Advertisement

(d)-β-Hydroxybutyrate Inhibits Adipocyte Lipolysis via the Nicotinic Acid Receptor PUMA-G*

Open AccessPublished:June 01, 2005DOI:https://doi.org/10.1074/jbc.C500213200
      As a treatment for dyslipidemia, oral doses of 1–3 grams of nicotinic acid per day lower serum triglycerides, raise high density lipoprotein cholesterol, and reduce mortality from coronary heart disease (Tavintharan, S., and Kashyap, M. L. (2001) Curr. Atheroscler. Rep. 3, 74–82). These benefits likely result from the ability of nicotinic acid to inhibit lipolysis in adipocytes and thereby reduce serum non-esterified fatty acid levels (Carlson, L. A. (1963) Acta Med. Scand. 173, 719–722). In mice, nicotinic acid inhibits lipolysis via PUMA-G, a Gi/o-coupled seven-transmembrane receptor expressed in adipocytes and activated macrophages (Tunaru, S., Kero, J., Schaub, A., Wufka, C., Blaukat, A., Pfeffer, K., and Offermanns, S. (2003) Nat. Med. 9, 352–355). The human ortholog HM74a is also a nicotinic acid receptor and likely has a similar role in anti-lipolysis. Endogenous levels of nicotinic acid are too low to significantly impact receptor activity, hence the natural ligands(s) of HM74a/PUMA-G remain to be elucidated. Here we show that the fatty acid-derived ketone body (d)-β-hydroxybutyrate ((d)-β-OHB) specifically activates PUMA-G/HM74a at concentrations observed in serum during fasting. Like nicotinic acid, (d)-β-OHB inhibits mouse adipocyte lipolysis in a PUMA-G-dependent manner and is thus the first endogenous ligand described for this orphan receptor. These findings suggests a homeostatic mechanism for surviving starvation in which (d)-β-OHB negatively regulates its own production, thereby preventing ketoacidosis and promoting efficient use of fat stores.
      Ketone bodies (acetone, acetoacetate (AcAc),
      The abbreviations used are: AcAc, acetoacetate; (d)-β-OHB, (d)-β-hydroxybutyrate; NEFA, non-esterified fatty acid; GTPγS, guanosine 5′-O-(3-thiotriphosphate).
      1The abbreviations used are: AcAc, acetoacetate; (d)-β-OHB, (d)-β-hydroxybutyrate; NEFA, non-esterified fatty acid; GTPγS, guanosine 5′-O-(3-thiotriphosphate).
      and (d)-β-OHB) are produced in the liver from acetyl-CoA derived from β-oxidation of fatty acids (
      • Laffel L.
      ). AcAc and (d)-β-OHB are small water-soluble carboxylic acids that are important energy sources for the brain and other tissues during prolonged fasting (
      • Cahill G.F.
      ). In humans, the serum concentration of (d)-β-OHB is typically ∼50 μm after a meal, rises to ∼0.2–0.4 mm after an overnight fast, reaches ∼1–2 mm after 2–3 days of fasting, and plateaus at ∼6–8 mm upon prolonged starvation (
      • Laffel L.
      ,
      • Fukao T.
      • Lopaschuk G.D.
      • Mitchell G.A.
      ,
      • Senior B.
      • Loridan L.
      ,
      • Owen O.E.
      • Reichard Jr., G.A.
      ). β-OHB infusion into rats (
      • Bates M.W.
      • Linn L.C.
      ), pancreatomized dogs (
      • Bjorntorp P.
      • Schersten T.
      ), and humans (
      • Senior B.
      • Loridan L.
      ,
      • Van Hove J.L.
      • Grunewald S.
      • Jaeken J.
      • Demaerel P.
      • Declercq P.E.
      • Bourdoux P.
      • Niezen-Koning K.
      • Deanfeld J.E.
      • Leonard J.V.
      ) lowers serum NEFAs in vivo, and β-OHB inhibits lipolysis in primary rat (
      • Bjorntorp P.
      ,
      • Bjorntorp P.
      ) or bovine (
      • Metz S.H.
      • Lopes-Cardozo M.
      • van den Bergh S.G.
