If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Department of Pediatrics and Department of Biochemistry and Biophysics, The Children's Hospital of Philadelphia, University of Pennsylvania, Philadelphia, Pennsylvania 19104
Department of Pediatrics and Department of Biochemistry and Biophysics, The Children's Hospital of Philadelphia, University of Pennsylvania, Philadelphia, Pennsylvania 19104
To whom correspondence should be addressed: University of Alabama at Birmingham, Dept. of Biochemistry and Molecular Genetics, 502 Kaul Genetics Bldg., 720 20th St. South, Birmingham, AL 35294. Tel.: 205-934-5294; Fax: 205-934-2889;
* This work was supported in part by National Institutes of Health Grants HL 57619, HL 43508, HL 35559, and HL 38632 and by a grant from the Mizuno Fund. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. § These authors contributed equally to this work. ¶ Supported by National Institutes of Health Predoctoral Fellowship Training Grant 5 T32 CA09467. ** Current address: Thomas Jefferson University, Philadelphia, PA 19104. ‡‡ Current address: Northwest Georgia Oncology Centers, P.C., 55 Whitcher St., Ste. 300, Marietta, GA 30060.
A new recombinant, human anti-sickling β-globin polypeptide designated βAS3 (βGly16 → Asp/βGlu22 → Ala/βThr87 → Gln) was designed to increase affinity for α-globin. The amino acid substitutions at β22 and β87 are located at axial and lateral contacts of the sickle hemoglobin (HbS) polymers and strongly inhibit deoxy-HbS polymerization. The β16 substitution confers the recombinant β-globin subunit (βAS3) with a competitive advantage over βS for interaction with the α-globin polypeptide. Transgenic mouse lines that synthesize high levels of HbAS3 (α2βAS32) were established, and recombinant HbAS3 was purified from hemolysates and then characterized. HbAS3 binds oxygen cooperatively and has an oxygen affinity that is comparable with fetal hemoglobin. Delay time experiments demonstrate that HbAS3 is a potent inhibitor of HbS polymerization. Subunit competition studies confirm that βAS3 has a distinct advantage over βS for dimerization with α-globin. When equal amounts of βS- and βAS3-globin monomers compete for limiting α-globin chains up to 82% of the tetramers formed is HbAS3. Knock-out transgenic mice that express exclusively human HbAS3 were produced. When these mice were bred with knock-out transgenic sickle mice the βAS3 polypeptides corrected all hematological parameters and organ pathology associated with the disease. Expression of βAS3-globin should effectively lower the concentration of HbS in erythrocytes of patients with sickle cell disease, especially in the 30% percent of these individuals who coinherit α-thalassemia. Therefore, constructs expressing the βAS3-globin gene may be suitable for future clinical trials for sickle cell disease.
The abbreviations used are: SCD, sickle cell disease; LCR, locus control region; HPLC, high performance liquid chromatography; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol.
1The abbreviations used are: SCD, sickle cell disease; LCR, locus control region; HPLC, high performance liquid chromatography; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol.
results from an A to T transversion at the sixth codon of the human β-globin gene on chromosome 11 (
). The mutation of a single DNA base leads to the substitution of a valine for a glutamic acid in the β-globin polypeptide of sickle hemoglobin (HbS). The positioning of a hydrophobic residue at this position permits an interaction with a hydrophobic pocket on another hemoglobin tetramer (see Fig. 1). This interaction allows deoxy-HbS to polymerize in an entropy-driven process (
). The polymerization of deoxy-HbS leads to erythrocyte deformation from a biconcave morphology into the sickle shapes for which SCD is named.
