If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
To whom correspondence should be addressed: Div. of Hematology, Dept. of Medicine, State University of New York, Stony Brook, NY 11794-8151. Tel.: 631-444-2059; Fax: 631-444-7530
* This work was supported in part by a grant from the American Federation for Aging Research, a Paul Beeson Physician Faculty Scholar Award, and a grant-in-aid from the American Heart Association, Texas Affiliate (to R. Z. L.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Catecholamines, acting through adrenergic receptors, play an important role in modulating the effects of insulin on glucose metabolism. Insulin activation of glycogen synthesis is mediated in part by the inhibitory phosphorylation of glycogen synthase kinase-3 (GSK-3). In this study, catecholamine regulation of GSK-3β was investigated in Rat-1 fibroblasts stably expressing the α1A-adrenergic receptor. Treatment of these cells with either insulin or phenylephrine (PE), an α1-adrenergic receptor agonist, induced Ser-9 phosphorylation of GSK-3β and inhibited GSK-3β activity. Insulin-induced GSK-3β phosphorylation is mediated by the phosphatidylinositol 3-kinase/Akt signaling pathway. PE treatment does not activate phosphatidylinositol 3-kinase or Akt (Ballou, L. M., Cross, M. E., Huang, S., McReynolds, E. M., Zhang, B. X., and Lin, R. Z. (2000) J. Biol. Chem. 275, 4803–4809), but instead inhibits insulin-induced Akt activation and GSK-3β phosphorylation. Experiments using protein kinase C (PKC) inhibitors suggest that phorbol ester-sensitive novel PKC and Gö6983-sensitive atypical PKC isoforms are involved in the PE-induced phosphorylation of GSK-3β. Indeed, PE treatment of Rat-1 cells increased the activity of atypical PKCζ, and expression of PKCζ in COS-7 cells stimulated GSK-3β Ser-9 phosphorylation. In addition, PE-induced GSK-3β phosphorylation was reduced in Rat-1 cells treated with a cell-permeable PKCζ pseudosubstrate peptide inhibitor. These results suggest that the α1A-adrenergic receptor regulates GSK-3β through two signaling pathways. One pathway inhibits insulin-induced GSK-3β phosphorylation by blocking insulin activation of Akt. The second pathway stimulates Ser-9 phosphorylation of GSK-3β, probably via PKC.
GSK-3
glycogen synthase kinase-3
PI3K
phosphatidylinositol 3-kinase
PE
phenylephrine
PMA
phorbol 12-myristate 13-acetate
8-Br-cAMP-S
(Rp)-8-bromoadenosine 3′:5′-monophosphorothioate
PKC
protein kinase C
PKA
protein kinase A
HA
hemagglutinin
ERK
extracellular signal-regulated kinase
Glycogen synthase kinase-3 (GSK-3)1 is an evolutionarily conserved signaling molecule that plays an important role in diverse biological processes, including metabolism, differentiation, and development. GSK-3 was initially identified as a kinase that phosphorylates glycogen synthase and has been found to play a key role in the regulation of glycogen metabolism in insulin-responsive cells (reviewed in Ref.
). GSK-3 also regulates cell fate determination inDictyostelium and has been intensively studied as a component of the Wg/Wnt signaling pathway in invertebrates and vertebrates that controls development (
The activity of glycogen synthase, the rate-limiting enzyme in glycogen synthesis, is increased by dephosphorylation of at least four serine residues in response to insulin treatment (
). Activation of PP1G, a protein phosphatase that can dephosphorylate all the sites in glycogen synthase, is one mechanism used by insulin to increase the activity of the enzyme (
). In addition, a protein kinase cascade has also been identified that appears to play an important role in insulin regulation of glycogen synthase (reviewed in Ref.
), suggesting that PI3K is required for this response. Insulin activation of PI3K and its downstream effector, the protein kinase Akt, induces the phosphorylation and inhibition of GSK-3. GSK-3 phosphorylates glycogen synthase at four sites (3a, 3b, 3c, and 4), provided that site 5 has already been phosphorylated by casein kinase II (
). Phosphorylation of sites 3a and 3b has been shown to potently inactivate the enzyme. Labeling studies with 32P have shown that phosphate turnover is relatively rapid in glycogen synthase, so inhibition of GSK-3 activity by the PI3K/Akt signaling pathway could lead to net dephosphorylation of sites 3a and 3b, resulting in increased glycogen synthase activity.
