Advertisement

A Sulforaphane Analogue That Potently Activates the Nrf2-dependent Detoxification Pathway*

Open AccessPublished:November 12, 2001DOI:https://doi.org/10.1074/jbc.M110244200
      Exposure of cells to a wide variety of chemoprotective compounds confers resistance to a broad set of carcinogens. For a subset of the chemoprotective compounds, protection is generated by an increase in the abundance of the protective phase II detoxification enzymes, such as glutathione S-transferase (GST). We have recently developed a cell culture system, using rat liver epithelial RL 34 cells, that potently responds to the phenolic antioxidants resulting in the induction of GST activity (Kawamoto, Y., Nakamura, Y., Naito, Y., Torii, Y., Kumagai, T., Osawa, T., Ohigashi, H., Satoh, K., Imagawa, M., and Uchida, K. (2000) J. Biol. Chem. 275, 11291–11299.) In the present study, we investigated the phase II-inducing potency of an isothiocyanate compound in vitro and in vivo and examined a possible induction mechanism. Based on an extensive screening of vegetable extracts for GST inducer activity in RL34 cells, we found Japanese horseradish, wasabi (Wasabia japonica, syn. Eutrema wasabi), as the richest source and identified 6-methylsulfinylhexyl isothiocyanate (6-HITC), an analogue of sulforaphane (4-methylsulfinylbutyl isothiocyanate) isolated from broccoli, as the major GST inducer in wasabi. 6-HITC potently induced both class α GSTA1 and class π GSTP1 isozymes in RL34 cells. In animal experiments, we found that 6-MSHI was rapidly absorbed into the body and induced hepatic phase II detoxification enzymes more potently than sulforaphane. The observations that (i) 6-HITC activated the antioxidant response element (ARE), (ii) 6-HITC induced nuclear localization of the transcription factor Nrf2 that binds to ARE, and (iii) the induction of phase II enzyme genes by 6-HITC was completely abrogated in the nrf2-deficient mice, suggest that 6-HITC is a potential activator of the Nrf2/ARE-dependent detoxification pathway.
      GST
      glutathioneS-transferase
      6-HITC
      6-methylsulfinylhexyl isothiocyanate
      HPLC
      high-performance liquid chromatography
      MS
      mass spectrometry
      TMS
      tetramethylsilane
      PBS
      phosphate-buffered saline
      γ-GCS
      γ-glutamylcysteine synthetase
      ARE
      antioxidant response element
      NQO1
      quinone reductase (NAD(P)H:(quinone-acceptor) oxidoreductase 1, EC 1.6.99.2)
      Xenobiotic metabolizing enzymes play a major role in regulating the toxic, oxidative damaging, mutagenic, and neoplastic effects of chemical carcinogens. Mounting evidence has indicated that the induction of phase II detoxification enzymes, such as glutathioneS-transferases (GSTs),1 results in protection against toxicity and chemical carcinogenesis, especially during the initiation phase. The GSTs are a family of enzymes that catalyze the nucleophilic addition of the thiol of reduced glutathione (GSH) to a variety of electrophiles (for a review, see Ref.
      • Hayes J.D.
      • Pulford D.J.
      ). In addition, the GSTs bind with varying affinities to a variety of aromatic hydrophobic compounds. It is now generally accepted that the GSTs are encoded by at least five different gene families. Four (Classes α, μ, π, and θ) of the gene families encode the cytosolic GSTs, whereas the fifth encodes a microsomal form of the enzyme. It has been shown that the induction of GST is associated with the reduced incidence and multiplicity of tumors (
      • Wattenberg L.W.
      ,
      • Wattenberg L.W.
      ). Recently, two transgenic rodent studies clearly demonstrated that one of the GST isozymes can profoundly alter the susceptibility to chemical carcinogenesis in mouse skin (
      • Henderson C.J.
      • Smith A.G.
      • Ure J.
      • Brown K.
      • Bacon E.J.
      • Wolf C.R.
      ) and rat liver (
      • Nakae D.
      • Denda A.
      • Kobayashi Y.
      • Akai H.
      • Kishida H.
      • Tsujiuchi T.
      • Konishi Y.
      • Suzuki T.
      • Muramatsu M.
      ). Thus, the induction of GSTs is regarded as one of the most important determinants in cancer susceptibility and that its elevated synthesis is required to prevent toxic compounds from accumulating in the cells. The induction of phase II enzymes, such as GSTs, is reported to be evoked by an extraordinary variety of chemical agents, including Michael reaction acceptors, diphenols, quinones, isothiocyanates, peroxides, vicinal dimercaptans, and others (
      • Prestera T.
      • Holtzclaw W.D.
      • Zhang Y.
      • Talalay P.
      ,
      • De Talalay P.
      • Long M.J.
      • Prochaska H.J.
      ,
      • Spencer S.R.
      • Xue L.
      • Klenz E.M.
      • Talalay P.
      ). With few exceptions, these agents are electrophiles, and accordingly, many of these inducers are substrates for phase II detoxification enzymes.
      Epidemiologic studies have found that persons who consume a high proportion of green and yellow vegetables in their diet have a decreased risk of developing some types of cancer (
      • Colditz G.A.
      • Branch L.G.
      • Lipinick R.J.
      • Willett W.C.
      • Rosner B.
      • Posner B.M.
      • Hennekens C.H.
      ,
      • Graham S.
      ). Subsequent laboratory work has led to the isolation of various phase II inducers from fruits and vegetables that reduce the incidence of experimental carcinogenesis in animal models. Among them are included β-carotene from a variety of vegetables and fruits (
      • Peto R.
      • Doll R.
      • Buckley J.D.
      • Sporn M.B.
      ) and the monoterpenesd-limonene and d-carvone from various food plants including Citrus species (
      • Wattenberg L.W.
      • Sparnins V.L.
      • Barany G.
      ). Later, as an approach for the detection of novel phase II inducing cancer chemoprotective agents, Talalay and his colleagues developed an in vitro assay system using cultured Hepa 1c1c7 murine hepatoma cells (
      • Prochaska H.J.
      • Santamaria A.B.
      • Talalay P.
      ). They then used this assay to demonstrate that Brassica vegetables are particularly rich sources of phase II inducers and to identify sulforaphane (4-methylsulfinylbutyl isothiocyanate) as the principal phase II inducer in broccoli extracts (
      • Zhang Y.
      • Talalay P.
      • Cho C.-G.
      • Posner G.H.
      ). They also have demonstrated that sulforaphane is a dose-related inhibitor of carcinogen-induced mammary tumorigenesis in rats (
      • Zhang Y.
      • Kensler T.W.
      • Cho C.-G.
      • Posner G.H.
      • Talalay P.
      ).
      We have recently developed a cell culture system, using rat liver epithelial RL34 cells, that potently responds to the already-known phase II inducers, such as phenolic antioxidants and α, β-unsaturated aldehydes, resulting in the induction of the GST activity (
      • Kawamoto Y.
      • Nakamura Y.
      • Naito Y.
      • Torii Y.
      • Kumagai T.
      • Osawa T.
      • Ohigashi H.
      • Satoh K.
      • Imagawa M.
      • Uchida K.
      ). In the present study, using the RL34 cells, we determined the GST induction potencies of food plants and found that the wasabi extracts induce GST activity with great potency. We provided an analysis of the wasabi extracts that demonstrate an isothiocyanate compound as a principal inducer of phase II enzymes. Moreover, we have investigated the phase II inducing potency of this compound in vitro and in vivo and examined a possible induction mechanism.