      ) adipocytes, whereas AcAc does not. The fact that these effects are similar to those of nicotinic acid and that both β-OHB and nicotinic acid are small carboxylic acids led us to investigate whether ketone bodies are HM74a agonists.

      EXPERIMENTAL PROCEDURES

      Materials—With the exception of Acifran and lithium (dl)-β-OHB, all compounds tested were from Sigma. Acifran was synthesized by chemists at Arena Pharmaceuticals, and lithium (dl)-β-OHB was made by titrating free (dl)-β-OHB acid (Sigma) with LiOH by chemists at Merck. [35S]GTPγS (1160 Ci/mmol) was from Amersham Biosciences, and [5,6-3H]nicotinic acid (50 Ci/mmol) was from American Radiolabeled Chemical (St. Louis, MO).
      Molecular Cloning—HM74a and HM74 were cloned by PCR using human genomic DNA as a template and the following primers, GCTGGAGCATTCACTAGGCGAG (sense for HM74a), AGATCCTGGTTCTTGGTGACAATG (antisense for HM74a), GGAGAATTCACTAGGCGAGGCGCTCCATC (sense for HM74), and GGAGGATCCAGGAAACCTTAGGCCGAGTCC (antisense for HM74). PUMA-G was cloned using mouse genomic DNA as template, the sense primer AGATCCACTCATGAGCAAGTCAGACC, and the antisense primer CCTTCTTGTCATAGTAACTTAACGAG.
      For the generation of stable cell lines, 5 × 106 CHO-K1 cells were transfected with 12 μg of plasmid DNA (pCDNA3.1, Invitrogen) containing either HM74a, HM74, or PUMA-G expressed from the cytomegalovirus promoter. Two days after transfection, the growth medium was supplemented with 400 μg/ml G418 to select for antibiotic-resistant cells. Clonal CHO-K1 cell lines that stably express HM74, HM74a, or PUMA-G were selected based on the ability of nicotinic acid (HM74a and PUMA-G) or S711589 (an Arena HM74-specific agonist; data not shown) to inhibit forskolin-induced cAMP production.
      Calcium Mobilization—CHO-K1 cells expressing an NFAT-β-lactamase reporter and the promiscuous Gα subunit Gqi5 (kind gift of K. Sullivan, Merck Research Laboratories) were stably transfected with either empty vector (pCDNA3.1, Invitrogen) or vector expressing PUMA-G, HM74a, or HM74. Cells were seeded at 10,000 cells/well in 384-well culture plates and grown overnight at 37 °C, 5% CO2 in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 2 mm l-glutamine, 10 mm HEPES, pH 7.4, 0.1 mm MEM non-essential amino acids solution, 1 mm sodium pyruvate, 0.6 mg/ml hygromycin B, 0.5 mg/ml zeocin, and 1 mg/ml geneticin (BD Biosciences). Cells were washed four times with Hanks' balanced salt solution containing 10 mm HEPES, pH 7.4, and loaded with calcium-sensitive dye by incubating with an equal volume of Molecular Devices calcium assay kit loading buffer at 37 °C for 1 h. Calcium response in the fluorometric imaging plate reader assay was measured according to the directions from Molecular Devices.
      [35S]GTPγS Binding Assay—Membranes from untransfected CHO-K1 cells or cells stably expressing PUMA-G, HM74a, or HM74 (20 μg/assay) were diluted in assay buffer (20 mm HEPES, pH 7.4, 100 mm NaCl, 10 mm MgCl2) in Wallac Scintistrip plates and preincubated with test compounds diluted in assay buffer containing 40 μm GDP (final [GDP] was 10 μm) for ∼10 min before addition of [35S]GTPγS to 0.3 nm. To measure the agonist activity of free acids, rather than sodium salts (Table I), the HEPES concentration was increased to 60 mm; this increase had no effect on the EC50 of nicotinic acid (data not shown). Binding was allowed to proceed for 1 h before centrifuging the plates at 4000 rpm for 15 min at room temperature and subsequent counting in a Packard TopCount scintillation counter. Non-linear regression analysis of the binding curves was performed in GraphPad Prism version 4.
