Advertisement

Metabotropic Glutamate Receptors

MODULATORS OF CONTEXT-DEPENDENT FEEDING BEHAVIOUR IN C. ELEGANS
Open AccessPublished:April 13, 2015DOI:https://doi.org/10.1074/jbc.M114.606608
      Glutamatergic neurotransmission is evolutionarily conserved across animal phyla. A major class of glutamate receptors consists of the metabotropic glutamate receptors (mGluRs). In C. elegans, three mGluR genes, mgl-1, mgl-2, and mgl-3, are organized into three subgroups, similar to their mammalian counterparts. Cellular reporters identified expression of the mgls in the nervous system of C. elegans and overlapping expression in the pharyngeal microcircuit that controls pharyngeal muscle activity and feeding behavior. The overlapping expression of mgls within this circuit allowed the investigation of receptor signaling per se and in the context of receptor interactions within a neural network that regulates feeding. We utilized the pharmacological manipulation of neuronally regulated pumping of the pharyngeal muscle in the wild-type and mutants to investigate MGL function. This defined a net mgl-1-dependent inhibition of pharyngeal pumping that is modulated by mgl-3 excitation. Optogenetic activation of the pharyngeal glutamatergic inputs combined with electrophysiological recordings from the isolated pharyngeal preparations provided further evidence for a presynaptic mgl-1-dependent regulation of pharyngeal activity. Analysis of mgl-1, mgl-2, and mgl-3 mutant feeding behavior in the intact organism after acute food removal identified a significant role for mgl-1 in the regulation of an adaptive feeding response. Our data describe the molecular and cellular organization of mgl-1, mgl-2, and mgl-3. Pharmacological analysis identified that, in these paradigms, mgl-1 and mgl-3, but not mgl-2, can modulate the pharyngeal microcircuit. Behavioral analysis identified mgl-1 as a significant determinant of the glutamate-dependent modulation of feeding, further highlighting the significance of mGluRs in complex C. elegans behavior.

