Advertisement

Cholinergic signaling at the body wall neuromuscular junction distally inhibits feeding behavior in Caenorhabditis elegans

Open AccessPublished:December 02, 2021DOI:https://doi.org/10.1016/j.jbc.2021.101466
      Complex biological functions within organisms are frequently orchestrated by systemic communication between tissues. In the model organism Caenorhabditis elegans, the pharyngeal and body wall neuromuscular junctions are two discrete structures that control feeding and locomotion, respectively. Separate, the well-defined neuromuscular circuits control these distinct tissues. Nonetheless, the emergent behaviors, feeding and locomotion, are coordinated to guarantee the efficiency of food intake. Here, we show that pharmacological hyperactivation of cholinergic transmission at the body wall muscle reduces the rate of pumping behavior. This was evidenced by a systematic screening of the effect of the cholinesterase inhibitor aldicarb on the rate of pharyngeal pumping on food in mutant worms. The screening revealed that the key determinants of the inhibitory effect of aldicarb on pharyngeal pumping are located at the body wall neuromuscular junction. In fact, the selective stimulation of the body wall muscle receptors with the agonist levamisole inhibited pumping in a lev-1-dependent fashion. Interestingly, this response was independent of unc-38, an alpha subunit of the nicotinic receptor classically expressed with lev-1 at the body wall muscle. This implies an uncharacterized lev-1-containing receptor underpins this effect. Overall, our results reveal that body wall cholinergic transmission not only controls locomotion but simultaneously inhibits feeding behavior.

      Keywords

      Abbreviations:

      AChEs (acetylcholinesterases), APs (auxiliary proteins), mAChRs (muscarinic acetylcholine receptors), nAChR (acetylcholine-gated cation channel), nd (not determined), ns (not significant), NTs (neurotransmitters)
      The communication between tissues has an important role in physiological processes in health, disease, and stress conditions (
      • Karsenty G.
      • Olson E.N.
      Bone and muscle endocrine functions: Unexpected paradigms of inter-organ communication.
      ,
      • Rai M.
      • Demontis F.
      Systemic nutrient and stress signaling via myokines and myometabolites.
      ). The communication between the skeletal muscle, liver, and adipose tissue during exercise is a clear example of tissue communication to control energy metabolism and insulin sensitivity in that particular stress condition (
      • Egan B.
      • Zierath J.R.
      Exercise metabolism and the molecular regulation of skeletal muscle adaptation.
      ). The imbalance of that communication causes an increase of energy expenditure associated with chronic disease or cachexia (
      • Argiles J.M.
      • Stemmler B.
      • Lopez-Soriano F.J.
      • Busquets S.
      Inter-tissue communication in cancer cachexia.
      ). This complex process is conserved from invertebrates to mammals and can be modeled in simpler organisms such as the fruit fly Drosophila melanogaster (
      • Delanoue R.
      • Slaidina M.
      • Leopold P.
      The steroid hormone ecdysone controls systemic growth by repressing dMyc function in Drosophila fat cells.
      ,
      • Demontis F.
      • Perrimon N.
      Integration of insulin receptor/Foxo signaling and dMyc activity during muscle growth regulates body size in Drosophila.
      ,
      • Rajan A.
      • Perrimon N.
      Drosophila as a model for interorgan communication: Lessons from studies on energy homeostasis.
      ).
      The survival of the model organism Caenorhabditis elegans depends on two essential behaviors, feeding and locomotion, as well as the ability to modify them according to the environmental cues. The external presence of bacteria, C. elegans’ food, is a potent stimulus that modulates the rate of feeding by increasing the pharyngeal movements and the intake of bacteria (
      • Avery L.
      • Horvitz H.R.
      Effects of starvation and neuroactive drugs on feeding in Caenorhabditis-elegans.
      ,
      • Avery L.
      • Horvitz R.
      Pharyngeal pumping continues after laser killing of the pharyngeal nervous-system of C-elegans.
      ,
      • Dalliere N.
      • Bhatla N.
      • Luedtke Z.
      • Ma D.K.
      • Woolman J.
      • Walker R.J.
      • Holden-Dye L.
      • O'Connor V.
      Multiple excitatory and inhibitory neural signals converge to fine-tune Caenorhabditis elegans feeding to food availability.
      ). Interestingly, nematodes can modify their locomotory patterns according to food availability and changing between dwelling and roaming (
      • Sawin E.R.
      • Ranganathan R.
      • Horvitz H.R.
      C-elegans locomotory rate is modulated by the environment through a dopaminergic pathway and by experience through a serotonergic pathway.
      ,
      • Ben Arous J.
      • Laffont S.
      • Chatenay D.
      Molecular and sensory basis of a food related two-state behavior in C. elegans.
      ). In this sense, the quality and quantity of food ingested emerges as an important environmental factor to modulate the worm’s motility directly controlled by the neuromuscular body wall (
      • Ben Arous J.
      • Laffont S.
      • Chatenay D.
      Molecular and sensory basis of a food related two-state behavior in C. elegans.
      ,
      • Shtonda B.B.
      • Avery L.
      Dietary choice behavior in Caenorhabditis elegans.
      ). Similarly, mechanical stimulation or the optogenetic silencing of the body wall musculature reduces the feeding rate of C. elegans that is otherwise directly governed by cholinergic transmission at the pharyngeal neuromuscular junction (
      • Takahashi M.
      • Takagi S.
      Optical silencing of body wall muscles induces pumping inhibition in Caenorhabditis elegans.
      ,
      • Chalfie M.
      • Sulston J.E.
      • White J.G.
      • Southgate E.
      • Thomson J.N.
      • Brenner S.
      The neural circuit for touch sensitivity in Caenorhabditis-elegans.
      ,
      • Keane J.
      • Avery L.
      Mechanosensory inputs influence Caenorhabditis elegans pharyngeal activity via ivermectin sensitivity genes.
      ). This supports the notion that locomotory function might provide additional pathways that contribute to regulation of the pharyngeal circuits that control feeding.
      Morphologically, the pharynx is divided into three different parts: the corpus, the isthmus, and the terminal bulb. Two pharyngeal movements are responsible for the transport of bacteria by ingestion via the buccal cavity to the intestines (
      • Albertson D.G.
      • Thomson J.N.
      The pharynx of Caenorhabditis elegans.
      ,
      • Avery L.
      The genetics of feeding in Caenorhabditis elegans.
      ,
      • Avery L.
      • Thomas J.H.
      Chapter 24: Feeding and defecation.
      ). The coordinated contraction-relaxation cycle of the corpus and the terminal bulb causes the opening of the lumen in these parts of the pharynx that results in the aspiration of bacteria into the cavity. This rhythmic movement is named pharyngeal pumping and is caused by the release of acetylcholine and glutamate from the MC and M3 pharyngeal neurons that contract and relax the pharyngeal muscle, respectively (
      • Avery L.
      Motor-neuron M3 controls pharyngeal muscle-relaxation timing in Caenorhabditis-elegans.
      ,
      • McKay J.P.
      • Raizen D.M.
      • Gottschalk A.
      • Schafer W.R.
      • Avery L.
      eat-2 and eat-18 are required for nicotinic neurotransmission in the Caenorhabditis elegans pharynx.
      ). The bacteria accumulated in the corpus during the pumping are directed to the terminal bulb by the progressive wavelike contractions of the muscles in the isthmus. This peristalsis movement depends on acetylcholine release from the pharyngeal motor neuron M4 (
      • Avery L.
      • Shtonda B.B.
      Food transport in the C-elegans pharynx.
      ,
      • Avery L.
      • Horvitz H.R.
      A cell that dies during wild-type C-elegans development can function as a neuron in a Ced-3 mutant.
      ), one of the 20 neurons that more widely supports the regulation of feeding. This circuit is isolated from the rest of the animal by a basal lamina (
      • Albertson D.G.
      • Thomson J.N.
      The pharynx of Caenorhabditis elegans.
      ). A single synaptic connection is described between the pharynx and the rest of the animal (I2-RIP). However, disruption of this connection does not cause any defect in the feeding phenotype, indicating that this anatomical route does not mediate a strong determinant of the pharyngeal modulation of feeding (
      • Avery L.
      • Thomas J.H.
      Chapter 24: Feeding and defecation.
      ). This points to a more important role of neuromodulatory signaling via biogenic amines and peptides, involving volume transmission (
      • Dalliere N.
      • Bhatla N.
      • Luedtke Z.
      • Ma D.K.
      • Woolman J.
      • Walker R.J.
      • Holden-Dye L.
      • O'Connor V.
      Multiple excitatory and inhibitory neural signals converge to fine-tune Caenorhabditis elegans feeding to food availability.
      ).
      In comparison to the body wall muscle, less is known about the molecular composition of the receptor organization that controls the pharyngeal neuromuscular junction and the feeding phenotype. The glutamate-gated chloride channel AVR-15 acts postsynaptically in the pharyngeal muscle to sense glutamate released from the motor neuron M3 that causes muscle relaxation (
      • Avery L.
      Motor-neuron M3 controls pharyngeal muscle-relaxation timing in Caenorhabditis-elegans.
      ,
      • Dent J.A.
      • Davis M.W.
      • Avery L.
      avr-15 encodes a chloride channel subunit that mediates inhibitory glutamatergic neurotransmission and ivermectin sensitivity in Caenorhabditis elegans.
      ). EAT-2 is a cys-loop acetylcholine receptor subunit localized at the synapse between the pharyngeal MC motor neuron and the muscle at the corpus. It requires the auxiliary protein EAT-18 to allow EAT-2 essential function in initiating contraction (
      • McKay J.P.
      • Raizen D.M.
      • Gottschalk A.
      • Schafer W.R.
      • Avery L.
      eat-2 and eat-18 are required for nicotinic neurotransmission in the Caenorhabditis elegans pharynx.
      ,
      • Choudhary S.
      • Buxton S.K.
      • Puttachary S.
      • Verma S.
      • Mair G.R.
      • McCoy C.J.
      • Reaves B.J.
      • Wolstenholme A.J.
      • Martin R.J.
      • Robertson A.P.
      EAT-18 is an essential auxiliary protein interacting with the non-alpha nAChR subunit EAT-2 to form a functional receptor.
      ). Mutations in avr-15 and eat-2 phenocopy the feeding behavior of nematodes with M3 and MC ablated neurons respectively, highlighting the critical role these receptor components play (
      • Avery L.
      Motor-neuron M3 controls pharyngeal muscle-relaxation timing in Caenorhabditis-elegans.
      ,
      • McKay J.P.
      • Raizen D.M.
      • Gottschalk A.
      • Schafer W.R.
      • Avery L.
      eat-2 and eat-18 are required for nicotinic neurotransmission in the Caenorhabditis elegans pharynx.
      ,
      • Dent J.A.
      • Davis M.W.
      • Avery L.
      avr-15 encodes a chloride channel subunit that mediates inhibitory glutamatergic neurotransmission and ivermectin sensitivity in Caenorhabditis elegans.
      ). The feeding phenotype in addition requires the release of acetylcholine by the motor neuron M4, triggering isthmus peristalsis (
      • Avery L.
      • Horvitz H.R.
      A cell that dies during wild-type C-elegans development can function as a neuron in a Ced-3 mutant.
      ). However, there is not any mutation in an acetylcholine receptor that phenocopies the M4 ablation, and the molecular determinants of this feeding critical function are unknown.
      To better define the molecular determinants of the pharyngeal neuromuscular junction of C. elegans, we performed a targeted screen of the pumping behavior on food with defined molecular determinants of cholinergic transmission in the presence or absence of aldicarb. This acetylcholinesterase inhibitor has been previously used to induce paralysis of movement, and this led to the discovery of molecular components at the body wall neuromuscular junctions in C. elegans (
      • Mahoney T.R.
      • Luo S.
      • Nonet M.L.
      Analysis of synaptic transmission in Caenorhabditis elegans using an aldicarb-sensitivity assay.
      ,
      • Oh K.H.
      • Kim H.
      Aldicarb-induced paralysis assay to determine defects in synaptic transmission in Caenorhabditis elegans.
      ). We found that the genes conferring significant drug sensitivity of the pharyngeal paralysis are surprisingly located in the body wall neuromuscular junction. In addition, we describe how the stimulation of a LEV-1-containing receptor at the body wall reduced the pharyngeal pumping rate. This indicates an unexpected communication between the body wall neuromuscular junction that controls locomotion and the distinct and physically separated pharyngeal circuit that controls feeding.

