS) or subunit d-depleted Vo (VoΔd) (in LPPG) was mixed with 15 mg of phosphatidylcholine:phosphatidic acid (19:1 v/v) and adjusted with CHAPS to 6%. In some experiments, 9% ergosterol was included in the reconstitution mix. Samples were applied to a Sephadex G50 column (50 cm × 1.6 cm) and eluted with high-potassium buffer (20 mm HEPES (pH 7), 2 mm BME, 0.2 mm EGTA, 10% glycerol, 100 mm K2SO4, and 0.5 mg/ml fatty acid-free BSA) at a flow rate of 0.5 ml/min. The eluate was collected in 1-ml fractions, and turbid fractions were analyzed by 13% SDS-PAGE and silver staining.

       Passive Proton Translocation Assay

      Proton translocation assays were performed as described by Qi and Forgac (
      • Qi J.
      • Forgac M.
      Function and subunit interactions of the N-terminal domain of subunit a (Vph1p) of the yeast V-ATPase.
      ). Briefly, assays were conducted in a 3-ml cuvette. 30 μl of each fraction was preincubated in high-sodium buffer (20 mm HEPES (pH 7), 2 mm BME, 0.2 mm EGTA, 10% glycerol, 150 mm NaCl, and 0.5 mg/ml fatty acid-free BSA) for 5 min at 30 °C in the presence of 2 μm 9-amino-6-chloro-2-methoxyacridine. After 300-s incubation, the process was started by addition of 1 μm valinomycin, followed by 1 μm carbonyl cyanide p-trifluoromethoxyphenylhydrazone. Different fractions were probed after 1, 4, and 10 days. Six independent preparations of Vo and Vo-d were analyzed.

       Flotation Assays

      To verify lipid vesicle reconstitution of Vo and Vo-d, fractions from the G50 column (fraction 29 for Vo and fraction 28 for Vo-d) were adjusted with sucrose to 53% and placed in the bottom of an 11-ml tube. A sucrose step gradient (40, 20, and 0% (w/v) in 20 mm HEPES (pH 7), 2 mm BME, 0.2 mm EGTA, 10% glycerol, and 150 mm NaCl) was layered on top of the Vo sample and centrifuged at 200,000 × g for 16 h at 4 °C. Fractions were collected from the top of the tube and analyzed by 13% SDS-PAGE and silver staining.

       Mass Spectrometry of Vo Subunits

      The Vo sector was precipitated with 1% trichloroacetic acid, and the centrifuged pellet was washed with water. The pellet was extracted with a 1:1 mixture of water and trifluoroethanol, and the soluble fraction was analyzed by electrospray ionization mass spectrometry using a Q-TOF Micro mass spectrometer (Waters, Inc.) in positive ion mode. Charge envelopes between 800–2500 m/z were deconvoluted using MaxEnt2 as implemented in MassLynx4.1. Calibration of the instrument was carried out with phosphoric acid and sodium/cesium iodide. Analysis of gel bands by peptide sequencing was done at the Upstate Medical University mass spectrometry core facility using a Thermo LTQ Orbitrap mass spectrometer.

       Small-angle X-ray Scattering Analysis

      Small-angle x-ray scattering (SAXS) data were collected at the Cornell High-energy Synchrotron Source (MacCHESS) F2 beam line operating at a wavelength of 1.2524 Å at 4 °C. For SAXS data collection, Vo was purified using UnDM instead of DDM. Vo was diluted into 10 mm Tris-HCl (pH 8), 10 mm BME, 0.5 mm EGTA, and 0.05% UnDM to 1, 2, 4, 6, 8, and 10 mg/ml. 30-μl samples were exposed twice for 180 s without an obvious decay in signal. Signal averaging, buffer subtraction and Guinier analysis were done in Bioxtas RAW (
      • Nielsen S.S.
      • Toft K.N.
      • Snakenborg D.
      • Jeppesen M.G.
      • Jacobsen J.K.
      • Vestergaard B.
      • Kutter J.P.
      • Arleth L.
      BioXTAS RAW, a software program for high-throughput automated small-angle X-ray scattering data reduction and preliminary analysis.
      ). Molecular weight was estimated using lysozyme as the standard. Thirty data points were used for Guinier analysis for each tested concentration (qRg was ∼1.1 in all cases).

       Two-dimensional Crystallization and EM Analysis

      Purified Vo was diluted to 3 mg/ml in 10 mm Tris-HCl (pH 6.5), 10 mm BME, 0.5 mm EGTA, 10% glycerol, and 1 mm DTT, and sonicated DOPC was added to reach a lipid-to-protein ratio of 0.3 (w/w). After 24 h, the detergent was removed by stepwise addition (every 3 days) of equal amounts of polystyrene beads (Bio Beads SM2, Bio-Rad) for a total of 10 days so that the final ratio of beads to liquid was ∼1:1. Samples were kept at 4 °C, and 1 mm sodium azide was added to inhibit bacterial growth. Vo two-dimensional crystals were spotted on glow discharge-treated, carbon-coated copper grids and stained with 1% uranyl acetate. Micrographs were recorded on a 4096 × 4096 charge-coupled device (TVIPS F415MP) at ×20,000–40,000 electron optical magnification and an underfocus of 1.5 μm. The quality of the crystalline areas was assessed from calculated power spectra, and areas showing isotropic reflections to ∼20-Å resolution were excised and analyzed with the 2dx package of programs (
      • Gipson B.
      • Zeng X.
      • Zhang Z.Y.
      • Stahlberg H.
      2dx: user-friendly image processing for 2D crystals.
      ) and/or by correlation averaging as implemented in IMAGIC 5 (
      • van Heel M.
      • Harauz G.
      • Orlova E.V.
      • Schmidt R.
      • Schatz M.
      A new generation of the IMAGIC image processing system.
      ,
      • Lee J.Y.
      • Urbatsch I.L.
      • Senior A.E.
      • Wilkens S.
      Nucleotide-induced structural changes in P-glycoprotein observed by electron microscopy.
      ).

       Cryo EM and Single-particle Image Analysis

      The solubilized Vo sector was vitrified at 1–2 mg/ml on glow-discharged, holey, carbon-coated copper grids (C-flat, 2/2 μm). Grids were mounted in a Gatan 626 cryoholder and imaged in a JEOL JEM-2100 transmission electron microscope operating at 120 kV. Micrographs were recorded on a 4096 × 4096 charge-coupled device (TVIPS F415MP) at an electron optical magnification of ×40,000 and an underfocus of between 1.5–2.5 μm. The calibrated pixel size on the specimen level was 2.62 Å. A total of 12,035 particles was extracted as 144 × 144 pixel images using the “boxer” program of the EMAN1.9 software package (
      • Ludtke S.J.
      • Baldwin P.R.
      • Chiu W.
      EMAN: semiautomated software for high-resolution single-particle reconstructions.
      ). The dataset was contrast transfer function-corrected using “ctfit” as implemented in EMAN1.9. All subsequent image analysis was done with the IMAGIC 5 package of programs (
      • van Heel M.
      • Harauz G.
      • Orlova E.V.
      • Schmidt R.
      • Schatz M.
      A new generation of the IMAGIC image processing system.
      ). Images were bandpass-filtered to remove low (<6.4 × 10−3−1) and high (>0.15 Å−1) spatial frequencies, and a soft-edge circular mask was applied before subjecting the images to reference-free alignment (
      • Dube P.
      • Tavares P.
      • Lurz R.
      • van Heel M.
      The portal protein of bacteriophage SPP1: a DNA pump with 13-fold symmetry.
      ). Averages from the reference-free alignment were then used in subsequent multireference alignment, and the multireference alignment was iterated to obtain averages of the most abundant projections. Three-dimensional reconstruction was initiated by one round of projection-matching using the low pass-filtered three-dimensional reconstruction of the bovine V-ATPase membrane sector (
      • Wilkens S.
      • Forgac M.
      Three-dimensional structure of the vacuolar ATPase proton channel by electron microscopy.
      ) as a reference model. Because the bovine Vo sector subunit Ac45 is not found in yeast Vo, the density corresponding to Ac45 was removed with the volume eraser tool as implemented in the visualization software Chimera (
      • Pettersen E.F.
      • Goddard T.D.
      • Huang C.C.
      • Couch G.S.
      • Greenblatt D.M.
      • Meng E.C.
      • Ferrin T.E.
      UCSF Chimera: a visualization system for exploratory research and analysis.
      ). Cycles of projection-matching alignment and three-dimensional reconstruction were iterated with increasing numbers of references until no further improvement was observed. The resolution of the final model was estimated using the 0.5 Fourier shell correlation criterion (
      • Böttcher B.
      • Wynne S.A.
      • Crowther R.A.
      Determination of the fold of the core protein of hepatitis B virus by electron cryomicroscopy.
      ). The final EM density was fitted manually with crystal structures of bacterial homologs for the yeast Vo subunits, including the aNT homolog from Meiothermus ruber (INT, PDB code 3RRK), the subunit d homolog from Thermus thermophilus (subunit C, PDB code 1R5Z), and the c subunit ring homolog from E. hirae (K10, PDB code 2BL2). Although the primary sequence conservation between the yeast and bacterial subunits is limited (11%, 16%, and 26% for aNT and INT, d and C, and c and K, respectively), their secondary and tertiary structure is highly conserved, as evidenced by the fact that the yeast subunit structures can be modeled on the basis of the bacterial A/V-ATPase subunit crystal structures using the Phyre2 server (
      • Kelley L.A.
      • Mezulis S.
      • Yates C.M.
      • Wass M.N.
      • Sternberg M.J.
      The Phyre2 web portal for protein modeling, prediction and analysis.
      ) with 100% confidence.

