Advertisement

Parathyroid Hormone Stimulates Osteoblastic Expression of MCP-1 to Recruit and Increase the Fusion of Pre/Osteoclasts*

  • Xin Li
    Affiliations
    Department of Physiology and Biophysics, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey 08854
    Search for articles by this author
  • Ling Qin
    Affiliations
    Department of Physiology and Biophysics, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey 08854
    Search for articles by this author
  • Marika Bergenstock
    Affiliations
    Department of Physiology and Biophysics, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey 08854
    Search for articles by this author
  • Laura M. Bevelock
    Affiliations
    Department of Physiology and Biophysics, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey 08854
    Search for articles by this author
  • Deborah V. Novack
    Affiliations
    Department of Medicine, Washington University School of Medicine, St. Louis, Missouri 63110
    Search for articles by this author
  • Nicola C. Partridge
    Correspondence
    To whom correspondence should be addressed: Dept. of Physiology and Biophysics, UMDNJ-Robert Wood Johnson Medical School, 675 Hoes Ln., Research Tower 561, Piscataway, NJ 08854. Tel.: 732-235-4552; Fax: 732-235-3977
    Affiliations
    Department of Physiology and Biophysics, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey 08854
    Search for articles by this author
  • Author Footnotes
    * This work was supported in part by National Institutes of Health Grant DK48109 (to N. C. P.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Open AccessPublished:August 09, 2007DOI:https://doi.org/10.1074/jbc.M611781200
      The clinical findings that alendronate blunted the anabolic effect of human parathyroid hormone (PTH) on bone formation suggest that active resorption is involved and enhances the anabolic effect. PTH signals via its receptor on the osteoblast membrane, and osteoclasts are impacted indirectly via the products of osteoblasts. Microarray with RNA from rats injected with human PTH or vehicle showed a strong association between the stimulation of monocyte chemoattractant protein-1 (MCP-1) and the anabolic effects of PTH. PTH rapidly and dramatically stimulated MCP-1 mRNA in the femora of rats receiving daily injections of PTH or in primary osteoblastic and UMR 106-01 cells. The stimulation of MCP-1 mRNA was dose-dependent and a primary response to PTH signaling via the cAMP-dependent protein kinase pathway in vitro. Studies with the mouse monocyte cell line RAW 264.7 and mouse bone marrow proved that osteoblastic MCP-1 can potently recruit osteoclast monocyte precursors and facilitate receptor activator of NF-κB ligand-induced osteoclastogenesis and, in particular, enhanced fusion. Our model suggests that PTH-induced osteoblastic expression of MCP-1 is involved in recruitment and differentiation at the stage of multinucleation of osteoclast precursors. This information provides a rationale for increased osteoclast activity in the anabolic effects of PTH in addition to receptor activator of NF-κB ligand stimulation to initiate greater bone remodeling.
      Parathyroid hormone (PTH)
      The abbreviations used are: PTH, parathyroid hormone; h, human; r, rat; RT, reverse transcription; ELISA, enzyme-linked immunosorbent assay; RANKL, receptor activator of NF-κB ligand; M-CSF, macrophage colony-stimulating factor; PKA, cAMP-dependent protein kinase; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; TRAP, tartrate-resistant acid phosphatase.
      2The abbreviations used are: PTH, parathyroid hormone; h, human; r, rat; RT, reverse transcription; ELISA, enzyme-linked immunosorbent assay; RANKL, receptor activator of NF-κB ligand; M-CSF, macrophage colony-stimulating factor; PKA, cAMP-dependent protein kinase; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; TRAP, tartrate-resistant acid phosphatase.
      is a principal hormone regulating bone remodeling via its actions on both bone formation and bone resorption. The finding that the anabolic effect of human PTH-(1-34) on bone formation was blunted when bone resorption was inhibited indicated that active resorption is involved and enhances the in vivo anabolic effect of PTH (
      • Delmas P.D.
      • Vergnaud P.
      • Arlot M.E.
      • Pastoureau P.
      • Meunier P.J.
      • Nilssen M.H.
      ,
      • Black D.M.
      • Greenspan S.L.
      • Ensrud K.E.
      • Palermo L.
      • McGowan J.A.
      • Lang T.F.
      • Garnero P.
      • Bouxsein M.L.
      • Bilezikian J.P.
      • Rosen C.J.
      ,
      • Finkelstein J.S.
      • Hayes A.
      • Hunzelman J.L.
      • Wyland J.J.
      • Lee H.
      • Neer R.M.
      ). However, the molecular basis of the osteoclast activation in this process has not been fully studied. In order to identify the key mediators for the anabolic effects of PTH, we performed microarray using RNA from the femora of 3-month-old Sprague-Dawley female rats injected daily with hPTH-(1-34) to increase bone formation or vehicle. This was compared with rats receiving hPTH-(1-34) in a catabolic protocol by continuous infusion. PTH-(1-34) regulated numerous genes (∼1,000), but differentially, in both regimes (see accompanying article, Ref.
      • Li X.
      • Liu H.
      • Qin L.
      • Tamasi J.
      • Bergenstock M.
      • Shapses S.
      • Feyen J.H.M.
      • Notterman D.A.
      • Partridge N.C.
      ). Notably, in the anabolic protocol, a number of cytokines and chemokines, RANKL, interleukin-6, CXCL1, and CCL2 (MCP-1), were highly induced. In contrast, none of these were significantly increased, by microarray, in the catabolic protocol. The chemokine, monocyte chemoattractant protein-1 (MCP-1, CCL2), was found to be the most highly stimulated gene from 14-day intermittent hPTH-(1-34) or hPTH-(1-31) administration (both cause over 100-fold changes). With continuous infusion of PTH, the MCP-1 mRNA was elevated less than 2-fold, and this difference indicates a potentially important role for MCP-1 in the anabolic effect of PTH.
      Chemokines are bioactive peptides that regulate leukocyte activation and migration. They are essential mediators of inflammation and are crucial for the control of viral infections. MCP-1 is one of the CC chemokines, one of the four main subfamilies of chemokines, consisting of C, CC, CXC, and CX3C, according to the location of the N-terminal four cysteine residues (
      • Sodhi A.
      • Montaner S.
      • Gutkind J.S.
      ). As a potent chemokine for monocytes and macrophages, MCP-1 is implicated in the pathogenesis of diseases characterized by monocytic infiltrates (
      • Wise G.E.
      • Frazier-Bowers S.
      • D'Souza R.N.
      ). It can be commonly detected at the site of tooth eruption, rheumatoid arthritic bone degradation, and bacterially induced bone loss (
      • Wise G.E.
      • Frazier-Bowers S.
      • D'Souza R.N.
      ) due to stimulation by inflammatory mediators. MCP-1 is also expressed by mature osteoclasts, and its expression is stimulated by receptor activator of NF-κB ligand (RANKL) and regulated by nuclear factor κB (
      • Wise G.E.
      • Frazier-Bowers S.
      • D'Souza R.N.
      ,
      • Ishida N.
      • Hayashi K.
      • Hoshijima M.
      • Ogawa T.
      • Koga S.
      • Miyatake Y.
      • Kumegawa M.
      • Kimura T.
      • Takeya T.
      ,
      • Cappellen D.
      • Luong-Nguyen N.H.
      • Bongiovanni S.
      • Grenet O.
      • Wanke C.
      • Susa M.
      ). It is known that expression of MCP-1 is temporally and spatially associated with the recruitment of monocytes in both osseous inflammation and during developmentally regulated bone remodeling in the process of tooth eruption (
      • Graves D.T.