      Results

      The determinants that control pharyngeal function are distinct from the determinants that control pharyngeal sensitivity to aldicarb

      To investigate the cholinergic regulation and better describe the molecular determinants of the feeding behavior, the well-characterized protocol of aldicarb-induced paralysis was performed (
      • Mahoney T.R.
      • Luo S.
      • Nonet M.L.
      Analysis of synaptic transmission in Caenorhabditis elegans using an aldicarb-sensitivity assay.
      ,
      • Oh K.H.
      • Kim H.
      Aldicarb-induced paralysis assay to determine defects in synaptic transmission in Caenorhabditis elegans.
      ). This assay has been extensively used to find molecular determinants at the neuromuscular junction of the body wall on the basis of resistance or hypersensitivity to paralysis of locomotion when nematodes are incubated on aldicarb-containing agar plates (
      • Mahoney T.R.
      • Luo S.
      • Nonet M.L.
      Analysis of synaptic transmission in Caenorhabditis elegans using an aldicarb-sensitivity assay.
      ). We previously demonstrated that aldicarb and other cholinesterase inhibitors also cause a dose-dependent inhibition of the pharyngeal function (
      • Izquierdo P.G.
      • O'Connor V.
      • Green A.C.
      • Holden-Dye L.
      • Tattersall J.E.H.
      C. elegans pharyngeal pumping provides a whole organism bio-assay to investigate anti-cholinesterase intoxication and antidotes.
      ). This inhibition was associated with the pharynx exhibiting hypercontraction observed by the opening of the lumen (
      • Izquierdo P.G.
      • O'Connor V.
      • Green A.C.
      • Holden-Dye L.
      • Tattersall J.E.H.
      C. elegans pharyngeal pumping provides a whole organism bio-assay to investigate anti-cholinesterase intoxication and antidotes.
      ). This implied that aldicarb intoxication in the context of the whole organism would result from drug-induced hyperactivation of the cholinergic transmission. In this sense, we hypothesized that molecular determinants in the pharynx would confer resistance or hypersensitivity to aldicarb-induced paralysis of feeding behavior.
      We screened the pharyngeal function of different mutant worms in the presence or absence of the cholinesterase-inhibitor aldicarb under the conditions we previously optimized (
      • Izquierdo P.G.
      • O'Connor V.
      • Green A.C.
      • Holden-Dye L.
      • Tattersall J.E.H.
      C. elegans pharyngeal pumping provides a whole organism bio-assay to investigate anti-cholinesterase intoxication and antidotes.
      ). The results of this screening are listed in Table 1. It consisted of 56 mutant strains deficient in cholinergic and other neurotransmitter signaling. The components of the cholinergic pathway tested included alpha and non-alpha subunits of the acetylcholine-gated cation channel (
      • Holden-Dye L.
      • Joyner M.
      • O'Connor V.
      • Walker R.J.
      Nicotinic acetylcholine receptors: A comparison of the nAChRs of Caenorhabditis elegans and parasitic nematodes.
      ), subunits of the nematode-selective acetylcholine-gated chloride channel (
      • Putrenko I.
      • Zakikhani M.
      • Dent J.A.
      A family of acetylcholine-gated chloride channel subunits in Caenorhabditis elegans.
      ), muscarinic acetylcholine receptors (
      • Culotti J.G.
      • Klein W.L.
      Occurrence of muscarinic acetylcholine receptors in wild type and cholinergic mutants of Caenorhabditis elegans.
      ,
      • Hwang J.M.
      • Chang D.J.
      • Kim U.S.
      • Lee Y.S.
      • Park Y.S.
      • Kaang B.K.
      • Cho N.J.
      Cloning and functional characterization of a Caenorhabditis elegans muscarinic acetylcholine receptor.
      ,
      • Lee Y.S.
      • Park Y.S.
      • Chang D.J.
      • Hwang J.M.
      • Min C.K.
      • Kaang B.K.
      • Cho N.J.
      Cloning and expression of a G protein-linked acetylcholine receptor from Caenorhabditis elegans.
      ,
      • Lee Y.S.
      • Park Y.S.
      • Nam Y.
      • Suh S.J.
      • Lee F.
      • Kaang B.K.
      • Cho N.J.
      Characterization of GAR-2, a novel G protein-linked acetylcholine receptor from Caenorhabditis elegans.
      ), acetylcholinesterases (
      • Combes D.
      • Fedon Y.
      • Grauso M.
      • Toutant J.P.
      • Arpagaus M.
      Four genes encode acetylcholinesterases in the nematodes Caenorhabditis elegans and Caenorhabditis briggsae. cDNA sequences, genomic structures, mutations and in vivo expression.
      ,
      • Selkirk M.E.
      • Lazari O.
      • Hussein A.S.
      • Matthews J.B.
      Nematode acetylcholinesterases are encoded by multiple genes and perform non-overlapping functions.
      ,
      • Selkirk M.E.
      • Lazari O.
      • Matthews J.B.
      Functional genomics of nematode acetylcholinesterases.
      ), and auxiliary proteins involved in the proper function of the cholinergic receptors (
      • McKay J.P.
      • Raizen D.M.
      • Gottschalk A.
      • Schafer W.R.
      • Avery L.
      eat-2 and eat-18 are required for nicotinic neurotransmission in the Caenorhabditis elegans pharynx.
      ,
      • Choudhary S.
      • Buxton S.K.
      • Puttachary S.
      • Verma S.
      • Mair G.R.
      • McCoy C.J.
      • Reaves B.J.
      • Wolstenholme A.J.
      • Martin R.J.
      • Robertson A.P.
      EAT-18 is an essential auxiliary protein interacting with the non-alpha nAChR subunit EAT-2 to form a functional receptor.
      ,
      • Bandyopadhyay J.
      • Lee J.
      • Lee J.
      • Lee J.I.
      • Yu J.R.
      • Jee C.
      • Cho J.H.
      • Jung S.
      • Lee M.H.
      • Zannoni S.
      • Singson A.
      • Kim D.H.
      • Koo H.S.
      • Ahnn J.
      Calcineurin, a calcium/calmodulin-dependent protein phosphatase, is involved in movement, fertility, egg laying, and growth in Caenorhabditis elegans.
      ,
      • Boulin T.
      • Gielen M.
      • Richmond J.E.
      • Williams D.C.
      • Paoletti P.
      • Bessereau J.L.
      Eight genes are required for functional reconstitution of the Caenorhabditis elegans levamisole-sensitive acetylcholine receptor.
      ,
      • Boulin T.
      • Rapti G.
      • Briseno-Roa L.
      • Stigloher C.
      • Richmond J.E.
      • Paoletti P.
      • Bessereau J.L.
      Positive modulation of a Cys-loop acetylcholine receptor by an auxiliary transmembrane subunit.
      ,
      • Briseno-Roa L.
      • Bessereau J.L.
      Proteolytic processing of the extracellular scaffolding protein LEV-9 is required for clustering acetylcholine receptors.
      ,
      • Gally C.
      • Eimer S.
      • Richmond J.E.
      • Bessereau J.L.
      A transmembrane protein required for acetylcholine receptor clustering in Caenorhabditis elegans.
      ,
      • Gendrel M.
      • Rapti G.
      • Richmond J.E.
      • Bessereau J.L.
      A secreted complement-control-related protein ensures acetylcholine receptor clustering.
      ,
      • Gottschalk A.
      • Almedom R.B.
      • Schedletzky T.
      • Anderson S.D.
      • Yates J.R.
      • Schafer W.R.
      Identification and characterization of novel nicotinic receptor-associated proteins in Caenorhabditis elegans.
      ,
      • Maryon E.B.
      • Coronado R.
      • Anderson P.
      unc-68 encodes a ryanodine receptor involved in regulating C-elegans body-wall muscle contraction.
      ,
      • Pierron M.
      • Pinan-Lucarre B.
      • Bessereau J.L.
      Preventing illegitimate extrasynaptic acetylcholine receptor clustering requires the RSU-1 protein.
      ,
      • Rapti G.
      • Richmond J.
      • Bessereau J.L.
      A single immunoglobulin-domain protein required for clustering acetylcholine receptors in C. elegans.
      ) (Table 1). We in addition included two nematode strains that exhibit hyperactivity at the body wall muscle (
      • Huang Y.C.
      • Pirri J.K.
      • Rayes D.
      • Gao S.
      • Mulcahy B.
      • Grant J.
      • Saheki Y.
      • Francis M.M.
      • Zhen M.
      • Alkema M.J.
      Gain-of-function mutations in the UNC-2/CaV2alpha channel lead to excitation-dominant synaptic transmission in Caenorhabditis elegans.
      ,
      • Bhattacharya R.
      • Touroutine D.
      • Barbagallo B.
      • Climer J.
      • Lambert C.M.
      • Clark C.M.
      • Alkema M.J.
      • Francis M.M.
      A conserved dopamine-cholecystokinin signaling pathway shapes context-dependent Caenorhabditis elegans behavior.
      ). In doing so, we have probed for molecules that represent structural or functional homologs of the receptors, trafficking or scaffolding molecules known to control archetypal cholinergic function and plasticity in higher animals (
      • Treinin M.
      • Jin Y.
      Cholinergic transmission in C. elegans: Functions, diversity, and maturation of ACh-activated ion channels.
      ). This analysis can be conveniently summarized by ascribing responses into three different groups of mutants regarding their pharyngeal pumping on food in the absence and presence of aldicarb (Fig. 1).
      Table 1Pharyngeal pumping rate on food in the absence or presence of aldicarb
      ClassificationStrainGeneAlleleOff aldicarbOn aldicarb% Inh
      Pumps/min ± SDNStatp valuePumps/min ± SDNStatp value
      N2249.4 ± 12.1529.5 ± 13.14896.2
      alpha-nAChR subunitsDH404unc-63b404178.4 ± 20.612∗∗∗∗<0.000147.1 ± 51.512∗∗∗∗<0.000173.6
      VC1041lev-8ok1519251 ± 9.86ns>0.999923.2 ± 26.75ns>0.999990.6
      ZZ20unc-38x20230.8 ± 12.89ns>0.999922.8 ± 13.49ns>0.999990.1
      CB904unc-38e264221 ± 15.9120.01038 ± 7.912ns>0.999996.4
      TU1747deg-3u662143.9 ± 65.98∗∗∗∗<0.00017.1 ± 11.98ns>0.999995.1
      NC293acr-5ok180253.8 ± 4.69ns>0.99994.3 ± 4.69ns>0.999998.3
      RB2294acr-6ok3117185.1 ± 17.99∗∗∗∗<0.000114.3 ± 27.19ns>0.999992.3
      FX863acr-7tm863256.4 ± 5.69ns>0.99993.3 ± 5.19ns>0.999998.7
      RB1195acr-8ok1240244.1 ± 7.29ns>0.999913.5 ± 11.69ns>0.999994.5
      RB2262acr-10ok3064196.3 ± 49.96∗∗∗∗<0.00012 ± 2.46ns>0.999999
      RB1263acr-11ok1345252.6 ± 4.99ns>0.99993.1 ± 5.68ns>0.999998.8
      VC188acr-12ok367252.6 ± 6.29ns>0.999976.8 ± 47.29∗∗∗∗<0.000169.6
      RB1172acr-15ok1214251.8 ± 2.27ns>0.999931.9 ± 24.27ns>0.999987.3
      RB918acr-16ok789242.9 ± 3.49ns>0.99990.9 ± 1.49ns>0.999999.6
      RB1226acr-18ok1285236.8 ± 10.59ns>0.99991.6 ± 1.69ns>0.999999.3
      DA1674acr-19ad1674246.3 ± 8.68ns>0.99993.3 ± 2.58ns>0.999998.7
      RB1250acr-21ok1314240 ± 98ns>0.99991.9 ± 2.28ns>0.999999.2
      RB2119acr-23ok2804230.2 ± 5.99ns>0.99992.3 ± 2.29ns>0.999999
      non-alpha nAChR subunitsCB193unc-29e193227.3 ± 9.48ns0.74952.3 ± 277∗∗∗0.000577
