Advertisement

Enhanced Expression of L-type Cav1.3 Calcium Channels in Murine Embryonic Hearts from Cav1.2-deficient Mice*

  • Man Xu
    Affiliations
    Institut für Pharmakologie und Toxikologie, Technische Universität München, Biedersteiner Strasse 29, 80802 München, Germany
    Search for articles by this author
  • Andrea Welling
    Affiliations
    Institut für Pharmakologie und Toxikologie, Technische Universität München, Biedersteiner Strasse 29, 80802 München, Germany
    Search for articles by this author
  • Susanne Paparisto
    Affiliations
    Institut für Pharmakologie und Toxikologie, Technische Universität München, Biedersteiner Strasse 29, 80802 München, Germany
    Search for articles by this author
  • Franz Hofmann
    Affiliations
    Institut für Pharmakologie und Toxikologie, Technische Universität München, Biedersteiner Strasse 29, 80802 München, Germany
    Search for articles by this author
  • Norbert Klugbauer
    Correspondence
    To whom correspondence should be addressed. Tel.: 49-89-4140-3256; Fax: 49-89-4140-3261
    Affiliations
    Institut für Pharmakologie und Toxikologie, Technische Universität München, Biedersteiner Strasse 29, 80802 München, Germany
    Search for articles by this author
  • Author Footnotes
    * This work was supported by grants from the Deutsche Forschungsgemeinschaft and Fond der Chemie. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Open AccessPublished:August 04, 2003DOI:https://doi.org/10.1074/jbc.M307598200
      Voltage-gated calcium (Ca2+) channels play a key role in the control of heart contraction and are essential for normal heart development. The Cav1.2 L-type calcium channel is the predominant isoform in cardiomyocytes and is essential for excitation-contraction coupling. Although the inactivation of the Cav1.2 gene caused embryonic lethality before embryonic day E14.5, hearts were contracting before E14 depending on a dihydropyridine-sensitive calcium influx. We analyzed the consequences of the deletion of the Cav1.2 channel on the expression level of other voltage-gated calcium channels in the embryonic mouse heart and isolated cardiomyocytes. A strong compensatory up-regulation of the Cav1.3 calcium channel was observed on the mRNA as well as on the protein level. Reverse transcriptase PCR indicated that the recently identified new Cav1.3(1b) isoform was strongly up-regulated, whereas a more moderate increase was found for the Cav1.3(1a) variant. Heterologous expression of Cav1.3(1b) in HEK293 cells induced Ba2+ currents with properties similar to those found in Cav1.2 (–/–) cardiomyocytes, suggesting that this isoform constitutes a major component of the residual L-type calcium current in Cav1.2 (–/–) cardiomyocytes. In summary, our results imply that calcium channel expression is dynamically regulated during heart development and that the Cav1.3 channel may substitute for Cav1.2 during early embryogenesis.
      Two distinctive families of voltage-gated Ca2+ channels have been identified in the cardiac tissue of various vertebrates, namely the L-type and the T-type Ca2+ channels (
      • Hofmann F.
      • Lacinova L.
      • Klugbauer N.
      ,
      • Larsen J.K.
      • Mitchell J.W.
      • Best P.W.
      ). The principal α1 subunits of L-type Ca2+ channels expressed in embryonic hearts are encoded by three different genes, i.e. Cav1.11S ), Cav1.21C ), and Cav1.31D ) (
      • Larsen J.K.
      • Mitchell J.W.
      • Best P.W.
      ,
      • Ertel E.A.
      • Campbell K.P.
      • Harpold M.M.
      • Hofmann F.
      • Mori Y.
      • Perez-Reyes E.
      • Schwartz A.
      • Snutch T.P.
      • Tanabe T.
      • Birnbaumer L.
      • Tsien R.W.
      • Catterall W.A.
      ,
      • Mikami A.
      • Imoto K.
      • Tanabe T.
      • Niidome T.
      • Mori Y.
      • Takeshima H.
      • Narumiya S.
      • Numa S.
      ,
      • Seisenberger C.
      • Specht V.
      • Welling A.
      • Platzer J.
      • Pfeifer A.
      • Kühbandner S.
      • Striessnig J.
      • Klugbauer N.
      • Feil R.
      • Hofmann F.
      ). Among these channels, Cav1.2 is the predominantly expressed isoform in cardiomyocytes and is important for excitation-contraction coupling (
      • Ertel E.A.
      • Campbell K.P.
      • Harpold M.M.
      • Hofmann F.
      • Mori Y.
      • Perez-Reyes E.
      • Schwartz A.
      • Snutch T.P.
      • Tanabe T.
      • Birnbaumer L.
      • Tsien R.W.
      • Catterall W.A.
      ,
      • Mikami A.
      • Imoto K.
      • Tanabe T.
      • Niidome T.
      • Mori Y.
      • Takeshima H.
      • Narumiya S.
      • Numa S.
      ,
      • Seisenberger C.
      • Specht V.
      • Welling A.
      • Platzer J.
      • Pfeifer A.
      • Kühbandner S.
      • Striessnig J.
      • Klugbauer N.
      • Feil R.
      • Hofmann F.
      ,
      • Bohn G.
      • Moosmang S.
      • Conrad H.
      • Ludwig A.
      • Hofmann F.
      • Klugbauer N.
      ,
      • Lipscombe D.
      ). Deletion of the Cav1.2 gene results in embryonic death before day E14.5 (
      • Seisenberger C.
      • Specht V.
      • Welling A.
      • Platzer J.
      • Pfeifer A.
      • Kühbandner S.
      • Striessnig J.
      • Klugbauer N.
      • Feil R.
      • Hofmann F.
      ), whereas deletion of the Cav1.3 (
      • Platzer J.
      • Engel J.
      • Schrott-Fischer A.
      • Stephan K.