Two isoforms of GSK-3 (GSK-3α and GSK-3β) have been identified in mammalian tissues, and both are negatively regulated by insulin (
). Both isoforms were found to be phosphorylated at a single tyrosine residue in unstimulated cells, and dephosphorylation of GSK-3β with a protein tyrosine phosphatase in vitro inactivates the enzyme (
). These results led to the suggestion that insulin inactivates GSK-3 through tyrosine dephosphorylation. However, subsequent studies showed that insulin-induced inhibition of GSK-3 is due to an increase in phosphorylation of Ser-21 in GSK-3α and Ser-9 in GSK-3β (
), but Akt is thought to be the physiologically relevant kinase in vivo that inactivates GSK-3 in response to insulin. This conclusion is based on the observations that insulin-induced inhibition of GSK-3 is blocked in cells treated with wortmannin or LY 294002 (
It is well known that catecholamines act through both α- and β-adrenergic receptors to modulate the effects of insulin on glucose metabolism. For example, stimulation of α1-adrenergic receptors in the livers of fed rats inhibits glycogen synthase and promotes gluconeogenesis (
). Adrenergic receptors are members of the G protein-coupled receptor family, and three subtypes of the α1-adrenergic receptor (α1A, α1B, and α1D) have been identified by molecular cloning (
). All three subtypes are widely expressed in a number of tissues and are coupled to α-subunits in the Gq/11 family that are insensitive to inhibition by pertussis toxin (
). It is important to note that, in addition to α1-adrenergic receptors, other receptors that couple to Gq/11, including vasopressin, purinergic, and angiotensin II receptors, also inhibit glycogen synthase (
In contrast to what is known about how insulin affects GSK-3 activity, relatively little is known about how Gq-coupled receptors regulate GSK-3 in mammalian cells. In this study, we investigated the regulation of GSK-3β by the α1A-adrenergic receptor stably expressed in Rat-1 fibroblasts. We found that activation of the α1A-adrenergic receptor leads to a modest increase in phosphorylation of GSK-3β at Ser-9 and inhibition of its catalytic activity. However, activation of the α1A-adrenergic receptor does not activate PI3K or Akt (
), but instead attenuates insulin-induced GSK-3β phosphorylation by inhibiting Akt. These results may explain how catecholamines modulate insulin activation of glycogen synthase.
EXPERIMENTAL PROCEDURES
Materials
Phenylephrine (PE) and insulin were from Sigma. [γ-32P]ATP (3000 Ci/mmol) was from PerkinElmer Life Sciences. Rapamycin, LY 294002, phorbol 12-myristate 13-acetate (PMA), Gö 6983, and 8-Br-cAMP-S were from Calbiochem. The myristoylated PKCζ pseudosubstrate (myr-SIYRRGARRWRKL) was purchased from Quality Controlled Biochemicals (Camarillo, CA). Antibodies to phospho-Ser-9 GSK-3β and phospho-Thr-389 p70 S6 kinase were from Cell Signaling Technology (Beverly, MA); anti-Myc antibody was from Covance (Richmond, CA); and antibody to total p70 S6 kinase was from Santa Cruz Biotechnology (Santa Cruz, CA).
DNA Constructs
The GSK-3β cDNA was isolated by reverse transcriptase polymerase chain reaction with primers 5′-CGCCTCGAGATGTCAGGGCGGCCCAGA (forward) and 5′-CGCGAATTCTCAGGTGGAGTTGGAAGCTG (reverse) using RNA from Swiss mouse 3T3 cells as template. A hemagglutinin (HA) epitope tag was introduced at the 5′-end of the GSK-3β cDNA by polymerase chain reaction using primers 5′-CGCCTCGAGGCCACCATGGCATACCCCTACGACGTGCCCGACTACGCCTCAGGGCGGCCCAGAACC and the reverse primer shown above to make HA-GSK-3β. The cDNA fragment was digested with EcoRI and XhoI and subcloned into pcDNA3.1/Zeo (Invitrogen, Carlsbad, CA). The HA-GSK-3β S9A phosphorylation site mutant was constructed using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the forward primer 5′-CCCAGAACCACCGCTTTGCGGAGAGC. The fidelity of all cDNA constructs was verified by sequencing. Myc-tagged wild-type PKCζ and kinase-dead K273A PKCζ were obtained from Dr. Feng Liu (University of Texas Health Science Center, San Antonio, TX) (
). Rat-1 and COS-7 cells were maintained in Dulbecco's modified Eagle's medium (Mediatech, Herndon, VA) containing 10% fetal bovine serum (Sigma). Rat-1 cells stably expressing the human α1A-adrenergic receptor and HA-GSK-3β or HA-GSK-3β S9A were selected using the antibiotic zeomycin. Cells were incubated in serum-free medium for 16–18 h before treatments. For experiments involving Ca2+, the cells were preincubated for 1 h in high salt/glucose buffer (10 mm Hepes, pH 7.4, 140 mm NaCl, 4 mm KCl, 2 mmMgSO4, 1 mm KH2PO4 and 10 mm glucose) plus either 2 mm EGTA or 1 mm Ca2+ before adding PE to the buffer.
COS-7 cells were seeded at 2 × 105 cells/six-well dish in growth medium and the next day were transfected with 2 µg of DNA in 1.25 ml of Opti-MEM plus 5 µl of LipofectAMINE (Life Technologies, Inc.). After 5 h, the transfection solutions were replaced with growth medium, and the cells were allowed to grow for 1 day. The cells were then placed in serum-free medium overnight, and cell extracts were prepared as described below.