      Table ILigand-induced [35S]GTPγS binding to membranes from CHO cells expressing PUMA-G, HM74α, or HM74
      CompoundEC50
      PUMA-GHM74aHM74
      μm
      Nicotinic acid0.04 ± 0.0030.10 ± 0.005>100
      Some compounds displayed activity at the highest concentration tested but not over a full dose response from which an EC50 could be determined. Therefore, the EC50 for these compounds is denoted as greater than the highest concentration tested.
      Acifran0.36 ± 0.031.13 ± 0.067.04 ± 0.6
      Lithium (dl)-β-hydroxybutyrate727 ± 40793 ± 60>25,000
      Sodium (d)-β-hydroxybutyrate318 ± 37767 ± 57>25,000
      Sodium (l)-β-hydroxybutyrate684 ± 1191662 ± 382>25,000
      Lithium acetoacetate>25,000>25,000>25,000
      AcetoneInactiveInactiveInactive
      Sodium (dl)-α-hydroxybutyrate>10,000Inactive>10,000
      Sodium lactate>10,000InactiveInactive
      Sodium acetate (C2)>10,000>10,000Inactive
      Sodium propionate (C3)>10,000>10,000Inactive
      Sodium butyrate (C4)702 ± 1081590 ± 211Inactive
      Pentanoic acid (C5)166 ± 33402 ± 51>10,000
      Sodium hexanoate (C6)133 ± 15451 ± 91995 ± 246
      Heptanoic acid (C7)730 ± 1322066 ± 300120 ± 23
      Sodium octanoate (C8)288 ± 40755 ± 8273 ± 12
      Sodium decanoate (C10)>10,000>10,000>10,000
      Oleic acid (C18:1)Inactive
      Fatty acids with >10 carbons were tested at 10 μm only.
      InactiveInactive
      Linoleic acid (C18:2)InactiveInactiveInactive
      Linolenic acid (C18:3)InactiveInactiveInactive
      Arachidonic acid (C20:4)InactiveInactiveInactive
      Eicosapentaenoic acid (C20:5)InactiveInactiveInactive
      Docosahexanoic acid (C22:6)InactiveInactiveInactive
      a Some compounds displayed activity at the highest concentration tested but not over a full dose response from which an EC50 could be determined. Therefore, the EC50 for these compounds is denoted as greater than the highest concentration tested.
      b Fatty acids with >10 carbons were tested at 10 μm only.
      [3H]Nicotinic Acid Binding Competition Assay—Assays were performed with the same preparations of membrane used for the [35S]GTPγS assay. Equilibrium binding of [3H]nicotinic acid was done with membranes (30 μg/assay) and test compounds diluted in assay buffer (20 mm HEPES, pH 7.4, 1 mm MgCl2, and 0.01% CHAPS) in a total volume of 200 μl. After 4 h at room temperature, reactions were filtered through Packard Unifilter GF/C plates using a Packard Harvester and washed eight times with 200 μl of ice-cold binding buffer. Nonspecific binding was determined in the presence of 250 μm unlabeled nicotinic acid. Competitive binding assays were performed in the presence of 50 nm [3H]nicotinic acid.
      In Vitro Lipolysis—Isolation of mouse primary epididymal adipocytes and in vitro determination of NEFA release was performed according to the method of Rodbell as adapted by Tunaru et al. (
      • Tunaru S.
      • Kero J.
      • Schaub A.
      • Wufka C.
      • Blaukat A.
      • Pfeffer K.
      • Offermanns S.
      ,
      • Rodbell M.
      ).

      RESULTS

      To ask whether β-OHB is a ligand for HM74a, we used Chinese hamster ovary (CHO) cells that stably express the chimeric G-protein α subunit Gqi5 (
      • Conklin B.R.
      • Farfel Z.
      • Lustig K.D.
      • Julius D.
      • Bourne H.R.
      ) and harbor either a control vector or vectors that expresses either HM74a or its paralog HM74, which is 95% identical at the amino acid level to HM74a but has ∼1000-fold less affinity for nicotinic acid (
      • Wise A.
      • Foord S.M.
      • Fraser N.J.
      • Barnes A.A.
      • Elshourbagy N.
      • Eilert M.