      EXPERIMENTAL PROCEDURES

      Materials

      Authentic 6-methylsulfinylhexyl isothiocyanate (6-HITC) and sulforaphane were synthesized by the oxidation of 6-methylthiohexyl isothiocyanate and 4-methylthiobutyl isothiocyanate (kind gifts of Kinjirushi Wasabi, Co., Ltd., Nagoya, Japan), respectively. The 6-HITC-related compounds were synthesized in our laboratory. All other chemicals were purchased from Wako Pure Chemical Industries (Osaka, Japan). Wasabi (Wasabia japonica, syn. Eutrema wasabi) cultivated in Shizuoka, Japan, was also obtained from Kinjirushi Wasabi Co., Ltd. Low- and high-resolution fast atom bombardment-mass spectrometry was measured using a JEOL JMS-700 (MStation) instrument. NMR spectra were recorded with a Bruker AMX600 (600 MHz) instrument. Ultraviolet absorption spectra were measured with a Hitachi U-Best-50 spectrophotometer, and fluorescence spectra were recorded with a Hitachi F-2000 spectrometer. Liquid chromatography-MS) was measured with a JASCO PlatformII-LC instrument.

      Cell Culture

      RL34 cells were obtained from the Japanese Cancer Research Resources Bank. The cells were grown as monolayer cultures in Dulbecco's modified Eagle's medium supplemented with 5% heat-inactivated fetal bovine serum, penicillin (100 units/ml), streptomycin (100 μg/ml), l-glutamine (588 μg/ml), and 0.16% NaHCO3 at 37 °C in an atmosphere of 95% air and 5% CO2.

      Extraction and Isolation Procedures

      Wasabi roots (water wasabi) harvested in Shizuoka, Japan, were kind gifts from Kinjirushi Wasabi Co, Ltd. The wasabi roots (1.3 kg) were smashed with a grater, and the homogenates were stored at room temperature for 10 min. The homogenates were then sequentially extracted with ethyl acetate, 2 liters), n-butanol (2 liters) and water (1 liters). The ethyl acetate extract was further separated by silica gel column chromatography (silica gel BM-300, Fuji-Silicia Chem), and the acetone fraction, which showed the most potent activity, was analyzed by reversed-phase HPLC (yield, 70 mg), using a Develosil ODS-HG-5 (8 × 250 mm) column. The flow solvent was methanol/water = 3/2 (v/v) at a flow rate of 2.0 ml/min. Detection was carried out at 254 nm. Identification of the active compound was done by spectroscopic analyses (
      • Etoh H.
      • Nishimura A.
      • Takasawa R.
      • Yagi A.
      • Saito K.
      • Sakata K.
      • Kishima I.
      • Ina K.
      ). The NMR and MS data were measured using a Bruker ARX 400 and a JEOL MStation MS-700, respectively. The IR, UV, and optical rotation data were measured by a JASCO FT/IR-8300, a Beckman DU7500 and a JASCO DIP-370, respectively. The spectral data of 6-HITC were as follows: 13C-NMR (CDCl3, TMS), d (ppm): 22.4 (C-4), 26.2 (C-3), 27.9 (C-5), 29.6 (C-2), 38.6 (sulfinyl methyl), 44.9 (C-6), 54.3 (C-1), 130.0 (-NCS); 1H-NMR (CDCl3, TMS), d (ppm): 1.4–1.6 (4H, m, H-3 and H-4), 1.73 (2H, tt, J = 6.7, 7.1 Hz, H-5), 1.81 (2H, tt, J = 6.4, 7.4 Hz, H-2), 2.58 (3H, s, sulfinyl methyl), 2.72 (2H, dt,J = 7.1, 13.1 Hz, H-6), 3.54 (2H, t, J= 6.4 Hz); IR (liquid film, CHCl3), νmax (cm−1): 3002 (CH strech), 2108 (-NCS), 1032 (sulfinyl); UV (MeOH), λmax (nm): 243 (ε 1210); [α]D: −65.0 (c 0.600, CHCl3, 23 °C).