      • Bova S.
      • Chen H.
      • Zheng H.
      • Striessnig J.
      ) and Cav3.1 (
      • Kim D.
      • Song I.
      • Keum S.
      • Lee T.
      • Jeong M.J.
      • Kim S.S.
      • McEnery M.W.
      • Shin H.S.
      ) genes does not significantly affect embryonic development. The Cav1.3 Ca2+ channel contributes to the generation of the spontaneous action potentials in SA node cells by participating to diastolic depolarization (
      • Platzer J.
      • Engel J.
      • Schrott-Fischer A.
      • Stephan K.
      • Bova S.
      • Chen H.
      • Zheng H.
      • Striessnig J.
      ,
      • Zhang Z.
      • Xu Y.
      • Song H.
      • Rodriguez J.
      • Tuteja D.
      • Namkung Y.
      • Shin H.S.
      • Chiamvimonvat N.
      ,
      • Mangoni M.E.
      • Couette B.
      • Bourinet E.
      • Platzer J.
      • Reimer D.
      • Striessnig J.
      • Nargeot J.
      ). So far, no specific cardiac function has been reported for the faintly expressed α1S subunit during embryogenesis.
      Two T-type Ca2+ channels have been detected in vertebrate heart, namely Cav3.1 (α1G) and Cav3.2 (α1H) (
      • Ferron L.
      • Capuano V.
      • Deroubaix E.
      • Coulombe A.
      • Renaud J.-F.
      ,
      • Cribbs L.L.
      • Martin B.L.
      • Schroder E.A.
      • Keller B.B.
      • Delisle B.P.
      • Satin J.
      ). T-type Ca2+ channels have been mainly studied in cardiac pacemaker cells and are thought to act together with the hyperpolarization-activated, cyclic nucleotide-gated (HCN) channels (
      • Biel M.
      • Schneider A.
      • Wahl C.
      ) and the L-type Ca2+ channels in the generation of pacemaker potentials. There is evidence that in heart the T-type current also contributes to pathological processes such as ventricular hypertrophy, post-myocardial infarction, and arrhythmogenesis that occur during atrial fibrillation (
      • Huang B.
      • Qin D.
      • Deng L.
      • Boutjdir M.
      • El-Sherif N.
      ,
      • Nattel S.
      ). In contrast to these observations, Cav3.1 knockout mice do not display a cardiac phenotype but reveal a lack of the burst firing of thalamocortical relay neurons and resistance to absence seizures (
      • Kim D.
      • Song I.
      • Keum S.
      • Lee T.
      • Jeong M.J.
      • Kim S.S.
      • McEnery M.W.
      • Shin H.S.
      ).
      Ca2+ channels have been extensively investigated by molecular biology, biochemical, and electrophysiological methods in heart cells (
      • An R.H.
      • Davies M.P.
      • Doevendans P.A.
      • Kubalak S.W.
      • Bangalore R.
      • Chien K.R.
      • Kass R.S.
      ,
      • Davies M.P.
      • An R.H.
      • Doevendans P.
      • Kubalak S.
      • Chien K.R.
      • Kass R.S.
      ,
      • Liu W.
      • Yasui K.
      • Arai A.
      • Kamiya K.
      • Cheng J.
      • Kodma I.
      • Toyama J.
      ). In contrast, there is only limited knowledge on the transcriptional levels of L- and T-type channels during heart development. We have shown previously that an intact Cav1.2 gene is required for normal embryonic development after embryonal day E14 (
      • Seisenberger C.
      • Specht V.
      • Welling A.
      • Platzer J.
      • Pfeifer A.
      • Kühbandner S.
      • Striessnig J.
      • Klugbauer N.
      • Feil R.
      • Hofmann F.
      ). Deletion of the cardiac calcium channel β2 gene results in embryonal death already after day E9.5 (
      • Weisgerber P.
      • Held B.
      • Fleischmann B.
      • Flockerzi V.
      • Freichel M.
      ). In view of the relative late death of the Cav1.2 (–/–) embryos, the early death of the β2 knockout mice was surprising. Furthermore, the analysis of Cav1.2 (–/–) cardiomyocytes at day E12.5 revealed that rhythmic contractility depended on an L-type-like Ca2+ current with a low affinity for dihydropyridines (
      • Seisenberger C.
      • Specht V.
      • Welling A.
      • Platzer J.
      • Pfeifer A.
      • Kühbandner S.
      • Striessnig J.
      • Klugbauer N.
      • Feil R.
      • Hofmann F.
      ). These results suggested that an unidentified L-type like calcium channel replaced the lacking Cav1.2 channel during early embryogenesis.
      In the present study, we compared the expression of six potential surrogate calcium channels by RT-PCR
      The abbreviations used are: RT-PCR, reverse transcriptase PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HEK 293, Human embryonic kidney 293 (cells); HP, holding potential; NMDG, N-methyl-d-glucamine.
      1The abbreviations used are: RT-PCR, reverse transcriptase PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HEK 293, Human embryonic kidney 293 (cells); HP, holding potential; NMDG, N-methyl-d-glucamine.
      in murine cardiomyocytes derived from Cav1.2-deficient embryos with that from wild type cells. We found major differences in the expression level of other calcium channel genes with a predominant up-regulation of a Cav1.3 splice form that has the electrophysiological and pharmacological properties of the L-type current found in Cav1.2 (–/–) cardiomyocytes.

      MATERIALS AND METHODS

      Animals and Cardiomyocytes Isolation—Wild type mice and Cav1.2 (±) mice (
      • Seisenberger C.
      • Specht V.
      • Welling A.
      • Platzer J.
      • Pfeifer A.
      • Kühbandner S.
      • Striessnig J.
      • Klugbauer N.
      • Feil R.
      • Hofmann F.