      Introduction

      In mammals, glutamate signals broadly via two classes of receptors: the ionotropic glutamate receptors and metabotropic glutamate receptors (mGluRs)
      The abbreviations used are: mGluR
      metabotropic glutamate receptor
      RACE
      rapid amplification of cDNA ends
      SL
      splice leader
      EPG
      electropharyngeogram
      (±)trans-ACPD
      (±)-1-aminocyclopentane-trans-1,3-dicarboxylic acid
      LCCG-I
      (2S,1′S,2′S)-2-(carboxycyclopropyl)glycine.
      (
      • Watkins J.C.
      • Davies J.
      • Evans R.H.
      • Francis A.A.
      • Jones A.W.
      Pharmacology of receptors for excitatory amino acids.
      ,
      • Pin J.P.
      • Duvoisin R.
      The metabotropic glutamate receptors: structure and functions.
      ). mGluRs are G protein-coupled receptors and perform an important neuromodulatory role in glutamatergic transmission within the mammalian nervous system (
      • Awad H.
      • Hubert G.W.
      • Smith Y.
      • Levey A.I.
      • Conn P.J.
      Activation of metabotropic glutamate receptor 5 has direct excitatory effects and potentiates NMDA receptor currents in neurons of the subthalamic nucleus.
      ,
      • Heidinger V.
      • Manzerra P.
      • Wang X.Q.
      • Strasser U.
      • Yu S.P.
      • Choi D.W.
      • Behrens M.M.
      Metabotropic glutamate receptor 1-induced upregulation of NMDA receptor current: mediation through the Pyk2/Src-family kinase pathway in cortical neurons.
      ). The importance of this class of receptors is highlighted by their involvement in a number of different neurological conditions, including anxiety, autism, and schizophrenia (
      • Herman E.J.
      • Bubser M.
      • Conn P.J.
      • Jones C.K.
      Metabotropic glutamate receptors for new treatments in schizophrenia.
      ,
      • Oberman L.M.
      mGluR antagonists and GABA agonists as novel pharmacological agents for the treatment of autism spectrum disorders.
      ). Interestingly, it has been proposed that each of these conditions involves a loss of the balance between cellular inhibition and excitation within the context of discrete microcircuits (
      • Yizhar O.
      • Fenno L.E.
      • Prigge M.
      • Schneider F.
      • Davidson T.J.
      • O'Shea D.J.
      • Sohal V.S.
      • Goshen I.
      • Finkelstein J.
      • Paz J.T.
      • Stehfest K.
      • Fudim R.
      • Ramakrishnan C.
      • Huguenard J.R.
      • Hegemann P.
      • Deisseroth K.
      Neocortical excitation/inhibition balance in information processing and social dysfunction.
      ,
      • Rubenstein J.L.
      • Merzenich M.M.
      Model of autism: increased ratio of excitation/inhibition in key neural systems.
      ,
      • Kehrer C.
      • Maziashvili N.
      • Dugladze T.
      • Gloveli T.
      Altered excitatory-inhibitory balance in the NMDA-hypofunction model of schizophrenia.
      ). As neuromodulators, mGluRs represent attractive targets to manipulate the excitatory-inhibitory balance and alleviate the behavioral dysfunction and sensory deficits associated with these conditions (
      • Oberman L.M.
      mGluR antagonists and GABA agonists as novel pharmacological agents for the treatment of autism spectrum disorders.
      ,
      • Conn P.J.
      • Jones C.K.
      Promise of mGluR2/3 activators in psychiatry.
      ). Therefore, an understanding of mGluR contribution to the balance of activity within a microcircuit is potentially beneficial within the broader context of neurological disorders in which this imbalance has been suggested as an underlying cause.
      Both the ionotropic glutamate receptor and mGluR classes of receptors are conserved within the genome of the model organism Caenorhabditis elegans. In C. elegans, the ionotropic glutamate receptor subfamily is well characterized and encompasses mammalian NMDA and AMPA-like receptors together with an invertebrate-specific subgroup of glutamate-gated chloride ion channels (
      • Brockie P.J.
      • Maricq A.V.
      Ionotropic glutamate receptors: genetics, behavior and electrophysiology.
      ). The C. elegans genome encodes at least three mGluRs, designated mgl-1, mgl-2, and mgl-3. Although the experimental tractability of C. elegans has provided insight into the molecular, cellular, and functional organization of the ionotropic glutamate receptor family (
      • Brockie P.J.
      • Maricq A.V.
      Ionotropic glutamate receptors: genetics, behavior and electrophysiology.
      ), comparatively less is known about the function of the MGL class of receptors in C. elegans. The identification of mGluRs in invertebrates that are closely related to specific vertebrate mGluR subtypes suggests that this class of receptors may play a similarly important role in signaling and adaptive behavior within simpler organisms (
      • Parmentier M.L.
      • Pin J.P.
      • Bockaert J.
      • Grau Y.
      Cloning and functional expression of a Drosophila metabotropic glutamate receptor expressed in the embryonic CNS.
      ,
      • Krenz W.D.
      • Nguyen D.
      • Pérez-Acevedo N.L.
      • Selverston A.I.
      Group I, II, and III mGluR compounds affect rhythm generation in the gastric circuit of the crustacean stomatogastric ganglion.
      ,
      • Kucharski R.
      • Mitri C.
      • Grau Y.
      • Maleszka R.
      Characterization of a metabotropic glutamate receptor in the honeybee (Apis mellifera): implications for memory formation.
      ,
      • Washio H.
      Glutamate receptors on the somata of dorsal unpaired median neurons in cockroach, Periplaneta americana, thoracic ganglia.
      ).
      C. elegans displays a number of rhythmic behaviors that undergo adaptation and are modulated by the activity of simple microcircuits that integrate sensory information from both the external and internal environment of the worm. A key sensory cue that governs the pattern of activity within these microcircuits is food (
      • Weinshenker D.
      • Garriga G.
      • Thomas J.H.
      Genetic and pharmacological analysis of neurotransmitters controlling egg laying in C. elegans.
      ,
      • Wakabayashi T.
      • Kitagawa I.
      • Shingai R.
      Neurons regulating the duration of forward locomotion in Caenorhabditis elegans.
      ). Indeed, dopaminergic, cholinergic, and 5-HT signaling via G protein-coupled receptors has been shown previously to contribute to a number of food-dependent behaviors that encompass changes in patterns of locomotory subbehaviors and pharyngeal function (
      • Jorgensen E.M.
      Dopamine: should I stay or should I go now?.
      ,
      • Sawin E.R.
      • Ranganathan R.
      • Horvitz H.R.
      C. elegans locomotory rate is modulated by the environment through a dopaminergic pathway and by experience through a serotonergic pathway.
      ,
      • You Y.J.
      • Kim J.
      • Cobb M.
      • Avery L.
      Starvation activates MAP kinase through the muscarinic acetylcholine pathway in Caenorhabditis elegans pharynx.
      ). Therefore, the presentation and removal of a sensory cue, such as food, represents two very distinct contexts that change the behavior of the worms by separate signaling pathways. In C. elegans, context-dependent signaling has been resolved at the level of neurons expressed within circuits that are responsible for either the detection of sensory cues or the integration of sensory signals with motor coordination. For example, the glutamatergic circuitry involved in chemotaxis toward an attractant contains both OFF-sensing neurons, which are active in the absence of an attractant, and ON-sensing neurons, which are active in the presence of an attractant. OFF and ON situations represent distinct contextual states, and the coordinated signaling between OFF-sensing and ON-sensing neurons provides a mechanism by which C. elegans can initiate adaptive changes in behavior in response to contextual changes such as the presentation and removal of a sensory cue (
      • Chalasani S.H.
      • Chronis N.
      • Tsunozaki M.
      • Gray J.M.
      • Ramot D.
      • Goodman M.B.
      • Bargmann C.I.
      Dissecting a circuit for olfactory behaviour in Caenorhabditis elegans.
      ). C. elegans feeding behavior has been shown previously to change upon the presentation and removal of food (
      • You Y.J.
      • Kim J.
      • Cobb M.
      • Avery L.
      Starvation activates MAP kinase through the muscarinic acetylcholine pathway in Caenorhabditis elegans pharynx.
      ,
      • Walker D.S.
      • Gower N.J.
      • Ly S.
      • Bradley G.L.
      • Baylis H.A.
      Regulated disruption of inositol 1,4,5-trisphosphate signaling in Caenorhabditis elegans reveals new functions in feeding and embryogenesis.
      ), highlighting that circuits contributing to the activity of the pharynx are subject to context-dependent signaling. The observation that glutamate signaling can activate circuits to mimic feeding behavior in the OFF-food state implicates a role for this neurotransmitter pathway in the context-dependent modulation of the pharyngeal nervous system (
      • Dalliere N.
      • Bhatla N.
      • Walker R.
      • O'Connor V.
      • Holden-Dye L.
      ). Glutamatergic signaling and specific receptors therein may therefore contribute to the signaling pathways underlying context-dependent changes in C. elegans feeding behavior.
      Here we describe three metabotropic glutamate receptors that have a widespread expression in the nervous system of C. elegans. The mgls appear to be differentially expressed exclusively in the nervous system of C. elegans. mgl-1, mgl-2, and mgl-3 expression in the pharyngeal nervous system suggests their involvement in the modulation of pharyngeal network activity. Electrophysiological recordings on a semi-intact preparation of the C. elegans pharynx, combined with the use of mGluR agonists and worms with putative null mutations identified that, under these experimental conditions, both mgl-1 and mgl-3, but not mgl-2, can modulate the activity of the pharyngeal circuit. Experiments performed on intact animals suggest that, of the three receptors, mgl-1 makes a significant contribution to changes in feeding behavior upon acute food removal and to the context-dependent modulation of C. elegans feeding behavior. Overall, the results reveal a role for glutamate neurotransmission and MGL receptor signaling in context-dependent feeding behaviors.