Fig. 1Structure of human HbS fibers. Two types of contacts occur between deoxy-HbS tetramers in the double-stranded fibers. Contacts along the long axis of the fiber are termed axial contacts, whereas contacts along the sides of tetramers are termed lateral contacts. The β6 valine plays a crucial role in the lateral contact by interacting with the hydrophobic β85 phenylalanine and β88 leucine on a neighboring tetramer. An important axial contact is the interaction of the β22 glutamic acid with an α20 histidine on an adjacent tetramer. The recombinant hemoglobin HbAS3 contains amino acid changes at positions 16, 22, and 87 of the β-globin chain. The modification at β16, glycine to aspartic acid, is known as HbJ-Baltimore and provides HbAS3 with an enhanced ability to interact with the α-globin subunit to form αβAS3 dimers. The amino acid modification at β22, glutamic acid to alanine, disrupts the axial contact interaction with the α20 histidine, and the mutation at β87, threonine to glutamine, disrupts the lateral contact of the β6 with the hydrophobic pocket.
Polymerization of deoxy-HbS is effectively inhibited by fetal hemoglobin (HbF), and individuals who are homozygous for the sickle mutation but also express high levels of HbF are typically asymptomatic (
). The level of HbF necessary to significantly reduce the symptoms of SCD ranges from about 20 to 25%; however, data showing an enhanced red cell survival with as little as 9% HbF have been reported (
). The efficacy of HbF in inhibiting HbS polymerization suggests that transduction of fetal globin genes into hematopoietic stem cells might be an effective strategy for sickle cell disease gene therapy. However, high levels of γ-globin gene expression are difficult to achieve in adult erythroid cells even in the absence of competition with the β-globin gene for locus control region (LCR) interactions (
). Low level expression of the γ-globin gene apparently results from the absence of fetal-specific positive regulatory factors in adult cells. Our approach to overcome this deficiency has been to utilize the β-globin gene as a backbone and to introduce γ-globin amino acid substitutions into this construct. We demonstrated previously that a β-globin gene containing alanine at position 22 and glutamine at position 87 (βAS2) significantly inhibited HbS polymerization (
). We have now introduced an additional modification into βAS2 to form βAS3; this modification increases the affinity of β-globin subunits for α-globin polypeptides. In this paper we demonstrate that βAS3 has a competitive advantage over βS polypeptides for interaction with limiting α-globin subunits and that HbAS3 dramatically inhibits deoxy-HbS polymerization.
MATERIALS AND METHODS
Construction and Microinjection of Anti-sickling β-Globin Genes— Plasmids were constructed by standard procedures (
). The mutagenic oligonucleotides were as follows: β16, CTGCCCTGTGGGACAAGGTGAACGTG; β22, GTGAACGTGGATGCCGTTGGTGGTGAG; β87, GGCACCTTTGCCCAGCTGAGTGAGCTG.
Fragment preparation and microinjection were as described previously (
). Transgenic animals expressing high levels of human hemoglobin were identified by isoelectric focusing of hemolysates. Isoelectric focusing was performed using the Isothermal Controlled Electrophoresis system (Fisher) with precast agarose isoelectric focusing gels (Isolab, Akron, OH).
Analysis and Purification of Recombinant Human Hemoglobins— Initial analysis of hemoglobin tetramers was performed by anion exchange high performance liquid chromatography (HPLC) utilizing a Synchropak AN 300 (4.6 × 25 mm) column (MICRA Scientific, Northbrook, IL) (
). Preparative isoelectric focusing was performed on 4% acrylamide gels with 2% Pharmalyte (Amersham Biosciences AB, Uppsala, Sweden) (pH 6.7–7.7). Bands of hemoglobin were sliced from the gel and eluted in 0.1 m potassium phosphate buffer, (pH 7.0) (
). Mouse and human globins were separated by reverse-phase HPLC using a Series 4500i HPLC system (Dionex, Sunnyvale, CA). Approximately 25–30 μg of hemoglobin was injected into a C4 reverse-phase (4.6 × 250 mm) column (Vydac, Hesperia, CA) and eluted with a linear gradient of acetonitrile and 0.3% trifluroacetic acid (
Functional Analysis of Recombinant Human Hemoglobins—Oxygen equilibrium curves were measured with a Hemox Analyzer (TCS Scientific, New Hope, PA) as described (
). The oxygen equilibrium curves were determined in 0.1 m potassium phosphate buffer (pH 7.0) at 20 °C with a hemoglobin concentration of 25 μm. Polymerization kinetics were determined in 1.8 m potassium phosphate buffer as described (
). Polymerization was initiated using the temperature jump method in which the temperature of deoxygenated hemoglobin solutions is rapidly changed from 0 to 30 °C, and aggregation is monitored turbidimetrically at 700 nm (
). The hemolysates were treated with carbon monoxide prior to separation to reduce formation of methemoglobin. Isolated α- and β-globin monomers were allowed to combine at 0 °C for 1 h. The amounts of HbS and HbAS3 formed were determined by HPLC using a PolyCAT A cation exchange column (PolyLC, Columbia, MD). Hemoglobins were eluted from the column with a linear gradient of Buffer A (35 mm BisTris, 1.5 mm KCN, 3 mm ammonium acetate, (pH 6.47)) and Buffer B (35 mm BisTris, 1.5 mm KCN, 16.85 mm ammonium acetate, 150 mm sodium acetate, (pH 7.0)) (
). The flow rate was 1 ml/min with detection at 415 nm. The relative amounts of each hemoglobin were calculated by integration of the area under each peak.