      • Ignar D.M.
      • Murdock P.R.
      • Steplewski K.
      • Green A.
      • Brown A.J.
      • Dowell S.J.
      • Szekeres P.G.
      • Hassall D.G.
      • Marshall F.H.
      • Wilson S.
      • Pike N.B.
      ,
      • Soga T.
      • Kamohara M.
      • Takasaki J.
      • Matsumoto S.
      • Saito T.
      • Ohishi T.
      • Hiyama H.
      • Matsuo A.
      • Matsushime H.
      • Furuichi K.
      ). Use of Gqi5 allows the normally Gi/o-coupled HM74 and HM74a to signal via the Gq pathway leading to Ca+2 mobilization. Nicotinic acid elicited Ca+2 mobilization only in cells expressing HM74a (Fig. 1A). In contrast, Acifran, an agonist on both HM74 and HM74a (
      • Wise A.
      • Foord S.M.
      • Fraser N.J.
      • Barnes A.A.
      • Elshourbagy N.
      • Eilert M.
      • Ignar D.M.
      • Murdock P.R.
      • Steplewski K.
      • Green A.
      • Brown A.J.
      • Dowell S.J.
      • Szekeres P.G.
      • Hassall D.G.
      • Marshall F.H.
      • Wilson S.
      • Pike N.B.
      ), elicited a response from both receptors demonstrating that HM74 was functional and could be used as a specificity control in this assay. Given that ketone bodies can reach millimolar concentrations in serum, we tested these compounds at 15 mm. Both (d)- and (l)-β-OHB, but not acetoacetate or free acetone, elicited a Ca+2 response in cells expressing HM74a but not HM74. Whereas the d-isomer of β-OHB is the sole form encountered in high concentrations physiologically (
      • Laffel L.
      ), both d- and l-isomers have been shown to inhibit lipolysis in vitro (
      • Metz S.H.
      • Lopes-Cardozo M.
      • van den Bergh S.G.
      ), consistent with the results shown here. Similar results were observed for cells expressing murine PUMA-G (data not shown).
      Figure thumbnail gr1
      Fig. 1The ketone body β-OHB is a ligand for the nicotinic acid receptor HM74a/PUMA-G. A, ligand-induced increases in [Ca2+]i were measured in a fluorometric imaging plate reader assay with CHO-K1 cell lines stably expressing the chimeric G-protein α subunit Gqi5 and either empty vector or vector expressing HM74a or HM74. Nicotinic acid and Acifran were tested at 100 μm, and acetone, lithium AcAc, and the sodium salts of (d)- and (l)-β-OHB at 15 mm. B, ligand-induced [35S]GTPγS binding to membranes from untransfected CHO cells or CHO cells stably expressing HM74a, PUMA-G, or HM74 (as indicated) by nicotinic acid (filled squares), Acifran (open squares), lithium (dl)-β-OHB (filled circles), lithium acetoacetate (open circles), acetone (filled diamonds), or lithium chloride (open diamonds). C, [3H]nicotinic acid binding competition study with HM74a. Competition with unlabeled nicotinic acid (filled squares), lithium (dl)-β-OHB (filled circles), lithium acetoacetate (open circles), and acetone (open diamonds) is shown. All data in Fig. 1 represent mean values ± S.E. from at least three independent determinations.
      Next, we determined the half-maximal concentration (EC50) of β-OHB required to stimulate receptor-mediated guanine nucleotide exchange on Gα using a [35S]GTPγS binding assay with membranes prepared from untransfected CHO cells or CHO cells stably expressing either mouse PUMA-G, human HM74a, or HM74 (Fig. 1B and Table I). Nicotinic acid stimulated [35S]GTPγS binding only in membranes from cells expressing HM74a (EC50 104 ± 5 nm) or the mouse ortholog PUMA-G (EC50 = 43 ± 3 nm), whereas Acifran was active on all three receptors (EC50 = 1127 ± 59 nm for HM74a, 358 ± 30 nm for PUMA-G, and 7039 ± 598 nm for HM74). Racemic (dl)-β-OHB also showed some degree of activity on all receptors; however, it was more potent on HM74a (EC50 = 0.8 ± 0.06 mm) and its ortholog PUMA-G (EC50 = 0.7 ± 0.04 mm) than on HM74. The EC50 for the l-enantiomer was ∼2-fold higher than that of the physiologically relevant d-enantiomer (Table I). Both the sodium and lithium salts of β-OHB were active, indicating that the anion is the active component. Moreover, sodium salts of other small monocarboxylic acids with similar pKa values to β-OHB (α-hydroxybutyrate and lactate) were not significantly active in this assay (Table I). At high concentrations, lithium acetoacetate, but not acetone or lithium chloride, elicited [35S]GTPγS binding to all three receptors but not to membranes from untransfected cells, suggesting that acetoacetate is a weak agonist of these receptors.