      Experimental Procedures

      Culturing of C. elegans

      C. elegans strains were cultured under standard conditions (
      • Brenner S.
      The genetics of Caenorhabditis elegans.
      ). Wild-type Bristol N2 and eat-4(ky5) was obtained from the Caenorhabditis Genetics Centre. The strain pha-1(e2123) was obtained from R. Schnabel. The putative mgl knockout strains mgl-1(tm1811), mgl-2(tm0355), and mgl-3(tm1766) were obtained from the National Bioresources Project (Tokyo women's Medical University, Tokyo). The mgl GFP reporter strain utIs35[mgl-1::GFP] is a mgl-1::GFP gene fusion under the mgl-1 promoter (as described in unpublished communication (
      • Ishihara T.
      • Katsura I.
      Worm Breeder's Gazette.
      ). The mgl mutant strains were outcrossed at least three times.

      Molecular Phylogeny of MGL Proteins

      Protein sequences for 77 metazoans with sequenced genomes were downloaded from Ensembl (version 61, March 2, 2011) (
      • Flicek P.
      • Amode M.R.
      • Barrell D.
      • Beal K.
      • Brent S.
      • Chen Y.
      • Clapham P.
      • Coates G.
      • Fairley S.
      • Fitzgerald S.
      • Gordon L.
      • Hendrix M.
      • Hourlier T.
      • Johnson N.
      • Kähäri A.
      • Keefe D.
      • Keenan S.
      • Kinsella R.
      • Kokocinski F.
      • Kulesha E.
      • Larsson P.
      • Longden I.
      • McLaren W.
      • Overduin B.
      • Pritchard B.
      • Riat H.S.
      • Rios D.
      • Ritchie G.R.
      • Ruffier M.
      • Schuster M.
      • Sobral D.
      • Spudich G.
      • Tang Y.A.
      • Trevanion S.
      • Vandrovcova J.
      • Vilella A.J.
      • White S.
      • Wilder S.P.
      • Zadissa A.
      • Zamora J.
      • Aken B.L.
      • Birney E.
      • Cunningham F.
      • Dunham I.
      • Durbin R.
      • Fernández-Suarez X.M.
      • Herrero J.
      • Hubbard T.J.
      • Parker A.
      • Proctor G.
      • Vogel J.
      • Searle S.M.
      Ensembl 2011.
      ). In addition, Brugia malayi proteins were downloaded from Wormbase (February 13, 2011) (
      • Harris T.W.
      • Antoshechkin I.
      • Bieri T.
      • Blasiar D.
      • Chan J.
      • Chen W.J.
      • De La Cruz N.
      • Davis P.
      • Duesbury M.
      • Fang R.
      • Fernandes J.
      • Han M.
      • Kishore R.
      • Lee R.
      • Müller H.M.
      • Nakamura C.
      • Ozersky P.
      • Petcherski A.
      • Rangarajan A.
      • Rogers A.
      • Schindelman G.
      • Schwarz E.M.
      • Tuli M.A.
      • Van Auken K.
      • Wang D.
      • Wang X.
      • Williams G.
      • Yook K.
      • Durbin R.
      • Stein L.D.
      • Spieth J.
      • Sternberg P.W.
      WormBase: a comprehensive resource for nematode research.
      ). Homologues of C. elegans MGL-2 (F45H11.4.2) were identified from these proteomes using BLAST (
      • Altschul S.F.
      • Madden T.L.
      • Schäffer A.A.
      • Zhang J.
      • Zhang Z.
      • Miller W.
      • Lipman D.J.
      Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
      ), and the protein family was constructed with HAQESAC (
      • Edwards R.J.
      • Moran N.
      • Devocelle M.
      • Kiernan A.
      • Meade G.
      • Signac W.
      • Foy M.
      • Park S.D.
      • Dunne E.
      • Kenny D.
      • Shields D.C.
      Bioinformatic discovery of novel bioactive peptides.
      ). Protein alignments were performed with MAFFT (
      • Katoh K.
      • Toh H.
      Recent developments in the MAFFT multiple sequence alignment program.
      ) using default settings. Minimum evolution molecular phylogenies were constructed using FastTree (
      • Price M.N.
      • Dehal P.S.
      • Arkin A.P.
      FastTree: computing large minimum evolution trees with profiles instead of a distance matrix.
      ) with 1000 bootstrap replicates.