       Expression and Purification of aNT(1–372) and Subunit d

      Plasmid pRS316 containing the open reading frame for subunit d (Vma6p) was as a gift from the laboratory of Dr. Karlett Parra (University of New Mexico). The coding sequence for subunit d was PCR-amplified using primers GCTCAGGT ACCGATGGAAGGCGTGTATTTCAATATT (forward) and CGAGTCCTGCAGTCAATCAATAAACG GAAATATAATT (reverse), and the resulting PCR product was ligated into pGEM T-easy. Subsequent cloning of the subunit d coding sequence into a modified plasmid pMAL-c2e (New England Biolabs, enterokinase cleavage site replaced by the human rhinovirus 3C site) for bacterial protein expression was done by BioBasic, Inc. (Markham, Ontario). The resulting construct consisted of subunit d with an N-terminal fusion of maltose binding protein (MBP) separated by a protease cleavage site (human rhinovirus 3C protease) for removal of MBP. pMAL-c2E harboring MBP subunit d was expressed in Escherichia coli strain Rosetta2. Cells were grown in rich broth (Lennox broth plus 0.2% glucose) to an A600 of 0.6 and induced with 500 μm isopropyl 1-thio-β-d-galactopyranoside for 4 h at 37 °C. Purification was done following the recommended protocol for MBP-tagged proteins (New England Biolabs). The PreScission Protease-cleaved (GE Healthcare) fusion was dialyzed against 25 mm Tris-HCl, 1 mm EDTA, 1 mm tris(2-carboxyethyl)phosphine (pH 7), followed by anion exchange chromatography on a 1-ml mono Q-Sepharose column attached to an AKTA FPLC (GE Life Sciences). Under these buffer conditions, subunit d bound to the column and was eluted using a 0–500 mm sodium chloride gradient in the same buffer. Protein-containing fractions were pooled, concentrated to 1–2 ml, and subjected to size-exclusion chromatography over Superdex S75 (16 × 500 mm). An expression construct for the N-terminal domain of subunit a (Vph1p) consisting of residues 1–372 (aNT(1–372)) was generated as described previously (
      • Oot R.A.
      • Wilkens S.
      Subunit interactions at the V1-Vo interface in yeast vacuolar ATPase.
      ). The cleavable MBP tag resulted in an N-terminal extension for both subunit d and aNT(1–372) constructs with the amino acid sequence GPKVP. Constructs were confirmed by DNA sequencing. A detailed biochemical and biophysical characterization of recombinant subunit d and a1–372 will be presented elsewhere.

       Isothermal Titration Calorimetry (ITC)

      ITC measurements of the interaction of aNT(1–372) with subunit d using a Microcal VP-ITC isothermal titration calorimeter were done as described previously (
      • Oot R.A.
      • Wilkens S.
      Subunit interactions at the V1-Vo interface in yeast vacuolar ATPase.
      ,
      • Oot R.A.
      • Wilkens S.
      Domain characterization and interaction of the yeast vacuolar ATPase subunit C with the peripheral stator stalk subunits E and G.
      ), with the following modifications. Prior to the titration, both proteins were dialyzed (in the same container) against 2 liters of 25 mm Tris-HCl (pH 7), 0.5 mm EDTA, and 1 mm tris(2-carboxyethyl)phosphine. aNT(1–372) was concentrated to 375 μm and titrated into 25 μm subunit d at 10 °C using a total of 30 injections with 10.7% saturation/injection. A heat of dilution titration of 375 μm aNT(1–372) into dialysis buffer was subtracted from the aNT(1–372) into subunit d titration. A second titration was carried out with 320 μm aNT(1–372) in the syringe using, again, 25 μm subunit d in the ITC cell. Both titrations produced very similar results. Protein concentrations were determined from A280 using calculated extinction coefficients. ITC data were fitted to a one-site model using the VP-ITC programs in Originlab.

       Other Methods

      Membrane protein concentrations were measured by BCA method (Thermo Scientific) and improved by TCA precipitation as in Lowry-TCA (
      • Peterson G.L.
      A simplification of the protein assay method of Lowry et al. which is more generally applicable.
      ) using fatty acid-free BSA as the standard.

      Results

       Purification of the Vo Proton Channel Sector

      To isolate the yeast Vo sector for structural and functional studies, we attempted several strategies, including C- and N-terminal histidine tags fused to subunits d and c″ as well as a TAP tag fused to the C terminus of subunit a or c. In the end, the best results were obtained using only the second affinity step of the TAP procedure, where Vo (containing TAP-tagged subunit a) is detergent-solubilized from vacuolar membranes and captured by a calmodulin column by way of the calmodulin binding peptide in the tag. To eliminate possible co-purification of (partially) assembled V-ATPase, the gene for V1-ATPase subunit B (VMA2) was disrupted. For large-scale purification of the vacuolar ATPase membrane sector, yeast was grown in a 10-liter fermenter. The yield of Vo sector purified as described under “Experimental Procedures” was ∼2–3 mg/150 g of cells. Fig. 2 summarizes the purification of the yeast V-ATPase Vo sector and characterization of the protein by negative-stain transmission electron microscopy and SAXS. Fig. 2A shows SDS-PAGE of fractions 1–4 eluted from the calmodulin column. The Coomassie-stained gel shows bands for subunits a, d, c″, c, c′, and e. Fig. 2B shows SDS-PAGE of the final preparation obtained after concentrating fractions 2–4 of the calmodulin column (lane 1, 10 μg of protein loaded), and lane 2 shows SDS-PAGE of holo V-ATPase (
      • Zhang Z.
      • Inoue T.
      • Forgac M.
      • Wilkens S.
      Localization of subunit C (Vma5p) in the yeast vacuolar ATPase by immuno electron microscopy.
      ) for comparison. Mass spectrometry analysis of the subunit a band from SDS-PAGE gels such as shown in Fig. 2, A and B, only produced subunit a-derived peptides, with no peptides from protein A being detected, indicating that the protein A moiety of the TAP tag was lost because of proteolytic degradation following cell lysis and detergent extraction of membranes. Loss of protein A was confirmed by immunoblot analysis (using an antibody directed against the C-terminal end of the calmodulin binding peptide) that showed that the apparent molecular mass of the subunit a band decreased in size from an initial ∼130 kDa at the washed membrane stage to the final ∼116 kDa after the elution from the calmodulin affinity column (data not shown). Electrospray ionization/TOF mass spectrometry analysis of denatured Vo revealed the presence of proteins with masses of 39,903 Da (subunit d, expected 39,791 Da), 16,255 Da (subunit c, expected 16,219 Da), and 8,250 Da (subunit e, expected 8,249 Da). The mass differences suggest N-terminal acetylation for subunit c and an ∼100-Da modification for subunit d. Possibly because of their large size or lower abundance, no peaks for subunits a (100,143 Da without protein A), c′ (16,902 Da), and c″ (22,464 Da) were observed in the deconvoluted charge series (data not shown).
      Figure thumbnail gr2
      FIGURE 2Purification of the yeast V-ATPase Vo domain. Yeast Vo is purified by way of a calmodulin binding peptide tag fused to the C terminus of subunit a (Vph1p) using a yeast strain deleted for subunit B (vma2Δ). The yield of the Vo sector is ∼2–3 mg/150 g of cells. A, SDS-PAGE of fractions 1–4 eluted from the calmodulin affinity column (10 μg loaded). M, molecular mass marker from top to bottom, 170, 130, 100, 70, 55, 40, 35, 25, 15 kDa. B, Vo-containing fractions were pooled and concentrated, and 10 μg was resolved on SDS-PAGE and stained with Coomassie Blue (lane 1). For comparison, lane 2 shows SDS-PAGE of the V1Vo holo enzyme (modified from Ref.
      • Zhang Z.
      • Inoue T.
      • Forgac M.
      • Wilkens S.
      Localization of subunit C (Vma5p) in the yeast vacuolar ATPase by immuno electron microscopy.
      ). C, transmission electron microscopy of Vo spotted onto glow-discharged, carbon-coated copper grids at 20 μg/ml and stained with 1% uranyl acetate. D, SAXS analysis of the Vo sector at concentrations between 1–10 mg/ml in UnDM-containing buffer. E, Guinier analysis of the scattering profiles shown in D. The calculated radius of gyration is 51 ± 3.5 Å. The transmission electron microscopy image and SAXS data show that the preparation is homogenous and monodisperse at a concentration of up to 10 mg/ml.
      Fig. 2C shows negative-stain transmission electron microscopy analysis of detergent-solubilized Vo. The image shows homogeneously sized particles with a diameter of ∼10–15 nm, indicating that the preparation contains intact Vo sectors that are stable in the detergent used for purification (DDM). Furthermore, Guinier plots of small angle x-ray scattering profiles obtained from solutions of Vo sector purified in UnDM (chosen here for its smaller micelle size) showed that the preparation is monodisperse at concentrations of up to 10 mg/ml. The molecular mass of Vo as estimated by SAXS was 544 ± 33 kDa, with a calculated radius of gyration of ∼51 ± 3.5 Å. The expected mass of Vo (assuming a subunit ratio of ac8ccde, see next paragraph and “Discussion”) is ∼320 kDa, resulting in a difference between the measured and expected mass of ∼244 kDa. Considering the average size of UnDM micelles of 35 kDa (micelle size reported by Anatrace) suggests that each Vo sector binds six to seven detergent micelles. Taken together, the data show that highly purified, stable, and monodispersed yeast Vo sector can be obtained via affinity chromatography using a calmodulin peptide fused to the C terminus of subunit a.