      ) were housed at 20 °C with a 12-h light/dark cycle. Individual embryos were obtained after breeding of wild type or heterozygous Cav1.2 (±) mice. The hearts were dissected at embryonic day E9.5, E12.5, or E15.5 and were either used for cell isolation or quickly frozen and stored at –80 °C for RNA isolation. Embryonic cardiomyocytes were isolated as described (
      • Seisenberger C.
      • Specht V.
      • Welling A.
      • Platzer J.
      • Pfeifer A.
      • Kühbandner S.
      • Striessnig J.
      • Klugbauer N.
      • Feil R.
      • Hofmann F.
      ). The dispersed cells were plated on 60-mm dishes for 48 h and then harvested for RNA isolation.
      RNA Isolation, First Strand cDNA Synthesis, and RT-PCR—Frozen heart tissue or cultured cardiomyocytes were homogenized in Trizol LS Reagent (Invitrogen), and total RNA was isolated according to the manufacturer's recommendations. Total RNA was then quantified by spectrophotometry. The RNA samples were not contaminated with DNA, which was checked by PCR in the absence of reverse transcriptase. First strand cDNA synthesis was carried out for 1 h at 42 °C in a 20-μl reaction mixture containing 4 μg of total RNA, 2 units of RNase H, 1.25 mm dNTP, 100 pmol of random hexamer primers, and 50 units of Superscript II reverse transcriptase (Invitrogen). The enzyme was inactivated by incubation at 90 °C for 5 min. The cDNAs were first analyzed with a GAPDH-specific RT-PCR as an internal control. Specific primer pairs were used to detect Cav1.1, Cav1.2, Cav1.3, Cav2.3, Cav3.1, and Cav3.2 transcripts (Table I). For each primer pair, amplification of the cDNA was carried out in a reaction mixture containing 2 μl of the first strand cDNA preparation, 1× PCR buffer, 25 pmol of each primer, and 2.5 units of Taq polymerase (Promega) in a total volume of 50 μl. The PCR cycles were denaturing at 94 °C for 1 min, annealing at appropriate temperature (Table I) for 1 min, and extension at 72 °C for 1 min during 35∼40 cycles. The PCR products were separated on 2% agarose gels and stained with ethidium bromide. The gels were recorded and analyzed by an imaging software (Bio-Rad Gel 2000, Quantity One software version 4). The relative amount of the amplicons were determined and normalized to that of the GAPDH fragment. The identity of the PCR products was verified by DNA sequencing.
      Table IPrimers used to amplify the calcium channel cDNAs and the predicted product sizes
      NamePrimer5′-Location (bp)Sequence (5′-3′)Size (bp)
      Cav1.1F1235GCGAGGTCATGGACGTGGACGA200
      L06234R1434GATCACCAGCCAATAGAAGAC
      Cav1.2F3527CAGGAGGTGATGGAGAAGCCA316
      L01776R3842CTGCAGGCGGAACCTGTTGTT
      Cav1.3F3217GGGGTCCAGCTGTTCAAGGGGGAA555
      AJ437292R3771GCATGATGAGGACGAACATCATG
      Cav3.1F2998GTGGAGGGTTTCCAGGCAGAGG279
      AJ012569R3276GTGCTGGAGCTCTTGGG
      Cav3.2F3105AGAGGAAGATTTCGATAAGCT328
      AF051946R3432GCTGTTCCAGCTGGAGCGCC
      Cav1.3(1a)Dutr01-45AGCAYAGTGCCCTGCACACAGTA590
      AJ437291RACE12545CAGTCCATACGCTATAATCTTCAGAAATGT
      Cav1.3(1b)RACE20-31GCTCGGTGGCTGTATTTTCAAC649
      AJ437292RACE12618CAGTCCATACGCTATAATCTTCAGAAATGT
      The cloning and expression of the two N-terminal Cav1.3 splice variants (Cav1.3 (1a) and Cav1.3 (1b)) has been described (
      • Klugbauer N.
      • Welling A.
      • Specht V.
      • Seisenberger C.
      • Hofmann F.
      ). The relative expression levels of the Cav1.3 (1a) or (1b) mRNA were analyzed by the use of a mixture of the two forward primers Dutr01 and Race20 (1:1 ratio) and the reverse primer Race12 (see Fig. 3). Detection of the two splice variants by this mixture is possible because this PCR reaction yields different sized amplicons (
      • Klugbauer N.
      • Welling A.
      • Specht V.
      • Seisenberger C.
      • Hofmann F.
      ).
      Figure thumbnail gr3
      Fig. 3Expression of Cav1.3 in Cav1.2 (–/–) and Cav1.2 (+/+) embryos. A, scheme of exons 1–4 of Cav1.3(1a) and Cav1.3(1b). For primers, see . B, RT-PCR-based analysis of Cav1.3 splice variants in embryonic hearts at day E9.5 and day E12.5. p. c., post coitum. C, Western blotting of Cav1. 2, Cav1.3, and β-actin in murine embryonic hearts at day E12.5.
      Western Blots—E12.5 embryonic hearts were exposed to one freeze-thaw cycle and homogenized in lysis buffer (20 mm KH2PO4, pH 7.2, and 1mm EDTA) containing protease inhibitors (1 mm benzamidine, 0.1 mm phenylmethylsulfonyl fluoride and protease inhibitor mixture (1:500); Sigma). Lysates (60-μg proteins) were loaded on 11% SDS-polyacrylamide gels. After electrophoresis, proteins were transferred to a polyvinylidene difluoride membrane (Millipore). Membranes were blocked in 1× Tris-buffered saline-Tween 20 buffer containing 3% bovine serum albumin and 0.1% Tween 20. For detecting Cav1.2 and Cav1.3, the membranes were incubated overnight at 4 °C with primary antibody (1:200) (Alamone and Chemicon, respectively). For β-actin, the lower part of the membranes was incubated overnight at 4 °C in a 1:200 primary antibody. All immunoblots were followed by incubation for 1 h at room temperature in 1× Tris-buffered saline-Tween 20 buffer with a 1:10,000 diluted peroxidase-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch) for detecting Cav1.2 and Cav1.3 or peroxidase-conjugated goat anti-mouse IgG (Jackson ImmunoResearch) for detecting β-actin. The immunoblots were visualized by the ECL system (PerkinElmer Life Sciences).