      RACE, SL-1, and Predictive PCR Analysis

      Rapid Amplification of cDNA Ends (RACE) Amplifications

      Total RNA was extracted from mixed-stage Bristol N2 animals using a TRIzol® (Invitrogen) extraction method. Both reverse-transcribed mRNA and a C. elegans cDNA library (Origene) were used as templates for the various characterization techniques used and outlined below. All 5′-RACE products analyzed in this study were derived from two rounds of amplification using a 5′-RACE primer in the first reaction and a nested 5′-RACE primer in the second reaction, as indicated below. In contrast, all analyzed 3′-RACE products were generated using a single amplification with a 3′-RACE primer. For these experiments, 1 μg of total RNA was used to perform first-strand cDNA synthesis and incorporate either the 5′- or 3′-RACE adaptor sequence as described by the manufacturer (SMART RACE cDNA amplification kit, Clontech). The RACE adaptor-fused first-strand cDNA was used directly as the template for RACE PCR. RACE primers were designed using the sequence information available at the time. The sequences of primers used were as follows: mgl-1 5′-RACE (5′-GATGGCGAGCTCTCGTCATCTGTCATCCTC-3′), mgl-1 5′-nested RACE (5′-GTCATTGTTTCTATCCCACGACTCTGATGCAAGC-3′),mgl-1 3′-RACE (5′-CTCCGCCTGGGTCAACGGCATCAAGGTGC-3′), mgl-2 5′-RACE (5′-CGATGCTGTTCGTGTGACTCCTCCACCCATAC-3′), mgl-2 5′-nested RACE (5′-GTCGGATAAGTCTGGAGTGGTGGCGGAG-3′), mgl-2 3′-RACE (5′-GTCGGAGTTGGTTTGATGCGGGATTGGCCGGATG-3′), mgl-3 5′-RACE (5′-GAACCGGAGGAATTGGCACGAAAAATGAAGAG-3′), mgl-3 5′-nested RACE (5′-CGGCTCCTGTTGAACTGTAGCTGACTTGAGG-3′), and mgl-3 3′-RACE (5′-GAATGGTGACGGAATCGGACGATATGATGTCTTC-3′).

      C-terminal Domain Amplification

      Mixed-stage cDNA was used as a template in reactions designed to amplify the sequences encoding the entire intracellular C-terminal domain of the receptors. This was done with primers encoding the 5′ (5′-CT) end of this domain and the 3′ end (3′-CT) encoding the last eight to ten amino acids preceding the predicted stop codon: mgl-1 5′-CT (5′-GAAAAACACAAAAACGTCCGAAAG-3′), mgl-1 3′-CT (5′-TCATAAGAAAGTATCGTGAGC-3′), mgl-2 5′-CT (5′-CATCCTGAGAAGAATATCAGA-3′), mgl-2 3′-CT (5′-TCAAAAGATTTGCTTGAAATC-3′), mgl-3 5′-CT (5′-CAACCATACAAAAATGTGAGG-3′), and mgl-3 3′-CT (5′-TCAAAGAAAAGTGGAATTAGTGTC-3′).

      Splice Leader (SL) Analysis

      SL primers were designed according to the published sequences for SL-1 (5′-GGTTTAATTACCCAAGTTTGAG-3′) and SL-2 (5′-GGTTTTAACCCAGTTACTCAAG-3′). These were combined in a standard PCR reaction with mgl-1 5′-RACE and mgl-3 5′-nested RACE as required. All PCRs were performed with the enzyme BD Advantage2 (Clontech). “Touchdown” PCR parameters were used for the first-round RACE reaction; all other PCRs were performed under standard conditions (Clontech). The amplified fragments were gel-extracted (Qiagen) and ligated into a suitable vector before sequencing (MWG Biotech). The cDNA was aligned to mgl sequences using BLASTn (NCBI) and Wormbase.

      Rescue Experiments

      The cosmid ZC506 was used to perform mgl-1(tm1811) rescue experiments and was supplied by the Caenorhabditis Genetics Centre. The cosmid ZC506 (at 10–15 ng/μl) was coinjected with the myo-2::GFP reporter plasmid pPD11833 (obtained from A. Fire) at 20–30 ng/μl. The expression of GFP in the pharyngeal muscle was used to screen for transgenic lines expressing ZC506.

      Generation of the Peat-4::ChR2;mRFP Integrated Strain

      ChR2 was amplified from the plasmid Pmyo-3::ChR2(H134R);YFP using the primers 5′-CTAGAGACTAGTATGGATTATGGAGGGCCTG (forward) and 5′-ATGGGGTACCTTAG GGCACCGCGCCAGCCTCGGCCTC (reverse). The reverse primer contained a synonymous substitution that removed a KpnI site internal to ChR2 and introduced an artificial stop codon. ChR2 was cloned SpeI/KpnI upstream of mRFP in the gateway entry vector p-ENTR. This was recombined with the gateway destination vector, p-DEST, containing 6 kb of eat-4 promoter to generate the construct Peat-4::ChR2;mRFP. The construct Peat-4::ChR2;mRFP was injected at a concentration of 50 ng/μl. Lines were established from the F2 generation stably expressing mRFP. Peat-4::ChR2;mRFP was integrated by UV irradiation and outcrossed six times.