      Short-chain fatty acids were recently identified as ligands for the G-protein-coupled receptor GPR41, which is, like HM74a/PUMA-G, expressed in adipocytes (
      • Le Poul E.
      • Loison C.
      • Struyf S.
      • Springael J.Y.
      • Lannoy V.
      • Decobecq M.E.
      • Brezillon S.
      • Dupriez V.
      • Vassart G.
      • Van Damme J.
      • Parmentier M.
      • Detheux M.
      ,
      • Xiong Y.
      • Miyamoto N.
      • Shibata K.
      • Valasek M.A.
      • Motoike T.
      • Kedzierski R.M.
      • Yanagisawa M.
      ,
      • Brown A.J.
      • Goldsworthy S.M.
      • Barnes A.A.
      • Eilert M.M.
      • Tcheang L.
      • Daniels D.
      • Muir A.I.
      • Wigglesworth M.J.
      • Kinghorn I.
      • Fraser N.J.
      • Pike N.B.
      • Strum J.C.
      • Steplewski K.M.
      • Murdock P.R.
      • Holder J.C.
      • Marshall F.H.
      • Szekeres P.G.
      • Wilson S.
      • Ignar D.M.
      • Foord S.M.
      • Wise A.
      • Dowell S.J.
      ). Given their similarity to β-OHB, we determined whether small fatty acids are ligands for HM74a/PUMA-G. Indeed, a structure-activity relationship was observed for fatty acids of varying chain length (Table I), with pentanoic (C5) and hexanoic (C6) acids being the most active on HM74a (C5, EC50 = 402 ± 51 μm; C6, EC50 = 451 ± 91 μm) and PUMA-G (C5, EC50 = 166 ± 33 μm; C6, EC50 = 133 ± 15 μm). HM74 has affinity for slightly longer chain length fatty acids, with a peak of activity centered on octanoic acid (C8, EC50 = 73 ± 12 μm; Table I). However, it is unlikely that these small fatty acids reach sufficient concentrations in serum to activate these receptors (
      • Le Poul E.
      • Loison C.
      • Struyf S.
      • Springael J.Y.
      • Lannoy V.
      • Decobecq M.E.
      • Brezillon S.
      • Dupriez V.
      • Vassart G.
      • Van Damme J.
      • Parmentier M.
      • Detheux M.
      ), and so their low affinity for PUMA-G/HM74a and HM74 is probably not physiologically relevant. Consistent with this, while both HM74a/PUMA-G and GPR41 have similar chain length preferences, the latter receptor has at least 10-fold higher affinity for these acids (Table I and Ref.
      • Xiong Y.
      • Miyamoto N.
      • Shibata K.
      • Valasek M.A.
      • Motoike T.
      • Kedzierski R.M.
      • Yanagisawa M.
      ). We note as well that in another study racemic (dl)-β-OHB was not a GPR41 agonist at concentrations up to 10 mm (
      • Xiong Y.
      • Miyamoto N.
      • Shibata K.
      • Valasek M.A.
      • Motoike T.
      • Kedzierski R.M.
      • Yanagisawa M.
      ). Similarly, another study found “l-OH-butyrate” (the exact molecular structure of which was not described) to be only a very weak (EC50 ∼5 mm) ligand of human GPR41 and GPR43, another receptor for short-chain fatty acids expressed predominantly in leukocytes (
      • Le Poul E.
      • Loison C.
      • Struyf S.
      • Springael J.Y.
      • Lannoy V.