      CB211lev-1e211244.8 ± 10.615ns>0.9999131.7 ± 61.115∗∗∗∗<0.000146.2
      ZZ427lev-1x427253.7 ± 17.84ns>0.9999113.2 ± 72.54∗∗∗∗<0.000155.4
      DA465eat-2ad46550.3 ± 10.114∗∗∗∗<0.00010.5 ± 0.611ns>0.999999
      RB1559acr-2ok1887254.4 ± 5.78ns>0.999962.5 ± 598∗∗∗∗<0.000175.4
      RB1659acr-3ok2049235.8 ± 20.49ns>0.999921.8 ± 20.39ns>0.999990.8
      VC649acr-9ok933217.3 ± 16.79∗∗0.004011.3 ± 119ns>0.999994.8
      RB1132acr-14ok1155250.8 ± 4.49ns>0.99990.8 ± 1.19ns>0.999999.7
      FX627acr-22tm627227.1 ± 18.97ns>0.99995.9 ± 5.87ns>0.999997.4
      XA21193lev-1; unc-29e211; e193250 ± 1.33ns>0.9999115.1 ± 24.83∗∗∗∗<0.000145
      ACh-gated Cl channel subunitsVC1757acc-2ok2216228.5 ± 28.49ns0.522220.5 ± 19.55ns>0.999990.3
      RB2490acc-3ok3450153.7 ± 38.48∗∗∗∗<0.000139.2 ± 37.77ns0.102774.5
      RB1832acc-4ok2371225.3 ± 31.34ns>0.99995.5 ± 8.34ns>0.999997.6
      mAChRsRB896gar-1ok755222.3 ± 7.54ns>0.999924.8 ± 47.54ns>0.999988.8
      RB756gar-2ok520224.6 ± 11.36ns0.802312.5 ± 8.94ns>0.999994.4
      VC670gar-3gk337252.8 ± 8.36ns>0.99997 ± 12.74ns>0.999997.2
      AChEsVC505ace-1ok663226.3 ± 26.95ns>0.99992.8 ± 4.94ns>0.999998.8
      GG202ace-2g72235.5 ± 4.83ns>0.99996.8 ± 6.33ns>0.999997.1
      PR1300ace-3dc2235.6 ± 13.74ns>0.99993.6 ± 6.34ns>0.999998.5
      Ancillary proteinsMF200ric-3hm9201 ± 27.66∗∗∗0.000174.1 ± 426∗∗∗∗<0.000163.1
      CB306unc-50e306223 ± 154ns>0.99998.7 ± 7.53ns>0.999996.1
      CB883unc-74e883232.1 ± 4.34ns>0.99995.9 ± 7.44ns>0.999997.5
      APs involved in location of nAChRsRB1717lev-9ok2166236.5 ± 14.86ns>0.999994.9 ± 66.54∗∗∗∗<0.000159.9
      ZZ17lev-10x17239.7 ± 8.66ns>0.999983.6 ± 49.94∗∗∗∗<0.000165.1
      EN39oig-4kr39227.4 ± 21.44ns>0.99997 ± 9.13ns>0.999997
      EN300rsu-1kr300243.9 ± 9.94ns>0.999920.4 ± 36.84ns>0.999991.6
      Other APsDA1110eat-18ad111065.9 ± 86∗∗∗∗<0.00011.6 ± 1.44ns>0.999997.6
      PR675tax-6p675222.1 ± 15.64ns>0.999917.1 ± 14.94ns>0.999992.3
      KJ300cnb-1jh103193.6 ± 15.46∗∗∗∗<0.00011.8 ± 1.86ns>0.999999.1
      HK30unc-68kh30231.2 ± 17.94ns>0.999921.3 ± 23.24ns>0.999990.8
      EN100molo-1kr100249.4 ± 6.66ns>0.999919.4 ± 7.44ns>0.999992.2
      BWM hyperactive signalingQW37unc-2zf35gf257.2 ± 3.96ns>0.999922.1 ± 6.96ns>0.999991.4
      IZ236Pmyo-3::unc-38(V/S), Pmyo-3::unc-29(L/S), and Pmyo-3::lev-1(L/S)246.9 ± 6.66ns>0.999910.5 ± 9.26ns>0.999995.7
      NTs signalingMT6308eat-4ky5211.6 ± 13.94ns0.11489.6 ± 19.85ns>0.999995.5
      VC862cho-1ok1069206 ± 38.740.02329 ± 25.44ns>0.999985.9
      GR1321tph-1mg280217.1 ± 124ns0.460913.3 ± 14.33ns>0.999993.9
      RB681cat-1ok411241.5 ± 14.84ns>0.999930.5 ± 9.53ns>0.999987.4
      CB156unc-25e156225 ± 5.14ns>0.99993.8 ± 44ns>0.999998.3
      Synchronized L4 + 1 nematodes were incubated for 24 h on seeded plates containing aldicarb or vehicle control before pumps per minute was quantified. Percentage of inhibition (% inh) is indicated and was calculated as 1 − (pumps off aldicarb/pumps on aldicarb) ∗ 100. Statistical analysis corresponds to the comparison between each strain and the N2 WT control in each condition (off and on aldicarb). The data are shown as mean ± SD. nsp ≥ 0.05; ∗p ˂ 0.05; ∗∗p ˂ 0.01; ∗∗∗p < 0.001; ∗∗∗∗p < 0.0001 by two-way ANOVA test followed by Bonferroni corrections.
      Abbreviations: AChEs, acetylcholinesterases; APs, auxiliary proteins; mAChRs, muscarinic acetylcholine receptors; nAChR, acetylcholine-gated cation channel; ns, not significant; NTs, neurotransmitters.
      Figure thumbnail gr1
      Figure 1Molecular determinants that control pharyngeal function are distinct from the determinants that confer pharyngeal resistance to aldicarb. Pharyngeal pumping on food in the absence (−) or presence (+) of 500 μM aldicarb. A, mutant nematodes deficient in the non-alpha acetylcholine-gated cation channel subunits ACR-9 and EAT-2; the alpha acetylcholine-gated cation channel subunits ACR-10, ACR-6, and DEG-3; the acetylcholine-gated chloride channel subunit ACC-3; and the acetylcholine-receptor auxiliary proteins EAT-18 and CNB-1 exhibited a significant reduction of the pumping rate but a normal sensitivity to aldicarb compared with the WT control. B, mutant nematodes deficient in the non-alpha acetylcholine-gated cation channel subunits UNC-29, LEV-1, and ACR-2; the alpha acetylcholine-gated cation channel subunit ACR-12; and the acetylcholine-receptor auxiliary proteins LEV-9 and LEV-10 exhibited normal pumping rate on food but significant resistant to aldicarb compared with the WT worms. C, nematodes deficient in the ancillary protein RIC-3 and the alpha acetylcholine-gated cation channel subunit UNC-63 presented both phenotypes, reduced pumping rate on food, and resistance to aldicarb compared with the WT control. The data are shown as mean + SD of the pumping per minute. Statistical analysis corresponds to the same condition (absence or presence of aldicarb) between the N2 WT and each mutant strains. nsp > 0.05; ∗∗∗p < 0.001 by two-way ANOVA test. Refer to for N numbers and p values.
      One class of mutants showed reduced pumping rate in the absence of aldicarb but WT inhibition of pharyngeal pumping in the presence of the drug (Fig. 1A and Table 1). This class of mutants clearly harbors an important contribution to feeding at physiological levels of cholinergic stimulation when nematodes are on food. However, despite this essential contribution, no resistance to the inhibition was observed when the cholinergic stimulation increased because of aldicarb exposure. According to this, we identified this class of mutants as “physiological determinants” of the feeding phenotype. This is exemplified by the eat-2 and eat-18 mutants. In addition, mutant nematodes deficient in the subunits of the acetylcholine-gated cation channel DEG-3, ACR-6, ACR-9, and ACR-10, the subunit of the acetylcholine-gated chloride channel ACC-3, and the calcineurin CNB-1 exhibited a similar pattern of reduced pumping when they are off drug and similar pharyngeal inhibition on aldicarb compared with the response shown by the N2 WT (Fig. 1A).
      The second class of mutants essentially described the opposite of the above. These mutants showed normal pumping rate on food relative to N2 but clear resistance to the aldicarb-induced inhibition of the pharyngeal function observed in the WT treated worms (Fig. 1B and Table 1). The effect of this second class of determinants in the pharyngeal function was only apparent when the cholinergic transmission was overstimulated beyond the physiological levels by preventing acetylcholine degradation due to acetylcholinesterase inhibition by aldicarb. Therefore, we named this group “pharmacological determinants” of feeding. These mutants included the well-characterized subunits of the acetylcholine-gated cation channel UNC-29, ACR-2, ACR-12, and LEV-1, along with the auxiliary proteins LEV-9 and LEV-10 (Fig. 1B). Interestingly, all the pharmacological determinants of the pharyngeal function are essential determinants of the body wall neuromuscular transmission by either acting in the motor neurons that release acetylcholine or postsynaptically in the body wall muscle (
      • Briseno-Roa L.
      • Bessereau J.L.
      Proteolytic processing of the extracellular scaffolding protein LEV-9 is required for clustering acetylcholine receptors.
      ,
      • Gally C.
      • Eimer S.
      • Richmond J.E.
      • Bessereau J.L.
      A transmembrane protein required for acetylcholine receptor clustering in Caenorhabditis elegans.
      ,
      • Fleming J.T.
      • Squire M.D.
      • Barnes T.M.
      • Tornoe C.
      • Matsuda K.
      • Ahnn J.
      • Fire A.
      • Sulston J.E.
      • Barnard E.A.
      • Sattelle D.B.
      • Lewis J.A.
      Caenorhabditis elegans levamisole resistance genes lev-1, unc-29, and unc-38 encode functional nicotinic acetylcholine receptor subunits.
      ,
      • Jospin M.
      • Qi Y.B.
      • Stawicki T.M.
      • Boulin T.
      • Schuske K.R.
      • Horvitz H.R.
      • Bessereau J.L.
      • Jorgensen E.M.
      • Jin Y.S.
      A neuronal acetylcholine receptor regulates the balance of muscle excitation and inhibition in Caenorhabditis elegans.
      ).
      An important exception to this observation was the WT response to aldicarb of the unc-38 alleles tested (Table 1). Despite their established role in body wall muscle sensitivity to acetylcholine and ensuing control of locomotion, these mutants expressed normal pumping on food and a WT sensitivity to aldicarb-induced inhibition of pharyngeal pumping.
      To understand potential interaction between subunits that might define the aldicarb-induced inhibition of pharyngeal pumping on food, we compared the effect of aldicarb on the lev-1, unc-29 single mutants and lev-1; unc-29 double mutant. This comparison suggested no additive effect of combining the two mutations supporting the notion that they may act together in a single acetylcholine receptor. However, this is unlikely to be within the archetypal unc-38 containing assemble that is classically studied at the body wall muscle of C. elegans (
      • Boulin T.
      • Gielen M.
      • Richmond J.E.
      • Williams D.C.
      • Paoletti P.
      • Bessereau J.L.
      Eight genes are required for functional reconstitution of the Caenorhabditis elegans levamisole-sensitive acetylcholine receptor.
      ).
      Finally, the third class of mutants showed clear deficiency in the two distinct contexts, namely pumping on food in the absence of drug and resistance to aldicarb-induced inhibition of the pharyngeal function (Fig. 1C and Table 1). Only two mutants of the genes tested were encompassed in this group (Fig. 1C), the alpha subunit of the L-type receptor UNC-63 and the chaperone of the nicotinic receptors RIC-3 (
      • Culetto E.
      • Baylis H.A.
      • Richmond J.E.
      • Jones A.K.
      • Fleming J.T.
      • Squire M.D.
      • Lewis J.A.
      • Sattelle D.B.
      The Caenorhabditis elegans unc-63 gene encodes a levamisole-sensitive nicotinic acetylcholine receptor alpha subunit.
      ,
      • Halevi S.
      • McKay J.
      • Palfreyman M.
      • Yassin L.
      • Eshel M.
      • Jorgensen E.
      • Treinin M.
      The C-elegans ric-3 gene is required for maturation of nicotinic acetylcholine receptors.
      ).
      Overall, the results suggest an unexpected divergence in cholinergic determinants of the pharyngeal function. Some of these control the physiological transmission that underpins fast pumping rate on food and others the hypothesized aldicarb-dependent process that executes an inhibition of feeding in the presence of the drug.