      Construction of the mgl-2::GFP and mgl-3::GFP Gene Reporter

      For the mgl-2::GFP reporter construct, the primers 5′-CATGCATGCAAGCAAACTGAAAATCGCTCCGTGG and 5′-CAAGGTACCTTCGCCGCGTTTTTGCTCTTTTCTAC were used to amplify ∼4.5 kb of mgl-2 promoter. This was cloned into the fire vector pPD95-75 using the restriction sites Sph1/Kpn1. Using the primers 5′-GTTGGTACCAATGGTGTAGCTTGAGACAGC-3′ and 5′-CAAGGTACCATGCTCTACAGTCATGTCACAC-3′, the full-length cDNA encoding MGL-2 (F45H11.4 in WS243) was amplified, TOPO-cloned (Invitrogen), and cut using the enzyme KpnI. The 5′ KpnI site was incorporated into the 5′ primer, whereas the 3′ site was internal to the MGL-2 coding sequence and located within the C terminus. This product was cloned downstream of the mgl-2 promoter in the vector pPD95-75 using the KpnI restriction site to generate an MGL-2 protein fusion to GFP at the C terminus. This was injected at 20 ng/μl into the N2 strain by standard techniques (
      • Mello C.
      • Fire A.
      DNA transformation.
      ).
      For the mgl-3::GFP reporter construct, the primers 5′-TTCGTCGACAATAGTATTCCCGAGAACGG and 5′-GCGGCCGCTTTTACTGTCGAACTGATTGG were used to amplify ∼5 kb of mgl-3 promoter and the first exon (containing the first putative start codon). This fragment was cloned upstream of GFP in the vector pHABGFP (provided by Howard Bayliss) using the restriction sites SalI and NotI to generate the construct mgl-3::GFP. This was coinjected at 10–20 ng/μl with the pha-1 rescue plasmid pBX (obtained from R. Schnabel) into the temperature-sensitive strain pha-1(e2123) by standard techniques (
      • Mello C.
      • Fire A.
      DNA transformation.
      ). Transformed lines were selected under temperature-sensitive conditions (25.5 °C).

      Imaging of the mgl::GFP Reporter Strains

      Animals were mounted in a 5 μl drop of 10 mm levamisole (Sigma) on a 2% agarose pad covered with a 24 × 24 mm coverslip. Differential interference contrast and fluorescence imaging were performed on a Nikon Eclipse TE800 fluorescence microscope equipped with a Hamamatsu C4742-95 digital camera. Confocal images were captured with a Zeiss LSM-510 laser-scanning microscope.

      Electropharyngeogram (EPG) Recordings

      Hermaphrodite animals were grown on a bacterial lawn of OP50, and young adults were picked for electrophysiological experiments. Animals were placed into a Petri dish containing modified Dent's saline (10 mm glucose, 5 mm HEPES, 140 mm NaCl, 6 mm KCl, 3 mm CaCl2, and 1 mm MgCl2 (pH7.4)) supplemented with bovine serum albumin (0.1% w/v). Worms were dissected by cutting them at the pharyngeal-intestinal valve with a razor blade, causing the cuticle to retract and exposing the isthmus and terminal bulb to generate a semi-intact pharyngeal preparation in which the pharyngeal microcircuit remained intact. The dissected preparation will have a distinct physiology compared with the intact organism, where the somatic nervous system was completely intact. All experiments were performed at room temperature (≈ 20–22 °C). The pharyngeal preparation was transferred to a custom-made recording chamber (volume, 1 ml) mounted on a glass coverslip. Suction pipettes were pulled from borosilicate glass (glass diameter, 1 mm; tip diameter, ≈12 μm; Harvard Instruments). The pipette was lowered into the recording chamber and placed close to the anterior end of the preparation. Suction was then applied to attach the preparation to the pipette. The suction pipette was attached to an Axoclamp 2B recording amplifier. The reference electrode was a silver chloride pellet in Dent's saline connected to the recording chamber by an agar bridge. Extracellular voltage recordings were made in “bridge” mode, and the extracellular potential was set to 0 mV using the voltage offset immediately prior to recording. Data were acquired using Axoscope (Axon Instruments) and stored for subsequent offline analysis.
      In single-dose experiments, the recordings were made from the pharynges in Dent's saline for 5 min. The drug was then applied to the semi-intact pharyngeal preparation by removing and replacing the solution using a 1-ml pipette. Recordings were made from the pharynx in the presence of drug for 5 min, and then the drug was washed off. The frequency of the EPGs was measured for 5 min before drug application and 5 min after drug application. The drug was then washed off the preparation. After the drug was washed off, the preparations of EPGs were measured for a further 5 min in Dent's saline. Following the 5 min recovery period in Dent's saline, 500 nm 5-HT was applied by removing and replacing the Dent's saline using a 1-ml pipette. EPGs were measured for a further 2.5 min in the presence of 5-HT. The duration of the entire experiment for a single worm did not exceed 25 min, including the time taken to dissect the worm pharynx and apply the suction electrode.
      The LCCG-I concentration-response curve was generated by sequentially applying increasing concentrations of drug to the dissected semi-intact pharynges. The addition of each concentration was preceded by a 5-min recovery period in Dent's saline. The drug was applied for 2.5 min, and the EPGs were measured during this period. The effect of the drug on the frequency of pharyngeal EPGs was expressed as a percentage change compared with the basal resting rate during the 2.5 min immediately before the addition of the drug. The duration of the entire experiment for a single worm did not exceed 77.5 min for mgl-1and 62.5 min for N2, including the time taken to dissect the worm pharynx and apply the suction electrode.

      Intracellular Recordings

      The dissected pharynx was transferred to a custom-built perfusion chamber (volume, 1 ml) on a glass coverslip. The recording chamber was mounted on a microscope stage and perfused via gravity feed with saline at a rate of 20 ml min−1. The preparation was secured with a glass suction pipette applied to the terminal bulb region of the pharynx and then impaled with an aluminosilicate glass microelectrode (1.0-mm outer diameter) pulled on a microelectrode puller to tip with a resistance of 60–80 MΩ, filled with 4 m potassium acetate and 10 mm KCl, and connected to an Axoclamp 2A amplifier. The reference electrode was a silver chloride-coated silver pellet in 3 m KCl connected to the recording chamber by an agar bridge. Data were acquired and analyzed using PClamp8 (Axon Instruments). Drug solutions were diluted with Dent's saline from stocks as required.