      Gas-Liquid Chromatography Analysis of 6-HITC in Wasabi Extracts

      The wasabi extract for the gas-liquid chromatography analyses was prepared using dichloromethane (CH2Cl2) as the extracting solvent. The CH2Cl2 was carefully removed under atmospheric pressure in a N2 stream on the ice bath. The residue was redissolved with an adequate amount of CH2Cl2. A 1 μl-aliquot of the CH2Cl2 solution of the wasabi extract was injected into the gas-liquid chromatography equipment. The quantitative analyses of 6-HITC and 6-methylthiohexyl isothiocyanate were carried out with a Hitachi G-3500 gas chromatograph (column, DB-1, 0.25 mm × 30 m; carrier gas, N2 at 1 ml/min; temp. program, 60–230 °C at 5 °C/min). Each peak was identified by the retention time of each authentic or synthetic sample and the gas-liquid chromatography-mass spectrometry analysis using a JEOL MStation MS-700 mass spectrometer linked to a Hewlett-Packard 6890 (column, DB-1, 0.25 mm × 30 m; carrier gas, He at 1 ml/min; temp. program, 60–300 °C at 8 °C/min; column inlet split rate, 1/100). These analyses were repeated three times.

      Enzyme Activity Assays

      The total GST activity was measured in cytosolic fractions (105,000 × g) in the presence of 0.1% bovine serum albumin with 1-chloro-2,4-dinitrobenzene as a substrate (
      • Habig W.H.
      • Pabst M.J.
      • Jakoby W.B.
      ), whereas quinone reductase (NAD(P)H:(quinone-acceptor) oxidoreductase 1 (NQO1)) activity was determined using menadione as the substrate (
      • Prochaska H.J.
      • Santamaria A.B.
      ). Cytochrome P4501A1-mediated ethoxyresorufin O-deethylase activity was measured using the procedures of Kennedy et al. (
      • Kennedy S.W.
      • Lorenzen A.
      • James C.A.
      • Collins B.T.
      ). The protein concentration was determined using the bicinchoninic acid protein assay (Pierce).

      Western Blot Analysis

      The homogenates prepared from the cells or animal tissues were treated with SDS-sample buffer (without dye or 2-mercaptoethanol) and immediately boiled for 5 min. The protein concentrations were determined using the BCA protein assay kit (Pierce). One hundred μg of the proteins were separated by SDS-polyacrylamide gel electrophoresis in the presence of 2-mercaptoethanol and electro-transferred onto an Immobilon membrane (Millipore, Bedford, MA). To detect the immunoreactive proteins, we used horseradish peroxidase-conjugated anti-rabbit IgG and ECL blotting reagents (Amersham Biosciences, Inc.). The polyclonal antibodies against GSTA1 were the kind gifts from Dr. K. Satoh of Hirosaki University School of Medicine. The polyclonal antibodies against GSTP1 and GSTM1 were obtained from Medical and Biological Laboratories Co., Ltd. (Nagoya, Japan) and Oxford Biomedical Research, Inc. (Oxford, MI), respectively. Polyclonal rabbit antisera raised against mouse Nrf2 was used as previously described (
      • Ishii T.
      • Itoh K.
      • Takahashi S.
      • Sato H.
      • Yanagawa T.
      • Katoh Y.
      • Bannai S.
      • Yamamoto M.
      ). The anti-nuclear Lamin B antiserum was purchased from Santa Cruz Biotechnology (Palo Alto, CA).

      Nuclear Translocation of Nrf2

      The cells treated with Me2SO or 6-HITC were fixed overnight in PBS containing 2% paraformaldehyde and 0.2% picric acid at 4 °C. The membranes were permeabilized by exposing the fixed cells to PBS containing 0.3% Triton X-100. The cells were then sequentially incubated in PBS solutions containing blocking serum (5% normal rabbit serum) and immunostained with the anti-Nrf2 polyclonal antibody (Santa Cruz, Santa Cruz, CA). The cells were then incubated for 1 h in the presence of fluorescein isothiocyanate-labeled rabbit anti-goat (DAKO A/S, Glostrup, Denmark), rinsed with PBS containing 0.3% Triton X-100, and covered with anti-fade solution. Images of the cellular immunofluorescence were acquired using a confocal laser microscope (Bio-Rad, Hercules, CA) with a 40× objective (488-nm excitation and 518-nm emission).