Analysis of Heterotetramer Formation—Equimolar amounts of purified oxygenated HbS and HbAS3 or HbA were mixed and allowed to equilibrate overnight at 0 °C as described previously (
). The mixtures were analyzed by cation exchange chromatography as described above with the addition of 3 mm sodium dithionite to the elution buffers. Sodium dithionite was added to allow separation of hemoglobins under anaerobic conditions, which was necessary for detection of heterotetramers.
Production of HbAS3, Knock-out Transgenic Sickle Mice—Mice that express HbAS3 exclusively were produced by breeding the HbAS3 mice with mouse α- and β-globin gene knock-out animals (
) to obtain mice that were homozygous for mouse α- and β-globin gene knock-outs and contained the human LCR α, LCR γ-βS, and LCR βAS3 transgenes. These animals expressed approximately equal amounts of HbAS3 and HbS.
Hematological Indices and Histopathology—Blood was collected from anesthetized animals into Microtainer EDTA collection tubes. The red blood cell count was measured on a HemaVet 1500 hematology analyzer. Hemoglobin concentration was determined spectrophotometrically after conversion to cyanmethemoglobin with Drabkin's reagent. Before determining the hemoglobin concentration, red cell membranes were formed into pellets at 14,000 rpm for 5 min in an Eppendorf centrifuge. Removal of the membranes inhibits artifactually high values caused by membrane-bound, denatured hemoglobin. Hematocrit was measured with a JorVet J503 microhematocrit centrifuge. Reticulocyte count was determined by flow cytometry after staining with thiazole orange. Urine osmolality was measured after food and water were withheld from the mice for 4 h. Tissues were fixed in 70% alcoholic formalin, embedded in paraffin, sectioned, and stained with hematoxylin-eosin or Gomori's iron stain by standard methods.
RESULTS AND DISCUSSION
Production of Recombinant Human Hemoglobin in Transgenic Mice—Fig. 1 illustrates the major contacts present in the HbS polymer. We reported previously amino acid substitutions (βGly22 → Asp and βThr87 → Gln) that inhibit HbS polymerization (
). To provide the modified β-globin polypeptide with a competitive advantage for interacting with α-globin chains, we made an additional amino acid substitution (βGly16 → Asp). Codon changes were introduced into the human β-globin gene by site-directed mutagenesis, and the modified sequences were inserted downstream of a 22-kb DNA fragment containing the DNase hypersensitive sites 1–5(5′-HS 1–5) of the β-globin LCR (
). These constructs were injected into fertilized mouse eggs, and transgenic lines were established. Hemolysates obtained from several animals were analyzed by HPLC to quantitate the amounts of human, mouse, and hybrid hemoglobins (
Functional Analysis of Recombinant Human Hemoglobins— The oxygen equilibrium curve for purified HbAS3 is sigmoidal (data not shown), demonstrating that oxygen binding is cooperative. The P50 value (partial pressure of oxygen at which hemoglobin is half-saturated) was determined for HbAS3 and compared with HbA and HbF (Table I). The P50 for stripped HbAS3 is 7.2 mm Hg and is increased to 10.3 mm Hg in the presence of 2 mm bisphosphoglycerate. Although stripped HbAS3 has a higher oxygen affinity than HbA or HbF, its affinity in the presence of bisphosphoglycerate is similar to that of HbF. In a physiologic environment, HbAS3 should be indistinguishable from HbF, which is a protein that is known to function in vivo to provide protection against sickling crises.