       Two-dimensional Crystallization of the Yeast Vo Sector

      Fig. 3 summarizes the transmission electron microscopy analysis of yeast Vo domain two-dimensional crystals. The two-dimensional crystals were obtained by mixing the purified Vo domain at 3 mg/ml with 1 mg/ml DOPC, followed by removal of detergent (DDM) using polystyrene beads over a period of 7–10 days. Vo two-dimensional crystals were visualized by negative-stain transmission electron microscopy, and images showing crystalline areas (Fig. 3, A and B) with reflections in calculated power spectra extending to the first zero of the contrast transfer function (∼24 Å; Fig. 3, C and D) were processed as described under “Experimental Procedures.” The crystals belong to plane group P1 with an alternating up and down orientation of the molecules, as evident from the final projection map shown in Fig. 3E. At the current resolution of ∼24 Å, the projections obtained in negative stain show a ring-like structure with a diameter of 8.5 nm and an asymmetric mass at its periphery (arrow and arrowheads, respectively, Fig. 3E). We interpret the ring to represent the proteolipid ring (for comparison, see the low pass-filtered projection of the E. hirae K10 ring (PDB code 2BL2 (
      • Murata T.
      • Yamato I.
      • Kakinuma Y.
      • Leslie A.G.
      • Walker J.E.
      Structure of the rotor of the V-Type Na+-ATPase from Enterococcus hirae.
      ), shown in Fig. 3F) and the asymmetric mass aCT. As can be seen in Fig. 3, E and F, both rings are of equal size, consistent with the now established number of 10 proteolipids in the yeast enzyme (
      • Zhao J.
      • Benlekbir S.
      • Rubinstein J.L.
      Electron cryomicroscopy observation of rotational states in a eukaryotic V-ATPase.
      ). Taken together, the data show that the detergent-solubilized yeast V-ATPase Vo sector can be lipid-reconstituted and crystallized in two dimensions, opening a path for high-resolution structure determination of the V-ATPase membrane sector in its native environment.
      Figure thumbnail gr3
      FIGURE 3Electron crystallography of yeast Vo sector two-dimensional crystals. The two-dimensional crystals were obtained by mixing purified Vo at 3 mg/ml with 1 mg/ml DOPC with subsequent removal of detergent (DDM) with polystyrene beads. A, overview of a large, single-layer sheet of reconstituted Vo containing several crystalline domains (negatively stained with 1% uranyl acetate). B, larger view of a crystalline area, with the power spectrum shown in C. D, IQ plot after unbending using the 2dx package of programs (
      • Gipson B.
      • Zeng X.
      • Zhang Z.Y.
      • Stahlberg H.
      2dx: user-friendly image processing for 2D crystals.
      ). E, projection map with unit cell outlined by the rectangle. The cell dimensions are 101 × 236 Å with 2 molecules/cell. The crystals belong to plane group P1 with alternating up and down orientation of the molecules. At the current resolution of ∼24 Å, the projections obtained in negative stain show a ring-like structure (arrow) with a two-domain asymmetric mass at the periphery (arrowheads). We interpret the ring to represent the proteolipid ring and the asymmetric mass aCT. F, cross-section of the E. hirae K10 ring as seen perpendicular to the plane of the membrane, filtered to a resolution of 16 Å.

       Cryo-electron Microscopy and Three-dimensional Reconstruction

      Fig. 4 summarizes single-molecule cryo-transmission electron microscopy analysis of the detergent-solubilized Vo sector. Vo was vitrified at a concentration of 2 mg/ml, and charge-coupled device (CCD) images were recorded at a magnification of ×40,000 (Fig. 4A). Three enlarged raw images of particles and three averages of aligned projections in the typical “side” and “top” view orientations are shown next to the micrograph. A dataset of 12,035 single-particle images was used to generate a three-dimensional model, starting with projections of the low pass-filtered three-dimensional reconstruction of the bovine Vo sector (
      • Wilkens S.
      • Forgac M.
      Three-dimensional structure of the vacuolar ATPase proton channel by electron microscopy.
      ) as initial references, followed by multiple rounds of projection-matching refinement. The resolution of the final model (Fig. 4B) was estimated to be ∼18 Å on the basis of the 0.5 Fourier shell correlation criterion using models calculated from half-data sets (data not shown). The yeast Vo sector is composed of a ring of 10 proteolipids (likely c8cc″, see “Discussion”), the 100-kDa a subunit that is equally divided into a cytoplasmic aNT and a membrane integral aCT that is bound at the periphery of the proteolipid ring, the ∼40 kDa d subunit that is bound at the cytoplasmic rim of the proteolipid ring (Fig. 4C), and subunit e, which is likely bound to aCT (
      • Compton M.A.
      • Graham L.A.
      • Stevens T.H.
      Vma9p (subunit e) is an integral membrane V0 subunit of the yeast V-ATPase.
      ). Because there are no x-ray crystal structures available for any of the yeast polypeptides, the EM model was fitted with crystal structures of the homologous subunits of related bacterial rotary ATPases: the K10 ring from E. hirae (PDB code 2BL2 (
      • Murata T.
      • Yamato I.
      • Kakinuma Y.
      • Leslie A.G.
      • Walker J.E.
      Structure of the rotor of the V-Type Na+-ATPase from Enterococcus hirae.
      )), INT from M. ruber (PDB code 3RRK (
      • Srinivasan S.
      • Vyas N.K.
      • Baker M.L.
      • Quiocho F.A.
      Crystal structure of the cytoplasmic N-terminal domain of subunit I, a homolog of subunit a, of V-ATPase.
      )), and the subunit d homolog from T. thermophilus (PDB code 1R5Z (
      • Iwata M.
      • Imamura H.
      • Stambouli E.
      • Ikeda C.
      • Tamakoshi M.
      • Nagata K.
      • Makyio H.
      • Hankamer B.
      • Barber J.
      • Yoshida M.
      • Yokoyama K.
      • Iwata S.
      Crystal structure of a central stalk subunit C and reversible association/dissociation of vacuole-type ATPase.
      )). A comparison with the negative-stain three-dimensional model of the bovine Vo (
      • Wilkens S.
      • Forgac M.
      Three-dimensional structure of the vacuolar ATPase proton channel by electron microscopy.
      ) revealed an overall similar architecture except for the presence of density for Ac45 on the luminal side of the bovine model (a homolog for Ac45 is not present in yeast) and the presence of density for the linker (or tether) connecting aNT and aCT in the yeast cryo-EM model (Fig. 4C). At the current resolution of ∼18 Å, the proteolipid ring within the membrane domain is not clearly resolved, likely because of the small size of the relatively featureless complex and the lack of internal symmetry. Well resolved, however, are aNT and subunit d, which are situated on the cytoplasmic side of the membrane.
      Figure thumbnail gr4
      FIGURE 4Three-dimensional reconstruction of the yeast Vo sector from cryo-EM. A, the purified yeast Vo domain was vitrified at a concentration of 2 mg/ml and visualized at −170 °C. Individual side view projections are shown at the top right, and averages obtained by reference-free alignment of characteristic side and top views are shown at the bottom right. Bar = 20 nm. B, side view (left) and top view (right) of the three-dimensional reconstruction of yeast Vo calculated from a dataset of ∼12,000 single molecules at a resolution of ∼18 Å. The gray rectangle in the side view indicates the position of the lipid bilayer. C, fitting of crystal structures into the EM reconstruction. The structural models used were the aNT homolog from M. ruber (PDB code 3RRK, blue), the subunit d homolog from T. thermophilus (PDB code 1R5Z, green), and the K10 proteolipid ring from E. hirae (PDB code 2BL2, magenta). D, side view (left panel) and cross-section (center panel) of holo yeast V-ATPase cryo-EM reconstruction (emd-5476 (
      • Benlekbir S.
      • Bueler S.A.
      • Rubinstein J.L.
      Structure of the vacuolar-type ATPase from Saccharomyces cerevisiae at 11-A resolution.
      )) for comparison. In free Vo (right panel, arrow), the “distal” end of aNT is in contact with subunit d, whereas, in holo V1Vo, the distal domain of aNT is in a more peripheral position in contact with Cfoot and EG2 (center panel, arrow). For details, see text.