      Plasmid Preparation

      The annealed oligonucleotide of GSTA1 ARE (top strand: TCGAGTAGCTTGGAAATGACATTGCTAATGGTGACAAAGCAACTTTG; bottom strand: TCGACAAAGTTGCTTTGTCACCATTAGCAATGTCATTTCCAAGCTAC) was ligated to the XhoI and SalI sites of the Bluescript SK(−) plasmid, and the plasmid with three GSTA1 ARE inserts in tandem was selected. The KpnI and HincII fragment of the plasmid was blunted and then subcloned into the SmaI site of the pRBGP3 plasmid (
      • Igarashi K.
      • Kataoka K.
      • Itoh K.
      • Hayashi N.
      • Nishizawa M.
      • Yamamoto M.
      ). The annealed oligonucleotide of the human NQO1 ARE (top strand: CGCGTTCAGAGATTTCAGTCTAGAGTCACAGTGACTTGGCAAAATCG; bottom strand: CTAGCGATTTTGCCAAGTCACTGTGACTCTAGACTGAAATCTCTGAA) was ligated to the MluI and NheI site of the pRBGP3.

      RNA Blot Hybridization

      RL34 cells were maintained in Iscoves's modified Dulbecco's medium and 10% fetal bovine serum. Fifteen μg of the total cellular RNAs extracted by ISOGEN (NipponGene) was electrophoresed and transferred to Zeta-Probe GT membranes (Bio-Rad Japan, Tokyo). The membranes were probed with 32P-labeled cDNA probes as indicated in the figures. 18S RNA cDNA was used as the positive control.

      Transient Transfection Assay

      RL34 cells were maintained in Iscoves's modified Dulbecco's medium supplemented with 10% fetal bovine serum and seeded in 5 × 104/well in 12-well dishes 24 h before transfection. The cells were transfected with plasmids using FuGENE (Roche Molecular Biochemicals) according to the manufacturer's instructions. Nine hours after the transfection, the medium was changed to the fresh medium, and the cells were treated with Me2SO or 6-HITC (5 μm). After 36 h, the luciferase assay was performed by utilizing the Luciferase Assay System (Promega, Madison, WI) following the supplier's protocol and measured in a Biolumat Luminometer (Berthold, Bad Wildbad, Germany). Transfection efficiencies were routinely normalized by the activity of a co-transfected Renilla luciferase. Normally, three independent experiments, each carried out in duplicate, were performed, and the mean values were presented with the standard error of means (S.E.).

      Animal Study

      Determination of 6-HITC and Its Dithiocarbamate in the Plasma

      Male Wistar rats (Japan SLC Inc., Hamamatsu, Japan) were obtained at 7 weeks of age and individually housed in stainless wire-mesh cages at 23 ± 0.3 °C with a 12-h light cycle. They were fed unrestricted amounts of water, and the control diet was as follows: 20% casein, 3.5% mineral (93G-MX), 5.0% vitamin (93-VX), 0.2% choline chloride, 5.0% corn oil, 4.0% cellulose powder, 22.1% sucrose, and 44.2% starch. After 7 days of feeding the control diet, food was withheld for 24 h, and then 6-HITC dissolved in sesame oil was orally administered to four rats by direct stomach intubation. Blood samples were collected by heart puncture using heparinized needles and syringes under anesthesia with diethyl ether. The plasma was immediately obtained from the collected blood by centrifugation at 1600 × g for 15 min at 4 °C. The plasma separation was finished within 30 min. An aliquot of the plasma was acidified with one-tenth volume of phosphoric acid and stored at −80 °C until used. The levels of 6-MSHI in plasma were measured by the cyclocondensation assay as previously reported (
      • Zhang Y.
      • Talalay P.
      ).

      6-HITC-administered Mice

      Female ICR mice (Japan SLC Inc., Hamamatsu, Japan) were obtained at 4 weeks of age and individually housed in plastic cages (five/cage) at 23 ± 0.3 °C with a 12-h light cycle. They were fed for 12 days unrestricted amounts of water, and the control diet was as follows: 20% casein, 3.5% mineral (93G-MX), 5.0% vitamin (93-VX), 0.2% choline chloride, 5.0% corn oil, 4.0% cellulose powder, 22.1% sucrose, and 44.2% starch. From the thirteenth day, 6-HITC or sulforaphane was administered to these mice by gavage in daily doses of 15 μmol for 5 days (
      • Zhang Y.
      • Talalay P.
      • Cho C.-G.
      • Posner G.H.
      ).

      Nrf2 Knockout Mice

      A single dose of 15 μmol of 6-HITC was suspended in olive oil and administered to adult female Nrf2 knockout mice (
      • Itoh K.
      • Chiba T.
      • Takahashi S.
      • Ishii T.
      • Igarashi K.
      • Katoh Y.
      • Oyake T.
      • Hayashi N.
      • Satoh K.
      • Hatayama I.
      • Yamamoto M.
      • Nabeshima Y.
      ) or ICR control animals (Nrf2 +/+) by gavage.