      The pharyngeal function of C. elegans exposed to levamisole exhibits a complex dose- and time-dependent inhibition

      The pharmacological determinants of the pharyngeal function highlighted in the previous screening with aldicarb (Fig. 1B) are known to underpin the mode of action of the nematode-selective pharmacological agent levamisole. This drug acts as an agonist of the body wall muscle nicotinic L-type receptor causing a spastic paralysis, essential for its use as a nematicide (
      • Hernando G.
      • Berge I.
      • Rayes D.
      • Bouzat C.
      Contribution of subunits to Caenorhabditis elegans levamisole-sensitive nicotinic receptor function.
      ,
      • Lewis J.A.
      • Wu C.H.
      • Berg H.
      • Levine J.H.
      The genetics of levamisole resistance in the nematode Caenorhabditis-elegans.
      ,
      • Lewis J.A.
      • Wu C.H.
      • Levine J.H.
      • Berg H.
      Levamisole-resistant mutants of the nematode Caenorhabditis-elegans appear to lack pharmacological acetylcholine-receptors.
      ). Although distinct in its mode of action, levamisole, like aldicarb intoxication, leads to a hyperstimulation of the cholinergic synapses in the nematodes (
      • Lewis J.A.
      • Wu C.H.
      • Levine J.H.
      • Berg H.
      Levamisole-resistant mutants of the nematode Caenorhabditis-elegans appear to lack pharmacological acetylcholine-receptors.
      ).
      Accordingly, we investigated the levamisole response in the pharyngeal circuit to increasing concentrations of drug over the time by quantifying the pharyngeal pumping of WT worms (Fig. 2). Interestingly, the nematodes displayed a profound initial inhibition of pharyngeal pumping rate when placed on levamisole-containing plates (Fig. 2A). This reduction of the pharyngeal pumping was observed after control worms recovered from the mechanical stimulation caused by the picking process, which inhibits the feeding temporarily (Fig. 2A) (
      • Chalfie M.
      • Sulston J.E.
      • White J.G.
      • Southgate E.
      • Thomson J.N.
      • Brenner S.
      The neural circuit for touch sensitivity in Caenorhabditis-elegans.
      ). The IC50 value calculated after 10 min of incubation onto levamisole plates was 140 ± 1 μM (Fig. 2B).
      Figure thumbnail gr2
      Figure 2Pharyngeal function of Caenorhabditis elegans exposed to levamisole exhibited a complex concentration and time-dependent inhibition. A, pharyngeal pumping was quantified for synchronized L4 + 1 nematodes immediately after transferring to either naïve or levamisole-containing plates. The initial picking-mediated inhibition of pumping (
      • Chalfie M.
      • Sulston J.E.
      • White J.G.
      • Southgate E.
      • Thomson J.N.
      • Brenner S.
      The neural circuit for touch sensitivity in Caenorhabditis-elegans.
      ) was recovered within 4 min. The nematodes picked onto levamisole-containing plates displayed a delayed dose-dependent recovery of the pharyngeal function after picking. The data are shown as mean + SD of the pumping rate of four worms in four different experiments. B, IC50 value for pharyngeal inhibition by levamisole after 10 min of incubation. The curve corresponds to the following equation y = 100/(1 + 10((−3.853 − x)(−3.246))); R2 = 0.9663; HillSlope = −3.246. C, pharyngeal pumping rate was quantified for synchronized L4 + 1 nematodes at different range of concentrations of levamisole over the time. An increased dose-dependent response was observed. The data are shown as mean ± SD of the pumping rate of eight worms in four different experiments per dose. D, IC50 value for pharyngeal inhibition by levamisole after 24 h of exposure. The curve corresponds to the following equation y = 100/(1 + 10((−3.7 − x)(−1.457))); R2 = 0.8080; HillSlope = −1.457. Statistical analysis corresponds to the comparison between each concentration and the nondrug control in each end-point time of incubation. nsp > 0.05; ∗p ˂ 0.05; ∗∗p ˂ 0.01; ∗∗∗p < 0.001 by two-way ANOVA test.
      After this initial inhibition of the pharyngeal function by levamisole, WT nematodes exhibited a partial recovery of the pumping rate over time at the lowest concentrations tested (10 μM and 50 μM), but the pumping was profoundly inhibited at the highest doses (250 μM and 500 μM) (Fig. 2C). This recovery of the pharyngeal function impacted on the IC50 value calculated, being 199 ± 1 μM after 24 h of incubation on levamisole-containing plates (Fig. 2D).
      The fact that both levamisole and aldicarb inhibit pumping rate on WT worms and that lev-1 deficient mutants are partially resistant to this effect for both drugs. This supports the hypothesis that the pharmacological hyperstimulation of the cholinergic system by either aldicarb or levamisole inhibits pharyngeal pumping by a common mechanism.
      These data raised the idea that overactivity of the cholinergic system might act as the trigger to inhibit pharyngeal pumping. To assess this, we added genetic models that ape a hyperstimulated cholinergic transmission to our screen (QW37 and IZ236 strains in Table 1). We investigated the unc-2 (zf35gf) allele that has elevated acetylcholine release and the IZ236 strain engineered to overexpress a gain of function body wall muscle L-type receptor (
      • Huang Y.C.
      • Pirri J.K.
      • Rayes D.
      • Gao S.
      • Mulcahy B.
      • Grant J.
      • Saheki Y.
      • Francis M.M.
      • Zhen M.
      • Alkema M.J.
      Gain-of-function mutations in the UNC-2/CaV2alpha channel lead to excitation-dominant synaptic transmission in Caenorhabditis elegans.
      ,
      • Bhattacharya R.
      • Touroutine D.
      • Barbagallo B.
      • Climer J.
      • Lambert C.M.
      • Clark C.M.
      • Alkema M.J.
      • Francis M.M.
      A conserved dopamine-cholecystokinin signaling pathway shapes context-dependent Caenorhabditis elegans behavior.
      ). These strains showed no change in the expression of aldicarb-induced inhibition of pharyngeal pumping. Interestingly, despite harboring an intrinsically enhanced cholinergic tone, these strains did not have a per se change in their pharyngeal pumping. Thus, these genetic approaches do not mimic the signaling engaged by pharmacological activation via aldicarb.