       Comparison of EM Reconstructions of the Isolated Vo and Vo Sector as Part of Holo V-ATPase

      As can be seen in Fig. 4C, fitting the crystal structures of the bacterial homologs of yeast aNT (PDB code 3RRK (
      • Srinivasan S.
      • Vyas N.K.
      • Baker M.L.
      • Quiocho F.A.
      Crystal structure of the cytoplasmic N-terminal domain of subunit I, a homolog of subunit a, of V-ATPase.
      )) and subunit d (PDB code 1R5Z (
      • Iwata M.
      • Imamura H.
      • Stambouli E.
      • Ikeda C.
      • Tamakoshi M.
      • Nagata K.
      • Makyio H.
      • Hankamer B.
      • Barber J.
      • Yoshida M.
      • Yokoyama K.
      • Iwata S.
      Crystal structure of a central stalk subunit C and reversible association/dissociation of vacuole-type ATPase.
      )) into the yeast Vo EM density shows an interaction of the distal lobe of aNT with the d subunit (Fig. 4D, right panel, arrow), with subunit d binding slightly off-center at the edge of the proteolipid ring. Interestingly, a comparison with the three-dimensional reconstruction of holo yeast V-ATPase (
      • Zhao J.
      • Benlekbir S.
      • Rubinstein J.L.
      Electron cryomicroscopy observation of rotational states in a eukaryotic V-ATPase.
      ,
      • Zhang Z.
      • Zheng Y.
      • Mazon H.
      • Milgrom E.
      • Kitagawa N.
      • Kish-Trier E.
      • Heck A.J.
      • Kane P.M.
      • Wilkens S.
      Structure of the yeast vacuolar ATPase.
      ,
      • Benlekbir S.
      • Bueler S.A.
      • Rubinstein J.L.
      Structure of the vacuolar-type ATPase from Saccharomyces cerevisiae at 11-A resolution.
      ) (Fig. 4D, left and center panels) reveals that aNT in the holo enzyme adopts a different conformation where the distal domain of aNT is bound to Cfoot (subunit domain nomenclature as in Refs.
      • Srinivasan S.
      • Vyas N.K.
      • Baker M.L.
      • Quiocho F.A.
      Crystal structure of the cytoplasmic N-terminal domain of subunit I, a homolog of subunit a, of V-ATPase.
      and
      • Drory O.
      • Frolow F.
      • Nelson N.
      Crystal structure of yeast V-ATPase subunit C reveals its stator function.
      , respectively) and the N termini of one of the three EG heterodimer peripheral stalks (EG2; Fig. 4D, center panel, arrow). In line with this observation, we have previously characterized the binding interactions between aNT, Cfoot, and the EG heterodimer and we found that these interactions are of moderate affinity (
      • Oot R.A.
      • Wilkens S.
      Subunit interactions at the V1-Vo interface in yeast vacuolar ATPase.
      ). Taken together, the comparison of Vo and holo V1Vo suggests that aNT undergoes a large conformational rearrangement upon enzyme disassembly, going from a conformation in free Vo that binds the d subunit to a more peripheral conformation that binds Cfoot and EG2 in holo V1Vo.

       In Vitro Interaction of Recombinant Subunit d and aNT(1–372)

      To test whether the interaction between aNT and subunit d as seen in the EM reconstruction is specific and can be quantified in vitro, we performed ITC experiments with recombinant subunits. For these experiments, subunit d and aNT(1–372)were expressed in E. coli as N-terminal fusions with MBP and affinity-purified on amylose resin. MBP was cleaved, and the resulting subunits were further purified using ion exchange and size-exclusion chromatography. Fig. 5A shows SDS-PAGE of aNT(1–372) (lane 1) and subunit d (lane 2). Both proteins are stable and highly soluble at pH 7, and, although recombinant subunit d elutes with an apparent molecular mass of ∼42 kDa from a S200 gel filtration column (expected, 40,267 Da), suggesting a globular monomeric protein, aNT(1–372) exists in a concentration-dependent monomer-dimer equilibrium, as already described for the shorter aNT(104–372) construct (Ref.
      • Oot R.A.
      • Wilkens S.
      Subunit interactions at the V1-Vo interface in yeast vacuolar ATPase.
      ) and data not shown). Fig. 5B shows a representative ITC experiment in which 375 μm aNT(1–372) was titrated into 25 μm subunit d. As can be seen from the titration, complex formation between aNT(1–372) and subunit d was exergonic, and fitting the data to a one-site model revealed an N value of 0.98 (consistent with a 1:1 stoichiometry of complex formation), a Ka of 2.1 × 105 ± 3.5 × 104 m−1 (Kd, ∼4.8 μm), a ΔH of −4.2 ± 0.22 kcal/mol, a ΔS of 9.7 cal/(K·mol), and a ΔG of −6.9 kcal/mol. After the titration, the ITC cell content was resolved by gel filtration (S200, 16 × 500 mm), and fractions were analyzed by SDS-PAGE (Fig. 5C). As can be seen from the gel, aNT(1–372) and subunit d co-elute around fraction 31 (62 ml), corresponding to an apparent molecular mass of ∼72 kDa (84 kDa expected for the aNT(1–372)-d complex; subunit d alone elutes at an apparent molecular mass of ∼42 kDa, see above). Together, the ITC and gel filtration data suggest that subunit d and aNT(1–372)bind each other in a specific manner, albeit with moderate affinity.
      Figure thumbnail gr5
      FIGURE 5Isothermal titration calorimetry of the aNT-subunit d interaction. A, SDS-PAGE of bacterially expressed aNT (residues 1–372, lane 1, 5 μg) and subunit d (lane 2, 5 μg). M, molecular mass marker from top to bottom, 170, 130, 100, 70, 55, 40, 35, 25, 15 kDa. B, subunit d at a concentration of 25 μm in 25 mm Tris/HCl (pH 7), 0.5 mm EDTA, and 1 mm tris(2-carboxyethyl)phosphine was titrated with 375 μm aNT(1–372) in the same buffer. Fitting the ΔH data to a one-site binding model revealed a close to 1:1 binding stoichiometry (n = 0.98), a Ka of 2.1 × 105 ± 3.5 × 104 m−1 (Kd, ∼4.8 μm), a ΔH of −4.2 ± 0.22 kcal/mol, a ΔS of 9.7 cal/(K·mol), and a ΔG of −6.9 kcal/mol. C, the ITC cell content was resolved by gel filtration over Superdex S200 (16 × 500 mm), and fractions were analyzed by SDS-PAGE. The arrowhead (fraction 34) indicates where subunit d alone elutes from the column.

       Preparation and Functional Analysis of the ac8c′c″e Subcomplex (VoΔd)

      In living cells, V-ATPase activity is regulated by reversible dissociation into V1-ATPase and membrane integral Vo sectors (Fig. 1B). Upon enzyme dissociation, the activity of both V1 and Vo is silenced so that V1 loses the ability to hydrolyze magnesium ATP and Vo becomes impermeable to protons. Considering the interaction described above between aNT and subunit d seen in free Vo but not V1Vo, we speculated that this interaction may contribute to the inhibition of passive proton translocation through isolated Vo by blocking rotation of the c-ring past aCT. To assess the role subunit d might be playing in blocking proton translocation through isolated Vo, we developed a procedure to selectively remove subunit d from Vo to generate the ac8cce subcomplex (VoΔd). Fig. 6, A and B, shows SDS-PAGE of glycerol density centrifugation of Vo sector in presence of the ionic detergent LPPG and CHAPS, respectively. As can be seen from Fig. 6A, in the presence of LPPG, subunit d remains at the top of the gradient separated from ac8cce, whereas, in CHAPS, subunit d migrates as part of intact Vo. To determine whether removal of subunit d allows passive proton translocation through the resulting VoΔd, Vo and VoΔd were reconstituted into liposomes in the presence of potassium chloride-containing buffer. Liposomes were collected by centrifugation and subjected to SDS-PAGE and silver staining (Fig. 6C). Vo- and VoΔd-containing liposomes were subjected to a fluorescence-based assay to test for passive proton conductance. Fig. 6D shows a representative assay for passive proton conductance. As can be seen from the Fig. 6D, both Vo- and VoΔd-containing liposomes as well as control liposomes showed the same slow quenching upon addition of the potassium ionophore valinomycin and a sharp drop in the fluorescence signal following addition of the protonophore carbonyl cyanide p-trifluoromethoxyphenylhydrazone, which verified the presence of a proton gradient. This result indicates that removal of subunit d does not alleviate the inhibition of proton translocation across the Vo, suggesting that the interaction of aNT and subunit d in free Vo is not (solely) responsible for activity silencing in the isolated V-ATPase membrane sector.
      Figure thumbnail gr6
      FIGURE 6Preparation and functional characterization of VoΔd. A and B, Coomassie-stained SDS-PAGE of glycerol density gradient centrifugation fractions of Vo in the presence of LPPG (A) and CHAPS (B). Gradient centrifugation in the presence of LPPG resulted in selective release of subunit d, whereas, in the presence of CHAPS, Vo migrates as a homogeneous complex. C, Vo and VoΔd in CHAPS were reconstituted at a high lipid:protein ratio using gel filtration (Sephadex G50) in the presence of potassium chloride-containing buffer. Liposomes were collected by centrifugation and subjected to SDS-PAGE and silver staining. D, fluorescence-based assay for passive proton translocation. Vo, VoΔd, and control liposomes prepared in high-potassium buffer were diluted into sodium-containing buffer in the presence of 9-amino-6-chloro-2-methoxyacridine (ACMA), and, after 5 min, a proton gradient was generated by the addition of the potassium ionophore valinomycin. The presence of a proton gradient was subsequently confirmed by addition of the protonophore carbonyl cyanide p-trifluoromethoxyphenylhydrazone. Both Vo and VoΔd showed essentially the same behavior as control liposomes, indicating that removal of subunit d did not result in passive proton translocation activity.