      • Jiang Y.
      • Valente A.J.
      ).
      In vitro studies have shown that osteoclasts in both mice and humans may form directly from precursor cell populations of monocytes and macrophages (
      • Udagawa N.
      • Takahashi N.
      • Akatsu T.
      • Tanaka H.
      • Sasaki T.
      • Nishihara T.
      • Koga T.
      • Martin T.J.
      • Suda T.
      ). It is very likely that MCP-1 may play a role in hormone-stimulated bone remodeling through action on osteoclasts. However, the relationship between MCP-1 and PTH, one of the most effective hormones regulating bone remodeling, has never been investigated. Here we propose a model suggesting that PTH-induced osteoblastic expression of MCP-1 is involved in osteoclast recruitment and differentiation at the stage of fusion and multinucleation of osteoclast precursors. This hypothesis provides a rationale for increased osteoclast activity in the anabolic effect of PTH, apart from RANKL stimulation, to initiate greater bone remodeling in a transient time-dependent fashion. Collectively, our data strongly point toward MCP-1 being an important molecule for communication between osteoblasts and osteoclasts in the anabolic effect of PTH.

      EXPERIMENTAL PROCEDURES

      Chemicals—Synthetic PTH-(1-34) (human), PTH-(3-34) (bovine), and PTH-(1-31) (human), were purchased from Bachem (Torrance, CA). Inhibitors H-89 and GF109203X were purchased from Calbiochem. Rat PTH-(1-34), 8-bromo-cAMP, PMA, and cycloheximide were obtained from Sigma. Recombinant rat/murine RANKL, M-CSF, MCP-1, and neutralizing anti-MCP-1 antibody were purchased from Chemicon (Temecula, CA). Penicillin/streptomycin was obtained from Invitrogen.
      In Vivo Treatment of PTH in Rats—Sprague-Dawley rats (3-month-old female, about 250 g) were purchased from Taconic Farms, Inc. (Germantown, NY). For the anabolic protocol, rats were injected subcutaneously with vehicle (0.9% saline solution) or hPTH-(1-34) (8 μg/100 g) and euthanized using CO2 at the indicated time after injection. For the catabolic protocol, vehicle (0.9% saline solution) or hPTH-(1-34) in a final volume of 200 μl was continuously infused into animals at a nominal pumping rate of 1 μl/h by Alzet osmotic pumps (DURECT Corp.) implanted subcutaneously; continuous infusion of PTH-(1-34) was at 4 μg/100 g/day for the indicated time to 3-month-old female Sprague-Dawley rats (at least four animals per group).
      The animal protocols were approved by the Robert Wood Johnson Medical School Institutional Animal Care and Use Committee. The primary spongiosa samples from the distal femur were harvested immediately after sacrifice as described previously (
      • Onyia J.E.
      • Bidwell J.
      • Herring J.
      • Hulman J.
      • Hock J.M.
      ).
      Analysis of mRNA Abundance by Real Time RT-PCR—Cells or tissues were harvested at the indicated time points after PTH treatment. As described earlier (
      • Qin L.
      • Li X.
      • Ko J.K.
      • Partridge N.C.
      ), total RNA was isolated using TRI Reagent® (Sigma) followed by purification with the RNeasy kit (Qiagen). A TaqMan® reverse transcription kit (Applied Biosystems) was used to reverse-transcribe mRNA into cDNA. Following this, PCR was performed on Opticon (MJ Research) using a SYBR® Green PCR core kit (Applied Biosystems). The primers used for the RT-PCR are summarized in Table 1. For cell culture samples, glyceraldehyde-3-phosphate dehydrogenase was used as an internal control. For femoral samples, β-actin was used as an internal control.
      TABLE 1Sequences of primers for real time RT-PCR
      Gene5′-Primer3′-Primer
      Mouse β-actinTCCTCCTGAGCGCAAGTACTCTCGGACTCATCGTACTCCTGCTT
      Mouse TRAPCACTCCCACCCTGAGATTTGTGACGGTTCTGGCGATCTCTTTGC
      Mouse CCR2ATTCTCCACACCCTGTTTCGGATTCCTGGAAGGTGGTCAA
      Rat MCP-1TAGCATCCACGTGCTGTCTATGCTGCTGGTGATTCTCTTG
      Rat β-actinTCCTGAGCGCAAGTACTCTGTGCGGACTCATCGTACTCCTGCTT
      Rat RANKLACCAGCATCAAAATCCCAAGGGACGCTAATTTCCTCACCA
      Rat OPGATACAGACAGCTGGCACACGTGCTTTCGATGACGTCTCAC
      Rat glyceraldehyde-3-phosphate dehydrogenaseAACCCATCACCATCTTCCAGGGCCTTCTCCATGGTGGTGAA
      Cell Culture—UMR 106-01 cells were maintained in Eagle's minimal essential medium supplemented with 5% fetal bovine serum, nonessential amino acids, 25 mm HEPES (pH 7.4), 1% penicillin/streptomycin (5,000 units/ml), and 100 μg/ml streptomycin. For serum starvation, osteoblastic cells were allowed to grow to 70-80% confluence and then switched to serum-free minimal essential medium for 1 day before the addition of PTH.
      Rat primary calvarial osteoblastic cells were obtained and cultured as described previously (
      • Shalhoub V.
      • Gerstenfeld L.C.
      • Collart D.
      • Lian J.B.
      • Stein G.S.
      ). Before PTH treatment, these cells were serum-starved for 1 day.
      RAW 264.7 cells were plated at 106 cells/cm2 concentration in Dulbecco's minimal essential medium (supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin, 5,000 units/ml). The cells were cultured in 5% CO2 in a humidified environment.
      Mouse osteoclasts were cultured from bone marrow isolated from femora and tibiae of 4-6-week-old wild-type B6/129 mice. Briefly, bone marrow was flushed from long bones with serum-free α-minimum Eagle's medium, and the marrow clumps were broken down by passing media through a syringe with an 18-gauge needle; after centrifugation, the cell pellets were resuspended in 10% α-minimum Eagle's medium and incubated in tissue culture dishes at 37 °C in 5% CO2. Cells were stimulated with the indicated concentration of cytokines (M-CSF, 30 ng/ml; RANKL, 50 ng/ml) from the time of culture; fresh cytokines were added every other day until day 6 or day 10 (for bone resorption assay only) (
      • Kitaura H.
      • Sands M.S.
      • Aya K.
      • Zhou P.
      • Hirayama T.
      • Uthgenannt B.
      • Wei S.
      • Takeshita S.
      • Novack D.V.
      • Silva M.J.
      • Abu-Amer Y.
      • Ross F.P.
      • Teitelbaum S.L.
      ,
      • Abu-Amer Y.
      • Erdmann J.
      • Alexopoulou L.
      • Kollias G.
      • Ross F.P.
      • Teitelbaum S.L.
      ).
      MCP-1 ELISA—A rat MCP-1-specific ELISA kit was purchased from BIOSOURCE to measure the protein level of MCP-1 in cell culture media. Assays were performed as recommended by the manufacturer to determine levels of secreted MCP-1 in UMR 106-01 cell culture media that had been concentrated in Amicon Ultra spin columns (Millipore, Billerica, MA) from 4 ml to a 500-μl volume. Values were calculated from standard curves set up for each assay. Supernatants were always run in duplicate, and the variance between the two replicates averaged less than 10%.
      Chemotaxis Assay—This method was performed as described previously (
      • Wuyts A.
      • Proost P.