      The extra-pharyngeal nicotinic receptor subunit LEV-1 is a key determinant of levamisole inhibition of pharyngeal pumping

      To more clearly resolve the molecular pathway through which the pharyngeal inhibition is mediated, we focused on the quantification of the pharyngeal function of lev-1 deficient strains in the presence of levamisole (Fig. 3). The LEV-1 subunit was highlighted in our screen as the most significant determinant of the aldicarb-induced modulation of the feeding (Fig. 1B). In addition, the LEV-1 subunit was originally identified as a determinant of body wall muscle sensitivity to levamisole (
      • Fleming J.T.
      • Squire M.D.
      • Barnes T.M.
      • Tornoe C.
      • Matsuda K.
      • Ahnn J.
      • Fire A.
      • Sulston J.E.
      • Barnard E.A.
      • Sattelle D.B.
      • Lewis J.A.
      Caenorhabditis elegans levamisole resistance genes lev-1, unc-29, and unc-38 encode functional nicotinic acetylcholine receptor subunits.
      ).
      Figure thumbnail gr3
      Figure 3The non-alpha subunit LEV-1 of the heteromeric cholinergic receptor is responsible of the pharyngeal inhibition in the presence of levamisole at later end-point times. A, pharyngeal pumping was measured in the presence or absence of 250 μM of levamisole. The data are shown as mean ± SD of the pumping rate of 45 worms in at least 25 independent experiments. B, pumping rate of CB211 lev-1 strain in the presence or absence of 250 μM levamisole. The data are shown as mean ± SD of 22 worms in at least ten independent experiments. C, pharyngeal pumping rate of ZZ427 lev-1 mutant strain nematodes onto naïve or levamisole-containing plates. The data are shown as mean ± SD of the pumping per minute of eight nematodes in four independent experiments. Statistical analysis corresponds to the comparison between pumping rate on and off levamisole plates in each end-point time of incubation nsp > 0.05; ∗∗∗p < 0.001 by two-way ANOVA test.
      The strains deficient in lev-1 displayed a similar inhibition of the pharyngeal function as WT worms after 10 min of incubation on 250 μM levamisole plates (Fig. 3). However, the pumping rate completely recovered over the time, being similar to the nondrug exposed nematodes after 3 h of incubation (Fig. 3, B and C). This phenotype was consistent in the two lev-1 deficient strains tested, indicating the LEV-1 subunit of the nicotinic receptor is not responsible for the pharyngeal inhibition by levamisole at early exposure times, but its function is indeed required at the later exposure times.
      These results highlight two distinct components of a complex response to worm intoxication by levamisole. Although the rapid effect is independent of lev-1, the late sustained inhibition is clearly lev-1 dependent. This points to an overlapping mechanism for the aldicarb- and levamisole-induced inhibition of the pharynx at protracted intoxication conditions. This mechanism is mediated by a LEV-1 containing receptor.
      Because of the pivotal role played by LEV-1, we sought to detail its expression beyond the well characterized body wall muscle expression (
      • Fleming J.T.
      • Squire M.D.
      • Barnes T.M.
      • Tornoe C.
      • Matsuda K.
      • Ahnn J.
      • Fire A.
      • Sulston J.E.
      • Barnard E.A.
      • Sattelle D.B.
      • Lewis J.A.
      Caenorhabditis elegans levamisole resistance genes lev-1, unc-29, and unc-38 encode functional nicotinic acetylcholine receptor subunits.
      ). We first investigated the expression of lev-1 in the pharyngeal circuit of C. elegans using existing GFP translational reporters previously used to address functional expression of lev-1 (
      • Gottschalk A.
      • Schafer W.R.
      Visualization of integral and peripheral cell surface proteins in live Caenorhabditis elegans.
      ). Our analysis of these strains supported previous descriptions about the location in the body wall muscle cells as well as nerve ring, dorsal, and ventral nerve cord (Fig. 4A) (
      • Culetto E.
      • Baylis H.A.
      • Richmond J.E.
      • Jones A.K.
      • Fleming J.T.
      • Squire M.D.
      • Lewis J.A.
      • Sattelle D.B.
      The Caenorhabditis elegans unc-63 gene encodes a levamisole-sensitive nicotinic acetylcholine receptor alpha subunit.
      ,
      • Gottschalk A.
      • Schafer W.R.
      Visualization of integral and peripheral cell surface proteins in live Caenorhabditis elegans.
      ). However, the previous investigations highlighted that some pharyngeal gene expression can be masked by overlying nerve ring expression (
      • Dalliere N.
      Delineation of a Gut Brain Axis That Regulates Context-Dependent Feeding Behaviour of the Nematode Caenorhabditis elegans.
      ). To address this, pharynxes from transgenic worms carrying transcriptional (AQ585) and translational (AQ749) GFP reporters (
      • Gottschalk A.
      • Schafer W.R.
      Visualization of integral and peripheral cell surface proteins in live Caenorhabditis elegans.
      ) were isolated and imaged to test for fluorescent signal (Fig. 4A). We did not observe GFP fluorescence in any of the isolated pharynx preparations, indicating the absence of LEV-1 expression in the isolated muscle or in its associated basal lamina embedded pharyngeal circuit (Fig. 4A).
      Figure thumbnail gr4
      Figure 4Differential dissection of isolated pharynx relative to intact worms does not detect expression of lev-1 reporter constructs or lev-1 transcripts in the pharynx. A, representative images of lev-1 expression in both transcriptional and translational transgenic lines. The strain AQ585 corresponds to a transcriptional reporter expressing GFP under lev-1 promoter in a WT background. The strain AQ749 corresponds to a translational reporter expressing the coding sequence of lev-1 tagged with GFP under the control of lev-1 naïve promoter in a lev-1 (x427) IV deficient background. lev-1 is observed in body wall muscle and other head and body neurons in the intact worm. In micro dissected isolated pharynx, there is no detectable reported expression of lev-1 (images to the right within each panel). B, representative images from isolated pharynxes derived from transgenic strains expressing fluorescence protein under the control of the cholinergic unc-17 (GFP), glutamatergic eat-4 (mCherry), or biogenic aminergic cat-1 (mCherry) promoters. This shows the expected identity of distinct classes of pharyngeal neurons remain associated with the pharynx after micro-dissected isolation. The panel to the right shows the isolation of a pharynx from a N2 animal showing nonexpression. C, SYBR Green PCR of N2 WT isolated pharynxes demonstrates lev-1 is not expressed of in the pharyngeal muscle or neuronal circuits. cDNA was reverse transcribed from RNA extracted from the pools of five single worms or five isolated pharynxes of WT nematodes. A comparative PCR was performed using primers for lev-1 and two pharyngeal genes myo-2 and eat-2. Representative amplification with the indicated primers is shown in the agarose gel images. The relative expression of these mRNAs was assessed based on the Ct values in the reactions performed on intact worms and isolated pharynxes. This data shows that the robust detection of lev-1 transcripts in whole worm cDNAs fell below the limits of detection (ND: not determined after saturating 40 cycles) from isolated pharynxes. In contrast, the amplification and transcript abundance were very similar in cDNA from intact worms and isolated pharynx tested for pharyngeal selective genes eat-2 and myo-2. The data are shown as mean + SD.
      This notion was reinforced using a different approach in which cDNA was synthesized from mRNA extracted from five pooled intact worms or five pooled isolated pharynxes. Specific amplification of lev-1 was performed using SYBR Green. myo-1 and eat-2 were amplified in parallel as positive controls (Fig. 4C). We compared the relative abundance between the intact worm and isolated pharynxes by comparing the Ct values for each of these transcripts. This analysis showed robust amplification of the lev-1 transcript from the cDNA from intact worms (Ct = 23; Fig. 4C), with two distinct pair of primers. In contrast, after 40 cycles, we failed to detect any amplification of lev-1 using cDNA extracted from an equivalent number of isolated pharynxes (Ct = not-determined; Fig. 4C). This is consistent with lev-1 expression falling below the limit of detection in a 40 cycles SYBR Green PCR. In contrast, two specific pharynx expressed transcripts, myo-2 and eat-2, were equally amplified from both cDNAs, intact worms, and isolated pharynxes.
      Taken together, these results indicate that the major pharmacological determinant of the drug-induced pharyngeal inhibition phenotype exerts its function outside the pharyngeal circuit.