      Discussion

      Transmembrane proton transport across the vacuolar ATPase Vo sector involves rotation of the proteolipid ring past aCT. A major difference between eukaryotic vacuolar ATPase and the related F- and A-type motors is the mode of regulation of V-ATPase, which involves dissociation into free ATPase and proton channel sectors triggered by nutrient availability or developmental cues (Fig. 1). However, unlike F- and bacterial A/V-like ATPase ion channels, which, when detached from the ATPase, catalyze passive transmembrane proton transport (
      • Schneider E.
      • Altendorf K.
      All three subunits are required for the reconstitution of an active proton channel (F0) of Escherichia coli ATP synthase (F1F0).
      ,
      • Mosher M.E.
      • Peters L.K.
      • Fillingame R.H.
      Use of λ unc transducing bacteriophages in genetic and biochemical characterization of H+-ATPase mutants of Escherichia coli.
      ), the eukaryotic Vo sector becomes impermeable to protons upon dissociation of the V1, preserving any existing proton gradient across the organellar membrane (
      • Zhang J.
      • Myers M.
      • Forgac M.
      Characterization of the V0 domain of the coated vesicle H+-ATPase.
      ). In case of the F-ATPase ion channel, Fo, it has been shown that rotation of the proteolipid ring relative to the a subunit is essential for passive proton conductance (
      • Suzuki T.
      • Ueno H.
      • Mitome N.
      • Suzuki J.
      • Yoshida M.
      F(0) of ATP synthase is a rotary proton channel: obligatory coupling of proton translocation with rotation of c-subunit ring.
      ), and, because the mechanism of ion transport is highly conserved between F- and V-type motors, that means that rotation of the proteolipid ring in free Vo appears to be blocked by an unknown mechanism. Previously, we generated an EM reconstruction of free Vo sector from bovine brain V-ATPase that suggested an interaction between aNT and subunit d, although the linker connecting aNT and aCT was not resolved in the negative stain model (
      • Wilkens S.
      • Forgac M.
      Three-dimensional structure of the vacuolar ATPase proton channel by electron microscopy.
      ). Later, we (
      • Wilkens S.
      • Zhang Z.
      • Zheng Y.
      A structural model of the vacuolar ATPase from transmission electron microscopy.
      ) and others (
      • Qi J.
      • Forgac M.
      Function and subunit interactions of the N-terminal domain of subunit a (Vph1p) of the yeast V-ATPase.
      ) speculated that the interaction between aNT and d may serve to silence passive proton transport by linking the rotor and stator of the motor. To address the mechanism of activity silencing as well as other aspects of Vo structure and function, we developed a protocol to isolate milligram amounts of yeast Vo proton channel sector using affinity chromatography. Biochemical experiments show that the complex is stable in low and intermediate critical micelle concentration (cmc) detergents such as UnDM, DDM, and CHAPS, respectively, as evident from glycerol gradient centrifugation. Negative-stain and cryo-electron microscopy as well as small-angle x-ray scattering experiments show that detergent-solubilized yeast Vo is monodisperse at concentrations up to several milligrams per milliliter, a prerequisite for structural studies.
      We next used transmission electron microscopy of two-dimensional crystals and single Vo molecules to obtain structural information that may provide clues regarding the mechanism of activity silencing. Upon reconstitution into DOPC lipid bilayers, we were able to generate two-dimensional crystals of the Vo, to our knowledge the first two-dimensional crystals of any eukaryotic V-ATPase proton channel sector. Projection maps calculated at a resolution of ∼24 Å show a ring-like structure with an asymmetric mass bound at the periphery of the ring, consistent with current structural models obtained for the holo V-ATPase from single-particle reconstructions (
      • Zhao J.
      • Benlekbir S.
      • Rubinstein J.L.
      Electron cryomicroscopy observation of rotational states in a eukaryotic V-ATPase.
      ,
      • Zhang Z.
      • Zheng Y.
      • Mazon H.
      • Milgrom E.
      • Kitagawa N.
      • Kish-Trier E.
      • Heck A.J.
      • Kane P.M.
      • Wilkens S.
      Structure of the yeast vacuolar ATPase.
      ,
      • Benlekbir S.
      • Bueler S.A.
      • Rubinstein J.L.
      Structure of the vacuolar-type ATPase from Saccharomyces cerevisiae at 11-A resolution.
      ,
      • Rawson S.
      • Phillips C.
      • Huss M.
      • Tiburcy F.
      • Wieczorek H.
      • Trinick J.
      • Harrison M.A.
      • Muench S.P.
      Structure of the vacuolar H+-ATPase rotary motor reveals new mechanistic insights.
      ). Although the relatively small size of the crystals obtained so far has limited our ability to use cryo-electron crystallography for structural analysis, there are several features that are noteworthy at the current resolution. The diameter of the ring is, with ∼8.5 nm, virtually identical to the diameter of the K subunit ring of the related sodium V-like ATPase from E. hirae (K10, 8.3 nm (
      • Murata T.
      • Yamato I.
      • Kakinuma Y.
      • Leslie A.G.
      • Walker J.E.
      Structure of the rotor of the V-Type Na+-ATPase from Enterococcus hirae.
      )). This is consistent with the now established stoichiometry of 10 proteolipids for the yeast V-ATPase proteolipid ring (
      • Zhao J.
      • Benlekbir S.
      • Rubinstein J.L.
      Electron cryomicroscopy observation of rotational states in a eukaryotic V-ATPase.
      ), eight of which are c subunits (Vma3p), with each one copy of c′ (Vma11p) and c″ (Vma16p) (
      • Powell B.
      • Graham L.A.
      • Stevens T.H.
      Molecular characterization of the yeast vacuolar H+-ATPase proton pore.
      ) to give a complex of c8cc″. Another observation from the two-dimensional crystal projection is that aCT appears to be organized in two domains of slightly unequal size (Fig. 3E, arrowheads). A recent cryo-EM model of another rotary motor enzyme, the dimeric F-ATPase from Polytomella mitochondria revealed two almost horizontal α helices as part of the Fo-a subunit (
      • Allegretti M.
      • Klusch N.
      • Mills D.J.
      • Vonck J.
      • Kühlbrandt W.
      • Davies K.M.
      Horizontal membrane-intrinsic α-helices in the stator a-subunit of an F-type ATP synthase.
      ). F-ATPase Fo a subunits are predicted to contain five transmembrane α helices, and it is possible that the larger of the two domains observed here for Vo aCT in the two-dimensional crystals represents the structural and functional homologue of Fo a, with the smaller of the two domains representing a part of Vo a that is not present in F-ATPase. Almost horizontal transmembrane α helices were also observed in a recent cryo-EM reconstruction of the holo yeast V-ATPase (
      • Zhao J.
      • Benlekbir S.
      • Rubinstein J.L.
      Electron cryomicroscopy observation of rotational states in a eukaryotic V-ATPase.
      ), suggesting that tilted α helices in the interface between aCT and the proteolipid ring are a conserved feature in all rotary motor enzymes.
      Because the current two-dimensional crystals are too small to generate a three-dimensional structural model from images of a tilted specimen, we used cryo-electron microscopy of detergent-solubilized single Vo sectors to calculate a three-dimensional reconstruction of the complex using our earlier negative-stain, three-dimensional EM reconstruction of the bovine Vo (
      • Wilkens S.
      • Forgac M.
      Three-dimensional structure of the vacuolar ATPase proton channel by electron microscopy.
      ) as a starting model. Although the resolution of the yeast Vo reconstruction presented here is limited to about 18 Å (likely because of the relatively small size of the Vo (∼320 kDa), the presence of a featureless detergent belt, and the lack of overall symmetry), the EM density allows placing of the crystal structures of equivalent subunits from related bacterial enzymes, namely the E. hirae K10 ring (
      • Murata T.
      • Yamato I.
      • Kakinuma Y.
      • Leslie A.G.
      • Walker J.E.
      Structure of the rotor of the V-Type Na+-ATPase from Enterococcus hirae.
      ) and aNT and subunit d homologs from M. ruber (
      • Srinivasan S.
      • Vyas N.K.
      • Baker M.L.
      • Quiocho F.A.
      Crystal structure of the cytoplasmic N-terminal domain of subunit I, a homolog of subunit a, of V-ATPase.
      ) and T. thermophilus (
      • Iwata M.
      • Imamura H.
      • Stambouli E.