      DISCUSSION

      Epidemiological studies have demonstrated that the consumption of cruciferous vegetables is associated with a lower incidence of cancers (
      • Lee H.P.
      • Gourley L.
      • Duffy S.W.
      • Esteve J.
      • Lee J.
      • Day N.E.
      ,
      • Olsen G.W.
      • Mandel J.S.
      • Gibson R.W.
      • Wattenberg L.W.
      • Schuman L.M.
      ,
      • Mehta B.G.
      • Liu J.
      • Constantinou A.
      • Thomas C.F.
      • Hawthorne M.
      • You M.
      • Gerhauser C.
      • Pezzuto J.M.
      • Moon R.C.
      • Moriarty R.M.
      ). An important group of compounds that have this property are organosulfur compounds, such as the isothiocyanates. The isothiocyanates are compounds that occur as glucosinolates in a variety of cruciferous vegetables, such as Brussica species. Glucosinolates are found in the cell vacuoles of various plants in the family Cruciferae such as horseradish, mustard, broccoli, and wasabi. When plant cells are damaged, glucosinolates are hydrolyzed by myrosinase (thioglucoside glucohydrolase, EC 3.2.3.1), which is also produced in the same family, and produce isothiocyanates. It is known that wasabi contains isothiocyanate components, such as allyl isothiocyanate, 6-HITC, 7-methylthioheptyl isothiocyanate, and 8-methylthiooctyl isothiocyanate (
      • Ina K.
      • Ina H.
      • Ueda M.
      • Yagi A.
      • Kishima I.
      ). These isothiocyanates have been suggested to have important medical benefits. They not only inhibit microbes, but can also help treat or prevent blood clotting and asthma (
      • Depree J.A.
      • Howard T.M.
      • Savage G.P.
      ). Many isothiocyanates are also effective chemoprotective agents against chemical carcinogenesis in experimental animals. The isothiocyanates have been shown to inhibit rat lung, esophagus, mammary gland, liver, small intestine, colon, and bladder tumorigenesis (
      • Wattenberg L.W.
      ,
      • Morse M.A.
      • Zu H.
      • Galati A.J.
      • Schmidt C.J.
      • Stoner G.D.
      ,
      • Stoner G.D.
      • Morrissey D.T.
      • Heur Y.H.
      • Daniel E.M.
      • Galati A.J.
      • Wagner S.A.
      ,
      • Hecht S.S.
      ). It has been suggested that the anticarcinogenic effects of isothiocyanates are closely associated with their capacity to induce phase II detoxification enzymes and to inhibit phase I enzymes that are required for the bioactivation of carcinogens. Indeed, some of the isothiocyanates have been shown to inhibit cytochrome P450 and increase the carcinogen excretion or detoxification by the phase II detoxification enzymes (
      • Talalay P.
      ,
      • Guo Z.
      • Smith T.J.
      • Wang E.
      • Eklind K.
      • Chung F.-L.
      • Yang C.S.
      ,
      • Morse M.A.
      • Stoner G.D.
      ). Many natural isothiocyanates derived from cruciferous vegetables and some fruits have been shown to induce phase II enzymes in cultured cells and rodents (
      • Leonard T.B.
      • Popp J.A.
      • Graichen M.E.
      • Dent J.G.
      ,
      • Yang C.S.
      • Smith T.J.
      • Hong J.Y.
      ,
      • Barcelo S.
      • Gardiner J.M.
      • Gescher A.
      • Chipman J.K.
      ). Recently, sulforaphane has been isolated from broccoli as the major inducer of phase II enzymes with potent in vivo chemopreventive properties (
      • Prestera T.
      • Holtzclaw W.D.
      • Zhang Y.
      • Talalay P.
      ,
      • Zhang Y.
      • Talalay P.
      • Cho C.-G.
      • Posner G.H.
      ,
      • Zhang Y.
      • Kensler T.W.
      • Cho C.-G.
      • Posner G.H.
      • Talalay P.
      ). In addition, sulforaphane was found to inhibit the cytochrome P450 isozyme 2E1, which is responsible for the activation of a variety of genotoxic chemicals (
      • Barcelo S.
      • Gardiner J.M.
      • Gescher A.
      • Chipman J.K.
      ).
      On the basis of its structural similarity to sulforaphane, the GST-inducing potencies of 6-HITC and sulforaphane were anticipated to be equally potent. However, the structure-activity relationship study revealed that the inducing potencies of 6-HITC was significantly greater than that for sulforaphane (Fig. 2). This was also the case in the animal experiments, in which the hepatic GST activity was induced more potently by 6-HITC than by sulforaphane (Fig. 5). The structure-activity relationship study also indicated that the isothiocyanate moiety is essential for the induction of GST activity (Fig. 2). Talalay et al. (
      • De Talalay P.
      • Long M.J.
      • Prochaska H.J.
      ) have suggested that the inductive ability of various alkyl and aromatic isothiocyanates dependent on the presence of one hydrogen on the adjacent carbon to the isothiocyanate group and that tautomerization of the methylene-isothiocyanate moiety to a structure resembling an α, β-unsaturated thioketone may be important for inductive activity. However, the present study demonstrated that the methylthioalkyl isothiocyanates were less potent inducers than theirS-oxidized forms (Fig. 2). The methylsulfinyl group, in addition to the isothiocyanate group, of 6-HITC is therefore suggested to be involved in its inductive activity. Although the reduced potency of the methylthioalkyl isothiocyanates may be simply due to their high volatility, it is not unlikely that the electron-withdrawing potentials of both the sulfinyl or sulfonyl groups may affect the signaling mechanism in the phase II induction.
      To confirm that 6-HITC is absorbed into the body following its oral administration, the plasma level of 6-HITC and/or its GSH adduct was analyzed by the cyclocondensation assay, which provides a valid measurement of isothiocyanates or their dithiocarbamates,i.e. GSH derivatives (
      • Zhang Y.
      • Talalay P.
      ). As shown in Fig. 4, it was revealed that 6-HITC was utilized very rapidly, reaching a maximum level within 30 min. Thus, 6-HITC is absorbed and rapidly enters the circulatory system. The plasma concentration of the isothiocyanate began to decrease after 30 min; however, this decrease was relatively slow. Zhang and Talalay (
      • Zhang Y.
      • Talalay P.
      ) have recently proposed that the induction of phase II enzymes by isothiocyanates depends on their intracellular levels of accumulation in the cells. Therefore, the prolonged accumulation of 6-HITC in the circulatory system may also correlate with its phase II inducer potencies.
      It is notable that 6-HITC specifically accelerated the production of GSTA1 and GSTP1 isozymes in vitro and in vivo(Figs. 3 and 5). The increase in GST activity by treatment with 6-HITC may, therefore, be largely attributable to the elevated synthesis of these isozymes. The class α GSTs represent the most abundant GST isozymes in the liver and kidney. It has been shown that a small increase in the class α GSTs is linked to a 90% decrease in the levels of the DNA adduct formation with aflatoxin B1, a liver carcinogen that is specifically detoxified by these isozymes (