      • Decobecq M.E.
      • Brezillon S.
      • Dupriez V.
      • Vassart G.
      • Van Damme J.
      • Parmentier M.
      • Detheux M.
      ). Finally, β-OHB was not an agonist of GPR81 (
      • Lee D.K.
      • Nguyen T.
      • Lynch K.R.
      • Cheng R.
      • Vanti W.B.
      • Arkhitko O.
      • Lewis T.
      • Evans J.F.
      • George S.R.
      • O'Dowd B.F.
      ), the next most phylogenetically related receptor to HM74a/PUMA-G (data not shown).
      We employed an equilibrium [3H]nicotinic acid binding competition assay to ask whether nicotinic acid and β-OHB compete for the same binding site on the receptor. [3H]Nicotinic acid bound specifically and saturably to membranes from cells expressing HM74a, but not HM74 (data not shown), with a calculated Kd of 105 ± 9 nm (data not shown), a value in good agreement with published results (
      • Tunaru S.
      • Kero J.
      • Schaub A.
      • Wufka C.
      • Blaukat A.
      • Pfeffer K.
      • Offermanns S.
      ,
      • Wise A.
      • Foord S.M.
      • Fraser N.J.
      • Barnes A.A.
      • Elshourbagy N.
      • Eilert M.
      • Ignar D.M.
      • Murdock P.R.
      • Steplewski K.
      • Green A.
      • Brown A.J.
      • Dowell S.J.
      • Szekeres P.G.
      • Hassall D.G.
      • Marshall F.H.
      • Wilson S.
      • Pike N.B.
      ). Homologous competition with unlabeled nicotinic acid yielded a Ki of 130 ± 14 nm, similar to the observed Kd (Fig. 1C). As in the [35S]GTPγS binding assay, AcAc displayed low apparent affinity for HM74a, but (dl)-β-OHB bound the receptor with physiologically relevant affinity (Ki = 0.7 ± 0.06 mm; Fig. 1C). Similar results were observed for PUMA-G (Ki = 0.7 mm ± 0.1 mm; data not shown). Taken together, these data show that (d)-β-OHB is a HM74a/PUMA-G agonist and that the serum concentrations of this ketone body observed as early as 2–3 days into a fast in humans (
      • Laffel L.
      ,
      • Fukao T.
      • Lopaschuk G.D.
      • Mitchell G.A.
      ) will result in significant receptor occupancy and activity.
      Previous studies with isolated adipocytes from knock-out mice demonstrated that PUMA-G mediates the anti-lipolytic effect of nicotinic acid (
      • Tunaru S.
      • Kero J.
      • Schaub A.
      • Wufka C.
      • Blaukat A.
      • Pfeffer K.
      • Offermanns S.
      ); we performed analogous experiments with (d)-β-OHB. Both nicotinic acid and sodium (d)-β-OHB suppressed free fatty acid efflux from isoproterenol-stimulated primary adipocytes from wild-type mice, the latter at concentrations consistent with the affinity determined previously (approximate EC50 for (d)-β-OHB-mediated lipolysis inhibition ∼2 mm, Fig. 2A). This suppression was PUMA-G-mediated, as nicotinic acid and (d)-β-OHB were without significant effect in adipocytes from PUMA-G knock-out mice (Fig. 2B). Adipocytes from PUMA-G knock-out mice were not merely refractory to lipolysis inhibition per se, as ADP inhibited fatty acid efflux equally well in wild-type and knock-out cells (Fig. 2B). The adenosine analogue phenylisopropyladenosine also inhibited lipolysis equally well in wild-type and knock-out cells (data not shown). We note that the rate of both basal and isoproterenol-stimulated lipolysis was routinely lower in adipocytes from knock-out mice compared with those from wild-type animals (Fig. 2B; compare “No stimulation” and “Iso”). It is unlikely that this difference is due to a deficiency of lipid in the knockout adipocytes, as wild-type and knock-out cells had approximately the same overall size as determined by microscopy (data not shown), and wild-type and knock-out mice had the same overall fat mass as determined by NMR spectroscopy.