      Electrophysiology—Electrophysiological experiments were performed as described earlier (
      • Seisenberger C.
      • Specht V.
      • Welling A.
      • Platzer J.
      • Pfeifer A.
      • Kühbandner S.
      • Striessnig J.
      • Klugbauer N.
      • Feil R.
      • Hofmann F.
      ,
      • Klugbauer N.
      • Welling A.
      • Specht V.
      • Seisenberger C.
      • Hofmann F.
      ). HEK 293 cells were transiently transfected with the expression vector for the Cav1.3 (1a) or (1b) subunit (0.2 μg per well) and the expression vectors for the β3 and the α-1 subunits (0.15 μg each per well) using LipofectAMINE according to the manufacturer's instructions (Invitrogen). The holding potential (HP) was –80 mV. Current-voltage relations (I-V) were recorded from –60 to 50 mV with 10-mV increments and a frequency of 0.2 Hz. Cumulative dose-response curves were measured using 2–3 different nisoldipine concentrations per cell. Trains of test pulses were to 0 or 10 mV for 40 ms with 0.1 Hz for I Ba of native cells or to –10 or 0 mV for 100 ms with 0.2 Hz for I Ba of expressed channels. IC50 values were calculated by fitting the averaged dose-response curves to the Hill equation shown in Equation 1,
      I/Imax=1/(1+([nisoldipine]/IC50)H)
      (Eq. 1)


      where [nisoldipine] is the concentration of nisoldipine, IC50 is the half-blocking concentration, H is the Hill coefficient, I is the current measured at any concentration of nisoldipine, and I max is the current measured in the absence of drug. The data for the I Ba of wild type cardiomyocytes were fitted with a two-component Hill equation.
      The intracellular solution contained 60 mm CsCl, 50 mm aspartic acid, 68 mm CsOH, 1 mm MgCl2, 5 mm potassium-ATP, 1 mm CaCl2, 10 mm HEPES, and 11 mm EGTA (pH 7.4). Seals were formed in a barium Tyrode solution of the composition 130 mm NaCl, 4.8 mm KCl, 5 mm BaCl2, 1 mm MgCl2, 5 mm glucose, and 5 mm HEPES (pH 7.4). The bath solution contained 130 mm N-methyl-d-glucamine (NMDG), 4.8 mm CsCl, 5 mm BaCl2, 5 mm glucose, and 5 mm HEPES at pH 7.4 (NMDG Tyrode). Nisoldipine stock solution was 10 mm in ethanol. On each experimental day, nisoldipine was diluted from the stock solution into the NMDG Tyrode to the indicated concentrations.

      RESULTS

      Expression of Calcium Channel α 1 Subunit mRNAs in Murine Fetal Heart and Cardiomyocytes—To analyze Ca2+ channel diversity in murine embryonic hearts, we determined the relative mRNA expression at day E9.5, a time point when the heart starts regular beating, at day E12.5, a time point when Cav1.2-deficient embryos still develop, and at day E15.5, a time point when the heart is fully developed (
      • Passier R.
      • Richardson J.A.
      • Olson E.N.
      ). To compare expression levels obtained from independent experiments, we normalized the data by using GAPDH as an internal standard. In agreement with others (
      • Hofmann F.
      • Lacinova L.
      • Klugbauer N.
      ,
      • Takimoto K.
      • Li D.
      • Nerbonne J.M.
      • Levitan E.S.
      ,
      • Ménard C.
      • Pupier S.
      • Mornet D.
      • Kitzmann M.
      • Nargeot J.
      • Lory P.
      ), we obtained amplicons for Cav1.1, Cav1.2, Cav1.3, Cav3.1, and Cav3.2 channels (Fig. 1A). No specific DNA fragments were detected for the R-type Cav2.3 and L-type Cav1.4 calcium channels. Transcripts of the L-type channels Cav1.1, Cav1.2, and Cav1.3 were present throughout the fetal heart development. At day E9.5 the expression levels of the three channels were nearly identical. In contrast to the Cav1.3 and Cav1.1 mRNAs, the Cav1.2 subunit was up-regulated ∼3-fold at day E15.5 (Fig. 1B). Cav1.2 becomes the predominant L-type channel isoform in late developmental stages. In isolated embryonic cardiomyocytes, up-regulation of Cav1.2 was even slightly more pronounced than in total heart at E15.5 (not shown). In general, the changes in mRNA levels were more pronounced in cardiomyocytes than in total heart tissue, which may be caused by various expression levels in multiple cardiac cell types. Whereas in total heart the Cav3.1 T-type Ca2+ channel subunit could be consistently found at all three time points investigated, Cav3.2 was barely detectable at all developmental stages (Figs. 1B and 2B). At day E15.5, Cav3.2 could be detected neither in total heart nor in isolated cardiomyocytes, indicating that Cav3.1 is the major cardiac T-type channel isoform (
      • Mikami A.
      • Imoto K.
      • Tanabe T.
      • Niidome T.
      • Mori Y.
      • Takeshima H.
      • Narumiya S.
      • Numa S.
      ,
      • Ménard C.
      • Pupier S.
      • Mornet D.
      • Kitzmann M.
      • Nargeot J.
      • Lory P.