      Electrophysiological Recording of the Peat-4::ChR2;mRFP Light-evoked Response

      The strains N2;Is[Peat-4::ChR2;mRFP], mgl-1(tm1811);Is[Peat-4::ChR2;mRFP], and eat-4(ky5);Is[Peat-4::ChR2;mRFP] were subjected to pharyngeal dissection as in Ref.
      • Franks C.J.
      • Murray C.
      • Ogden D.
      • O'Connor V.
      • Holden-Dye L.
      A comparison of electrically evoked and channel rhodopsin-evoked postsynaptic potentials in the pharyngeal system of Caenorhabditis elegans.
      . Desheathed pharynges were placed in a recording chamber and illuminated using a blue light-emitting diode with a wavelength of 470 nm as described in Ref.
      • Franks C.J.
      • Murray C.
      • Ogden D.
      • O'Connor V.
      • Holden-Dye L.
      A comparison of electrically evoked and channel rhodopsin-evoked postsynaptic potentials in the pharyngeal system of Caenorhabditis elegans.
      ). Intracellular recordings of muscle action potentials were recorded from the terminal bulb using sharp electrodes (as described above). For N2;Is[Peat-4::ChR2;mRFP] and mgl-1(tm1811);Is[Peat-4::ChR2;mRFP], recordings were made in the presence and absence of LCCG-I. The last ten light stimuli for each phase of the experimental time course were analyzed.

      Chemicals

      (±)-1-Aminocyclopentane-trans-1,3-dicarboxylic acid ((±)trans-ACPD) (catalog no. 0187), and (2S,1′S,2′S)-2-(carboxycyclopropyl)glycine (LCCG-I, catalog no. 0333) were obtained from Tocris Biosciences (Bristol, UK). All other chemicals were obtained from Sigma or Fisher.

      Pharyngeal Pumping Assays in Intact Animals

      A synchronized population of young adult worms was generated by picking L4-staged animals to a fresh food plate 16–18 h before performing the assay. For each individual animal, the number of pumps performed within 1 min on food was counted, and the food was then removed by placing the animal onto a fresh non-food plate and allowing it to move around for 1 min. Individual animals were transferred to a separate, second non-food plate, and the number of pumps (defined as the number of backward movements of the terminal bulb grinder) performed in 1 min were counted at two time points, 5 min and 95 min following the transfer. Then, after 96 min, worms were returned to food, and, at 100 min, the pharyngeal pumping was recorded.

      Data Analysis

      The results are expressed as the percentage change in frequency ± S.E. of the mean for n individual pharynxes. For the EPG recordings, each drug was tested on a separate pharynx. Significance was measured using one-way analysis of variance with Bonferroni post test, unless stated otherwise. Concentration-response curves were plotted by fitting the data to the modified logistic equation (GraphPad Prism, San Diego, CA), and EC50 values are given with 95% confidence limits.

      Acknowledgments

      Some strains were provided by the CGC, which is funded by National Institutes of Health Office of Research Infrastructure Programs (P40 OD010440).
      • P40 OD010440 National Institutes of Health