Immunocomplex Kinase Assays
After treatment, cells were rinsed with ice-cold phosphate-buffered saline and then scraped into lysis buffer (50 mm Tris, pH 7.5, 120 mm NaCl, 1% Nonidet P-40, 1 mm EDTA, 50 mm NaF, 40 mm 2-glycerophosphate, 0.1 mm sodium orthovanadate, 1 mm benzamidine, 0.5 mmphenylmethylsulfonyl fluoride, and 10 µg/ml each aprotinin and leupeptin). Homogenates were centrifuged at 12,000 × gfor 10 min at 4 °C, and supernatants were retained for kinase assays and Western blotting. Akt-1 activity was assayed following a method described previously (
). To assay GSK-3β activity, equal amounts of lysate protein were incubated with antibody to either GSK-3β (Transduction Laboratories, Lexington, KY) or HA (Covance) for 3 h on ice and then with protein G-agarose for 1 h. The immunocomplexes were washed three times with lysis buffer and once with kinase assay buffer (40 mm Hepes, pH 7.4, 20 mm2-glycerophosphate, and 10 mm MgCl2). The reaction was initiated with 25 µl of assay buffer containing 40 µm ATP, 2.5 µCi of [γ-32P]ATP, 1 µm protein kinase A (PKA) inhibitor peptide (Sigma), and 1 µg of phospho-GS2 substrate peptide (Upstate Biotechnology, Inc.). After incubation at 30 °C for 20 min, an aliquot was spotted onto P-81 phosphocellulose paper; and following extensive washing with 75 mm phosphoric acid, radioactivity on the papers was quantified by scintillation counting.
PKCζ activity was assayed following a previously described method with modifications (
). Equal amounts of lysate protein were incubated with anti-PKCζ antibody (Transduction Laboratories) for 3 h on ice and then with protein G-agarose for 1 h. Following extensive washing, the reaction was initiated with 25 µl of assay buffer containing 50 mm Tris, pH 7.5, 5 mmMgCl2, 1 mm NaHCO3, 1 mm phenylmethylsulfonyl fluoride, 40 µg/ml phosphatidylserine, 40 µm ATP, 2.5 µCi of [γ-32P]ATP, and 40 µm[Ser159]PKCε-(149–164) substrate peptide (Quality Controlled Biochemicals). The reactions were incubated for 10 min at 30 °C. An aliquot was spotted onto P-81 phosphocellulose paper, and radioactivity was quantified as described above.
Immunoblotting
Cell lysates were prepared as described above, and proteins were subjected to SDS gel electrophoresis and Western blotting as previously described (
An epitope-tagged Akt construct (Akt-HA) was obtained from Dr. Richard Roth (Stanford University, Stanford, CA). Polymerase chain reaction was used to incorporate the myristoylation/palmitoylation sequence from the Lck tyrosine kinase into the 5′-end of Akt-HA to produce m-Akt-HA. The primers used were 5′-CGCCTCGAGGCCACCATGGGCTGCGTGTGCAGCAGCAACCCCGAGGACGACAGCGACGTGGCTATTGTGAAG (forward) and 5′-CGCGATATCTCACAGTCCAGGTCCCAGAC (reverse). Recombinant adenoviruses expressing m-Akt-HA (pAdm-Akt) were constructed using a method described by He et al. (
). Briefly, m-Akt-HA was first subcloned into the shuttle vector pAdTrack, and the resultant plasmid was linearized with PmeI and transformed intoEscherichia coli BJ5183 together with the adenoviral backbone plasmid pAdEasy-1. Recombinants were selected, and recombination was confirmed by restriction analysis. Finally, the linearized recombinant plasmid was transfected into a packaging cell line (HEK 293 cells). The adenoviruses produced were used to infect additional HEK 293 cells, and a high titer adenovirus stock was made following multiple rounds of infection. The viruses were purified by CsCl banding. Concentrated viruses were incubated with Rat-1 cells under conditions that caused nearly 100% of the cells to be infected (data not shown). Adenoviruses expressing green fluorescent protein (pAdGFP) were also constructed to serve as a negative control.
RESULTS
Phenylephrine Antagonizes Insulin Inhibition of GSK-3β
Insulin activation of Akt leads to the inhibitory phosphorylation of GSK-3β at Ser-9, which promotes the dephosphorylation and activation of glycogen synthase. It is well known that catecholamine activation of adrenergic receptors opposes insulin action by inhibiting glycogen synthesis. We showed previously that stimulation of the α1A-adrenergic receptor with PE, a specific α1-adrenergic receptor agonist, inhibits insulin-like growth factor I-induced activation of Akt (
). Therefore, we investigated if PE treatment also inhibits insulin-induced GSK-3β phosphorylation. Rat-1 cells stably expressing the α1A-adrenergic receptor were treated with or without insulin in the presence or absence of PE. Cell extracts were then subjected to Western blotting to measure Ser-9 phosphorylation. As expected, exposure of the cells to insulin alone induced GSK-3β phosphorylation (Fig. 1A). Unexpectedly, PE treatment alone also caused an increase in GSK-3β phosphorylation, although the response was weaker than that seen with insulin (Fig. 1A). (The effect of PE alone on GSK-3β will be examined further below.) Cotreatment of the cells with insulin plus PE reduced the insulin-stimulated phosphorylation to the level seen with PE alone (Fig. 1A). To determine whether Ser-9 phosphorylation correlated with a decrease in GSK-3β kinase activity, Rat-1 cells stably expressing both the α1A-adrenergic receptor and HA-tagged wild-type GSK-3β were treated for 10 min with or without PE or insulin, and then GSK-3β activity was measured in HA immunoprecipitates (Fig. 2A). GSK-3β activity was reduced by 40% in insulin-treated cells and by 20% in cells treated with PE alone (Fig. 2B). The insulin-induced inhibition of GSK-3β was relieved in the presence of PE (Fig. 2B).