      D. Marsh, unpublished observations.
      Figure thumbnail gr2
      Fig. 2β-OHB inhibits adipocyte lipolysis in vitro. A, dose response of sodium (dl)-β-OHB on NEFA efflux from isoproterenol (Iso)-stimulated primary adipocytes isolated from wild-type C57BL/6 mice. **, p < 0.01 and ***, p < 0.001 compared with isoproterenol-stimulated. B, NEFA efflux from primary adipocytes isolated from wild-type or PUMA-G knock-out mice (as indicated). Cells were either unstimulated (–), stimulated with 1 μm isoproterenol alone (Iso), or isoproterenol-stimulated and subsequently treated with 20 mm sodium (dl)-β-OHB, 300 μm nicotinic acid, or 1 μm ADP before measuring NEFA concentration in the cell medium. Data in A and B represent averaged values + S.E. from four independent experiments. **, p < 0.01 and ***, p < 0.001 compared with isoproterenol-stimulated, two-way analysis of variance.

      DISCUSSION

      In this work we have shown that the ketone body (d)-β-OHB specifically binds to and activates the adipocyte-expressed GPCRs HM74a/PUMA-G with an affinity that is well within the range of serum concentrations observed for this metabolite after ∼2–3 days of starvation in humans and ∼1–2 days in mice (
      • Laffel L.
      ,
      • Cahill G.F.
      ). The effect of (d)-β-OHB is, like nicotinic acid, anti-lipolytic (
      • Tavintharan S.
      • Kashyap M.L.
      ,
      • Carlson L.A.
      ,
      • Pike N.B.
      • Wise A.
      ). (d)-β-OHB is thus the first endogenous ligand described for the orphan receptor PUMA-G.
      During starvation, the rate of hepatic ketone body synthesis is at least partially limited by the rate of adipocyte lipolysis (
      • Laffel L.
      ). That (d)-β-OHB is itself anti-lipolytic suggests a homeostatic negative feedback mechanism in which this metabolite regulates its own production by decreasing the serum level of fatty acid precursors available for hepatic ketogenesis. Indeed, in a study of the serum NEFA-lowering effect of β-OHB infused into humans, Senior and Loridan (
      • Senior B.
      • Loridan L.
      ) proposed that during starvation ketone bodies exert “a fine regulatory adjustment” of their own synthesis by inhibiting adipocyte lipolysis. Such a mechanism would potentially conserve fat stores during extended starvation and attenuate excessive formation of ketoacids from unrestrained lipolysis and ketogenesis. This model implies that PUMA-G knock-out mice would experience higher rates of lipolysis and ketogenesis during a fast, as (d)-β-OHB does not inhibit lipolysis in the absence of this receptor. In preliminary experiments, we have not observed significant reproducible differences between wild-type and PUMA-G knock-out animals in rate of body fat depletion or serum levels of NEFA or (d)-β-OHB during 24 and 48 h of fasting.
      D. Marsh, M. Reitman, and A. Taggart, unpublished observations.
      However, we note that adipocytes from knock-out animals are refractory to stimulation with isoproterenol (Fig. 2B), perhaps suggesting a fundamental difference in lipolysis regulation in the knock-out cells that may compensate for lack of PUMA-G. Studies with inducible knock-outs of PUMA-G in adult animals may shed light on this question.

      Acknowledgments

      We thank Steve Colletti of Merck Research Laboratories for synthesis of lithium (dl)-β-OHB; Graeme Semple and colleagues at Arena Pharmaceuticals for synthesis of Acifran; Sorin Tunaru of the University of Heidelberg for assistance with PUMA-G knock-out mice experiments; Donald Marsh, Kimberly Cox-York, and Marc Reitman for fasting studies with knock-out animals and advice; and Ismail Kola of Merck Research Laboratories for comments on the manuscript and support of this project.

      References

        • Tavintharan S.
        • Kashyap M.L.
        Curr. Atheroscler. Rep. 2001; 3: 74-82
        • Carlson L.A.
        Acta Med. Scand. 1963; 173: 719-722
        • Tunaru S.
        • Kero J.
        • Schaub A.
        • Wufka C.
        • Blaukat A.
        • Pfeffer K.
        • Offermanns S.
        Nat. Med. 2003; 9: 352-355
        • Wise A.