      • Hayes J.D.
      • Judah D.J.
      • McLellan L.I.
      • Kerr L.A.
      • Peacock S.D.
      • Neal G.E.
      ). A recent study using transgenic mice lacking the class π GSTP1 has demonstrated that this class of GST is also involved in the metabolism of carcinogens, such as 7,12-dimethylbenz[a]anthracene, in mouse skin and has a profound effect on tumorigenicity (
      • Henderson C.J.
      • Smith A.G.
      • Ure J.
      • Brown K.
      • Bacon E.J.
      • Wolf C.R.
      ). These data suggest that both isozymes may represent the important determinants in cancer susceptibility, particularly in diseases where exposure to polycyclic aromatic hydrocarbons is involved.
      In early studies of the stress response system, a wide variety of phase II detoxification enzymes inducers were found to be electrophiles. Although the primary target of 6-HITC is still unknown, there is evidence that the intracellular level of GSH, regulating the redox state of the cell, may be an important sensor for the initiation of the cellular response to various compounds. In fact, the intracellular GSH levels of RL34 cells were readily reduced by treatment with 6-HITC.
      Y. Morimistu, Y. Nakagawa, and K. Uchida, unpublished observation.
      Interestingly, the amount of GSH began to recover and increased to over the basal level, indicating that the cell responded to the GSH depletion. Because GSH is important in metabolism and enzyme regulation as well as the detoxification of cytotoxic materials, the level of intracellular GSH is a critical parameter for a signaling cascade for the induction of phase II enzymes by 6-HITC. On the other hand, it has also been shown that the gene expression of GSTA1 is related to the intracellular oxidative stress presumably mediated by reactive oxygen species or the pro-oxidative potential of GSTA1 inducers (
      • Pinkus R.
      • Weiner L.M.
      • Daniel V.
      ,
      • Pinkus R.
      • Weiner L.M.
      • Daniel V.
      ). In addition to GSTA1, oxidative stress has been reported to enhance the expression of genes encoding other antioxidant enzymes, including the γ-GCS (
      • Shi M.M.
      • Kugelman A.
      • Iwamoto T.
      • Tian L.
      • Forman H.J.
      ), heme oxygenase (
      • Lautier D.
      • Luscher P.
      • Tyrrell R.M.
      ), and heat shock protein 90 (49). Thus, it is increasingly recognized that an adequate amount of oxidative stress stimulates a variety of signal transduction pathways under circumstances that do not result in cell death.
      The transcriptional activation of the phase II enzymes has been traced to a cis-acting transcriptional enhancer called ARE (
      • Rushmore T.H.
      • King R.G.
      • Paulson K.E.
      • Pickett C.B.
      ), or alternatively, the electrophile response element (
      • Friling R.S.
      • Bensimon A.
      • Tichauer T.
      • Daniel V.
      ). It has been shown that the transcription factor Nrf2 positively regulates the ARE-mediated expression of the phase II detoxification enzyme genes. Itoh et al. (
      • Itoh K.
      • Chiba T.
      • Takahashi S.
      • Ishii T.
      • Igarashi K.
      • Katoh Y.
      • Oyake T.
      • Hayashi N.
      • Satoh K.
      • Hatayama I.
      • Yamamoto M.
      • Nabeshima Y.
      ) have recently established by gene-targeted disruption in mice that Nrf2 is a general regulator of the phase II enzyme genes in response to electrophiles and reactive oxygens. More recently, the general regulatory mechanism underlying the electrophile counterattack response has been demonstrated in which electrophilic agents alter the interaction of Nrf2 with its repressor protein (Keap1), thereby liberating Nrf2 activity from repression by Keap 1, culminating in the induction of the phase II enzyme genes and antioxidative stress protein genes via AREs (
      • Itoh K.
      • Wakabayashi N.
      • Katoh Y.
      • Ishii T.
      • Igarashi K.
      • Engel J.D.
      • Yamamoto M.
      ). It has been suggested that the dissociation of Nrf2 from Keap I may involve modification of either one of these proteins and could be achieved by direct or indirect mechanisms. For example, Nrf2 can be phosphorylated by components of the MAP kinase cascade (
      • Yu R.
      • Lei W.
      • Mandlekar S.
      • Weber M.J.
      • Der C.J.
      • Wu J.
      • Kong A.-N.T.
      ), which could result in its dissociation. On the other hand, Dinkova-Kostova et al. (
      • Dinkova-Kostova A.T.
      • Massiah M.A.
      • Bozak R.E.
      • Hicks R.J.
      • Talalay P.
      ) have provided an alternative possibility that the dissociation of this complex may be potentiated by the direct interaction of electrophilic agents with reactive thiol residues in either of the two proteins. This hypothesis is supported by the strong relationship between the potency of the agents as inducers of the gene expression through the ARE and their rate of reaction with sulfhydryl groups. This mechanism implies that the inducing agent will become covalently bound either to Keap I or Nrf2. Thus, our findings that (i) 6-HITC induced a significant increase in specific binding to the ARE (Fig. 7), (ii) 6-HITC activated Nrf2 (Fig. 8), and (iii) negligible inducibility in nrf2-deficient mice was observed (Fig. 9) suggest that 6-HITC may directly or indirectly act on the Keap 1/Nrf2 complex and activate ARE.
      In conclusion, to identify novel cancer chemopreventive agents from plants, we screened extracts from a variety of commonly consumed vegetables on the basis of the GST-inducing effect and found that wasabi, which is known to have a variety of medical benefits, including the prevention of blood clotting, asthma, and even cancer, was the richest source of inducers. An analysis of the wasabi extracts demonstrated that 6-HITC, the major isothiocyanate compound in wasabi, is the principal GST inducer. Moreover, we established the GST inducing potency of this compound not only in vitro but also in vivo. These and the previous findings that 6-HITC has an inhibitory effect on the growth of human stomach tumor cells and on skin carcinogenesis of mice induced by 12-O-tetradecanoylphorbol-13-acetate (
      • Fuke Y.
      • Haga Y.
      • Ono H.
      • Nomura T.
      • Ryoyama K.
      ) suggested that this isothiocyanate may be a chemoprotector against tumors evoked by a number of chemical carcinogens and can be regarded as a readily available promising new cancer chemopreventive agent.