      LEV-1 is required in the body wall muscle to mediate levamisole inhibition of pharyngeal pumping

      In view of the significance of LEV-1 in the body wall neuromuscular junction, we investigated tissue-specific rescue of LEV-1 at the musculature controlling the locomotion. For this, we generated transgenic lines of lev-1 deficient nematodes expressing the WT cDNA version of the gene under the control of either lev-1 or myo-3 promoter. This experiment was replicated with two distinct lev-1 deficient mutant strains (Fig. 5).
      Figure thumbnail gr5
      Figure 5LEV-1 WT expression in body wall muscles of lev-1 mutant nematodes restores the levamisole induced inhibition of the pharyngeal function. A, pharyngeal pumping in the absence (black) or presence (green) of 250 μM levamisole at different end-point times for N2, CB211 lev-1 (e211) mutant strain and transgenic lines expressing lev-1 under either its own promoter (naïve rescue) or body wall muscle promoter (BW) into a CB211 background. The transgenic control lines were made by expressing GFP in coelomocytes of a lev-1 (e211). The data are shown as mean ± SD of the pumping rate of 14 worms in at least seven different experiments for N2 WT, eight worms in at least five independent experiments for CB211 lev-1 (e211) mutant strain, 14 worms from two different lines in at least four independent experiments per line for control transgenic line, 22 worms from four different lines in at least three different experiments per line for body wall rescue transgenic lines, and 24 worms from four different lines in at least three different experiments per line for naïve rescue lines. B, pharyngeal pumping in the absence (black) or presence (green) of 250 μM levamisole at different end-point times for N2, ZZ427 lev-1 (x427) mutant strain and transgenic lines expressing lev-1 under either its own promoter (naïve rescue) or body wall muscle promoter (BW) into a ZZ427 background. The transgenic control lines were made by expressing GFP in coelomocytes of a lev-1 (x427). The data are shown as mean ± SD of the pumping rate of 14 worms in at least seven different experiments for N2 WT, eight worms in at least five independent experiments for ZZ427 lev-1 (x427) mutant strain, 12 worms from two different lines in at least three independent experiments per line for control transgenic line, 18 worms from three different lines in at least three different experiments per line for body wall rescue transgenic lines, and 24 worms from four different lines in at least three different experiments per line for naïve rescue lines. nsp > 0.05; ∗∗∗p < 0.001 by two-way ANOVA test.
      The naïve expression of lev-1 rescued the WT pharyngeal sensitivity to levamisole in the two lev-1 deficient mutants tested (Fig. 5). Furthermore, the phenotype was partially rescued in the lev-1 (e211) mutant strain (Fig. 5A) and fully rescued in the lev-1 (x427) mutant strain (Fig. 5B) when the WT version of the lev-1 cDNA was selectively expressed in the body wall musculature under the control of the myo-3 promoter.
      These results indicate that the inhibition of the pharyngeal function by levamisole exposure is driven by the LEV-1 dependent signaling at the body wall muscle.

      Neurohumoral signaling in C. elegans has limited contribution to the pharyngeal sensitivity to levamisole

      Pharyngeal pumping rate in mutants deficient in major transmitters was investigated after 6 h of incubation with levamisole (Fig. 6), a time at which the inhibition of pumping rate by this drug was dependent on the LEV-1 function at the body wall neuromuscular junction (Figs. 3 and 5). These strains included those deficient in unc-25 (e156), eat-4 (ky5), cat-1 (ok411), tph-1 (mg280), tdc-1 (n3419), tbh-1 (n3247), and egl-3 (n150) (Fig. S1).
      Figure thumbnail gr6
      Figure 6The inhibitory effect of levamisole on the pharyngeal function is independent of distinct classes of neurotransmitter, neurohumoral, and neuropeptidergic signaling. The pumping rate of indicated neuromodulatory deficient mutants on food in the absence (gray column) or presence (green column) of 250 μM of levamisole after 6 h incubation. See for a cartoon summarizing the neurochemical deficiencies in the analyzed mutant backgrounds. Statistical analysis corresponds to the comparison between pumping rate on levamisole for N2 WT and the different mutant strains. The data are shown as mean + SD. nsp > 0.05; ∗p ˂ 0.05 by two-way ANOVA test.
      Nematodes deficient in the neurotransmitters GABA (unc-25), glutamate (eat-4), the biogenic amines (cat-1), serotonin (tph-1), octopamine (tbh-1), or both tyramine and octopamine (tdc-1), exhibited a similar response to levamisole compared with the WT nematodes. None of the mutant strains tested phenocopy the response observed in lev-1 deficient worms, indicating limited contribution of these major transmitter pathways to the levamisole-induced inhibition of the pharyngeal circuit or the underlying pharyngeal muscle pumping. (Fig. 6).

      Discussion

      The screening performed in the present study was designed to identify molecular determinants that control the pharmacological inhibition of pumping during cholinergic hyperstimulation while comparing the cholinergic dependent intrinsic ability with respond to food (
      • Dalliere N.
      • Bhatla N.
      • Luedtke Z.
      • Ma D.K.
      • Woolman J.
      • Walker R.J.
      • Holden-Dye L.
      • O'Connor V.
      Multiple excitatory and inhibitory neural signals converge to fine-tune Caenorhabditis elegans feeding to food availability.
      ). After this, we clearly defined three groups of determinants.

      Physiological determinants of pharyngeal function

      Although the pharyngeal muscle has two important cholinergic inputs in MC and M4 controlling its core function, there are additional cholinergic neurons of unknown function (
      • Albertson D.G.
      • Thomson J.N.
      The pharynx of Caenorhabditis elegans.
      ). Our study highlights an important class of mutants, including eat-2 and eat-18 deficient worms, which are fundamental to sustain high pumping rate on food in physiological conditions (Fig. 1A). Indeed, our comparative approach strongly reinforces the critical role of the EAT-2/EAT-18-dependent receptor (
      • McKay J.P.
      • Raizen D.M.
      • Gottschalk A.
      • Schafer W.R.
      • Avery L.
      eat-2 and eat-18 are required for nicotinic neurotransmission in the Caenorhabditis elegans pharynx.
      ,
      • Choudhary S.
      • Buxton S.K.
      • Puttachary S.
      • Verma S.
      • Mair G.R.
      • McCoy C.J.
      • Reaves B.J.
      • Wolstenholme A.J.
      • Martin R.J.
      • Robertson A.P.
      EAT-18 is an essential auxiliary protein interacting with the non-alpha nAChR subunit EAT-2 to form a functional receptor.
      ). The subunits of the nicotinic receptor ACR-6, ACR-10, DEG-3, and ACR-9 (
      • Holden-Dye L.
      • Joyner M.
      • O'Connor V.
      • Walker R.J.
      Nicotinic acetylcholine receptors: A comparison of the nAChRs of Caenorhabditis elegans and parasitic nematodes.
      ), the acetylcholine-gated chloride channel subunit ACC-3 (
      • Putrenko I.
      • Zakikhani M.
      • Dent J.A.
      A family of acetylcholine-gated chloride channel subunits in Caenorhabditis elegans.
      ) and the calcineurin CNB-1 (
      • Bandyopadhyay J.
      • Lee J.
      • Lee J.
      • Lee J.I.
      • Yu J.R.
      • Jee C.
      • Cho J.H.
      • Jung S.
      • Lee M.H.
      • Zannoni S.
      • Singson A.
      • Kim D.H.
      • Koo H.S.
      • Ahnn J.
      Calcineurin, a calcium/calmodulin-dependent protein phosphatase, is involved in movement, fertility, egg laying, and growth in Caenorhabditis elegans.
      ) are included in this group (Fig. 7). This may have a value in better understanding the additional roles of cholinergic signaling and associated receptors in feeding behavior. However, further investigations will be required to identify the molecular pathways in which the physiological determinants of the feeding phenotype exert their function.
      Figure thumbnail gr7
      Figure 7Physiological and pharmacological determinants of the feeding. The determinants of the pharyngeal function are distinct in the two contexts probed in this study. A, when nematodes are on food, the cholinergic transmission stimulates pumping that underpins physiological feeding. The determinants of the pumping rate are EAT-2 and EAT-18, transducing the MC cholinergic signal in the pharyngeal muscle (
      • McKay J.P.
      • Raizen D.M.
      • Gottschalk A.
      • Schafer W.R.
      • Avery L.
      eat-2 and eat-18 are required for nicotinic neurotransmission in the Caenorhabditis elegans pharynx.
      ,
      • Choudhary S.
      • Buxton S.K.
      • Puttachary S.
      • Verma S.
      • Mair G.R.
      • McCoy C.J.
      • Reaves B.J.
      • Wolstenholme A.J.
      • Martin R.J.
      • Robertson A.P.
      EAT-18 is an essential auxiliary protein interacting with the non-alpha nAChR subunit EAT-2 to form a functional receptor.
      ). The subunits of the nicotinic receptor ACR-6, ACR-9, ACR-10, DEG-3, ACC-3, UNC-63, the calcineurin subunit CNB-1, and the ancillary protein RIC-3 were identified as additional molecular determinants of pumping rate on food. B, the pharmacological overstimulation of the cholinergic pathway by aldicarb or levamisole drives activation body wall muscle that imposes inhibition of the pumping rate. In this context, a lev-1 and unc-29 containing receptor in the body wall musculature is involved in this response. The evidence suggests the subunits of the acetylcholine-gated ion channel UNC-63, UNC-29, LEV-1, ACR-2, ACR-12 and their auxiliary proteins LEV-9, LEV-10, and RIC-3 are important in modulating the body wall muscle activity that couples an inhibition of pharyngeal function. Interestingly, there is no unc-38 dependence to this response precluding the classic L-type receptor in mediating the distal inhibition of feeding.
      Interestingly, none of the mutants included in this group displayed resistance to aldicarb-induced inhibition of the pharyngeal function (Fig. 1A). It indicates that the physiological determinants responsible for the essential control of the pharynx are quite distinct from those that drive the inhibition in the presence of aldicarb. Indeed, the distinct nature of mutants reinforces this proposition (Fig. 7).