      ). Like Cav1.2, the Cav3.1 subunit was also up-regulated during early fetal development, but the Cav3.1 mRNA levels did not further increase between E12.5 and E15.5. Interestingly, unlike in total heart, expression of Cav3.1 was not observed in isolated cardiomyocytes at day E9.5 (Fig. 2B). This finding indicates that at this time point Cav3.1 could be expressed in cell types different from cardiomyocytes.
      Figure thumbnail gr1
      Fig. 1Expression profiles of α1 subunit genes in murine fetal heart. A, RT-PCR-based analysis of calcium channel α1 subunit mRNA from murine heart at embryonic days E9.5, E12.5, and E15.5. For each lane, 0.4 μg of total RNA was used to perform RT-PCR with primer pairs shown in . GAPDH was used as an internal control. B, relative expression levels of α1 subunit genes. The intensities of the respective ethidium bromide-stained amplicons were measured and normalized against the GAPDH amplicon as an internal standard. Data are presented as means ± S.E. (n = 3). *, p < 0.05; **, p < 0.01 versus the group of day E9.5; #, p < 0.05; ##, p < 0.01 versus the group of day E 2.5. p. c., post coitum.
      Figure thumbnail gr2
      Fig. 2Expression of calcium channel α1 subunit mRNAs in Cav1.2 (–/–) and Cav1.2 (+/+) cardiomyocytes. A, RT-PCR-based analysis of calcium channel α1 subunit mRNA in cardiomyocytes isolated from murine Cav1.2 (–/–) embryos at day E9.5 and E12.5. For each lane, 0.4 μg of total RNA was used to perform RT-PCR with primer pairs shown in . GAPDH was used as an internal standard. p. c., post coitum. B, relative mRNA expression levels of α1 subunits compared with GAPDH expression. Data are presented as means ± S.E. (n = 3). n. d. indicates expression below the level of detection. *, p < 0.05; **, p < 0.01, the group of day E12.5 versus the group of day E9.5; †, p < 0.05; ††, p < 0.01, the group of Cav1.2 (–/–) versus the group of Cav1.2 (+/+) at the same day.
      Different Expression Levels of Calcium Channel α 1 Subunit mRNAs in Cav1.2-deficient Murine Embryonic Cardiomyocytes—Embryos deficient for the Cav1.2 gene die before day E14.5 (
      • Seisenberger C.
      • Specht V.
      • Welling A.
      • Platzer J.
      • Pfeifer A.
      • Kühbandner S.
      • Striessnig J.
      • Klugbauer N.
      • Feil R.
      • Hofmann F.
      ), although hearts of Cav1.2 (+/+) and Cav1.2 (–/–) embryos contracted with the same frequency at day E12.5. This surprising result indicated that Cav1.2 is either not required for rhythmic heart contraction or is functionally compensated by another calcium channel during early embryogenesis. Therefore, we determined the expression of calcium channel α1 subunit mRNAs in cardiomyocytes isolated from days E9.5 and E12.5 of Cav1.2 (–/–) embryos (Fig. 2). Transcripts of the Cav1.2 subunit could be detected in (–/–) cardiomyocytes. These transcripts are not translated into a functional calcium channel protein, because their open reading frame is disrupted by the introduction of a premature stop codon in exon 3 (
      • Seisenberger C.
      • Specht V.
      • Welling A.
      • Platzer J.
      • Pfeifer A.
      • Kühbandner S.
      • Striessnig J.
      • Klugbauer N.
      • Feil R.
      • Hofmann F.
      ). Deletion of the Cav1.2 gene increased the expression levels of three other channels, Cav1.1, Cav1.3, and Cav3.1 at day E9.5 (Fig. 2B). The mRNA of the Cav3.1 channel was not detected in wild type cardiomyocytes but was present in Cav1.2 (–/–) cells at day E9.5 (Fig. 2B). At day E12.5, similar levels of mRNA were detected for the Cav1.1 and Cav3.1 channels. In contrast, the expression of Cav1.3 changed dramatically. At days E9.5 and E12.5, the mRNA of this channel was up-regulated 4-fold in Cav1.2 (–/–) cardiomyocytes (Fig. 2B).
      Expression of Cav1.3 Splice Variants in Cav1.2 Wild Type and Cav1.2-deficient Murine Embryonic Hearts—To further analyze the expression of Cav1.3 in Cav1.2-deficient hearts, we investigated the expression levels of two Cav1.3 N-terminal splice variants, Cav1.3(1a) and the recently identified novel isoform Cav1.3(1b) (Fig. 3A). RT-PCR indicated that both splice variants of Cav1.3 were slightly increased at day E9.5 in Cav1.2 (–/–) hearts. Notably, the up-regulation of Cav1.3 observed at day E12.5 was even more pronounced. At this time, Cav1.3(1b) was clearly the dominant splice variant. (Fig. 3B).
      These PCR results were confirmed by Western blots with an Cav1.3-specific antibody (Fig. 3C). The amount of Cav1.3 protein was substantially increased in the heart of Cav1.2 (–/–) embryos. As expected, Cav1.2 was absent in knockout embryos, whereas the expression levels of β-actin were not affected by the knockout.
      Electrophysiological and Pharmacological Properties of the Cav1.3 Splice Variants—It was tempting to speculate that the previously described (
      • Seisenberger C.
      • Specht V.
      • Welling A.
      • Platzer J.
      • Pfeifer A.
      • Kühbandner S.
      • Striessnig J.
      • Klugbauer N.
      • Feil R.
      • Hofmann F.
      ) L-type-like dihydropyridine-sensitive calcium current of Cav1.2 (–/–) cardiomyocytes could be caused by the up-regulated Cav1.3 channel. To test this hypothesis, we expressed Cav1.3(1a) and CaV1.3(1b) in HEK 293 cells and compared the expressed currents with currents from Cav1.2 (–/–) cardiomyocytes. The expression of both the β2 and β3 subunits has been reported in cardiac muscle (
      • Hullin R.