Figure 1Inhibitory effect ofPEon insulin signaling toGSK-3β. Serum-starved Rat-1 cells stably expressing the human α1A-adrenergic receptor were treated for 5 min with 1 µm insulin (INS), 10 µm PE, or both agents together. A, phosphorylated GSK-3β was detected on a Western blot probed with antibody to phospho-Ser-9 GSK-3β (upper panel). The blot was stripped and reprobed with a general anti-GSK-3β antibody (lower panel). Con, control. The data shown are representative of three independent experiments. B, Akt activity was measured in immunocomplexes. The data shown are representative of three independent experiments. C, cells were infected with pAdGFP or pAdm-Akt (see “Experimental Procedures”); and 48 h later, the cells were serum-starved overnight prior to treatment with or without 10 µm PE for 5 min. Phosphorylated GSK-3β was detected on a Western blot probed with antibody to phospho-Ser-9 GSK-3β (upper panel). The blot was reprobed with a general anti-GSK-3β antibody (middle panel) and with anti-HA antibody to detect m-Akt-HA (lower panel). The experiment was repeated with similar results.
Figure 2Role of Ser-9 inGSK-3inhibition.A, extracts of parental Rat-1 cells (Con) and cells stably expressing wild-type HA-GSK-3β (WT) or the S9A phosphorylation site mutant were subjected to Western blotting to detect GSK-3β phosphorylated at Ser-9 (upper panel). All cells were stimulated for 5 min with 1 µm insulin. HA-GSK-3β can be distinguished from endogenous GSK-3β by its slower mobility on SDS-polyacrylamide gels. The blot was reprobed with anti-HA antibody (lower panel). B and C, Rat-1 cells expressing wild-type HA-GSK-3β or HA-GSK-3β S9A, respectively, were stimulated for 10 min with 1 µminsulin (INS), 10 µm PE, or both agents together; and GSK-3β activity was measured in HA immunoprecipitates (see “Experimental Procedures”). The data are means ± S.E. from three experiments and are plotted as a percentage of the basal GSK-3β activity measured in untreated control cells. Theasterisk represents a significant difference between insulin and PE/insulin (p < 0.05). The data were analyzed by one-way analysis of variance, and pairwise comparisons were made using Fisher's post-hoc tests.
The effect of PE on Akt, which acts upstream of GSK-3β in the insulin signaling pathway, was also examined. Akt activity in Rat-1 cell extracts was measured using an in vitro immunocomplex kinase assay. Insulin treatment increased Akt activity ∼6-fold, and this response was totally suppressed in the presence of PE (Fig.1B). PE by itself did not activate Akt. These results suggested that the α1A-adrenergic receptor attenuates the effect of insulin on GSK-3 activity by inhibiting Akt activation. To test this hypothesis further, cells were infected with either a control virus (pAdGFP) or a virus encoding a constitutively active form of Akt (pAdm-Akt). Similar to results reported by others using distinct Akt mutants (
), expression of m-Akt-HA caused an increase in Ser-9 phosphorylation of GSK-3β in the absence of any agonist treatment (Fig. 1C). Treatment of these cells with PE did not cause a decrease in Ser-9 phosphorylation, implying that the α1A-adrenergic receptor inhibits insulin signaling to GSK-3 at or above the level of Akt. Together, these results show that activation of the α1A-adrenergic receptor opposes insulin activation of Akt and insulin inhibition of GSK-3β. The change in GSK-3β activity could account for the counter-regulatory effect of catecholamines on insulin stimulation of glycogen synthase.