Table IP50 values of recombinant and naturally occurring human hemoglobins
Inhibition of HbS Polymerization by Recombinant Human Hemoglobins—The ability of HbAS3 to inhibit deoxy-HbS polymerization was analyzed by delay time measurements (
). Briefly, HbS (100%) or mixtures of HbS (75%) and HbF or HbAS3 (25%) were deoxygenated, and polymerization as a function of time was measured spectrophotometrically (
). Fig. 2A demonstrates that HbS polymerizes rapidly but that HbF and HbAS3 markedly delay HbS polymerization. HbAS3 inhibits HbS polymerization at approximately the same level as HbF, which is known to inhibit sickling in vivo at a 3:1 ratio (
). This finding strongly suggests that HbAS3 would inhibit HbS polymerization in vivo if HbAS3 levels constituted 25% of total hemoglobin.
Fig. 2Polymerization delay times for deoxygenated mixtures of human hemoglobins.A, delay times for hemoglobin solutions containing 100% HbS or 75% HbS plus 25% HbAS3. Curves were determined at a concentration of 60 mg/dl using the temperature jump method. The delay time measures the efficacy of the modified hemoglobin to inhibit polymerization of HbS. B, delay time versus hemoglobin concentration. Hemoglobin concentration ranged from 30 to 125 mg/dl. The progression of the plots from left to right demonstrates the increased hemoglobin concentrations that are required for polymerization to occur in the presence of either HbF or the recombinant anti-sickling HbAS3.
The delay times determined in Fig. 2A were all measured at a concentration of 60 mg/dl. Fig. 2B illustrates the results of similar experiments performed using different concentrations of total hemoglobin. The ratio of HbS to HbF or HbAS3 in these experiments was 3:1. In this figure the log of the reciprocal of the delay time and the log of hemoglobin concentration are plotted. As reported by Hofrichter et al. (
), an empirical relationship between delay time and hemoglobin concentration is described by the equation 1/td = γSn, where S = [Hb]total/[Hb]soluble and γ is an experimental constant. The n value is related to the size of nuclei formed during polymerization. The n values of the data shown in Fig. 2B are between 2 and 3, which agree well with those shown previously in high phosphate buffer (
). The delay time plots for mixtures of HbS with HbF and HbS with HbAS3 overlap, indicating that HbAS3 has an ability to inhibit HbS polymerization that equals that of HbF.
Competition for Dimerization with the α-Globin Subunit— Previous work demonstrated that two mutations were sufficient to provide the β-globin subunit with a significant ability to inhibit the polymerization of sickle hemoglobin (
). The anti-sickling HbAS2 described in that work was the starting point for the improved anti-sickling hemoglobin, which we have termed AS3. HbAS3 combines the mutations at position 22 and 87 of AS2 with a third mutation at position 16, which is known as HbJ-Baltimore (
). Mutations that increase the net negative charge on the β-subunit increase its ability to dimerize with the α-subunit. Similarly, mutations that decrease the negative charge on the β-subunit decrease its ability to dimerize with the α-subunit. The βS-subunit is particularly vulnerable to competition with a more negatively charged β-subunit because the sickle mutation, glutamic acid to valine, reduces the negative charge on the βS-chain. For this reason, erythrocytes in individuals with sickle trait do not contain 50% HbS and 50% HbA but contain ∼42–45% HbS (
). Competition for the α-subunit, therefore, appears to be a potential method to increase the amount of anti-sickling hemoglobin in an erythrocyte at the expense of sickle hemoglobin.