      Pharmacological determinants of pharyngeal function

      In the present study, we have used the aldicarb-induced paralysis protocol (
      • Mahoney T.R.
      • Luo S.
      • Nonet M.L.
      Analysis of synaptic transmission in Caenorhabditis elegans using an aldicarb-sensitivity assay.
      ,
      • Oh K.H.
      • Kim H.
      Aldicarb-induced paralysis assay to determine defects in synaptic transmission in Caenorhabditis elegans.
      ) to investigate determinants that regulate the pharyngeal pumping behavior. However, this has highlighted a distinct nonpharyngeal modulation of drug-induced feeding inhibition. These investigations have been built on our previous observations indicating that aldicarb and other anti-cholinesterases cause a profound inhibition of the pharyngeal pumping (
      • Izquierdo P.G.
      • O'Connor V.
      • Green A.C.
      • Holden-Dye L.
      • Tattersall J.E.H.
      C. elegans pharyngeal pumping provides a whole organism bio-assay to investigate anti-cholinesterase intoxication and antidotes.
      ). It was underpinned by a spastic paralysis of the radial muscles in the pharynx evidenced by an overt opening of the lumen (
      • Izquierdo P.G.
      • O'Connor V.
      • Green A.C.
      • Holden-Dye L.
      • Tattersall J.E.H.
      C. elegans pharyngeal pumping provides a whole organism bio-assay to investigate anti-cholinesterase intoxication and antidotes.
      ). The prediction of our initial investigations was explained by assuming that aldicarb-dependent inhibition of acetylcholinesterase leads to an excess of input to the pharyngeal muscle from the two cholinergic motor neurons, MC and M4 (
      • Avery L.
      The genetics of feeding in Caenorhabditis elegans.
      ,
      • Avery L.
      • Horvitz H.R.
      A cell that dies during wild-type C-elegans development can function as a neuron in a Ced-3 mutant.
      ,
      • Trojanowski N.F.
      • Padovan-Merhar O.
      • Raizen D.M.
      • Fang-Yen C.
      Neural and genetic degeneracy underlies Caenorhabditis elegans feeding behavior.
      ,
      • Raizen D.M.
      • Lee R.Y.N.
      • Avery L.
      Interacting genes required for pharyngeal excitation by motor-neuron Mc in Caenorhabditis-elegans.
      ). In contrast to this view, we demonstrated here that LEV-1 and other molecular components of the body wall neuromuscular junction are strong determinants of the aldicarb-induced inhibition of the pharyngeal function (Fig. 1B). This points to the pivotal role of body wall muscle receptor in controlling locomotion and pharyngeal pumping in conditions where the pharmacological stimulation of the cholinergic signal causes an excitation of the musculature beyond the physiological levels (Fig. 7). This is reinforced by two observations: the failure to detect the lev-1 expression in the pharynx (Fig. 4) and the tissue-specific rescue experiments in the lev-1 mutant backgrounds (Fig. 5). The introduction of the WT version of lev-1 in the body wall muscle had a strong rescue effect of the levamisole-induced inhibition of pumping (Fig. 5). However, we note that lev-1 is expressed more widely than body wall muscle. Therefore, the expression in the nerve cord and nerve ring could in addition contribute to the integrity of the response.
      A surprising extension of our work is that the body wall muscle receptor that organizes this coupling is not the same receptor that is classically associated with body wall function. This idea of different subunits composition creating a receptor at the body wall muscle has been previously insinuated in C. elegans and other nematodes (
      • Holden-Dye L.
      • Joyner M.
      • O'Connor V.
      • Walker R.J.
      Nicotinic acetylcholine receptors: A comparison of the nAChRs of Caenorhabditis elegans and parasitic nematodes.
      ,
      • Almedom R.B.
      • Liewald J.F.
      • Hernando G.
      • Schultheis C.
      • Rayes D.
      • Pan J.
      • Schedletzky T.
      • Hutter H.
      • Bouzat C.
      • Gottschalk A.
      An ER-resident membrane protein complex regulates nicotinic acetylcholine receptor subunit composition at the synapse.
      ,
      • Blanco M.G.
      • Vela Gurovic M.S.
      • Silbestri G.F.
      • Garelli A.
      • Giunti S.
      • Rayes D.
      • De Rosa M.J.
      Diisopropylphenyl-imidazole (DII): A new compound that exerts anthelmintic activity through novel molecular mechanisms.
      ,
      • Verma S.
      • Kashyap S.S.
      • Robertson A.P.
      • Martin R.J.
      Functional genomics in Brugia malayi reveal diverse muscle nAChRs and differences between cholinergic anthelmintics.
      ). Our conclusion emerges from the observation that unc-38 mutants have a WT response to aldicarb-induced inhibition of pharyngeal function. In contrast, our analysis does support a role for both lev-1 and unc-29. It is important to note that these two subunits would need to coassemble with an alpha-like subunit to make the functional receptor but the nature of the fully assembled receptor that triggers the coupling to distal pharyngeal inhibition remains to be resolved.
      Overall, these results suggest that hyperstimulation of LEV-1-containing receptor at the body wall muscle modulates pharyngeal function by inhibiting the pumping rate in that particular stress condition. Indeed, feeding can continue after the ablation of the pharyngeal neurons (
      • Avery L.
      • Horvitz R.
      Pharyngeal pumping continues after laser killing of the pharyngeal nervous-system of C-elegans.
      ) but can be completely abolished by mechanical stimulation of the nematodes (
      • Chalfie M.
      • Sulston J.E.
      • White J.G.
      • Southgate E.
      • Thomson J.N.
      • Brenner S.
      The neural circuit for touch sensitivity in Caenorhabditis-elegans.
      ) or optical silencing of the body wall musculature (
      • Takahashi M.
      • Takagi S.
      Optical silencing of body wall muscles induces pumping inhibition in Caenorhabditis elegans.
      ). In the present study, we demonstrated that the pharmacological stimulation of the cholinergic signal at the body wall neuromuscular junction causes the reduction of the pharyngeal pumping (Fig. 7). This is a clear example of inter-tissue communication that is advantageous to the worm, allowing the coupling of two distinct functions. The mechanism underpinning the communication between the body wall and the pharyngeal neuromuscular junction is still unknown. Previously published observations highlighted the implication of dense core vesicle release and innexins as part of this mechanism (
      • Takahashi M.
      • Takagi S.
      Optical silencing of body wall muscles induces pumping inhibition in Caenorhabditis elegans.
      ). Using our pharmacological paradigm, we did not identify clear routes of chemical transmission responsible for the coupling between feeding and locomotion (Figs. 6 and S1). Further investigations will be needed to underpin the signaling between the body wall and the pharyngeal circuits.

      Determinants playing a role in both scenarios

      A final class of mutants that emerged from the screen includes unc-63 and ric-3 deficient strains. These two mutants are the only ones tested that exhibited a deficit in the pumping rate on food in the absence of aldicarb and a resistance to the inhibition of pumping in the presence of the drug (Fig. 1C). Indeed, this facet of the response in the unc-63 mutant indicates it is a candidate to coassemble with lev-1 and possibly unc-29 to generate the body wall receptor that couples to the inhibition of pharyngeal pumping. However, the fact that these mutants also impart the loss of the physiological pump rate on food suggests an under investigated role of UNC-63 and RIC-3 function within the pharyngeal circuit. This highlights paucity of understanding of the cholinergic determinants in pharyngeal function and how our screening approach may provide information about this in the future (Fig. 7).

      Conclusion

      In the C. elegans model organism, the ability of the pharynx to act as an interceptive cue for food to globally affect motility has been previously established (
      • Ben Arous J.
      • Laffont S.
      • Chatenay D.
      Molecular and sensory basis of a food related two-state behavior in C. elegans.
      ). In the present work, we demonstrated that the pharmacological activation of the body wall circuit allows the distal inhibition of the pharyngeal pumping rate. This highlights a reverse route in which the tone of the musculature that controls locomotion impacts the circuit controlling the feeding behavior. This finding provides insight into how the functional state of one tissue can indirectly, but profoundly, impose control on distinct organs with an unrelated function. Acute regulation of pumping by the locomotory circuit has been noted (
      • Takahashi M.
      • Takagi S.
      Optical silencing of body wall muscles induces pumping inhibition in Caenorhabditis elegans.
      ,
      • Chalfie M.
      • Sulston J.E.
      • White J.G.
      • Southgate E.
      • Thomson J.N.
      • Brenner S.
      The neural circuit for touch sensitivity in Caenorhabditis-elegans.
      ), however, the advantages and mechanisms for allowing this remain to be resolved. In a wider sense, this kind of inter-tissue communication can report stress or disease in the whole organism’s physiology. In C. elegans, the hyperstimulation of the body wall muscle might act as an aversive cue that impacts in the feeding rate of the worm. This presents similarities to the signals involved in disease in higher animals that impact on the appetite and feeding during cachexia (
      • Evans W.J.
      • Morley J.E.
      • Argiles J.
      • Bales C.
      • Baracos V.
      • Guttridge D.
      • Jatoi A.
      • Kalantar-Zadeh K.
      • Lochs H.
      • Mantovani G.
      • Marks D.
      • Mitch W.E.
      • Muscaritoli M.
      • Najand A.
      • Ponikowski P.
      • et al.
      Cachexia: A new definition.
      ).

      Experimental procedures

      C. elegans maintenance and strains

      Nematodes were maintained at 20 °C on NGM plates supplemented with Escherichia coli OP50 strain as a source of food (
      • Brenner S.
      The genetics of Caenorhabditis elegans.
      ). The C. elegans mutant strains are listed in Table 1 and were provided by Caenorhabditis Genetics Center unless otherwise specified. The mutant strains EN39 oig-4 (kr39) II, EN300 rsu-1 (kr300) III, and EN100 molo-1 (kr100) III were kindly provided by Jean-Louis Bessereau Lab (Institut NeuroMyoGène). ZZ427 lev-1 (x427) and transgenic lines AQ585 corresponding to N2; Ex [Plev-1::gfp; rol-6] genotype and AQ749 corresponding to ZZ427 lev-1 (x427) IV; and Is[Plev-1::lev-1::HA::gfp; rol-6] genotype were kindly provided by William Schafer Lab (MRC Laboratory of Molecular Biology). QW37 unc-2 (zf35gf)X was kindly provided by Alkema Lab (UMass Chan Medical School). The transgenic line IZ236 ufIs6 [Pmyo-3:: unc-38(V/S), Pmyo-3::unc-29(L/S), Pmyo-3:: lev-1(L/S)] was kindly provided by Francis Lab (UMass Chan Medical School). The transgenic lines GE24 pha-1 (e2123) III; Ex[Punc-17::gfp; pha-1 (+)], OH9279 otIs266 (Pcat-1::mCherry), and N2; Is[Peat-4::ChR2::mCherry] were previously available in the laboratory stock. The double mutant strain XA211193 lev-1 (e211) IV; unc-29 (e193) I was generated in this work.
      The following transgenic lines were generated in this work: VLP1: CB211 lev-1 (e211) IV; Ex[Punc-122::gfp]; VLP2: CB211 lev-1 (e211) IV; Ex[Punc-122::gfp; Pmyo-3::lev-1]; VLP3: ZZ427 lev-1 (x427) IV; Ex[Punc-122::gfp]; VLP4: ZZ427 lev-1 (x427) IV; Ex[Punc-122::gfp; Pmyo-3::lev-1]; VLP5: CB211 lev-1 (e211) IV; Ex[Punc-122::gfp; Plev-1::lev-1]; VLP6: ZZ427 lev-1 (x427) IV; and Ex[Punc-122::gfp; Plev-1:lev-1].