PE-induced GSK-3β Inhibition Is Mediated by Ser-9 Phosphorylation
The results showing that treatment of Rat-1 cells with PE alone induced Ser-9 phosphorylation (Fig. 1A) and GSK-3β inhibition (Fig. 2B) were surprising because we anticipated that activation of the α1A-adrenergic receptor would have effects opposite to those induced by insulin. To characterize further the effect of the α1A-adrenergic receptor on GSK-3β, Rat-1 cells were treated with PE for increasing times, and GSK-3β activity was measured in cell extracts. Maximal inhibition of 25% was seen after 10 min of PE treatment, and the activity remained essentially the same for the next 20 min (Fig.3A). In comparison, insulin treatment induced a 35% inhibition of GSK-3β activity at 10 min, and the inhibitory effect increased to ∼47% after 30 min of treatment (Fig. 3A). The phosphorylation of Ser-9 seemed to correlate well with GSK-3β inhibition in cells exposed to PE, considering the semiquantitative nature of Western blotting. GSK-3β phosphorylation reached a maximum at 5 min and did not change for the remainder of the time course (Fig. 3B). The signal with insulin-treated cells was stronger than that seen with PE-treated cells (Fig. 3B). Phosphorylation of GSK-3β in response to insulin also reached a maximum after 5 min and did not seem to change over the next 25 min. Thus, GSK-3β inhibition correlated poorly with Ser-9 phosphorylation in cells treated with insulin. The reason for this apparent discrepancy is not known.
Figure 3Time dependence ofPEeffects onGSK-3β activity and phosphorylation.A, serum-starved Rat-1 cells were treated for the indicated times with water (vehicle (Veh)), 10 µm PE, or 1 µm insulin (INS), and GSK-3β activity was measured in cell lysates (see “Experimental Procedures”). The data are means ± S.E. from three experiments and are plotted as a percentage of the basal GSK-3β activity measured in untreated control cells. The asterisk represents significant differences between PE versus vehicle and insulin versusvehicle (p < 0.05) at the 10-min time point. The data were analyzed by one-way analysis of variance, and pairwise comparisons were made using Fisher's post-hoc tests. B, equal amounts of cell lysate protein from A were subjected to Western blotting, and GSK-3β phosphorylated at Ser-9 was detected with a phospho-specific antibody (upper panels). The blots were reprobed with a general anti-GSK-3β antibody (lower panels). The experiment was repeated with similar results.
We wondered if inhibition of GSK-3β by the α1A-adrenergic receptor is mediated solely by phosphorylation of Ser-9. For example, there is evidence suggesting that GSK-3 activity can also be regulated by tyrosine phosphorylation (
). To determine the contribution of Ser-9 phosphorylation to PE-induced GSK-3β inhibition, an HA-tagged phosphorylation site mutant (S9A) of GSK-3β was stably expressed in Rat-1 cells containing the α1A-adrenergic receptor. Fig. 2A (upper panel) shows that Ser-9 in endogenous GSK-3β (lower band) was phosphorylated in insulin-treated parental cells and in cells expressing either wild-type HA-GSK-3β or the S9A mutant. Wild-type HA-GSK-3β (upper band), but not the S9A mutant, was also phosphorylated in insulin-treated cells. Fig. 2A(lower panel) shows that the HA-tagged GSK-3β proteins were expressed at equal levels in both cell populations.
These cells were then used to compare the inhibition of wild-type HA-GSK-3β and HA-GSK-3β S9A following PE treatment. The cells were treated with insulin or PE, and GSK-3β activity was measured in HA immunoprecipitates. HA-GSK-3β was inhibited by ∼20% in cells treated with PE (Fig. 2B), whereas there was a 10–15% increase in activity of HA-GSK-3β S9A under the same conditions (Fig.2C). Likewise, insulin inhibited the activity of wild-type HA-GSK-3β (Fig. 2B), but slightly activated the S9A mutant (Fig. 2C). These results indicate that PE-induced GSK-3β inhibition is mediated by Ser-9 phosphorylation.
PE-induced Signaling Pathways That Mediate GSK-3β Ser-9 Phosphorylation
), have been shown to phosphorylate and inhibit GSK-3 in vitro. We examined the involvement of these kinases in the PE-induced phosphorylation of GSK-3β. Akt does not appear to be involved in this pathway, as PE did not activate Akt or its upstream regulator PI3K in Rat-1 cells (Fig. 1B) (
). We also tested if PE-induced Ser-9 phosphorylation is inhibited by a pharmacological inhibitor of PI3K. Cells were pretreated with 50 µm LY 294002 for 30 min prior to stimulation with PE, and GSK-3β phosphorylation was analyzed by Western blotting. We found that PE-induced GSK-3β phosphorylation was not affected by LY 294002 treatment, whereas the inhibitor strongly antagonized the phosphorylation of GSK-3β induced by insulin (Fig.4A). These results are consistent with our hypothesis that the PI3K/Akt signaling pathway does not mediate the stimulatory effect of the α1A-adrenergic receptor on GSK-3β phosphorylation.