The addition of the HbJ-Baltimore mutation causes the net charge on βAS3 to equal that of βA; the addition of an aspartic acid at β16 compensates for the loss of a glutamic acid at β22. Based strictly upon charge, βAS3 should have a competitive advantage over βS for dimerization with the α-subunit. When α-, βS-, and βAS3-globin subunits are combined at an α-globin: β-globin ratio of 1:1, HbAS3 comprises 59.5% of total hemoglobin. As the α-globin subunit becomes limiting, the proportion of HbAS3 increases dramatically, reaching a level of 75.1% of total hemoglobin at an α-globin:β-globin ratio of 0.5:1 and 82% of total hemoglobin at a ratio of 0.1:1. These results demonstrate that β-subunits with the HbJ-Baltimore mutation have a significant competitive advantage over βS-polypeptides for interaction with α-subunits. The βAS3-subunit interacts with the α-subunit even more efficiently than would be expected on the basis of charge alone. Apparently, the specific combination of negative residues in βAS3-subunits improves the ability of this polypeptide to interact with α-globin chains.
Additionally, a recombinant therapeutic hemoglobin must be able to form heterotetramers with deoxy-HbS to achieve effective inhibition of polymerization. Earlier studies have shown that the inhibitory effect of HbF on the polymerization of deoxy-HbS is dependent on the formation of heterotetramers (α2βSγ) (
). Unlike the α2βAβS heterotetramer, the α2βSγ and αβSδ heterotetramers are excluded from the sickle polymer, which accounts for the increased inhibitory effects of HbF and HbA2 relative to HbA. To determine whether recombinant HbAS3 could form heterotetramers (a2βSβAS3), we mixed oxygenated HbAS3 with oxygenated HbS. At equilibrium, a binomial (1:2:1) distribution of parent hemoglobins and heterotetramers is observed (Fig. 3). Similar results were obtained for oxygenated mixtures of HbA and HbS.
Fig. 3Heterotetramer formation. Oxygenated forms of purified HbS and HbAS3 or HbA were mixed and allowed to equilibrate overnight at 0 °C. The hemoglobin mixtures were separated by cationic exchange chromatography under anaerobic conditions, which allows detection of hybrid heterotetramers. The ratio of peak areas for HbAS3 (or HbA):heterotetramer:HbS was 1:2:1.
Correction of Abnormal Red Blood Cell Morphology and Hematological Parameters in Knock-out Transgenic Sickle/AS3 Mice—To determine whether HbAS3 would inhibit HbS polymerization in vivo, we bred mice that express HbAS3 with our knock-out transgenic sickle mice and obtained animals that were homozygous for mouse α- and β-globin gene knock-outs and contained the human LCR α, LCR γ-βS, and LCR βAS3 transgenes. Blood smears from sickle control and sickle/AS3 animals are illustrated in Fig. 4. Many sickled cells are observed in the sickle control; however, no sickled cells are observed in sickle/AS3 mice (two representative animals). The upper left panel is a wild-type control. The blood smears of sickle/AS3 animals also lack the anisocytosis, poikilocytosis, and polychromasia that are characteristic of erythrocyte morphology observed in SCD mice and HbS patients (
). Fig. 5 compares hematological indices of control, sickle, and sickle/AS3 mice. In sickle/AS3 animals, red blood cell counts are nearly doubled, hemoglobin levels are increased by 6 g/dl, hematocrit is normalized, and reticulocytosis is reduced to levels approaching those of wild-type mice. Sickled erythrocytes are not observed in blood smears or in tissues of sickle/AS3 mice. These data demonstrate that HbAS3 is a potent anti-sickling hemoglobin in vivo.
Fig. 4Correction of abnormal red blood cell morphology in sickle/AS3 mice. Shown is a blood smear of a sickle animal with characteristic sickled erythrocytes, anisopoikilocytosis, and a pronounced reticulocytosis (S). Two representative sickle/AS3 animals are shown (S/A #1 and S/A #2). No sickled cells were observed in any fields examined. WT, wild-type C57Bl6 control.
Fig. 5Hematological parameters of sickle/AS3 corrected mice. Shown are hematological indices of control (n = 5), sickle (n = 5), and sickle/AS3 (n = 5) mice. Red blood cell (RBC) counts of sickle/AS3 mice are nearly doubled, hemoglobin levels are increased by 6 g/dl, hematocrit is normalized, and reticulocytosis is reduced to levels approaching those of wild-type mice.