      • Froyen G.
      • Haelens A.
      • Billiau A.
      • Opdenakker G.
      • Van Damme J.
      ,
      • Votta B.J.
      • White J.R.
      • Dodds R.A.
      • James I.E.
      • Connor J.R.
      • Lee-Rykaczewski E.
      • Eichman C.F.
      • Kumar S.
      • Lark M.W.
      • Gowen M.
      ,
      • Chen X.D.
      • Qian H.Y.
      • Neff L.
      • Satomura K.
      • Horowitz M.C.
      ). Briefly, serial dilutions of MCP-1 or conditioned media from UMR 106-01 cell culture media treated with PTH-(1-34) for 2 h were added to the bottom wells of a 96-well chemotaxis chamber (Neuro Probe, Inc.) with osteoclasts or the precursors scraped off from the culture dishes with a rubber-tipped cell scraper (
      • Collin-Osdoby P.
      • Yu X.
      • Zheng H.
      • Osdoby P.
      ) and placed on the top of the membrane (8-μm pores). After incubating 6 h at 37 °C in a humidified incubator, chambers were disassembled, and the excess cells were mechanically removed from the applied side of the membranes. Membranes were fixed with methanol and processed for TRAP staining followed by counterstaining with hematoxylin. Cells positive for TRAP were identified as osteoclasts. Migration was quantitated by cell counts in six fields (×200 magnification) of each well on the semi-membrane by light microscopy using image analysis software (SPOT Advanced; Diagnostic Instruments, Inc.).
      The conditioned media were concentrated in Amicon Ultra spin columns (Millipore, Billerica, MA) from 10 ml to a 100-μl volume before inclusion in the chemotaxis assay. Conditioned media prepared in this way generally contained ∼25 ng/ml MCP-1 (in the concentrated media) as determined by ELISA. In experiments to test the specificity of the chemotactic effect of MCP-1, the medium containing the recombinant MCP-1 or concentrated conditioned media was incubated with 2.5 μg/ml of either rabbit IgG or anti-MCP-1 neutralizing antibody (polyclonal) at room temperature for 2 h before being used to study chemotaxis of pre/osteoclast cells as described above.
      Osteoclastogenesis—A serial dilution of recombinant rat MCP-1 (10-200 ng/ml) with or without RANKL and M-CSF (in primary osteoclast culture only) was added to cell culture media for the indicated time, and osteoclast differentiation was then assessed by measuring the activity of TRAP, a marker enzyme of osteoclasts, using acid phosphatase kit 387-A (Sigma) and by the direct enumeration of TRAP-positive, morphologically distinct, multinucleated osteoclasts (
      • Igarashi K.
      • Woo J.T.
      • Stern P.H.
      ,
      • Woo J.T.
      • Kasai S.
      • Stern P.H.
      • Nagai K.
      ). Briefly, the specimens were fixed for 30 s and then stained with naphthol AS-BI-phosphate and a tartrate solution for 30 min at 37 °C, followed by counterstaining with a hematoxylin solution. Osteoclasts were determined to be TRAP-positive staining multinuclear (>3 nuclei) cells using light microscopy. The total number of TRAP-positive cells and the number of nuclei per TRAP-positive cell in each well were counted. The morphological features of osteoclasts were also photographed.
      Bone Resorption Assay—Mice bone marrow cells were plated onto BioCoat™ Osteologic™ disks (BD Biosciences) under the same culture conditions as described above. The disk incorporates an artificial bone analog in the form of sub-micron calcium phosphate films that can be resorbed on transparent quartz substrates. After a 10-day culture, 1 ml of bleach solution (∼6% NaOCl, ∼5.2% NaCl) was added to each well. Five min later, the disks were washed with distilled water to remove adherent cells. The disks were then air dried and examined by light microscopy.
      Statistics—All data are based on a minimum of three replicate experiments performed independently on different occasions, unless otherwise stated. Data are shown as mean ± S.E. in the figures. Student's t test or one-way analysis of variance and Tukey's test was used for statistical analyses.

      RESULTS

      PTH Regulates MCP-1 mRNA Abundance in Vivo and in Vitro—Recent microarray studies from our laboratory identified MCP-1 as the most highly regulated target gene in an anabolic PTH protocol in rats, which was not significantly stimulated in a catabolic protocol (
      • Li X.
      • Liu H.
      • Qin L.
      • Tamasi J.
      • Bergenstock M.
      • Shapses S.
      • Feyen J.H.M.
      • Notterman D.A.
      • Partridge N.C.
      ). We confirmed this result by performing real time RT-PCR using RNA isolated from the metaphyseal region of the femora of rats that had received intermittent injections of PTH. As shown in Fig. 1A, daily injections of hPTH-(1-34) for 1, 3, 7, 10, and 14 days greatly stimulated MCP-1 mRNA expression in this bone tissue in rats 1 h after the injection. This induction occurs very quickly, since there is a 32-fold increase in the mRNA expression of MCP-1 1 h after even one PTH injection. Interestingly, the fold simulation of MCP-1 mRNA level kept increasing with longer PTH treatment resulting in an increase of more than 200-fold with 14 daily intermittent injections of PTH.
      Figure thumbnail gr1
      FIGURE 1PTH stimulates MCP-1 mRNA expression both in vivo and in vitro. A and B, mRNAs were extracted from distal femur metaphyses of 3-month-old female rats with either treatment of hPTH-(1-34) (8 μg/100 g) or saline control for the indicated time and collection 1, 2, and 24 h after the last subcutaneous daily injection (A) or at different times during infusion with 4 μg/100 g/day of hPTH-(1-34) or vehicle (B). Real time RT-PCR was performed to determine the fold change in MCP-1 compared with the respective saline control. d, day. C and D, cells were serum-starved for 1 day and then treated with 10-8 m rPTH-(1-34). RNAs were collected at the indicated time points from both control and PTH-treated samples to assess the fold change in MCP-1 mRNA using real time RT-PCR analysis. C, UMR 106-01 cells. D, rat primary calvarial osteoblastic cells at day 6 (proliferation phase), day 14 (differentiation phase), and day 21 (mineralization phase) in culture. *, p < 0.05; **, p < 0.001. Significant increase was compared with the vehicle control.
      In the PTH catabolic treatment model where hPTH-(1-34) was continuously infused into rats subcutaneously, the MCP-1 mRNA level was significantly increased in this region of bone at 6 h and 6 and 14 days but was never greater than 2.5-fold of the vehicle controls (Fig. 1B).
      To confirm that the stimulation of MCP-1 is an osteoblastic response to PTH, we examined the MCP-1 mRNA level after PTH-(1-34) (10-8 m) administration in osteoblastic cells, the UMR 106-01 cell line, and primary osteoblastic cells. The results indicate that PTH treatment stimulates MCP-1 mRNA levels by 20-fold in the UMR cells with the peak level around 90 min after PTH treatment (Fig. 1C). Correspondingly, ELISA showed that secreted MCP-1 protein in UMR cell culture media reached a peak level 2 h after PTH-(1-34) (10-8 m) treatment (Fig. 2). Furthermore, MCP-1 stimulation by PTH is also observed in rat primary calvarial osteoblastic cells (Fig. 1D). These cells mimic the development of osteoblasts in vivo by transitioning sequentially through three stages (proliferation, differentiation, and mineralization) when cultured in vitro. At all developmental stages, MCP-1 levels were stimulated at 1 h and then decreased to basal levels thereafter. The highest stimulation (6.4-fold) by PTH is observed in the differentiation stage, and the lowest (2.7-fold) is seen in the mineralization stage. It is possible that the osteocyte is also able to produce MCP-1, but these cells would make a minor contribution in the region of the femora (primary spongiosa) analyzed.