        • Foord S.M.
        • Fraser N.J.
        • Barnes A.A.
        • Elshourbagy N.
        • Eilert M.
        • Ignar D.M.
        • Murdock P.R.
        • Steplewski K.
        • Green A.
        • Brown A.J.
        • Dowell S.J.
        • Szekeres P.G.
        • Hassall D.G.
        • Marshall F.H.
        • Wilson S.
        • Pike N.B.
        J. Biol. Chem. 2003; 278: 9869-9874
        • Soga T.
        • Kamohara M.
        • Takasaki J.
        • Matsumoto S.
        • Saito T.
        • Ohishi T.
        • Hiyama H.
        • Matsuo A.
        • Matsushime H.
        • Furuichi K.
        Biochem. Biophys. Res. Commun. 2003; 303: 364-369
        • Pike N.B.
        • Wise A.
        Curr. Opin. Investig. Drugs. 2004; 5: 271-275
        • Laffel L.
        Diabetes/Metabolism Res. Rev. 1999; 15: 412-426
        • Fukao T.
        • Lopaschuk G.D.
        • Mitchell G.A.
        Prostaglandins Leukotrienes Essent. Fatty Acids. 2004; 70: 243-251
        • Senior B.
        • Loridan L.
        Nature. 1968; 219: 83-84
        • Cahill G.F.
        N. Engl. J. Med. 1970; 282: 668-675
        • Owen O.E.
        • Reichard Jr., G.A.
        Isr. J. Med. Sci. 1975; 11: 560-570
        • Bates M.W.
        • Linn L.C.
        Metabolism. 1976; 25: 685-695
        • Bjorntorp P.
        • Schersten T.
        Am. J. Physiol. 1967; 212: 683-687
        • Van Hove J.L.
        • Grunewald S.
        • Jaeken J.
        • Demaerel P.
        • Declercq P.E.
        • Bourdoux P.
        • Niezen-Koning K.
        • Deanfeld J.E.
        • Leonard J.V.
        Lancet. 2003; 361: 1433-1435
        • Bjorntorp P.
        J. Lipid Res. 1966; 7: 621-626
        • Bjorntorp P.
        Metabolism. 1966; 15: 191-193
        • Metz S.H.
        • Lopes-Cardozo M.
        • van den Bergh S.G.
        FEBS Lett. 1974; 47: 19-22
        • Conklin B.R.
        • Farfel Z.
        • Lustig K.D.
        • Julius D.
        • Bourne H.R.
        Nature. 1993; 363: 274-276
        • Le Poul E.
        • Loison C.
        • Struyf S.
        • Springael J.Y.
        • Lannoy V.
        • Decobecq M.E.
        • Brezillon S.
        • Dupriez V.
        • Vassart G.
        • Van Damme J.
        • Parmentier M.
        • Detheux M.
        J. Biol. Chem. 2003; 278: 25481-25489
        • Xiong Y.
        • Miyamoto N.
        • Shibata K.
        • Valasek M.A.
        • Motoike T.
        • Kedzierski R.M.
        • Yanagisawa M.
        Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 1045-1050
        • Brown A.J.
        • Goldsworthy S.M.
        • Barnes A.A.
        • Eilert M.M.
        • Tcheang L.
        • Daniels D.
        • Muir A.I.
        • Wigglesworth M.J.
        • Kinghorn I.
        • Fraser N.J.
        • Pike N.B.
        • Strum J.C.
        • Steplewski K.M.
        • Murdock P.R.
        • Holder J.C.
        • Marshall F.H.
        • Szekeres P.G.
        • Wilson S.
        • Ignar D.M.
        • Foord S.M.
        • Wise A.
        • Dowell S.J.
        J. Biol. Chem. 2003; 278: 11312-11319
        • Lee D.K.
        • Nguyen T.
        • Lynch K.R.
        • Cheng R.
        • Vanti W.B.
        • Arkhitko O.
        • Lewis T.
        • Evans J.F.
        • George S.R.
        • O'Dowd B.F.
        Gene (Amst.). 2001; 275: 83-91
        • Rodbell M.
        J. Biol. Chem. 1964; 239: 375-380