      • Ikeda C.
      • Tamakoshi M.
      • Nagata K.
      • Makyio H.
      • Hankamer B.
      • Barber J.
      • Yoshida M.
      • Yokoyama K.
      • Iwata S.
      Crystal structure of a central stalk subunit C and reversible association/dissociation of vacuole-type ATPase.
      ), respectively. The resulting pseudo-atomic model shows aNT and subunit d in close proximity, suggesting that the two polypeptides bind each other in free Vo, consistent with what had already been described for the bovine complex (
      • Wilkens S.
      • Forgac M.
      Three-dimensional structure of the vacuolar ATPase proton channel by electron microscopy.
      ,
      • Wilkens S.
      • Zhang Z.
      • Zheng Y.
      A structural model of the vacuolar ATPase from transmission electron microscopy.
      ). However, the cryo-EM model of yeast Vo presented here provides more detail by showing the tether connecting aNT and aCT that was not resolved in the bovine model (
      • Wilkens S.
      • Forgac M.
      Three-dimensional structure of the vacuolar ATPase proton channel by electron microscopy.
      ). Interestingly, a comparison of EM reconstructions of free Vo and Vo as part of holo V-ATPase (Fig. 4D) revealed that aNT must undergo a large conformational change during regulated enzyme disassembly, from a conformation in holo V-ATPase, where the distal domain of aNT binds Cfoot and EG2 (
      • Zhao J.
      • Benlekbir S.
      • Rubinstein J.L.
      Electron cryomicroscopy observation of rotational states in a eukaryotic V-ATPase.
      ,
      • Zhang Z.
      • Zheng Y.
      • Mazon H.
      • Milgrom E.
      • Kitagawa N.
      • Kish-Trier E.
      • Heck A.J.
      • Kane P.M.
      • Wilkens S.
      Structure of the yeast vacuolar ATPase.
      ,
      • Oot R.A.
      • Wilkens S.
      Subunit interactions at the V1-Vo interface in yeast vacuolar ATPase.
      ), to a conformation in free Vo, where aNT binds subunit d. As mentioned above, we initially reasoned that the aNT-d interaction may play a role in blocking passive proton conductance. However, as summarized in Fig. 6, removal of subunit d by the ionic detergent LPPG to produce VoΔd, followed by proton conductance assays, showed no difference in the behavior of the Vo and VoΔd complexes. This result suggests that the interaction of d with aNT is not (solely) responsible for blocking proton flow across free Vo, consistent with earlier experiments by Qi and Forgac (
      • Qi J.
      • Forgac M.
      Function and subunit interactions of the N-terminal domain of subunit a (Vph1p) of the yeast V-ATPase.
      ) that showed that proteolytic removal of aNT on vacuolar vesicles did not render the membrane permeable to protons. Taken together, this means that there must be other (or additional) mechanisms that prevent proton leakage through free Vo. As illustrated in Fig. 7, one possibility is that the conformational change in aNT upon enzyme dissociation is transmitted to aCT, thereby disrupting the path of protons along the interface between aCT and the proteolipid ring. Another mechanism for blocking passive proton transport could lie within the structure of the proteolipid ring itself. V-ATPase proteolipids have four transmembrane α helices but only one essential proton carrying carboxylate (
      • Hirata R.
      • Graham L.A.
      • Takatsuki A.
      • Stevens T.H.
      • Anraku Y.
      VMA11 and VMA16 encode second and third proteolipid subunits of the Saccharomyces cerevisiae vacuolar membrane H+-ATPase.
      ), resulting in a larger distance between proton binding sites compared with F-ATP synthase. The large gap between proton binding sites (Fig. 7) could represent too high of a barrier to overcome without the driving force from ATP hydrolysis, resulting in kinetic inhibition of proton flow from the vacuole into the cytoplasm.
      Figure thumbnail gr7
      FIGURE 7Structural rearrangement of aNT upon reversible disassembly and mechanism of activity silencing. A and B, comparison of cross-sections of thethree-dimensional EM reconstructions of (A) yeast V1Vo (emd-5476) and (B) isolated Vo at the level of aNT. In holo V1Vo, the distal domain of aNT is in contact with the foot domain of subunit C (Cf) and the N-terminal domain of peripheral stalk EG2. Release of V1 from Vo upon enzyme disassembly results in a large movement of aNT away from its peripheral position near Cf and EG2 to bind subunit d (A, red arrow). Upon (re)assembly, the interaction between aNT and d is broken, and aNT moves back to its peripheral position in the holo enzyme (B, orange arrow). In one model of activity silencing, the rearrangement of aNT upon enzyme disassembly is transmitted to aCT, thereby blocking passive proton transport by altering the proximity of critical residues in aCT (such as Arg-745, small blue sphere) relative to the proton-carrying carboxyls in the c subunit ring (small red spheres). Another possibility is that passive proton transport is kinetically inhibited because of the larger distance between carboxyls in the V-ATPase proteolipid ring compared with F-ATPase. Note that an even larger gap between carboxyls is predicted because of the proteolipid isoform c″, which has the essential glutamate in transmembrane α helix 3 (Glu-108) as opposed to in helix 4 as for c (Glu-137) and c′ (Glu-145) (
      • Hirata R.
      • Graham L.A.
      • Takatsuki A.
      • Stevens T.H.
      • Anraku Y.
      VMA11 and VMA16 encode second and third proteolipid subunits of the Saccharomyces cerevisiae vacuolar membrane H+-ATPase.
      ,
      • Wang Y.
      • Cipriano D.J.
      • Forgac M.
      Arrangement of subunits in the proteolipid ring of the V-ATPase.
      ,
      • Wang Y.
      • Inoue T.
      • Forgac M.
      TM2 but not TM4 of subunit c“ interacts with TM7 of subunit a of the yeast V-ATPase as defined by disulfide-mediated cross-linking.
      ). For details, see text.
      However, if the aNT-d interaction in free Vo is not involved in blocking passive proton translocation, what then, if any, might its physiological role be? It has been shown that removing the tether linking aNT and aCT prevents assembly of holo V-ATPase (resulting in free cytoplasmic V1 and vacuolar membrane-bound Vo that lacks subunit d), a defect that can be partially rescued upon overexpression of subunit d (
      • Ediger B.
      • Melman S.D.
      • Pappas Jr., D.L.
      • Finch M.
      • Applen J.
      • Parra K.J.
      The tether connecting cytosolic (N terminus) and membrane (C terminus) domains of yeast V-ATPase subunit a (Vph1) is required for assembly of V0 subunit d.
      ). This finding suggests that the interaction of d with the proteolipid ring is relatively weak and that the additional interaction with aNT is needed to increase avidity for d during Vo biogenesis and for retaining d upon regulated enzyme disassembly. In line with this model is the relatively weak affinity (Kd, ∼5 μm) between aNT and d, as measured by ITC using recombinant subunits because this interaction must be readily reversible for enzyme reassembly. Interestingly, recent studies have shown that the vacuole-specific phosphoinositide PI(3,5)P2 plays a role in regulating V-ATPase (re)assembly and that PI(3,5)P2 is able to directly bind aNT (
      • Li S.C.
      • Diakov T.T.
      • Xu T.
      • Tarsio M.
      • Zhu W.
      • Couoh-Cardel S.
      • Weisman L.S.
      • Kane P.M.
      The signaling lipid PI(3,5)P(2) stabilizes V1-Vo sector interactions and activates the V-ATPase.
      ). One possibility is that the PI(3,5)P2 headgroups compete with subunit d for aNT binding, thereby helping to change the conformation of aNT from the free Vo state to a more peripheral conformation in preparation for enzyme reassembly.
      Currently, there is no high-resolution structure available for an intact membrane domain of any of the rotary motor enzymes, and this lack of structural information has limited our understanding of the mechanism of ion translocation and activity silencing in case of the eukaryotic V-ATPase. The protocol described here allows isolation of highly purified and stable Vo, paving the way for obtaining a high-resolution structure of a rotary motor ATPase proton channel sector using crystallographic or single-molecule techniques. Studies toward that aim are ongoing in our laboratory.

      Author Contributions

      S. C. C. and S. W. designed the study and wrote the manuscript. S. C. C. performed the Vo purification and structural characterization with technical assistance from S. W. S. W. performed the ITC experiments, including recombinant protein purification. E. M. generated the subunit B deletion strain.