      Figure thumbnail gr2
      FIGURE 2Identification and determination of secreted MCP-1 levels in UMR 106-01 cell culture media by ELISA. After serum starvation, UMR 106-01 cells were treated with 10-8 m rPTH-(1-34), and culture media were collected at the indicated time points from both control (CTL) and PTH-treated samples to assess the level of MCP-1 by ELISA. *, p < 0.05; **, p < 0.001. Significant increase was compared with the vehicle control.
      PTH Stimulation of MCP-1 Is Dose-dependent via the PKA Pathway and Is a Primary Response—We observed significant increases in MCP-1 mRNA in UMR cells at low doses of PTH (10-10 m) when we performed a dose-response experiment with PTH-(1-34). Although 10-10 m PTH was sufficient to increase MCP-1 mRNA significantly (p < 0.05), maximal effects were observed with 10-8 m PTH, and half-maximal stimulation was calculated to occur with 5 × 10-9 m PTH (Fig. 3A). PTH signals through both PKA and PKC pathways after binding with its receptor, PTH1R, on the osteoblast membrane (
      • Civitelli R.
      • Reid I.R.
      • Westbrook S.
      • Avioli L.V.
      • Hruska K.A.
      ,
      • Partridge N.C.
      • Kemp B.
      • Veroni M.C.
      • Martin T.J.
      ). To study which pathway PTH uses to regulate MCP-1, we took advantage of different peptide fragments of PTH that activate different pathways as well as inhibitors and activators of these pathways. As shown in Fig. 3C, hPTH-(1-31) (which activates PKA but not PKC) (
      • Chakravarthy B.R.
      • Durkin J.
      • Rixon R.H.
      • Whitfield J.F.
      ,
      • Sabatini M.
      • Lesur C.
      • Pacherie M.
      • Pastoureau P.
      • Kucharczyk N.
      • Fauchere J.L.
      • Bonnet J.
      ) retained the ability to stimulate MCP-1 mRNA levels after a 1-h treatment of UMR 106-01 cells (5.7-fold increase compared with 6-fold increase by rPTH-(1-34)). However, bovine PTH-(3-34) (which activates PKC but not PKA) (
      • Sabatini M.
      • Lesur C.
      • Pacherie M.
      • Pastoureau P.
      • Kucharczyk N.
      • Fauchere J.L.
      • Bonnet J.
      ) failed to regulate the expression of MCP-1. In comparison, 8-bromo-cyclic AMP, a cell-permeable cAMP analog, stimulated the expression of MCP-1 about 5-fold, whereas PMA, an activator of the PKC pathway, had no effect. Consistent with these data, in the presence of the PKA inhibitor H-89, but not in the presence of the PKC inhibitor GF109203X, rPTH-(1-34) lost its ability to induce MCP-1, suggesting that this regulation is PKA-dependent but not PKC-dependent in osteoblastic cells.
      Figure thumbnail gr3
      FIGURE 3The stimulation of MCP-1 mRNA expression by PTH is dose-dependent (A), PKA-dependent (B), and is a primary response (C). A, after serum starvation, UMR 106-01 cells were treated with different concentrations of rPTH-(1-34), as indicated, for 1.5 h before harvesting RNA for real time RT-PCR analysis to determine the fold changes in MCP-1. B, UMR 106-01 cells were pretreated with ethanol (0.1%, v/v) or cycloheximide (CHX;30 μg/ml) for 1 h. Cells were then treated with 10-8 m rPTH-(1-34) for another 1 h before harvesting RNA for real time RT-PCR analyses. C, after serum starvation, UMR 106-01 cells were pretreated with the following for 30 min: Me2SO (0.1%, v/v), 40 μm H-89, or 5 μm GF109203X. Cells were then treated with 10-8 m rPTH-(1-34), 10-8 m hPTH-(1-31), 10-8 m bovine PTH-(3-34), 1 mm 8-bromo-cyclic AMP (8-BrcAMP), or 3 μm PMA as indicated for 1 h before harvesting RNA for real time RT-PCR analysis to determine the fold changes in MCP-1. *, p < 0.05; **, p < 0.001. con, significant increase over the vehicle control.
      To determine whether PTH induction of MCP-1 is a primary response, UMR 106-01 cells were treated with rPTH-(1-34) (10-8 m) in the presence or the absence of cycloheximide. Fig. 3B shows that cycloheximide had no effect on the PTH induction of MCP-1, suggesting that this process does not require de novo protein synthesis (i.e. this effect is a primary response).
      Both MCP-1- and PTH-treated UMR Cell Line Conditioned Media Have Chemotactic Effects on Pre/Osteoclasts—Because the expression of the C-C motif chemokine receptor-2 and -4 (CCR2 and CCR4, the receptors for MCP-1) could not be detected by real time RT-PCR in osteoblastic cells (data not shown), we studied the effect of MCP-1 on osteoclasts and their precursors. First, murine macrophage RAW 264.7 cells were used, which can differentiate into osteoclastic cells. RAW cells respond to RANKL stimulation in vitro to generate multinucleated osteoclasts (RAW osteoclasts), a hallmark characteristic of fully differentiated osteoclasts (
      • Hsu H.
      • Lacey D.
      • Dunstan C.R.
      • Solovyev I.
      • Colombero A.
      • Timms E.
      • Tan H.L.
      • Elliott G.
      • Sarosi I.
      • Wang L.
      • Xia X.Z.
      • Elliott R.
      • Chiu L.
      • Black T.
      • Scully S.
      • Capparelli C.
      • Morony S.
      • Shimamoto G.
      • Bass M.B.
      • Boyle W.J.
      ). RAW cells do not require M-CSF as a permissive factor in RANKL-induced formation of osteoclast differentiation and function (
      • Collin-Osdoby P.
      • Yu X.
      • Zheng H.
      • Osdoby P.
      ,
      • Hsu H.
      • Lacey D.
      • Dunstan C.R.
      • Solovyev I.
      • Colombero A.
      • Timms E.
      • Tan H.L.
      • Elliott G.
      • Sarosi I.
      • Wang L.
      • Xia X.Z.
      • Elliott R.
      • Chiu L.
      • Black T.
      • Scully S.
      • Capparelli C.
      • Morony S.
      • Shimamoto G.
      • Bass M.B.
      • Boyle W.J.
      ,
      • Yamamoto A.
      • Miyazaki T.
      • Kadono Y.
      • Takayanagi H.
      • Miura T.
      • Nishina H.
      • Katada T.
      • Wakabayashi K.
      • Oda H.
      • Nakamura K.
      • Tanaka S.
      ), so the cells are only treated with RANKL to differentiate them into mature osteoclasts. In Fig. 4A, both recombinant MCP-1- and PTH-treated UMR cell conditioned media have strong chemotactic effects on RAW cells without RANKL treatment. From Fig. 4D we can see that the chemotactic effects of MCP-1 are blocked by the presence of a neutralizing antibody. More importantly, the MCP-1 antibody also significantly decreased the chemotactic potency of PTH-treated UMR cell culture media. Furthermore, we extended our study using osteoclast precursor cells isolated from mouse long bones to confirm the chemotactic effect on primary osteoclastic cultures. Recombinant MCP-1- and PTH-treated UMR cell culture media similarly showed strong chemotactic effects on primary osteoclast precursors (Fig. 4B). Taken together, the results indicate that MCP-1 has a strong chemotactic effect on pre-osteoclast cells, and MCP1 is likely a major chemotactic factor in PTH-treated UMR media, which causes pre-osteoclast migration. RAW cells and the pre-osteoclasts from mouse long bone were induced to differentiate by treatment with RANKL for 6 days. The osteoclasts were used in chemotactic assays. As shown in Fig. 4C, MCP-1- and PTH-treated UMR culture media also demonstrated a chemotactic effect on these differentiated multinucleated cells. Overall, the results indicate that MCP-1 has chemotactic effects on both the mature osteoclast and its precursor cells.