Amelioration of Spleen, Liver, and Kidney Pathology and Restoration of Kidney Function in Sickle/AS3 Mice—Histological sections of wild-type, sickle, and sickle/AS3 animals are shown in Fig. 6A. The spleens of sickle mice are characterized by a massive expansion of red pulp, dramatic pooling of sinusoidal erythrocytes, vaso-occlusion, and a complete loss of lymphoid follicular structure. In sickle/AS3 mice, normal splenic red and white pulp is observed, and virtually no pools of sickle erythrocytes or infarcts are evident. In addition, splenomegaly is substantially diminished in sickle/AS3 mice (Fig. 6C); sickle/AS3 spleens are ∼0.6% of total body weight compared with sickle spleens that are almost 4% of body weight.
Fig. 6Normalization of spleen, liver, and kidney pathology in sickle/AS3 mice.A, spleen, liver, and kidney sections were analyzed at high magnification (×100), and kidney was examined at low (×10, bottom three panels) magnification. In sickle/AS3 mice, normal splenic red and white pulp is observed, and no pools of sickle erythrocytes or infarcts are evident. In livers of sickle/AS3 animals, focal areas of necrosis and aggregation of sickled erythrocytes are not observed; also, extramedullary hematopoiesis and hemosiderin deposition are absent. Kidneys of sickle/AS3 mice appear normal and free of the disruptive vascular red blood cell pooling and hemosiderin deposits observed in mock treated animals. B, urine concentrating ability is restored to wild-type levels in sickle/AS3 animals. n = 5 for wild-type, sickle, and sickle/AS3, respectively. C, correction of splenomegaly in sickle/AS3 mice. n = 5 for wild-type, sickle, and sickle/AS3.
Livers of sickle animals are characterized by focal areas of necrosis and pronounced congestion of the intrahepatic vasculature with pooling of sickled red blood cells. Large aggregates of erythroid progenitors are evident in the sinusoids, and this extramedullary hematopoiesis is indicative of severe anemia. There is also abundant hemosiderin deposition subsequent to Kupffer cell erythrophagocytosis. In sickle/AS3 animals, focal areas of necrosis and aggregation of sickled erythrocytes are not observed; also, extramedullary hematopoiesis and hemosiderin deposition are absent.
In the kidneys of mock transduced mice, engorgement and occlusion of blood vessels results in vascular, tubular, and glomerular changes. Sequestration and occlusion are most obvious at the corticomedullary junction where dilated capillaries are easily observed in this region of reduced oxygen tension. Reduced medullary blood flow in HbS patients causes extensive tubular damage that results in hyposthenuria, and this same loss of urine-concentrating ability is observed in the sickle mice. Kidneys of sickle animals also accumulate abundant hemosiderin in the cortical region, and these aggregates are easily visualized with Gomori's iron staining (data not shown). In contrast, kidneys of sickle/AS3 mice appear normal and free of the disruptive vascular red blood cell pooling and hemosiderin deposits observed in mock treated animals. Most importantly, urine-concentrating ability is completely restored in sickle/AS3 mice (Fig. 6B).
Expression of βAS3-globin should effectively lower the concentration of HbS in erythrocytes of patients with SCD, especially in the 30% of these individuals who coinherit α-thalassemia (
). We recently corrected our knock-out transgenic mouse model of SCD using lentiviral transduction of the βAS3 anti-sickling gene into purified hematopoietic stem cells (
). These results suggest that stem cell- and genetics-based therapies using recombinant βAS3-globin may be able to be translated to human sickle patients.
Acknowledgments
We thank members of the Townes laboratory for helpful discussions.
85415-5&id=gr1.jpg){kind=link}
85415-5&id=gr2.jpg){kind=link}
85415-5&id=gr3.jpg){kind=link}
85415-5&id=gr4.jpg){kind=link}
85415-5&id=gr5.jpg){kind=link}
85415-5&id=gr6.jpg){kind=link}