      Acknowledgments

      We thank G. Inoue (Kinjirushi Wasabi Co. Ltd.) for providing us all kinds of wasabi research samples.

      REFERENCES

        • Hayes J.D.
        • Pulford D.J.
        CRC Crit. Rev. Biochem. Mol. Biol. 1995; 30: 445-600
        • Wattenberg L.W.
        Cancer Res. 1983; 43: 2488-2493
        • Wattenberg L.W.
        Cancer Res. 1985; 45: 1-8
        • Henderson C.J.
        • Smith A.G.
        • Ure J.
        • Brown K.
        • Bacon E.J.
        • Wolf C.R.
        Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5275-5280
        • Nakae D.
        • Denda A.
        • Kobayashi Y.
        • Akai H.
        • Kishida H.
        • Tsujiuchi T.
        • Konishi Y.
        • Suzuki T.
        • Muramatsu M.
        Jpn. J. Cancer Res. 1998; 89: 1118-1125
        • Prestera T.
        • Holtzclaw W.D.
        • Zhang Y.
        • Talalay P.
        Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2965-2969
        • De Talalay P.
        • Long M.J.
        • Prochaska H.J.
        Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 8261-8265
        • Spencer S.R.
        • Xue L.
        • Klenz E.M.
        • Talalay P.
        Biochem. J. 1991; 273: 711-717
        • Colditz G.A.
        • Branch L.G.
        • Lipinick R.J.
        • Willett W.C.
        • Rosner B.
        • Posner B.M.
        • Hennekens C.H.
        Am. J. Clin. Nutr. 1985; 41: 32-36
        • Graham S.
        Cancer Res. 1983; 43: 2409-2413
        • Peto R.
        • Doll R.
        • Buckley J.D.
        • Sporn M.B.
        Nature. 1981; 290: 201-208
        • Wattenberg L.W.
        • Sparnins V.L.
        • Barany G.
        Cancer Res. 1989; 49: 2689-2692
        • Prochaska H.J.
        • Santamaria A.B.
        • Talalay P.
        Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 2394-2398
        • Zhang Y.
        • Talalay P.
        • Cho C.-G.
        • Posner G.H.
        Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 2399-2403
        • Zhang Y.
        • Kensler T.W.
        • Cho C.-G.
        • Posner G.H.
        • Talalay P.
        Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3147-3150
        • Kawamoto Y.
        • Nakamura Y.
        • Naito Y.
        • Torii Y.
        • Kumagai T.
        • Osawa T.
        • Ohigashi H.
        • Satoh K.
        • Imagawa M.
        • Uchida K.
        J. Biol. Chem. 2000; 275: 11291-11299
        • Etoh H.
        • Nishimura A.
        • Takasawa R.
        • Yagi A.
        • Saito K.
        • Sakata K.
        • Kishima I.
        • Ina K.
        Agric. Biol. Chem. 1990; 54: 1587-1591
        • Habig W.H.
        • Pabst M.J.
        • Jakoby W.B.
        J. Biol. Chem. 1974; 249: 7130-7139
        • Prochaska H.J.
        • Santamaria A.B.
        Anal. Biochem. 1988; 169: 328-336
        • Kennedy S.W.
        • Lorenzen A.
        • James C.A.
        • Collins B.T.
        Anal. Biochem. 1993; 211: 102-112
        • Ishii T.
        • Itoh K.
        • Takahashi S.
        • Sato H.
        • Yanagawa T.
        • Katoh Y.
        • Bannai S.
        • Yamamoto M.
        J. Biol. Chem. 2000; 275: 16023-16029
        • Igarashi K.
        • Kataoka K.
        • Itoh K.
        • Hayashi N.
        • Nishizawa M.
        • Yamamoto M.
        Nature. 1994; 367: 568-572
        • Zhang Y.
        • Talalay P.
        Cancer Res. 1988; 58: 4632-4639
        • Itoh K.
        • Chiba T.
        • Takahashi S.
        • Ishii T.
        • Igarashi K.
        • Katoh Y.
        • Oyake T.
        • Hayashi N.
        • Satoh K.
        • Hatayama I.
        • Yamamoto M.
        • Nabeshima Y.
        Biochem. Biophys. Res. Comm. 1997; 236: 313-322
        • Morimitsu Y.