      Figure thumbnail gr4
      FIGURE 4Chemotactic effects of MCP-1 and conditioned media on pre/osteoclasts. MCP-1 (concentration-dependently) and conditioned media increased the chemotaxis of RAW 264.7 cells (A), mouse bone marrow macrophages (B), and osteoclasts derived from both RAW 264.7 cells and mouse bone marrow (C) in a chemotaxis assay as described under “Experimental Procedures.” *, p < 0.05. Significant increase compared with the vehicle control (con). D, MCP-1 and conditioned media incubated with IgG (control) or MCP-1 antibody (Ab) before the chemotaxis assay with RAW 264.7 cells. a, p < 0.05 compared with control; b, p < 0.05 compared with group treated with MCP-1 antibody, by Student's t test.
      MCP-1 Enhances RANKL-induced Osteoclastogenesis and Fusion—We found that exogenous MCP-1 positively stimulated osteoclast differentiation. Adding MCP-1 to the standard M-CSF and RANKL regime of primary osteoclast cultures for 6 days (with fresh cytokines fed every other day) significantly increased TRAP mRNA expression dose-dependently (50 and 100% increases with MCP-1 of 50 and 100 ng/ml specifically) (Fig. 5A). The effect of MCP-1 to facilitate pre-osteoclast differentiation was quite remarkable, with significantly increased number of nuclei in the TRAP-positive cells as well as fusion resulting in morphologically larger multinucleated osteoclasts (Fig. 5, B and D) when compared with cultures without addition of MCP-1.
      Figure thumbnail gr5
      FIGURE 5MCP-1 stimulates osteoclast differentiation and fusion of mouse bone marrow cells. A, mouse bone marrow was cultured with cytokines as described under “Experimental Procedures” for 6 days before harvesting RNA for real time RT-PCR analysis to determine the fold changes in TRAP mRNA compared with cultures receiving no RANKL. B, in the presence of M-CSF (30 ng/ml) and RANKL, TRAP-positive multinuclear cells were formed. MCP-1 (50 and 100 ng/ml) significantly increased the number of nuclei in TRAP-positive multinuclear cells compared with M-CSF and RANKL alone. *, p < 0.01; **, p < 0.001, significant difference compared with M-CSF- and RANKL-treated cultures by Tukey's test. C, MCP-1 increases mineral dissolution in mouse bone marrow macrophage cultures on BD Biocoat osteologic disks. *, p < 0.01, significant difference compared with M-CSF- and RANKL-treated cultures by Tukey's test. D, in the presence of M-CSF and RANKL, MCP-1 causes a significant increase in the size of TRAP-positive multinuclear cells. E, representative images of mineral dissolution areas in osteologic disks (white areas) are shown and correspond to the treatments in C.
      MCP-1 Increases Osteoclastic Mineral Dissolution in Vitro—More importantly, by using BD Biocoat osteologic disks with cultured mouse bone macrophages, we found MCP-1 significantly increased the dissolved areas at concentrations of both 50 and 100 ng/ml (Fig. 5, C and E). The mineral dissolution activity was increased by 2- and 3.5-fold with addition of 50 and 100 ng/ml of MCP-1.

      DISCUSSION

      Parathyroid hormone is now accepted to have anabolic effects when injected intermittently; in fact, it is a highly effective treatment for osteoporosis. When given this way, PTH not only increases bone formation but also promotes bone remodeling (
      • Neer R.M.
      • Arnaud C.D.
      • Zanchetta J.R.
      • Prince R.
      • Gaich G.A.
      • Reginster J.Y.
      • Hodsman A.B.
      • Eriksen E.F.
      • Ish-Shalom S.
      • Genant H.K.
      • Wang O.
      • Mitlak B.H.
      ). Both clinical and animal studies have shown that bisphosphonates, inhibitors of bone resorption, can blunt the anabolic response to PTH, suggesting that active bone resorption enhances the anabolic actions of PTH (
      • Delmas P.D.
      • Vergnaud P.
      • Arlot M.E.
      • Pastoureau P.
      • Meunier P.J.
      • Nilssen M.H.
      ,
      • Black D.M.
      • Greenspan S.L.
      • Ensrud K.E.
      • Palermo L.
      • McGowan J.A.
      • Lang T.F.
      • Garnero P.
      • Bouxsein M.L.
      • Bilezikian J.P.
      • Rosen C.J.
      ,
      • Finkelstein J.S.
      • Hayes A.
      • Hunzelman J.L.
      • Wyland J.J.
      • Lee H.
      • Neer R.M.
      ). Bone resorption requires the activation of the pre-osteoclast to form mature osteoclasts. This involves migration, expression of certain molecular markers, and the increase in numbers of fused multinucleate osteoclasts.
      It is known that the PTH receptor mainly exists on osteoblasts and pre-osteoblastic cells, so it has been proposed that PTH-stimulated osteoclastic bone resorption is most likely mediated through factors expressed by osteoblasts upon PTH challenge. These factors play an important role in modulating the differentiation of osteoclast progenitors in two different ways as follows: one is the production of soluble factors, and the other is cell-cell recognition between osteoclast progenitors and osteoblasts or osteoblastic stromal cells. Two essential factors have been identified. M-CSF is probably the most important factor for the early stages of osteoclastogenesis, which appears to be necessary for not only proliferation of osteoclast progenitors but also differentiation into mature osteoclasts and their survival (
      • Cappellen D.
      • Luong-Nguyen N.H.
      • Bongiovanni S.
      • Grenet O.
      • Wanke C.
      • Susa M.
      ,
      • Collin-Osdoby P.
      • Yu X.
      • Zheng H.
      • Osdoby P.
      ). RANKL acts on osteoclast progenitors and prepares them to differentiate into mature osteoclasts (
      • Yasuda H.
      • Shima N.
      • Nakagawa N.
      • Yamaguchi K.
      • Kinosaki M.
      • Mochizuki S.
      • Tomoyasu A.
      • Yano K.
      • Goto M.
      • Murakami A.
      • Tsuda E.
      • Morinaga T.
      • Higashio K.
      • Udagawa N.
      • Takahashi N.
      • Suda T.
      ). Parathyroid hormone causes increased M-CSF and RANKL mRNA and protein expression by osteoblastic cells. As little as 10 ng/ml M-CSF can support survival of cells of the macrophage lineage into osteoclasts (
      • Yasuda H.
      • Shima N.
      • Nakagawa N.
      • Yamaguchi K.
      • Kinosaki M.
      • Mochizuki S.
      • Tomoyasu A.
      • Yano K.
      • Goto M.
      • Murakami A.
      • Tsuda E.
      • Morinaga T.
      • Higashio K.
      • Udagawa N.
      • Takahashi N.
      • Suda T.
      ,
      • Weir E.C.
      • Lowik C.W.
      • Paliwal I.
      • Insogna K.L.