      • Khan I.F.Y.
      • Wirtz S.
      • Mohacsi P.
      • Varadi G.
      • Schwarz A.
      • Herzig S.
      ). In initial experiments Cav1.3b was coexpressed with the β2a or β3 subunit, but in the presence of the β2a subunit only current densities below 1.0 pA/pF were obtained. Therefore we investigated the Cav1.3 subunit in further experiments in the presence of the β3 subunit. The coexpression of β3 with Cav1.3 will also facilitate comparability of our results with those of others (
      • Koschak A.
      • Reimer D.
      • Huber I.
      • Grabner M.
      • Glossmann H.
      • Engel J.
      • Striessnig J.
      ).
      Both isoforms induced L-type barium currents with slow inactivation kinetics in 55% (Cav1.3(1a)) and 16% (Cav1.3(1b)) of transfected HEK 293 cells (Fig. 4, A and B). Some of the untransfected HEK 293 cells (control cells) showed a small rapid inactivating inward current with a current density at 0 mV of 0.64 ± 0.08 pA/pF (n = 3). A similar current could be detected in pcDNA3 vector-transfected cells. The current was not sensitive to the dihydropyridine nisoldipine and disappeared at an HP of –40 mV, suggesting that this endogenous current was not an L-type current. To safely separate cells expressing Cav1.3(1b) from cells only containing endogenous current, only cells showing a slowly inactivating current and a current density above 1.0 pA/pF were considered for analysis. With 5 mm Ba2+ as charge carrier, the current density of CaV1.3(1a)- and CaV1.3(1b)-transfected cells was 11.8 ± 2.0 pA/pF (n = 30) and 1.9 ± 0.24 pA/pF (n = 25), respectively. The I-V curves indicated that the current through the CaV1.3 splice forms activated negative from –40 mV and were maximal between –10 mV and 0 mV (Fig. 4C). This result is in good agreement with the L-type current described in CaV1.2 (–/–) cardiomyocytes (
      • Seisenberger C.
      • Specht V.
      • Welling A.
      • Platzer J.
      • Pfeifer A.
      • Kühbandner S.
      • Striessnig J.
      • Klugbauer N.
      • Feil R.
      • Hofmann F.
      ).
      Figure thumbnail gr4
      Fig. 4Cav1.3 splice variants express functional calcium channels in HEK 293 cells. A and B, representative current traces for CaV1.3(1a) (A) and Cav1.3(1b) (B) to potentials from –60 mV to 60 mV (10 mV increments) from an HP of –80 mV. C, averaged current voltage (I-V) relations (mean ± S.E.; □, Cav1.3(1a), n = 13; ▪, Cav1.3(1b), n = 18; ▵, sustained current of nontransfected cells, n = 3). The HP was –80 mV. D and E, nisoldipine block of I Ba from expressed (D) and native (E) L-type calcium channels. Native channels were measured in primary embryonic cardiomyocytes cultured at day E12.5. Trains of test pulses were from –80 mV to the maximum current at 0.1 or 0.2 Hz. Data points are the mean ± S.E. The data for Cav1.2 (+/+) cardiomyocytes were fitted with a two-exponential Hill-equation, whereas data for Cav1.2 (–/–) cardiomyocytes, Cav1.3(1a) and Cav1.3(1b), were fitted with a simple Hill equation. IC50 values are 0.1 μm for Cav1.3(1a) (□, n = 12); 0.41 μm for Cav1.3(1b) (▪, n = 8); 1.1 μm for Cav1.2 (–/–) (g•, n = 3–8 per point); and 0.1 and 3.9 μm for Cav1.2+/+) (○, n = 3–6 per point).
      I Ba of wild type cardiomyocytes was blocked by nisoldipine with IC50 values of 0.1 and 3.9 μm. In contrast, I Ba currents of CaV1.2 knock-out cells were blocked with an IC50 of 1.1 μm (Fig. 4E). The IC50 values for the nisoldipine block of I Ba induced by the heterologously expressed CaV1.3 splice variants differed from each other, being 0.1 μm (Cav1.3(1a)) and 0.41 μm (Cav1.3(1b)) (Fig. 4D). The latter value is close to that found in CaV1.2 (–/–) cardiomyocytes, suggesting that Cav1.3(1b) channels could be responsible for the L-type like Ca2+ current in CaV1.2 knockout cells.

      DISCUSSION

      In this study, we investigated for the first time the developmental expression levels of all cardiac calcium channel α1 subunits in murine fetal hearts. In agreement with previous electrophysiological data (
      • Protas L.
      • Difrancesco D.
      • Robinson R.B.
      ), we observed an up-regulation of three subunits underlying L-type calcium currents (Cav1.1, Cav1.2, and Cav1.3). Up-regulation of the Cav1.2 subunit was much more pronounced than that of the other two subunits. This finding emphasizes the particular importance of Cav1.2 for heart function, especially during late fetal stages and in the adult heart. In contrast, in early cardiac developmental stages, when the expression levels of Cav1.2 are low, mechanisms that do not necessarily include the Cav1.2 channel may control heart contraction (
      • Yasui K.
      • Liu W.
      • Opthof T.
      • Kada K.
      • Lee J.K.
      • Kamiya K.
      • Kodama I.
      ,
      • Viatchenko-Karpinski S.
      • Fleischmann B.K.
      • Liu Q.
      • Sauer H.
      • Gryshchenko O.
      • Ji G.J.
      • Hescheler J.