      Acknowledgments

      We thank Dr. Patricia Kane for reagents and help with yeast molecular biology and Nicholas J. Stam, Stuti Sharma, and Dr. Rebecca A. Oot for discussions. We thank Dr. Karlett Parra for the plasmid encoding yeast V-ATPase subunit d and Dr. Lee Parsons for generating the subunit d expression construct. We also thank Robert Carroll for generating the aNT(1–372) expression construct and Dr. Richard Gillilan for help with BioSAXS data collection. Part of this work is on the basis of research conducted at the Cornell High-Energy Synchrotron Source (CHESS), which is supported by the National Science Foundation and the NIGMS/National Institutes of Health under National Science Foundation Award DMR-1332208, using the Macromolecular Diffraction at CHESS (MacCHESS) facility, which is supported by Award GM-103485 from the NIGMS/National Institutes of Health.

      References

        • Forgac M.
        Vacuolar ATPases: rotary proton pumps in physiology and pathophysiology.
        Nat. Rev. Mol. Cell Biol. 2007; 8: 917-929
        • Kane P.M.
        The long physiological reach of the yeast vacuolar H+-ATPase.
        J. Bioenerg. Biomembr. 2007; 39: 415-421
        • Sun-Wada G.H.
        • Wada Y.
        • Futai M.
        Diverse and essential roles of mammalian vacuolar-type proton pump ATPase: toward the physiological understanding of inside acidic compartments.
        Biochim. Biophys. Acta. 2004; 1658: 106-114
        • Blake-Palmer K.G.
        • Karet F.E.
        Cellular physiology of the renal H+ATPase.
        Curr. Opin. Nephrol. Hypertens. 2009; 18: 433-438
        • Smith A.N.
        • Skaug J.
        • Choate K.A.
        • Nayir A.
        • Bakkaloglu A.
        • Ozen S.
        • Hulton S.A.
        • Sanjad S.A.
        • Al-Sabban E.A.
        • Lifton R.P.
        • Scherer S.W.
        • Karet F.E.
        Mutations in ATP6N1B, encoding a new kidney vacuolar proton pump 116-kD subunit, cause recessive distal renal tubular acidosis with preserved hearing.
        Nat. Genet. 2000; 26: 71-75
        • Karet F.E.
        • Finberg K.E.
        • Nelson R.D.
        • Nayir A.
        • Mocan H.
        • Sanjad S.A.
        • Rodriguez-Soriano J.
        • Santos F.
        • Cremers C.W.
        • Di Pietro A.
        • Hoffbrand B.I.
        • Winiarski J.
        • Bakkaloglu A.
        • Ozen S.
        • Dusunsel R.
        • Goodyer P.
        • Hulton S.A.
        • Wu D.K.
        • Skvorak A.B.
        • Morton C.C.
        • Cunningham M.J.
        • Jha V.
        • Lifton R.P.
        Mutations in the gene encoding B1 subunit of H+-ATPase cause renal tubular acidosis with sensorineural deafness.
        Nat. Genet. 1999; 21: 84-90
        • Thudium C.S.
        • Jensen V.K.
        • Karsdal M.A.
        • Henriksen K.
        Disruption of the V-ATPase functionality as a way to uncouple bone formation and resorption: a novel target for treatment of osteoporosis.
        Curr. Protein Pept. Sci. 2012; 13: 141-151
        • Sun-Wada G.H.
        • Toyomura T.
        • Murata Y.
        • Yamamoto A.
        • Futai M.
        • Wada Y.
        The a3 isoform of V-ATPase regulates insulin secretion from pancreatic β-cells.
        J. Cell Sci. 2006; 119: 4531-4540
        • Wong D.
        • Bach H.
        • Sun J.
        • Hmama Z.
        • Av-Gay Y.
        Mycobacterium tuberculosis protein tyrosine phosphatase (PtpA) excludes host vacuolar-H+-ATPase to inhibit phagosome acidification.
        Proc. Natl. Acad. Sci. U.S.A. 2011; 108: 19371-19376
        • Lu X.
        • Yu H.
        • Liu S.H.
        • Brodsky F.M.
        • Peterlin B.M.
        Interactions between HIV1 Nef and vacuolar ATPase facilitate the internalization of CD4.
        Immunity. 1998; 8: 647-656
        • Brown D.
        • Smith P.J.
        • Breton S.
        Role of V-ATPase-rich cells in acidification of the male reproductive tract.
        J. Exp. Biol. 1997; 200: 257-262
        • Sennoune S.R.
        • Bakunts K.
        • Martínez G.M.
        • Chua-Tuan J.L.
        • Kebir Y.
        • Attaya M.N.
        • Martínez-Zaguilán R.
        Vacuolar H+-ATPase in human breast cancer cells with distinct metastatic potential: distribution and functional activity.
        Am. J. Physiol. Cell Physiol. 2004; 286: C1443-C1452
        • Johnson R.M.
        • Allen C.
        • Melman S.D.
        • Waller A.
        • Young S.M.
        • Sklar L.A.
        • Parra K.J.
        Identification of inhibitors of vacuolar proton-translocating ATPase pumps in yeast by high-throughput screening flow cytometry.
        Anal. Biochem. 2010; 398: 203-211
        • Kartner N.
        • Manolson M.F.
        Novel techniques in the development of osteoporosis drug therapy: the osteoclast ruffled-border vacuolar H+-ATPase as an emerging target.
        Expert. Opin. Drug Discov. 2014; 9: 505-522
        • Fais S.
        • De Milito A.
        • You H.
        • Qin W.
        Targeting vacuolar H+-ATPases as a new strategy against cancer.
        Cancer Res. 2007; 67: 10627-10630
        • Kitagawa N.
        • Mazon H.
        • Heck A.J.
        • Wilkens S.
        Stoichiometry of the peripheral stalk subunits E and G of yeast V1-ATPase determined by mass spectrometry.
        J. Biol. Chem. 2008; 283: 3329-3337
        • Powell B.
        • Graham L.A.
        • Stevens T.H.
        Molecular characterization of the yeast vacuolar H+-ATPase proton pore.
        J. Biol. Chem. 2000; 275: 23654-23660
        • Zhao J.
        • Benlekbir S.
        • Rubinstein J.L.
        Electron cryomicroscopy observation of rotational states in a eukaryotic V-ATPase.
        Nature. 2015; 521: 241-245
        • Arai S.
        • Saijo S.
        • Suzuki K.
        • Mizutani K.
        • Kakinuma Y.
        • Ishizuka-Katsura Y.
        • Ohsawa N.
        • Terada T.
        • Shirouzu M.
        • Yokoyama S.
        • Iwata S.
        • Yamato I.
        • Murata T.
        Rotation mechanism of Enterococcus hirae V1-ATPase based on asymmetric crystal structures.
        Nature. 2013; 493: 703-707
        • Kawasaki-Nishi S.
        • Nishi T.
        • Forgac M.
        Arg-735 of the 100-kDa subunit a of the yeast V-ATPase is essential for proton translocation.
        Proc. Natl. Acad. Sci. U.S.A. 2001; 98: 12397-12402
        • Muench S.P.
        • Trinick J.
        • Harrison M.A.
        Structural divergence of the rotary ATPases.
        Q. Rev. Biophys. 2011; 44: 311-356
        • Wilkens S.
        Rotary molecular motors.
        Adv. Protein Chem. 2005; 71: 345-382
        • Stewart A.G.
        • Sobti M.
        • Harvey R.P.
        • Stock D.
        Rotary ATPases: models, machine elements and technical specifications.
        Bioarchitecture. 2013; 3: 2-12
        • Sumner J.P.
        • Dow J.A.
        • Earley F.G.
        • Klein U.
        • Jäger D.
        • Wieczorek H.
        Regulation of plasma membrane V-ATPase activity by dissociation of peripheral subunits.
        J. Biol. Chem. 1995; 270: 5649-5653
        • Kane P.M.
        Disassembly and reassembly of the yeast vacuolar H+-ATPase in vivo.
        J. Biol. Chem. 1995; 270: 17025-17032
        • Parra K.J.
        • Keenan K.L.
        • Kane P.M.
        The H subunit (Vma13p) of the yeast V-ATPase inhibits the ATPase activity of cytosolic V1 complexes.
        J. Biol. Chem. 2000; 275: 21761-21767
        • Gräf R.
        • Harvey W.R.
        • Wieczorek H.
        Purification and properties of a cytosolic V1-ATPase.
        J. Biol. Chem. 1996; 271: 20908-20913
        • Diab H.
        • Ohira M.
        • Liu M.
        • Cobb E.
        • Kane P.M.
        Subunit interactions and requirements for inhibition of the yeast V1-ATPase.
        J. Biol. Chem. 2009; 284: 13316-13325
        • Wilkens S.
        • Forgac M.
        Three-dimensional structure of the vacuolar ATPase proton channel by electron microscopy.
        J. Biol. Chem. 2001; 276: 44064-44068
        • Wilkens S.