      ). So even without PTH stimulation, the basal M-CSF level in the microenvironment of bone produced by osteoblast and bone accessory cells such as macrophages should be enough to support osteoclastogenesis. This suggests that M-CSF is essential for osteoclastogenesis, but PTH can regulate osteoclastogenesis via stimulation of RANKL instead of M-CSF. However, RANKL is produced mainly as a typical type II transmembrane protein by the osteoblast that reacts with its receptor RANK on pre-osteoclast membranes to differentiate these cells into active osteoclasts and to initiate bone resorption; it is essential that the osteoblast and osteoclast are in close proximity or a soluble form of RANKL is cleaved and released into the remodeling environment (
      • Lacey D.L.
      • Timms E.
      • Tan H.L.
      • Kelley M.J.
      • Dunstan C.R.
      • Burgess T.
      • Elliott R.
      • Colombero A.
      • Elliott G.
      • Scully S.
      ). Direct cell contact is usually vital for RANKL stimulation of osteoclastogenesis. To facilitate this process after PTH stimulation, drawing the committed cells, osteoclasts or their precursors, close to RANKL on the osteoblast membrane is of particular importance to initiate direct cell contact to promote osteoclast maturation. In the present studies, MCP-1 was demonstrated to play an important role in this process by recruiting osteoclasts and their precursors and facilitating osteoclastogenesis and fusion.
      Bone resorption is now thought to enhance the anabolic effects of PTH, but in the final analysis, it is also critical to have more bone formation than resorption. Thus, the stimulation of bone resorption during the anabolic protocol should be a transient event preceding osteoblastic bone formation to provide new remodeling sites for new incoming osteoblasts. As mentioned earlier, it is well documented that the increase in osteoclast formation is directly proportional to the level of RANKL expression, and M-CSF plays primarily a permissive role (
      • Yasuda H.
      • Shima N.
      • Nakagawa N.
      • Yamaguchi K.
      • Kinosaki M.
      • Mochizuki S.
      • Tomoyasu A.
      • Yano K.
      • Goto M.
      • Murakami A.
      • Tsuda E.
      • Morinaga T.
      • Higashio K.
      • Udagawa N.
      • Takahashi N.
      • Suda T.
      ,
      • Fan X.
      • Fan D.
      • Genant H.
      • Royce C.L.
      • Nanes M.S.
      • Rubin J.
      ). Furthermore, both in vitro and in vivo studies have demonstrated that PTH influences osteoclast formation primarily by regulation of the RANKL/OPG ratio (
      • Khosla S.
      ). During the PTH anabolic protocol, the hormone would regulate bone turnover in an intermittent fashion. First, it would stimulate osteoclasts through paracrine proresorptive factors. Then, as PTH levels decline, osteoclasts need to be promptly removed and osteoblasts recruited to rebuild bone. It is important for the active osteoclast signal to cease quickly to allow osteoblasts to overcompensate, leading to a net gain in bone mass. As expected, the stimulation of RANKL by PTH administration is a transient response both in vitro and in vivo. The half-life is 40-60 min for RANKL mRNA, and the duration of increase in RANKL mRNA after each PTH administration is short (
      • Dai J.C.
      • He P.
      • Chen X.
      • Greenfield E.M.
      ). The peak level of the RANKL/OPG mRNA ratio is 1 h after each PTH injection and declines to basal at 2 h in 3-month-old female rats with 1-, 7-, and 14-day intermittent administration (
      • Li X.
      • Liu H.
      • Qin L.
      • Tamasi J.
      • Bergenstock M.
      • Shapses S.
      • Feyen J.H.M.
      • Notterman D.A.
      • Partridge N.C.
      ). Interestingly, the kinetic pattern of MCP-1 is very similar to the pattern of the ratio of RANKL and OPG with intermittent PTH injections. It is notable that the stimulation of MCP-1 by PTH in vivo is a rapid but transient event after each injection; this is very consistent with its potential role for the anabolic effect of PTH. Thus, PTH-induced osteoblastic expression of MCP-1 can facilitate RANKL action in the initiation of bone resorption by recruiting pre/osteoclasts to the remodeling sites and promoting osteoclast differentiation.
      It is worth noting that with continuous treatment, RANKL mRNA levels are moderately up-regulated but sustained throughout the treatment, which is also observed for MCP-1 expression. Thus, we think the catabolic effect is produced because of sustained elevated osteoclastic bone resorption due to the sustained up-regulation of RANKL with continuous infusion of PTH as well as the moderate up-regulation of MCP-1 to facilitate the effect of RANKL. We think the anabolic effect is achieved because up-regulation of RANKL and MCP-1 is transient and causes short term bone resorption, which is succeeded by increased bone formation. It is very noticeable that there is a progressive and adaptive response to PTH in the anabolic protocol, and this may be a key difference distinguishing the biology of intermittent versus continuous PTH. It is possible that a new population of osteoblasts (and other cells) is generated by this adaptive response, and these have a metabolic capacity for anabolic bone tissue production distinct from that of the existing lining cells at the start of treatment.
      This study suggests that PTH-induced osteoblastic expression of MCP-1 is involved in osteoclast recruitment, differentiation, and fusion of osteoclast precursors and provides a rationale for increased osteoclast activity in the anabolic effect of PTH in addition to the effects of RANKL to initiate bone remodeling. Our finding is consistent with the study from Kim et al. (
      • Kim M.S.
      • Day C.J.
      • Morrison N.A.
      ,
      • Kim M.S.
      • Day C.J.
      • Selinger C.I.
      • Magno C.L.
      • Stephens S.R.
      • Morrison N.A.
      ) that MCP-1 promotes human osteoclast fusion. These authors even showed that without RANKL, MCP-1 and M-CSF can stimulate the differentiation of human peripheral blood mononuclear cells to cells with the visual appearance of osteoclasts (
      • Kim M.S.
      • Day C.J.
      • Selinger C.I.
      • Magno C.L.
      • Stephens S.R.
      • Morrison N.A.
      ). The difference between their data and ours may be because of the difference in the cell types (they used human peripheral blood mononuclear cells and cultured the cells longer); we were unable to obtain mature osteoclasts with solely MCP-1, although we consistently find that MCP-1 can recruit pre-osteoclasts and osteoclasts and it enhances the effects of RANKL on osteoclastogenesis. Nevertheless, both sets of data suggest that MCP-1 has an important physiological role during the activation of bone resorption. Recently, DC-STAMP (dendritic cell-specific transmembrane protein), a putative seven-transmembrane protein, was identified as an essential regulator of osteoclast and macrophage cell fusion and to have an essential role for osteoclast multinucleation in bone homeostasis (
      • Kukita T.
      • Wada N.
      • Kukita A.
      • Kakimoto T.
      • Sandra F.
      • Toh K.
      • Nagata K.
      • Iijima T.
      • Horiuchi M.
      • Matsusaki H.
      • Hieshima K.
      • Yoshie O.
      • Nomiyama H.
      ,
      • Yagi M.
      • Miyamoto T.
      • Sawatani Y.
      • Iwamoto K.
      • Hosogane N.
      • Fujita N.
      • Morita K.
      • Ninomiya K.
      • Suzuki T.
      • Miyamoto K.
      • Oike Y.
      • Takeya M.
      • Toyama Y.
      • Suda T.
      ). So far, its ligand has not been identified. Although there is no evidence now to prove that MCP-1 interacts with DC-STAMP, the similar function of both in regulating osteoclast fusion suggests that MCP-1 may either interact with DC-STAMP, induce DC-STAMP, or induce the fusion partner for DC-STAMP on its corresponding fusion cell.