Figure 4Effect of inhibitors on PE-inducedGSK-3β phosphorylation. Equal amounts of lysate protein from Rat-1 cells treated as described below were analyzed on Western blots to visualize GSK-3β Ser-9 phosphorylation (upper panels). The blots were reprobed with a general anti-GSK-3β antibody (lower panels). Experiments were performed two or three times, yielding similar results, and representative data are shown. A, cells were preincubated for 30 min with or without 50 µm LY 294002 (LY) prior to stimulation for 5 min with 10 µmPE or 1 µm insulin (INS). B, cells were pretreated for 30 min with or without 5 µm Gö6983 prior to stimulation with 10 µm PE for 5 min.C, cells were preincubated in serum-free medium with 0.1% dimethyl sulfoxide or 100 nm PMA for 24 h. Then the cells were washed and incubated for 30 min in fresh serum-free medium prior to treatment with 10 µm PE or 100 nmPMA for 5 min as indicated. D, cells were preincubated in buffer containing EGTA or Ca2+ (see “Experimental Procedures”) and then stimulated for 5 min with or without 10 µm PE. GSK-3β Ser-9 phosphorylation and total GSK-3β were visualized on a Western blot (left panels). The blot was stripped and reprobed with antibodies to phospho-Thr-389 p70 S6 kinase (p70S6k) and total p70 S6 kinase (right panels). Con, control.
). However, PE-induced GSK-3β phosphorylation was not blocked by pretreatment with either rapamycin (data not shown) or LY 294002 (Fig.4A) to inhibit p70 S6 kinase (
) or with 8-Br-cAMP-S to inhibit PKA (data not shown). We have also shown that treatment of Rat-1 cells with catecholamines does not activate p90rsk or its upstream regulators ERK1 and ERK2 (
). Together, these results suggest that p70 S6 kinase, PKA, and p90rsk do not play a role in the phosphorylation of GSK-3β in response to stimulation of the α1A-adrenergic receptor.
Like all Gq-coupled receptors, activation of the α1A-adrenergic receptor causes an increase in phospholipase Cβ activity that leads to activation of diacylglycerol-dependent PKCs and an increase in intracellular Ca2+. To examine the role of PKCs in mediating α1A-adrenergic receptor signaling to GSK-3β, we first determined if PE-induced GSK-3β phosphorylation is blocked by a broad-spectrum PKC inhibitor. Rat-1 cells were pretreated with 5 µm Gö 6983 for 30 min prior to stimulation with PE, and Ser-9 phosphorylation was visualized by Western blotting. Pretreatment with Gö 6983 completely inhibited PE-induced GSK-3β phosphorylation (Fig. 4B), suggesting that PKCs are involved in this response. Next, the role of diacylglyceroldependent PKCs was examined in cells treated with or without 100 nm PMA for 24 h to down-regulate these enzymes. Acute PMA treatment of control cells strongly stimulated the phosphorylation of GSK-3β (Fig. 4C), similar to results previously reported for GSK-3α in Swiss 3T3 cells (
). In cells pretreated with PMA, the basal level of GSK-3β phosphorylation increased slightly, but increased phosphorylation induced by a subsequent challenge with PMA was abolished (Fig. 4C). More important, PE-induced phosphorylation of GSK-3β was partially blocked in cells depleted of diacylglycerol-dependent PKCs (Fig.4C). We next examined the role of Ca2+ in α1A-adrenergic receptor signaling to GSK-3β by incubating cells in medium containing EGTA under conditions known to completely abolish the PE-induced increase in intracellular Ca2+ concentration (
). The cells were then treated with or without PE, and Ser-9 phosphorylation of GSK-3β was measured by Western blot analysis. We found that there was no difference in Ser-9 phosphorylation in the presence or absence of intracellular Ca2+ release, whereas PE-induced phosphorylation of p70 S6 kinase was significantly decreased in Ca2+-depleted cells (Fig. 4D). Together, these results suggest that diacylglycerol-dependent novel PKCs, but not conventional Ca2+-dependent PKCs, play a role in signaling by the α1A-adrenergic receptor to GSK-3β. By contrast, we showed previously that PE-induced activation of p70 S6 kinase and phosphorylation of 4E-BP1 still occurs in Rat-1 cells subjected to prolonged treatment with PMA, but not in cells depleted of intracellular Ca2+ (
Since PE-induced GSK-3β phosphorylation was only partially blocked by down-regulation of diacylglycerol-dependent PKCs, but totally inhibited by treatment with Gö 6983, this suggested that atypical PKCs might also be involved. The angiotensin II receptor, a Gq-coupled receptor, has been shown to signal through PKCζ (
), but it is unknown if this atypical PKC can also be activated by the α1A-adrenergic receptor. We therefore measured PKCζ activity with an immunocomplex kinase assay after treating Rat-1 cells with or without PE for 5 min. PKCζ activity increased ∼2-fold in cells treated with PE compared with untreated control cells (Fig. 5A). We next investigated if increased PKCζ activity stimulates an increase in GSK-3β phosphorylation. Because Rat-1 cells undergo transient transfection at a very low efficiency and do not overexpress exogenous proteins at a high level (for example, see Fig. 2A,upper panel), COS-7 cells were used for these experiments. The cells were cotransfected with HA-GSK-3β and either Myc-tagged wild-type PKCζ or kinase-dead PKCζ. Extracts were made after the cells were serum-starved overnight, and proteins were immunoprecipitated with anti-HA antibody. Western blot analysis was then done on the immunoprecipitates to detect GSK-3β phosphorylated at Ser-9. We found that expression of wild-type PKCζ caused a small increase in HA-GSK-3β phosphorylation compared with cells transfected with HA-GSK-3β alone or with HA-GSK-3β together with kinase-dead PKCζ (Fig. 5B, upper panel). The membrane was stripped and reprobed with anti-HA antibody to confirm that similar amounts of HA-GSK-3β were present in each lane (Fig. 5B,middle panel), and Western blotting was done to confirm that the Myc-tagged PKCζ proteins were expressed (Fig. 5B,lower panel).