      ). Like Cav1.2, the Cav1.1 and Cav1.3 subunits are also significantly up-regulated between days E9.5 and E12.5. In contrast to Cav1.2, the expression levels of the two latter subunits increase only slightly after day E12.5. Taken together, these findings imply that Cav1.1 and Cav1.3 possibly fulfill an unknown role in early heart development that may change at later stages of cardiac development. A function for Cav1.1 has not been reported, but for Cav1.3 it has been shown that this channel is important for the generation of spontaneous action potentials in sino-atrial node cells of the adult heart (
      • Zhang Z.
      • Xu Y.
      • Song H.
      • Rodriguez J.
      • Tuteja D.
      • Namkung Y.
      • Shin H.S.
      • Chiamvimonvat N.
      ,
      • Mangoni M.E.
      • Couette B.
      • Bourinet E.
      • Platzer J.
      • Reimer D.
      • Striessnig J.
      • Nargeot J.
      ).
      The expression levels of the two cardiac T-type calcium channels differ profoundly from each other during heart development. Cav3.2 expression levels were very low. In isolated cardiomyocytes and in heart tissue this subunit could not be detected at day E15.5, suggesting that Cav3.2 does not play a substantial role in adult heart muscle. However, we cannot exclude that Cav3.2 may be expressed only in a subset of heart cells (e.g. cells of the conduction tissue) and, therefore, was not detected in whole heart preparations. The low but clearly measurable expression of Cav3.2 at days E9.5 and E12.5 points to a possible role of this subunit in early heart development. In agreement with previous studies (
      • Bohn G.
      • Moosmang S.
      • Conrad H.
      • Ludwig A.
      • Hofmann F.
      • Klugbauer N.
      ,
      • Cribbs L.L.
      • Martin B.L.
      • Schroder E.A.
      • Keller B.B.
      • Delisle B.P.
      • Satin J.
      ), the Cav3.1 mRNA was consistently detected in the developing heart, indicating that Cav3.1 is the major cardiac T-type calcium channel isoform.
      As we pointed out, mice deficient for Cav1.2 die in utero before day E14.5. The results of this study indicate that the loss of this key subunit increases the mRNA levels of Cav1.3, Cav1.1, and Cav3.1. Although the increase of the latter two subunits is only moderate, the mRNA and the protein levels of the Cav1.3 subunit are profoundly up-regulated. RT-PCR analysis indicated that the increase in Cav1.3 expression is mainly due to the up-regulation of the Cav1.3(1b) isoform of this channel. The electrophysiological and pharmacological properties of the Cav1.3(1b) subunit heterologously expressed in HEK293 cells are in good agreement with that of the residual L-type calcium current found in Cav1.2 (–/–) cardiomyocytes. These results strongly suggest that Ca2+ influx through Cav1.3(1b) is a major entry pathway in Cav1.2 (–/–) cardiomyocytes.
      The functional relevance of Cav1.3 up-regulation is evident. Most likely, the up-regulation of Cav1.3 constitutes a compensatory mechanism of the cell to rescue the loss of Cav1.2 function, strongly suggesting the importance of Cav1.2. However, the compensatory increase in the Cav1.3 subunit is not sufficient to allow development of the embryo beyond day E14. As shown in this report, the Cav1.2 mRNA level increases at this time, presumably because only this channel provides the necessary calcium ions for cardiac contraction. The importance of the cardiac Cav1.2 calcium channel during embryogenesis has also been demonstrated recently by another study showing that the inactivation of the cardiac β2 subunit resulted in an early death at E11.5 (
      • Weisgerber P.
      • Held B.
      • Fleischmann B.
      • Flockerzi V.
      • Freichel M.
      ). It is likely that the early death of the β2 subunit (–/–) mice is caused by an ER-retention of the Cav1.2 and the Cav1.3 subunit, because it was shown that the β2 subunit suppresses an ER-retention signal present in the α1 subunits (
      • Bichet D.
      • Cornet V.
      • Geib S.
      • Carlier E.
      • Volsen S.
      • Hoshi T.
      • Mori Y.
      • De Waard M.
      ).
      The results of this study add to the growing evidence that the different α1 subunits of the high voltage-activated calcium channels can substitute for each other in certain, but not all, functions. Our results indicate that there is a transcriptional cross-talk between the Cav1.2 and Cav1.3 calcium channel genes. A cross-talk between these two calcium channels has also been described in pancreatic β cells of Cav1.3-deficient mice (
      • Namkung Y.
      • Skrypnyk N.
      • Jeong M.J.
      • Lee T.
      • Lee M.S.
      • Kim H.L.
      • Chin H.
      • Suh P.G.
      • Kim S.S.
      • Shin H.S.
      ). Furthermore, a compensatory increase in the expression of calcium channel Cav1.2 subunit mRNA in Purkinje cells of the cerebellum was described in tottering mice (
      • Campbell D.B.
      • Hess E.J.
      ). Tottering mice inherit a recessive mutation of the P/Q-type Cav2.1 subunit. In wild type mice, Cav1.2 mRNA is expressed at extremely low levels in Purkinje cells; but, in tottering mice Cav1.2 mRNA is significantly increased in these cells. The results of these studies support the notion that a compensatory up-regulation of the calcium channel mRNA levels occurs only in specific cell types. Clearly, future studies will be necessary to verify the above hypothesis and to pinpoint the mechanism by which the mutual control of Cav 1.2, Cav 1.3, and other Cav genes is organized.

      References

        • Hofmann F.
        • Lacinova L.
        • Klugbauer N.
        Rev. Physiol. Biochem. Pharmacol. 1999; 139: 33-86
        • Larsen J.K.
        • Mitchell J.W.
        • Best P.W.
        J. Mol. Cell. Cardiol. 2002; 34: 519-532
        • Ertel E.A.
        • Campbell K.P.
        • Harpold M.M.
        • Hofmann F.
        • Mori Y.
        • Perez-Reyes E.
        • Schwartz A.
        • Snutch T.P.
        • Tanabe T.
        • Birnbaumer L.
        • Tsien R.W.