      The study by Kim et al. (
      • Kim M.S.
      • Day C.J.
      • Selinger C.I.
      • Magno C.L.
      • Stephens S.R.
      • Morrison N.A.
      ) also suggests that MCP-1 is induced by RANKL during osteoclast differentiation. We conclude that RANKL is unlikely to contribute greatly to the stimulation of MCP-1 mRNA during PTH intermittent administration for the following two reasons. The increase in MCP-1 mRNA is a primary response to PTH in osteoblastic cells in culture. Furthermore, both MCP-1 and RANKL show peak mRNA levels at 1 h after PTH administration in vivo, and both decline to basal levels at 2 h after the first injection. The RANKL mRNA will require sufficient time for increased expressed RANKL protein to regulate the expression of other genes. Since the peak mRNA of MCP-1 is also at 1 h, this is too early for an indirect effect in bone. After 14 days, the mRNA abundance of MCP-1 is still 30-fold higher than basal at 2 h after the last injection, which could possibly be partially due to RANKL stimulation of the osteoclasts. However, considering the fact that MCP-1 mRNA is more than 200-fold that of basal 1 h after the last injection on the 14th day, it is reasonable to see a relatively sustained MCP-1 level since cells may require more time to process this amount of mRNA.
      To further investigate the function of MCP-1, we plan to check the bone phenotype and response to PTH treatment of MCP-1 null mice, which have been described as indistinguishable from wild-type mice except for impaired delayed-type hypersensitivity responses due to abnormalities in monocyte recruitment (
      • Lu B.
      • Rutledge B.J.
      • Gu L.
      • Fiorillo J.
      • Lukacs N.W.
      • Kunkel S.L.
      • North R.
      • Gerard C.
      • Rollins B.J.
      ). Also, it was recently found that the circulating levels of MCP-1 are elevated in human obese subjects and associated with obesity-related parameters (
      • Chen A.
      • Mumick S.
      • Zhang C.
      • Lamb J.
      • Dai H.
      • Weingarth D.
      • Mudgett J.
      • Chen H.
      • MacNeil D.J.
      • Reitman M.L.
      • Qian S.
      ,
      • Kim C.S.
      • Park H.S.
      • Kawada T.
      • Kim J.H.
      • Lim D.
      • Hubbard N.E.
      • Kwon B.S.
      • Erickson K.L.
      • Yu R.
      ) through CCR2 (MCP-1 receptor), which seems to play a role in the maintenance of adipose tissue macrophages (
      • Weisberg S.P.
      • Hunter D.
      • Huber R.
      • Lemieux J.
      • Slaymaker S.
      • Vaddi K.
      • Charo I.
      • Leibel R.L.
      • Ferrante Jr., A.W.
      ).
      The stimulation of MCP-1 mRNA levels after PTH injection in an anabolic protocol in the animal model is very dramatic; our recent experiments have found a difference in serum MCP-1 concentrations from rats injected with PTH compared with vehicle but not of the fold difference of mRNA (data not shown). We think this is because the up-regulation of MCP-1 expression in bone mainly increases the local concentration of MCP-1. It is also possible that the stimulation of MCP-1 by PTH, although a large fold stimulation, represents a rather small absolute quantity of MCP-1 in these local bone compartments. MCP-1 secreted from the osteoblast upon PTH challenge constitutes a paracrine mode of communication to act on osteoclasts and its monocyte precursors. It is also possible that the osteocyte contributes to MCP-1 expression. Since we cannot detect mRNA expression of CCR2 or CCR4 by real time RT-PCR in osteoblastic cells (UMR 106-01 cells; data not shown), MCP-1 is unlikely to act on the osteoblastic lineage cells via an autocrine mode. Thus, the osteoclast and monocytes are likely to be the main targets for MCP-1 in bone.
      Since the incubation of PTH-treated UMR cell-conditioned media with MCP-1 neutralizing antibody only blunted and did not totally abolish its potency for chemotaxis, other chemokines likely exist in the media of these cells and may contribute to the migration of pre/osteoclasts as well. But since the effect was substantially decreased by an MCP-1 antibody, MCP-1 may be the main factor produced in PTH-treated UMR media, which induces the migration of osteoclasts and its precursors.
      In conclusion, as shown in Fig. 6, we propose a model that upon PTH treatment the PKA pathway is activated in osteoblasts, resulting in the expression of RANKL on the membrane and secretion of MCP-1. Osteoclasts and precursor monocytes are recruited to the remodeling site by MCP-1 to initiate the process of bone remodeling. At the same time, MCP-1 facilitates the fusion of the pre-osteoclast forming mature osteoclasts through a paracrine mode.
      Figure thumbnail gr6
      FIGURE 6A model for the role of the chemokine, MCP-1, in the process of bone remodeling associated with the anabolic effect of PTH.

      Acknowledgments

      We thank Drs. Robert L. Jilka and F. Patrick Ross for providing advice and the protocol for primary osteoclast cultures.

      References

        • Delmas P.D.
        • Vergnaud P.
        • Arlot M.E.
        • Pastoureau P.
        • Meunier P.J.
        • Nilssen M.H.
        Bone (Elmsford). 1995; 16: 603-610
        • Black D.M.
        • Greenspan S.L.
        • Ensrud K.E.
        • Palermo L.
        • McGowan J.A.
        • Lang T.F.
        • Garnero P.
        • Bouxsein M.L.
        • Bilezikian J.P.
        • Rosen C.J.
        N. Engl. J. Med. 2003; 349: 1207-1215
        • Finkelstein J.S.
        • Hayes A.
        • Hunzelman J.L.
        • Wyland J.J.
        • Lee H.
        • Neer R.M.
        N. Engl. J. Med. 2003; 349: 1216-1226
        • Li X.
        • Liu H.
        • Qin L.
        • Tamasi J.
        • Bergenstock M.
        • Shapses S.
        • Feyen J.H.M.
        • Notterman D.A.
        • Partridge N.C.
        J. Biol. Chem. 2007; 282: 33086-33097
        • Sodhi A.
        • Montaner S.
        • Gutkind J.S.
        Nat. Rev. Mol. Cell Biol. 2004; 5: 998-1012
        • Wise G.E.
        • Frazier-Bowers S.
        • D'Souza R.N.
        Crit. Rev. Oral. Biol. Med. 2002; 13: 323-334
        • Ishida N.
        • Hayashi K.
        • Hoshijima M.
        • Ogawa T.
        • Koga S.
        • Miyatake Y.
        • Kumegawa M.
        • Kimura T.
        • Takeya T.
        J. Biol. Chem. 2002; 277: 41147-41156
        • Cappellen D.
        • Luong-Nguyen N.H.
        • Bongiovanni S.
        • Grenet O.
        • Wanke C.
        • Susa M.
        J. Biol. Chem. 2002; 277: 21971-21982
        • Graves D.T.
        • Jiang Y.
        • Valente A.J.
        Histol. Histopathol. 1999; 14: 1347-1354
        • Udagawa N.
        • Takahashi N.
        • Akatsu T.
        • Tanaka H.
        • Sasaki T.
        • Nishihara T.
        • Koga T.
        • Martin T.J.
        • Suda T.
        Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 7260-7264
        • Onyia J.E.
        • Bidwell J.
        • Herring J.
        • Hulman J.
        • Hock J.M.
        Bone (Elmsford). 1995; 17: 479-484
        • Qin L.
        • Li X.
        • Ko J.K.
        • Partridge N.C.
        J. Biol. Chem. 2005; 280: 3104-3111
        • Shalhoub V.