      References

        • Watkins J.C.
        • Davies J.
        • Evans R.H.
        • Francis A.A.
        • Jones A.W.
        Pharmacology of receptors for excitatory amino acids.
        Adv. Biochem. Psychopharmacol. 1981; 27: 263-273
        • Pin J.P.
        • Duvoisin R.
        The metabotropic glutamate receptors: structure and functions.
        Neuropharmacology. 1995; 34: 1-26
        • Awad H.
        • Hubert G.W.
        • Smith Y.
        • Levey A.I.
        • Conn P.J.
        Activation of metabotropic glutamate receptor 5 has direct excitatory effects and potentiates NMDA receptor currents in neurons of the subthalamic nucleus.
        J. Neurosci. 2000; 20: 7871-7879
        • Heidinger V.
        • Manzerra P.
        • Wang X.Q.
        • Strasser U.
        • Yu S.P.
        • Choi D.W.
        • Behrens M.M.
        Metabotropic glutamate receptor 1-induced upregulation of NMDA receptor current: mediation through the Pyk2/Src-family kinase pathway in cortical neurons.
        J. Neurosci. 2002; 22: 5452-5461
        • Herman E.J.
        • Bubser M.
        • Conn P.J.
        • Jones C.K.
        Metabotropic glutamate receptors for new treatments in schizophrenia.
        Handb. Exp. Pharmacol. 2012; 213: 297-365
        • Oberman L.M.
        mGluR antagonists and GABA agonists as novel pharmacological agents for the treatment of autism spectrum disorders.
        Expert Opin. Investig. Drugs. 2012; 21: 1819-1825
        • Yizhar O.
        • Fenno L.E.
        • Prigge M.
        • Schneider F.
        • Davidson T.J.
        • O'Shea D.J.
        • Sohal V.S.
        • Goshen I.
        • Finkelstein J.
        • Paz J.T.
        • Stehfest K.
        • Fudim R.
        • Ramakrishnan C.
        • Huguenard J.R.
        • Hegemann P.
        • Deisseroth K.
        Neocortical excitation/inhibition balance in information processing and social dysfunction.
        Nature. 2011; 477: 171-178
        • Rubenstein J.L.
        • Merzenich M.M.
        Model of autism: increased ratio of excitation/inhibition in key neural systems.
        Genes Brain Behav. 2003; 2: 255-267
        • Kehrer C.
        • Maziashvili N.
        • Dugladze T.
        • Gloveli T.
        Altered excitatory-inhibitory balance in the NMDA-hypofunction model of schizophrenia.
        Front. Mol. Neurosci. 2008; 1: 6
        • Conn P.J.
        • Jones C.K.
        Promise of mGluR2/3 activators in psychiatry.
        Neuropsychopharmacology. 2009; 34: 248-249
        • Brockie P.J.
        • Maricq A.V.
        Ionotropic glutamate receptors: genetics, behavior and electrophysiology.
        WormBook. 2006: 1-16
        • Parmentier M.L.
        • Pin J.P.
        • Bockaert J.
        • Grau Y.
        Cloning and functional expression of a Drosophila metabotropic glutamate receptor expressed in the embryonic CNS.
        J. Neurosci. 1996; 16: 6687-6694
        • Krenz W.D.
        • Nguyen D.
        • Pérez-Acevedo N.L.
        • Selverston A.I.
        Group I, II, and III mGluR compounds affect rhythm generation in the gastric circuit of the crustacean stomatogastric ganglion.
        J. Neurophysiol. 2000; 83: 1188-1201
        • Kucharski R.
        • Mitri C.
        • Grau Y.
        • Maleszka R.
        Characterization of a metabotropic glutamate receptor in the honeybee (Apis mellifera): implications for memory formation.
        Invert. Neurosci. 2007; 7: 99-108
        • Washio H.
        Glutamate receptors on the somata of dorsal unpaired median neurons in cockroach, Periplaneta americana, thoracic ganglia.
        Zoolog. Sci. 2002; 19: 153-162
        • Weinshenker D.
        • Garriga G.
        • Thomas J.H.
        Genetic and pharmacological analysis of neurotransmitters controlling egg laying in C. elegans.
        J. Neurosci. 1995; 15: 6975-6985
        • Wakabayashi T.
        • Kitagawa I.
        • Shingai R.
        Neurons regulating the duration of forward locomotion in Caenorhabditis elegans.
        Neurosci. Res. 2004; 50: 103-111
        • Jorgensen E.M.
        Dopamine: should I stay or should I go now?.
        Nat. Neurosci. 2004; 7: 1019-1021
        • Sawin E.R.
        • Ranganathan R.
        • Horvitz H.R.
        C. elegans locomotory rate is modulated by the environment through a dopaminergic pathway and by experience through a serotonergic pathway.
        Neuron. 2000; 26: 619-631
        • You Y.J.
        • Kim J.
        • Cobb M.
        • Avery L.
        Starvation activates MAP kinase through the muscarinic acetylcholine pathway in Caenorhabditis elegans pharynx.
        Cell Metab. 2006; 3: 237-245
        • Chalasani S.H.
        • Chronis N.
        • Tsunozaki M.
        • Gray J.M.
        • Ramot D.
        • Goodman M.B.
        • Bargmann C.I.
        Dissecting a circuit for olfactory behaviour in Caenorhabditis elegans.
        Nature. 2007; 450: 63-70
        • Walker D.S.
        • Gower N.J.
        • Ly S.
        • Bradley G.L.
        • Baylis H.A.
        Regulated disruption of inositol 1,4,5-trisphosphate signaling in Caenorhabditis elegans reveals new functions in feeding and embryogenesis.
        Mol. Biol. Cell. 2002; 13: 1329-1337
        • Brenner S.
        The genetics of Caenorhabditis elegans.
        Genetics. 1974; 77: 71-94
        • Flicek P.
        • Amode M.R.
        • Barrell D.
        • Beal K.
        • Brent S.
        • Chen Y.
        • Clapham P.
        • Coates G.
        • Fairley S.
        • Fitzgerald S.
        • Gordon L.
        • Hendrix M.
        • Hourlier T.
        • Johnson N.
        • Kähäri A.
        • Keefe D.
        • Keenan S.
        • Kinsella R.
        • Kokocinski F.
        • Kulesha E.
        • Larsson P.
        • Longden I.
        • McLaren W.
        • Overduin B.
        • Pritchard B.
        • Riat H.S.
        • Rios D.
        • Ritchie G.R.
        • Ruffier M.
        • Schuster M.
        • Sobral D.
        • Spudich G.
        • Tang Y.A.
        • Trevanion S.
        • Vandrovcova J.
        • Vilella A.J.
        • White S.
        • Wilder S.P.