        • Inoue T.
        • Forgac M.
        Three-dimensional structure of the vacuolar ATPase: localization of subunit H by difference imaging and chemical cross-linking.
        J. Biol. Chem. 2004; 279: 41942-41949
        • Zhang Z.
        • Zheng Y.
        • Mazon H.
        • Milgrom E.
        • Kitagawa N.
        • Kish-Trier E.
        • Heck A.J.
        • Kane P.M.
        • Wilkens S.
        Structure of the yeast vacuolar ATPase.
        J. Biol. Chem. 2008; 283: 35983-35995
        • Benlekbir S.
        • Bueler S.A.
        • Rubinstein J.L.
        Structure of the vacuolar-type ATPase from Saccharomyces cerevisiae at 11-A resolution.
        Nat. Struct. Mol. Biol. 2012; 19: 1356-1362
        • Rawson S.
        • Phillips C.
        • Huss M.
        • Tiburcy F.
        • Wieczorek H.
        • Trinick J.
        • Harrison M.A.
        • Muench S.P.
        Structure of the vacuolar H+-ATPase rotary motor reveals new mechanistic insights.
        Structure. 2015; 23: 461-471
        • Qi J.
        • Forgac M.
        Function and subunit interactions of the N-terminal domain of subunit a (Vph1p) of the yeast V-ATPase.
        J. Biol. Chem. 2008; 283: 19274-19282
        • Nielsen S.S.
        • Toft K.N.
        • Snakenborg D.
        • Jeppesen M.G.
        • Jacobsen J.K.
        • Vestergaard B.
        • Kutter J.P.
        • Arleth L.
        BioXTAS RAW, a software program for high-throughput automated small-angle X-ray scattering data reduction and preliminary analysis.
        J. Appl. Cryst. 2009; 42: 959-964
        • Gipson B.
        • Zeng X.
        • Zhang Z.Y.
        • Stahlberg H.
        2dx: user-friendly image processing for 2D crystals.
        J. Struct. Biol. 2007; 157: 64-72
        • van Heel M.
        • Harauz G.
        • Orlova E.V.
        • Schmidt R.
        • Schatz M.
        A new generation of the IMAGIC image processing system.
        J. Struct. Biol. 1996; 116: 17-24
        • Lee J.Y.
        • Urbatsch I.L.
        • Senior A.E.
        • Wilkens S.
        Nucleotide-induced structural changes in P-glycoprotein observed by electron microscopy.
        J. Biol. Chem. 2008; 283: 5769-5779
        • Ludtke S.J.
        • Baldwin P.R.
        • Chiu W.
        EMAN: semiautomated software for high-resolution single-particle reconstructions.
        J. Struct. Biol. 1999; 128: 82-97
        • Dube P.
        • Tavares P.
        • Lurz R.
        • van Heel M.
        The portal protein of bacteriophage SPP1: a DNA pump with 13-fold symmetry.
        EMBO J. 1993; 12: 1303-1309
        • Pettersen E.F.
        • Goddard T.D.
        • Huang C.C.
        • Couch G.S.
        • Greenblatt D.M.
        • Meng E.C.
        • Ferrin T.E.
        UCSF Chimera: a visualization system for exploratory research and analysis.
        J. Comput. Chem. 2004; 25: 1605-1612
        • Böttcher B.
        • Wynne S.A.
        • Crowther R.A.
        Determination of the fold of the core protein of hepatitis B virus by electron cryomicroscopy.
        Nature. 1997; 386: 88-91
        • Kelley L.A.
        • Mezulis S.
        • Yates C.M.
        • Wass M.N.
        • Sternberg M.J.
        The Phyre2 web portal for protein modeling, prediction and analysis.
        Nat. Protoc. 2015; 10: 845-858
        • Oot R.A.
        • Wilkens S.
        Subunit interactions at the V1-Vo interface in yeast vacuolar ATPase.
        J. Biol. Chem. 2012; 287: 13396-13406
        • Oot R.A.
        • Wilkens S.
        Domain characterization and interaction of the yeast vacuolar ATPase subunit C with the peripheral stator stalk subunits E and G.
        J. Biol. Chem. 2010; 285: 24654-24664
        • Peterson G.L.
        A simplification of the protein assay method of Lowry et al. which is more generally applicable.
        Anal. Biochem. 1977; 83: 346-356
        • Zhang Z.
        • Inoue T.
        • Forgac M.
        • Wilkens S.
        Localization of subunit C (Vma5p) in the yeast vacuolar ATPase by immuno electron microscopy.
        FEBS Lett. 2006; 580: 2006-2010
        • Murata T.
        • Yamato I.
        • Kakinuma Y.
        • Leslie A.G.
        • Walker J.E.
        Structure of the rotor of the V-Type Na+-ATPase from Enterococcus hirae.
        Science. 2005; 308: 654-659
        • Compton M.A.
        • Graham L.A.
        • Stevens T.H.
        Vma9p (subunit e) is an integral membrane V0 subunit of the yeast V-ATPase.
        J. Biol. Chem. 2006; 281: 15312-15319
        • Srinivasan S.
        • Vyas N.K.
        • Baker M.L.
        • Quiocho F.A.
        Crystal structure of the cytoplasmic N-terminal domain of subunit I, a homolog of subunit a, of V-ATPase.
        J. Mol. Biol. 2011; 412: 14-21
        • Iwata M.
        • Imamura H.
        • Stambouli E.
        • Ikeda C.
        • Tamakoshi M.
        • Nagata K.
        • Makyio H.
        • Hankamer B.
        • Barber J.
        • Yoshida M.
        • Yokoyama K.
        • Iwata S.
        Crystal structure of a central stalk subunit C and reversible association/dissociation of vacuole-type ATPase.
        Proc. Natl. Acad. Sci. U.S.A. 2004; 101: 59-64
        • Drory O.
        • Frolow F.
        • Nelson N.
        Crystal structure of yeast V-ATPase subunit C reveals its stator function.
        EMBO Rep. 2004; 5: 1148-1152
        • Schneider E.
        • Altendorf K.
        All three subunits are required for the reconstitution of an active proton channel (F0) of Escherichia coli ATP synthase (F1F0).
        EMBO J. 1985; 4: 515-518
        • Mosher M.E.
        • Peters L.K.
        • Fillingame R.H.
        Use of λ unc transducing bacteriophages in genetic and biochemical characterization of H+-ATPase mutants of Escherichia coli.
        J. Bacteriol. 1983; 156: 1078-1092
        • Zhang J.
        • Myers M.
        • Forgac M.
        Characterization of the V0 domain of the coated vesicle H+-ATPase.
        J. Biol. Chem. 1992; 267: 9773-9778
        • Suzuki T.
        • Ueno H.
        • Mitome N.
        • Suzuki J.
        • Yoshida M.
        F(0) of ATP synthase is a rotary proton channel: obligatory coupling of proton translocation with rotation of c-subunit ring.
        J. Biol. Chem. 2002; 277: 13281-13285
        • Wilkens S.
        • Zhang Z.
        • Zheng Y.
        A structural model of the vacuolar ATPase from transmission electron microscopy.
        Micron. 2005; 36: 109-126
        • Allegretti M.
        • Klusch N.
        • Mills D.J.
        • Vonck J.
        • Kühlbrandt W.
        • Davies K.M.
        Horizontal membrane-intrinsic α-helices in the stator a-subunit of an F-type ATP synthase.
        Nature. 2015; 521: 237-240
        • Hirata R.
        • Graham L.A.
        • Takatsuki A.
        • Stevens T.H.
        • Anraku Y.
        VMA11 and VMA16 encode second and third proteolipid subunits of the Saccharomyces cerevisiae vacuolar membrane H+-ATPase.
        J. Biol. Chem. 1997; 272: 4795-4803
        • Ediger B.
        • Melman S.D.
        • Pappas Jr., D.L.
        • Finch M.
        • Applen J.
        • Parra K.J.
        The tether connecting cytosolic (N terminus) and membrane (C terminus) domains of yeast V-ATPase subunit a (Vph1) is required for assembly of V0 subunit d.
        J. Biol. Chem. 2009; 284: 19522-19532
        • Li S.C.
        • Diakov T.T.
        • Xu T.
        • Tarsio M.
        • Zhu W.
        • Couoh-Cardel S.
        • Weisman L.S.
        • Kane P.M.
        The signaling lipid PI(3,5)P(2) stabilizes V1-Vo sector interactions and activates the V-ATPase.
        Mol. Biol. Cell. 2014; 25: 1251-1262
        • Wang Y.
        • Cipriano D.J.
        • Forgac M.
        Arrangement of subunits in the proteolipid ring of the V-ATPase.
        J. Biol. Chem. 2007; 282: 34058-34065
        • Wang Y.
        • Inoue T.
        • Forgac M.
        TM2 but not TM4 of subunit c“ interacts with TM7 of subunit a of the yeast V-ATPase as defined by disulfide-mediated cross-linking.
        J. Biol. Chem. 2004; 279: 44628-44638