Figure 5EffectPKCζ onGSK-3β.A, Rat-1 cells were stimulated for 5 min with or without 10 µm PE, and PKCζ activity was measured in immunoprecipitates (see “Experimental Procedures”). Shown are means ± S.E. from three independent experiments. The asterisk indicates a significant difference between control and PE (p < 0.01). The data were analyzed by Student's t test. B, COS-7 cells were cotransfected with HA-GSK-3β and either wild-type Myc-PKCζ or kinase-dead (KD) Myc-PKCζ. The amount of DNA transfected was equalized by including empty vector where needed. Extracts of serum-starved cells were made 48 h later, and equal amounts of protein were subjected to immunoprecipitation using anti-HA antibody. The immunoprecipitates were then examined on Western blots probed with anti-phospho-Ser-9 GSK-3β antibody (upper panel). The blot was stripped and reprobed with anti-HA antibody (middle panel). Total cell extract proteins were examined on a Western blot probed with anti-Myc antibody (lower panel).C, Rat-1 cells were preincubated with or without 10 µm PKCζ pseudosubstrate inhibitory peptide for 1 h and then stimulated with or without 10 µm PE for 5 min. Cell extracts were examined on Western blots probed with anti-phospho-Ser-9 GSK-3β antibody (upper panel). The blot was reprobed with a general anti-GSK-3β antibody (lower panel). The data shown in B and C are representative of at least three independent experiments.
To further investigate the role of PKCζ in signaling by the α1A-adrenergic receptor to GSK-3β, Rat-1 cells were treated with a cell-permeable pseudosubstrate peptide of PKCζ that has been shown to inhibit agonist-induced activation of the enzyme (
). The stimulation of Ser-9 phosphorylation by PE was reduced in the presence of this peptide inhibitor (Fig. 5C). Together with the data using Gö 6983 to inhibit PKCζ (Fig. 4B) (
), these results suggest that PKCζ might be partly responsible for mediating Ser-9 phosphorylation of GSK-3β in response to stimulation of the α1A-adrenergic receptor.
DISCUSSION
The results presented here demonstrate that the α1A-adrenergic receptor can modulate GSK-3β activity in Rat-1 cells in two ways. One mechanism antagonizes insulin-induced Ser-9 phosphorylation to cause an increase in GSK-3β activity, and the second promotes the phosphorylation of GSK-3β at Ser-9 to cause a decrease in GSK-3β activity.
Recent experiments strongly suggest that Akt is the kinase that phosphorylates and inhibits GSK-3 in response to insulin (
). We show here that stimulation of the α1A-adrenergic receptor with PE antagonizes insulin activation of Akt (Fig. 1). As a consequence, insulin-induced Ser-9 phosphorylation and inhibition of GSK-3β are also reduced (Figs. 1 and 2). The inhibitory effect of the α1A-adrenergic receptor on insulin signaling to GSK-3β is overcome by expression of constitutively active Akt (Fig.1C) or by mutation of Ser-9 in GSK-3β to Ala (Fig. 2). These results indicate that the effect of the α1A-adrenergic receptor on insulin regulation of GSK-3β is most likely due to inhibition of the PI3K/Akt signaling pathway. This mechanism could explain the counter-regulatory effect of catecholamines on insulin activation of glycogen synthase. We showed previously that treatment of Rat-1 cells with PE inhibits the activation of PI3K and Akt induced by insulin-like growth factor I and platelet-derived growth factor (
). We have found that PE also inhibits insulin-induced PI3K activation (data not shown). The mechanism by which the α1A-adrenergic receptor inhibits PI3K activation by these diverse tyrosine kinase receptors is under investigation.
Surprisingly, treatment of Rat-1 cells with PE alone induced a modest increase in phosphorylation of GSK-3β and inhibition of its activity (Fig. 3). We suspect that this effect of the α1A-adrenergic receptor on GSK-3 would not result in the activation of glycogen synthase, as catecholamines have been shown to decrease the activity of glycogen synthase in hepatocytes from fasted rats (
). Presumably, dephosphorylation of glycogen synthase by PP1G could counteract the effect of GSK-3 under these conditions. On the other hand, we cannot rule out the possibility that inhibition of GSK-3 by the α1A-adrenergic receptor could play a role in a cellular process not related to glucose metabolism, such as development. The inhibitory effect of the α1A-adrenergic receptor on GSK-3β activity in Rat-1 cells was abolished using the S9A mutant (Fig. 2), indicating that inhibition is dependent on Ser-9 phosphorylation. Unlike insulin, increased Ser-9 phosphorylation of GSK-3β in response to PE is independent of PI3K/Akt signaling since PE did not activate PI3K or Akt (Fig. 1) (
), and the effect of PE on GSK-3β phosphorylation was not blocked by LY 294002 (Fig.4A). These results indicate that the signaling pathways used by the tyrosine kinase receptor and the Gq-coupled receptor to regulate GSK-3β activity are distinct.