        • Zadissa A.
        • Zamora J.
        • Aken B.L.
        • Birney E.
        • Cunningham F.
        • Dunham I.
        • Durbin R.
        • Fernández-Suarez X.M.
        • Herrero J.
        • Hubbard T.J.
        • Parker A.
        • Proctor G.
        • Vogel J.
        • Searle S.M.
        Ensembl 2011.
        Nucleic Acids Res. 2011; 39: D800-806
        • Harris T.W.
        • Antoshechkin I.
        • Bieri T.
        • Blasiar D.
        • Chan J.
        • Chen W.J.
        • De La Cruz N.
        • Davis P.
        • Duesbury M.
        • Fang R.
        • Fernandes J.
        • Han M.
        • Kishore R.
        • Lee R.
        • Müller H.M.
        • Nakamura C.
        • Ozersky P.
        • Petcherski A.
        • Rangarajan A.
        • Rogers A.
        • Schindelman G.
        • Schwarz E.M.
        • Tuli M.A.
        • Van Auken K.
        • Wang D.
        • Wang X.
        • Williams G.
        • Yook K.
        • Durbin R.
        • Stein L.D.
        • Spieth J.
        • Sternberg P.W.
        WormBase: a comprehensive resource for nematode research.
        Nucleic Acids Res. 2010; 38: D463-467
        • Altschul S.F.
        • Madden T.L.
        • Schäffer A.A.
        • Zhang J.
        • Zhang Z.
        • Miller W.
        • Lipman D.J.
        Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
        Nucleic Acids Res. 1997; 25: 3389-3402
        • Edwards R.J.
        • Moran N.
        • Devocelle M.
        • Kiernan A.
        • Meade G.
        • Signac W.
        • Foy M.
        • Park S.D.
        • Dunne E.
        • Kenny D.
        • Shields D.C.
        Bioinformatic discovery of novel bioactive peptides.
        Nat. Chem. Biol. 2007; 3: 108-112
        • Katoh K.
        • Toh H.
        Recent developments in the MAFFT multiple sequence alignment program.
        Brief Bioinform. 2008; 9: 286-298
        • Price M.N.
        • Dehal P.S.
        • Arkin A.P.
        FastTree: computing large minimum evolution trees with profiles instead of a distance matrix.
        Mol. Biol. Evol. 2009; 26: 1641-1650
        • Mello C.
        • Fire A.
        DNA transformation.
        Methods Cell Biol. 1995; 48: 451-482
        • Franks C.J.
        • Murray C.
        • Ogden D.
        • O'Connor V.
        • Holden-Dye L.
        A comparison of electrically evoked and channel rhodopsin-evoked postsynaptic potentials in the pharyngeal system of Caenorhabditis elegans.
        Invert. Neurosci. 2009; 9: 43-56
        • Dillon J.
        • Hopper N.A.
        • Holden-Dye L.
        • O'Connor V.
        Molecular characterization of the metabotropic glutamate receptor family in Caenorhabditis elegans.
        Biochem. Soc. Trans. 2006; 34: 942-948
        • Tharmalingam S.
        • Burns A.R.
        • Roy P.J.
        • Hampson D.R.
        Orthosteric and allosteric drug binding sites in the Caenorhabditis elegans mgl-2 metabotropic glutamate receptor.
        Neuropharmacology. 2012; 63: 667-674
        • Mitri C.
        • Parmentier M.L.
        • Pin J.P.
        • Bockaert J.
        • Grau Y.
        Divergent evolution in metabotropic glutamate receptors: a new receptor activated by an endogenous ligand different from glutamate in insects.
        J. Biol. Chem. 2004; 279: 9313-9320
        • Conn P.J.
        • Pin J.P.
        Pharmacology and functions of metabotropic glutamate receptors.
        Annu. Rev. Pharmacol. Toxicol. 1997; 37: 205-237
        • Avery L.
        • Horvitz H.R.
        Pharyngeal pumping continues after laser killing of the pharyngeal nervous system of C. elegans.
        Neuron. 1989; 3: 473-485
        • Rogers C.M.
        • Franks C.J.
        • Walker R.J.
        • Burke J.F.
        • Holden-Dye L.
        Regulation of the pharynx of Caenorhabditis elegans by 5-HT, octopamine, and FMRFamide-like neuropeptides.
        J. Neurobiol. 2001; 49: 235-244
        • Avery L.
        • Horvitz H.R.
        Effects of starvation and neuroactive drugs on feeding in Caenorhabditis elegans.
        J. Exp. Zool. 1990; 253: 263-270
        • Enz R.
        The trick of the tail: protein-protein interactions of metabotropic glutamate receptors.
        BioEssays. 2007; 29: 60-73
        • Lee R.Y.
        • Sawin E.R.
        • Chalfie M.
        • Horvitz H.R.
        • Avery L.
        EAT-4, a homolog of a mammalian sodium-dependent inorganic phosphate cotransporter, is necessary for glutamatergic neurotransmission in Caenorhabditis elegans.
        J. Neurosci. 1999; 19: 159-167
        • Nathoo A.N.
        • Moeller R.A.
        • Westlund B.A.
        • Hart A.C.
        Identification of neuropeptide-like protein gene families in Caenorhabditis elegans and other species.
        Proc. Natl. Acad. Sci. U.S.A. 2001; 98: 14000-14005
        • Kang C.
        • Avery L.
        Systemic regulation of starvation response in Caenorhabditis elegans.
        Genes Dev. 2009; 23: 12-17
        • Greer E.R.
        • Pérez C.L.
        • Van Gilst M.R.
        • Lee B.H.
        • Ashrafi K.
        Neural and molecular dissection of a C. elegans sensory circuit that regulates fat and feeding.
        Cell Metab. 2008; 8: 118-131
        • Zheng N.
        • Raman I.M.
        Prolonged postinhibitory rebound firing in the cerebellar nuclei mediated by group I metabotropic glutamate receptor potentiation of L-type calcium currents.
        J. Neurosci. 2011; 31: 10283-10292
        • Avery L.
        • You Y.J.
        C. elegans feeding.
        WormBook. 2012: 1-23
        • Dalliere N.
        • Bhatla N.
        • Walker R.
        • O'Connor V.
        • Holden-Dye L.
        Hart A. Neuronal Development, Synaptic Function, and Behavior C.elegans Topic Meeting, Madison, WI 2014. Madison, WI, 2014: 66
        • Ishihara T.
        • Katsura I.
        Worm Breeder's Gazette.
        . 1996; 14 (Avery, L., ed): 40
        • Franks C.J.
        • Murray C.
        • Ogden D.
        • O'Connor V.
        • Holden-Dye L.
        Tavernarakis N. European C. elegans Neurobiology Meeting, Fodele Village, 2010. Crete, Greece2010: 40 (P06)