        • Hayashi K.
        • Nakagawa Y.
        • Horio F.
        • Uchida K.
        • Osawa T.
        Biofactors. 2000; 13: 271-276
        • Rushmore T.H.
        • King R.G.
        • Paulson K.E.
        • Pickett C.B.
        Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 3826-3830
        • Friling R.S.
        • Bensimon A.
        • Tichauer T.
        • Daniel V.
        Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 6258-6262
        • Itoh K.
        • Wakabayashi N.
        • Katoh Y.
        • Ishii T.
        • Igarashi K.
        • Engel J.D.
        • Yamamoto M.
        Gene Dev. 1999; 13: 76-86
        • Lee H.P.
        • Gourley L.
        • Duffy S.W.
        • Esteve J.
        • Lee J.
        • Day N.E.
        Int. J. Cancer. 1989; 434: 1007-1016
        • Olsen G.W.
        • Mandel J.S.
        • Gibson R.W.
        • Wattenberg L.W.
        • Schuman L.M.
        Cancer Causes Control. 1991; 2: 291-297
        • Mehta B.G.
        • Liu J.
        • Constantinou A.
        • Thomas C.F.
        • Hawthorne M.
        • You M.
        • Gerhauser C.
        • Pezzuto J.M.
        • Moon R.C.
        • Moriarty R.M.
        Carcinogenesis. 1995; 16: 399-404
        • Ina K.
        • Ina H.
        • Ueda M.
        • Yagi A.
        • Kishima I.
        Agric. Biol. Chem. 1989; 53: 537-538
        • Depree J.A.
        • Howard T.M.
        • Savage G.P.
        Food Res. Inter. 1999; 31: 329-337
        • Wattenberg L.W.
        Cancer Res. 1981; 41: 2991-2994
        • Morse M.A.
        • Zu H.
        • Galati A.J.
        • Schmidt C.J.
        • Stoner G.D.
        Cancer Lett. 1993; 72: 103-110
        • Stoner G.D.
        • Morrissey D.T.
        • Heur Y.H.
        • Daniel E.M.
        • Galati A.J.
        • Wagner S.A.
        Cancer Res. 1991; 51: 2063-2068
        • Hecht S.S.
        J. Cell. Biochem. Suppl. 1995; 22: 195-209
        • Talalay P.
        Adv. Enzyme Regul. 1989; 28: 237-250
        • Guo Z.
        • Smith T.J.
        • Wang E.
        • Eklind K.
        • Chung F.-L.
        • Yang C.S.
        Carcinogenesis. 1993; 14: 1167-1173
        • Morse M.A.
        • Stoner G.D.
        Carcinogenesis. 1993; 14: 1737-1746
        • Leonard T.B.
        • Popp J.A.
        • Graichen M.E.
        • Dent J.G.
        Carcinogenesis. 1981; 2: 473-482
        • Yang C.S.
        • Smith T.J.
        • Hong J.Y.
        Cancer Res. 1994; 54: 1982-1986
        • Barcelo S.
        • Gardiner J.M.
        • Gescher A.
        • Chipman J.K.
        Carcinogenesis. 1996; 17: 277-282
        • Hayes J.D.
        • Judah D.J.
        • McLellan L.I.
        • Kerr L.A.
        • Peacock S.D.
        • Neal G.E.
        Biochem. J. 1991; 279: 385-398
        • Pinkus R.
        • Weiner L.M.
        • Daniel V.
        Biochemistry. 1995; 34: 81-88
        • Pinkus R.
        • Weiner L.M.
        • Daniel V.
        J. Biol. Chem. 1996; 271: 13422-13429
        • Shi M.M.
        • Kugelman A.
        • Iwamoto T.
        • Tian L.
        • Forman H.J.
        J. Biol. Chem. 1994; 269: 26512-26517
        • Lautier D.
        • Luscher P.
        • Tyrrell R.M.
        Carcinogenesis. 1992; 13: 227-232
        • Yu R.
        • Lei W.
        • Mandlekar S.
        • Weber M.J.
        • Der C.J.
        • Wu J.
        • Kong A.-N.T.
        J. Biol. Chem. 1999; 274: 27545-27552
        • Dinkova-Kostova A.T.
        • Massiah M.A.
        • Bozak R.E.
        • Hicks R.J.
        • Talalay P.
        Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3404-3409
        • Fuke Y.
        • Haga Y.
        • Ono H.
        • Nomura T.
        • Ryoyama K.
        Cytotechnology. 1997; 25: 197-203