        • Catterall W.A.
        Neuron. 2000; 25: 533-535
        • Mikami A.
        • Imoto K.
        • Tanabe T.
        • Niidome T.
        • Mori Y.
        • Takeshima H.
        • Narumiya S.
        • Numa S.
        Nature. 1989; 340: 230-233
        • Seisenberger C.
        • Specht V.
        • Welling A.
        • Platzer J.
        • Pfeifer A.
        • Kühbandner S.
        • Striessnig J.
        • Klugbauer N.
        • Feil R.
        • Hofmann F.
        J. Biol. Chem. 2000; 275: 39193-39199
        • Bohn G.
        • Moosmang S.
        • Conrad H.
        • Ludwig A.
        • Hofmann F.
        • Klugbauer N.
        FEBS Lett. 2000; 481: 73-76
        • Lipscombe D.
        Circ. Res. 2002; 90: 933-935
        • Platzer J.
        • Engel J.
        • Schrott-Fischer A.
        • Stephan K.
        • Bova S.
        • Chen H.
        • Zheng H.
        • Striessnig J.
        Cell. 2000; 102: 89-97
        • Kim D.
        • Song I.
        • Keum S.
        • Lee T.
        • Jeong M.J.
        • Kim S.S.
        • McEnery M.W.
        • Shin H.S.
        Neuron. 2001; 31: 35-45
        • Zhang Z.
        • Xu Y.
        • Song H.
        • Rodriguez J.
        • Tuteja D.
        • Namkung Y.
        • Shin H.S.
        • Chiamvimonvat N.
        Circ. Res. 2002; 90: 981-987
        • Mangoni M.E.
        • Couette B.
        • Bourinet E.
        • Platzer J.
        • Reimer D.
        • Striessnig J.
        • Nargeot J.
        Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 5543-5548
        • Ferron L.
        • Capuano V.
        • Deroubaix E.
        • Coulombe A.
        • Renaud J.-F.
        J. Mol. Cell. Cardiol. 2002; 34: 533-546
        • Cribbs L.L.
        • Martin B.L.
        • Schroder E.A.
        • Keller B.B.
        • Delisle B.P.
        • Satin J.
        Circ. Res. 2001; 88: 403-407
        • Biel M.
        • Schneider A.
        • Wahl C.
        Trends Cardiovasc. Med. 2002; 12: 206-213
        • Huang B.
        • Qin D.
        • Deng L.
        • Boutjdir M.
        • El-Sherif N.
        Cardiovasc. Res. 2000; 46: 442-449
        • Nattel S.
        Circ. Res. 1999; 85: 473-476
        • An R.H.
        • Davies M.P.
        • Doevendans P.A.
        • Kubalak S.W.
        • Bangalore R.
        • Chien K.R.
        • Kass R.S.
        Circ. Res. 1996; 78: 371-378
        • Davies M.P.
        • An R.H.
        • Doevendans P.
        • Kubalak S.
        • Chien K.R.
        • Kass R.S.
        Circ. Res. 1996; 78: 15-25
        • Liu W.
        • Yasui K.
        • Arai A.
        • Kamiya K.
        • Cheng J.
        • Kodma I.
        • Toyama J.
        Am. J. Physiol. 1999; 276: H608-H613
        • Weisgerber P.
        • Held B.
        • Fleischmann B.
        • Flockerzi V.
        • Freichel M.
        Naunyn-Schmiedeberg's Arch. Pharmacol. 2003; 367: R92
        • Klugbauer N.
        • Welling A.
        • Specht V.
        • Seisenberger C.
        • Hofmann F.
        Eur. J. Pharmacol. 2002; 447: 279-284
        • Passier R.
        • Richardson J.A.
        • Olson E.N.
        Mech. Develop. 2000; 92: 277-284
        • Takimoto K.
        • Li D.
        • Nerbonne J.M.
        • Levitan E.S.
        J. Mol. Cell. Cardiol. 1997; 29: 3035-3042
        • Ménard C.
        • Pupier S.
        • Mornet D.
        • Kitzmann M.
        • Nargeot J.
        • Lory P.
        J. Biol. Chem. 1999; 274: 29063-29070
        • Hullin R.
        • Khan I.F.Y.
        • Wirtz S.
        • Mohacsi P.
        • Varadi G.
        • Schwarz A.
        • Herzig S.
        J. Biol. Chem. 2003; 278: 21623-21630
        • Koschak A.
        • Reimer D.
        • Huber I.
        • Grabner M.
        • Glossmann H.
        • Engel J.
        • Striessnig J.
        J. Biol. Chem. 2001; 276: 22100-22106
        • Protas L.
        • Difrancesco D.
        • Robinson R.B.
        Am. J. Physiol. 2001; 281: H1252-H1259
        • Yasui K.
        • Liu W.
        • Opthof T.
        • Kada K.
        • Lee J.K.
        • Kamiya K.
        • Kodama I.
        Circ. Res. 2001; 88: 536-542
        • Viatchenko-Karpinski S.
        • Fleischmann B.K.
        • Liu Q.
        • Sauer H.
        • Gryshchenko O.
        • Ji G.J.
        • Hescheler J.
        Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8259-8264
        • Bichet D.
        • Cornet V.
        • Geib S.
        • Carlier E.
        • Volsen S.
        • Hoshi T.
        • Mori Y.
        • De Waard M.
        Neuron. 2000; 25: 177-190
        • Namkung Y.
        • Skrypnyk N.
        • Jeong M.J.
        • Lee T.
        • Lee M.S.
        • Kim H.L.
        • Chin H.
        • Suh P.G.
        • Kim S.S.
        • Shin H.S.
        J. Clin. Invest. 2001; 108: 1015-1022
        • Campbell D.B.
        • Hess E.J.
        Mol. Pharmacol. 1999; 55: 23-31