We found that PE-induced phosphorylation of GSK-3β was blocked in the presence of a general PKC inhibitor (Fig. 4B), suggesting that the α1A-adrenergic receptor uses a PKC-dependent pathway to regulate the enzyme. It was shown previously that acute treatment of mouse fibroblasts or A431 cells with PMA inactivates GSK-3 by 40–50% (
), suggesting that mammalian cells contain a PKC-dependent pathway that can regulate GSK-3. Indeed, several purified recombinant Ca2+-dependent PKCs have been reported to phosphorylate and inhibit GSK-3β in vitro (PKCα = PKCβ1 = PKCγ > PKCβ2) (
). We found that PMA treatment by itself promoted the phosphorylation of GSK-3β in Rat-1 cells, but Ca2+-dependent PKC isoforms do not appear to be involved in GSK-3β phosphorylation induced by the α1A-adrenergic receptor (Fig. 4, C andD). Instead, our results suggest that activation of a PMA-sensitive novel PKC (Fig. 4C) and the atypical PKCζ (Fig. 5) by the α1A-adrenergic receptor may play a role in signaling to GSK-3β. PKCζ may act directly on GSK-3β in cells, as incubation of GSK-3β (but not the S9A mutant) with PKCζ in vitro has been demonstrated to inhibit GSK-3 kinase activity (
Our results indicate that the signaling pathways used by the insulin and α1A-adrenergic receptors to induce GSK-3β phosphorylation are clearly distinct, as the former depends on PI3K and Akt, whereas the latter does not. The pathways used by some other G protein-coupled receptors to regulate GSK-3 are also different from the one described here for the α1A-adrenergic receptor. For example, agonist binding to the CB1 cannabinoid receptor activates Akt and increases GSK-3α Ser-21 phosphorylation. Treatment of the cells with pertussis toxin or wortmannin blocks the activation of Akt (
), indicating that signaling is through Gi/Go and PI3K. Other receptors coupled to Gi/Go have also been shown to activate the PI3K/Akt signaling pathway (
), and one would expect that they would also induce the wortmannin-sensitive phosphorylation of GSK-3. Treatment of Rat-1 cells with isoproterenol, a β-adrenergic receptor agonist, increases the phosphorylation and decreases the activity of both isoforms of GSK-3. Unlike our findings with the α1A-adrenergic receptor (data not shown), the effect of isoproterenol is reversed in the presence of a PKA inhibitor, and PKA has been proposed to directly phosphorylate and inactivate GSK-3 in response to β-adrenergic receptor stimulation (
). By contrast, activation of β3-adrenergic receptors in rat fat cells increases Akt activity and decreases GSK-3 activity in a manner that is independent of cAMP and insensitive to wortmannin or LY 294002 (
), suggesting that, in these cells, the β3-adrenergic receptor might activate Akt by a novel PI3K-independent pathway that results in the inhibition of GSK-3.
Several GSK-3 signaling pathways that regulate development also utilize heptahelical cell-surface receptors that resemble G protein-coupled receptors. In the Wg/Wnt signaling pathway in Drosophila and vertebrates, the extracellular Wg/Wnt signal is transduced from the membrane receptor Frizzled through Dsh/Dvl to inactivate GSK-3 (
). Stimulation of CAR4 inhibits GSK-3 by an unknown mechanism to promote the pre-stalk cell fate, whereas cAMP binding to CAR3 activates GSK-3 to allow the formation of pre-spore cells. In the latter pathway, CAR3 activates the tyrosine kinase ZAK1, which is thought to phosphorylate and activate GSK-3 (
Our understanding of the physiological role of GSK-3 has evolved significantly since its identification as an insulin-regulated glycogen synthase kinase. Additional studies to elucidate the signaling pathways used by the α1A-adrenergic receptor and other G protein-coupled receptors to regulate the function of this enzyme will add to our understanding of the complexity of GSK-3 regulation.
Acknowledgments
We thank Dr. Feng Liu for the PKCζ constructs and Dr. Richard Roth for Akt-HA. We also thank Ling-Chi Huang for making the GSK-3β expression construct.
REFERENCES
Cohen P.
Philos. Trans. R. Soc. Lond. B Biol. Sci.1999; 354: 485-495
77939-1&id=gr1.jpg){kind=link}
77939-1&id=gr2.jpg){kind=link}
77939-1&id=gr3.jpg){kind=link}
77939-1&id=gr4.jpg){kind=link}
77939-1&id=gr5.jpg){kind=link}