        • Gerstenfeld L.C.
        • Collart D.
        • Lian J.B.
        • Stein G.S.
        Biochemistry. 1989; 28: 5318-5322
        • Kitaura H.
        • Sands M.S.
        • Aya K.
        • Zhou P.
        • Hirayama T.
        • Uthgenannt B.
        • Wei S.
        • Takeshita S.
        • Novack D.V.
        • Silva M.J.
        • Abu-Amer Y.
        • Ross F.P.
        • Teitelbaum S.L.
        J. Immunol. 2004; 173: 4838-4846
        • Abu-Amer Y.
        • Erdmann J.
        • Alexopoulou L.
        • Kollias G.
        • Ross F.P.
        • Teitelbaum S.L.
        J. Biol. Chem. 2000; 275: 27307-27310
        • Wuyts A.
        • Proost P.
        • Froyen G.
        • Haelens A.
        • Billiau A.
        • Opdenakker G.
        • Van Damme J.
        Methods Enzymol. 1997; 287: 13-33
        • Votta B.J.
        • White J.R.
        • Dodds R.A.
        • James I.E.
        • Connor J.R.
        • Lee-Rykaczewski E.
        • Eichman C.F.
        • Kumar S.
        • Lark M.W.
        • Gowen M.
        J. Cell. Physiol. 2000; 183: 196-207
        • Chen X.D.
        • Qian H.Y.
        • Neff L.
        • Satomura K.
        • Horowitz M.C.
        J. Bone Miner. Res. 1999; 14: 362-375
        • Collin-Osdoby P.
        • Yu X.
        • Zheng H.
        • Osdoby P.
        Methods Mol. Med. 2003; 80: 153-166
        • Igarashi K.
        • Woo J.T.
        • Stern P.H.
        Biochem. Pharmacol. 2002; 63: 523-532
        • Woo J.T.
        • Kasai S.
        • Stern P.H.
        • Nagai K.
        J. Bone Miner. Res. 2000; 15: 650-662
        • Civitelli R.
        • Reid I.R.
        • Westbrook S.
        • Avioli L.V.
        • Hruska K.A.
        Am. J. Physiol. 1988; 225: E660-E667
        • Partridge N.C.
        • Kemp B.
        • Veroni M.C.
        • Martin T.J.
        Endocrinology. 1981; 108: 220-225
        • Chakravarthy B.R.
        • Durkin J.
        • Rixon R.H.
        • Whitfield J.F.
        Biochem. Biophys. Res. Commun. 1990; 171: 1105-1110
        • Sabatini M.
        • Lesur C.
        • Pacherie M.
        • Pastoureau P.
        • Kucharczyk N.
        • Fauchere J.L.
        • Bonnet J.
        Bone (Elmsford). 1996; 18: 59-65
        • Hsu H.
        • Lacey D.
        • Dunstan C.R.
        • Solovyev I.
        • Colombero A.
        • Timms E.
        • Tan H.L.
        • Elliott G.
        • Sarosi I.
        • Wang L.
        • Xia X.Z.
        • Elliott R.
        • Chiu L.
        • Black T.
        • Scully S.
        • Capparelli C.
        • Morony S.
        • Shimamoto G.
        • Bass M.B.
        • Boyle W.J.
        Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3540-3545
        • Yamamoto A.
        • Miyazaki T.
        • Kadono Y.
        • Takayanagi H.
        • Miura T.
        • Nishina H.
        • Katada T.
        • Wakabayashi K.
        • Oda H.
        • Nakamura K.
        • Tanaka S.
        J. Bone Miner. Res. 2002; 17: 612-621
        • Neer R.M.
        • Arnaud C.D.
        • Zanchetta J.R.
        • Prince R.
        • Gaich G.A.
        • Reginster J.Y.
        • Hodsman A.B.
        • Eriksen E.F.
        • Ish-Shalom S.
        • Genant H.K.
        • Wang O.
        • Mitlak B.H.
        N. Engl. J. Med. 2001; 344: 1434-1441
        • Yasuda H.
        • Shima N.
        • Nakagawa N.
        • Yamaguchi K.
        • Kinosaki M.
        • Mochizuki S.
        • Tomoyasu A.
        • Yano K.
        • Goto M.
        • Murakami A.
        • Tsuda E.
        • Morinaga T.
        • Higashio K.
        • Udagawa N.
        • Takahashi N.
        • Suda T.
        Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3597-3602
        • Weir E.C.
        • Lowik C.W.
        • Paliwal I.
        • Insogna K.L.
        J. Bone Miner. Res. 1996; 11: 1474-1481
        • Lacey D.L.
        • Timms E.
        • Tan H.L.
        • Kelley M.J.
        • Dunstan C.R.
        • Burgess T.
        • Elliott R.
        • Colombero A.
        • Elliott G.
        • Scully S.
        Cell. 1998; 93: 165-176
        • Fan X.
        • Fan D.
        • Genant H.
        • Royce C.L.
        • Nanes M.S.
        • Rubin J.
        Am. J. Physiol. 2001; 280: E103-E111
        • Khosla S.
        Endocrinology. 2001; 142: 5050-5055
        • Dai J.C.
        • He P.
        • Chen X.
        • Greenfield E.M.
        Bone (Elmsford). 2006; 38: 509-520
        • Kim M.S.
        • Day C.J.
        • Morrison N.A.
        J. Biol. Chem. 2005; 280: 16163-16169
        • Kim M.S.
        • Day C.J.
        • Selinger C.I.
        • Magno C.L.
        • Stephens S.R.
        • Morrison N.A.
        J. Biol. Chem. 2006; 281: 1274-1285
        • Kukita T.
        • Wada N.
        • Kukita A.
        • Kakimoto T.
        • Sandra F.
        • Toh K.
        • Nagata K.
        • Iijima T.
        • Horiuchi M.
        • Matsusaki H.
        • Hieshima K.
        • Yoshie O.
        • Nomiyama H.
        J. Exp. Med. 2004; 200: 941-946
        • Yagi M.
        • Miyamoto T.
        • Sawatani Y.
        • Iwamoto K.
        • Hosogane N.
        • Fujita N.
        • Morita K.
        • Ninomiya K.
        • Suzuki T.
        • Miyamoto K.
        • Oike Y.
        • Takeya M.
        • Toyama Y.
        • Suda T.
        J. Exp. Med. 2005; 202: 345-351
        • Lu B.
        • Rutledge B.J.
        • Gu L.
        • Fiorillo J.
        • Lukacs N.W.
        • Kunkel S.L.
        • North R.
        • Gerard C.
        • Rollins B.J.
        J. Exp. Med. 1998; 187: 601-608
        • Chen A.
        • Mumick S.
        • Zhang C.
        • Lamb J.
        • Dai H.
        • Weingarth D.
        • Mudgett J.
        • Chen H.
        • MacNeil D.J.
        • Reitman M.L.
        • Qian S.
        Obes. Res. 2005; 13: 1311-1320
        • Kim C.S.
        • Park H.S.
        • Kawada T.
        • Kim J.H.
        • Lim D.
        • Hubbard N.E.
        • Kwon B.S.
        • Erickson K.L.
        • Yu R.
        Int. J. Obes. 2006; 30: 1347-1355
        • Weisberg S.P.
        • Hunter D.
        • Huber R.
        • Lemieux J.
        • Slaymaker S.
        • Vaddi K.
        • Charo I.
        • Leibel R.L.
        • Ferrante Jr., A.W.
        J. Clin. Investig. 2006; 116: 115-124