      Generation of lev-1 (e211) and unc-29 (e193) double mutant

      lev-1; unc-29 double mutant strain (XA21193) was generated using previously described methods (
      • Fay D.
      Genetic mapping and manipulation: Chapter 7-making compound mutants.
      ). Briefly, lev-1 (e211) males were induced by heat shock. Several young lev-1 (e211) males were incubated with three unc-29 (e193) hermaphrodites onto freshly seeded PO50 plates for 3 days. The mating was considered successful if the same rate of males and hermaphrodites was observed in the F1 generation. In this case, F1 hermaphrodites were heterozygous for both mutations lev-1 (e211) and unc-29 (e193). Three F1 hermaphrodites were picked to individual plates and incubated till self-fertilization and egg-laying of the F2 generation. According to Mendel’s laws, 1/16 of the F2 progeny would be homozygous for both mutations, lev-1 and unc-29.
      40 F2 hermaphrodites were incubated onto individual seeded plates to lay progeny (F3) and then picked into 2 μl of worm lysis buffer (5 mM Tris pH8, 0.25 mM EDTA, 0.5% Triton X100, 0.5% Tween 20, and 1 mg/ml proteinase K) into PCR tubes for genotyping. After spinning the tubes, the mixture was incubated at 65 °C for 10 min and at 85 °C for 1 min using a T100 thermocycler (Bio-Rad). 1 μl of the lysate was used to amplify e211 mutation of lev-1 (Fw_lev-1_I6: 5′- TGAAATAGAAAACGTGGGGG -3′ and Rv_lev-1_UTR: 5′- AAGTTGAAAATGAAAGAATAATGG -3′) and the e193 mutation of unc-29 (Fw_unc-29_E7: 5′- GGTATTTGGAAGTTGGACTGTG -3′ and Rv_unc-29_E10: 5′- GCTCAGATGCCGATTTTGGG -3′). PCR was performed using Phusion High-Fidelity PCR Master Mix with HF Buffer (Thermo Fisher Scientific) following manufacturer instructions. The fragments were analyzed by Sanger sequencing.

      Generation of lev-1 rescue constructs

      PCR amplifications were performed using Phusion High-Fidelity PCR Master Mix with HF Buffer (Thermo Fisher Scientific) following manufacturer instructions unless otherwise is specified.
      PCR was used to amplify sequence for the myo-3 promoter. 2.3 kb upstream of myo-3 was amplified using the primers 5′ TCCTCTAGATGGATCTAGTGGTCGTGG 3′ and 5′ ACCAAGCTTGGGCTGCAGGTCGGCT 3′ (58 °C annealing temperature). This was subsequently cloned into pWormgate expression vector using the indicated restriction sites incorporated into the 5′ end of the oligonucleotides indicated above (HindIII/XbaI).
      The primers 5′ ATGCTAGCTCTCATAACACTCAAGAAAACCCA 3′ and 5′ CCTCTATCCTCCACCACCTCCTAAC 3′ were used to amplify 3.536 kb of lev-1 locus corresponding to 3.5 kb upstream of the starting codon and 36 pb of exon one. PCR conditions for amplification were as follows: initial 3 min at 98 °C after 34 cycles consisting of 1 min at 98 °C, annealing 1 min at 57 °C, extension 3:30 min at 72 °C, and a final extension 10 min at 72 °C. The amplification product was cloned into pWormgate expression vector using the restriction site NheI underlined in forward primer and the naturally occurred XbaI restriction site 4 pb upstream of the lev-1 starting codon.
      cDNA of lev-1 was amplified from a C. elegans cDNA library (OriGene) using 5′ AGAGAGAATGATGTTAGGAGG 3′ and 5′ AGTTGAAAATGAAAGAATAATGG 3′ (55 °C annealing temperature) forward and reverse primers, respectively. The PCR product was subcloned into pCR8/GW/TOPO following manufacturer protocol and subsequently cloned into pWormgate plasmid containing either Pmyo-3 or Plev-1 to generate Pmyo-3::lev-1 and Plev-1::lev-1 plasmids, respectively. The sequence of the plasmids was validated by Sanger sequencing before microinjection.

      Generation of transgenic lines

      The marker plasmid Punc-122::gfp was kindly provided by Antonio Miranda Lab (Instituto de Biomedicina de Sevilla). It drives the expression of GFP specifically in coelomocytes of C. elegans (
      • Miyabayashi T.
      • Palfreyman M.T.
      • Sluder A.E.
      • Slack F.
      • Sengupta P.
      Expression and function of members of a divergent nuclear receptor family in Caenorhabditis elegans.
      ).
      The microinjection procedure was performed as previously described (
      • Mello C.C.
      • Kramer J.M.
      • Stinchcomb D.
      • Ambros V.
      Efficient gene transfer in C. elegans: Extrachromosomal maintenance and integration of transforming sequences.
      ). A concentration of 50 ng/μl of the marker plasmid Punc-122::gfp was injected into 1 day old adults of the CB211 lev-1 (e211) IV and ZZ427 lev-1 (x427) IV mutant background to generate the transgenic strains VLP1 and VLP3, respectively. A mixture of 50 ng/μl of Punc-122::gfp plasmid and 50 ng/μl of Pmyo-3::lev-1 plasmid was microinjected into the adults of CB211 and ZZ427 strains to produce the transgenic lines VLP2 and VLP4, respectively. Finally, the transgenic strains VLP5 and VLP6 were generated by microinjecting adults of the lev-1 (e211) and lev-1 (x427) mutant backgrounds, respectively, with a mixture of 50 ng/μl of Punc-122::gfp plasmid and 50 ng/μl of Plev-1::lev-1 plasmid.
      The genotype of CB211 and ZZ427 strains was authenticated by PCR amplification of the lev-1 gene, and subsequent sequencing of the PCR product before microinjection was carried out.

      Quantification of body wall and pharyngeal transcripts in both intact animals and isolated pharynxes

      Five intact L4 + 1 worms or five isolated pharynxes were placed into 1 μl worm lysis buffer containing a final concentration of 5 mM Tris pH8, 0.25 mM EDTA, 0.5% Triton X100, 0.5% Tween 20, and 1 mg/ml proteinase K. After centrifugation for 5 s, the mixture containing either the intact worms or the isolated pharynxes was incubated at 65 °C for 10 min and at 85 °C for 1 min using a T100 thermocycler (Bio-Rad). The heated lysate was subsequently used in cDNA synthesis with SuperScript III Reverse Transcriptase kit in a total volume of 20 μl following manufacturer protocol (Invitrogen). 5 μl of the resulting cDNAs was used in PCR reactions using iQ SYBR Green Supermix and the indicated oligo primers. Each reaction contained 250 nM forward/reverse oligo primers and 10 μl iQ SYBR Green Supermix (final volume of 20 μl). Amplifications were performed in a 3-step real-time PCR protocol following recommendations for iQ SYBR Green Supermix: one cycle of initial denaturation and enzyme activation step at 95 °C for 3 min; after 40 cycles of denaturing at 95 °C for 15 s, annealing for 30 s, and extension at 72 °C for 30 s; finally, one cycle of melt curve 55 to 95 °C (in 0.5 °C increments) for 15 s. After completion of the 40 cycles reaction, the amplified products were resolved in a 2% agarose gel. The Ct values obtained for each reaction were used as a proxy for transcript abundance based on a normalization that each reaction had a fix number of worms or isolated pharynxes. At least two independent mRNA isolations and SYBR Green PCR were performed on independent days.
      The primers used for the SYBR Green based PCRs were: 5′ GGACAGGGAGCCGAGAAGAC 3′ and 5′ GAAGCATCGTTAAGGAAAGTCAGG 3′ (64 °C annealing temperature, amplifying 109 bp) for myo-2 (Ex2/3-Ex3); 5′ GTGAATAGTCAGTTGGTGATGG 3′ and 5′ TGCGAAAATAAGTGCTGTGGTG 3′ (66 °C annealing temperature, amplifying 207 bp) for eat-2 (Ex6-Ex7); 5′ ATGTTAGGAGGTGGTGGAGG 3′ and 5′ GTTGAACGAGAGAGTTGTATCC 3′ (66 °C annealing temperature, amplifying 162 bp) for lev-1 (Ex1-Ex2); and 5′- GTGTTTTTGGCAGTATCCCTCC -3 and 5′- TCCCATTTCATAGTCAACCACAC -3′ (63 °C annealing temperature, amplifying 217 bp) for lev-1 (Ex1/2-Ex2).

      Plate husbandry

      Aldicarb and levamisole hydrochloride (Merck) were dissolved in 70% ethanol and water, respectively. The stock drugs were kept at 4 °C and used within a month or discarded.
      Behavioral experiments were performed at room temperature (20 °C) in 6-well plates that were prepared the day before each experiment. Drug-containing plates were made by adding a 1:1000 aliquot of the concentrated stock to molten tempered NGM agar to give the indicated concentrations of aldicarb (500 μM) and levamisole (10 μM–500 μM). For aldicarb control plates, a similar aliquot of 70% ethanol was added to the molten agar. The final concentration of ethanol for control and aldicarb-containing plates was 0.07%. This concentration of ethanol did not affect any of the behavioral tests performed in this work (data not shown).
      For protracted intoxication experiments, 50 μl of OP50 bacteria culture at one A600 was pipetted onto the solidified NGM assay plates containing either drug or vehicle. For the first 10 min of exposure to levamisole (early intoxication experiment), assay plates were seeded with 100 μl of OP50 bacteria culture of one A600 that was spread evenly over the complete surface of the NGM agar. After seeding, plates were left in the laminar flow hood for 1 h to facilitate drying of the bacterial lawn. 6-well plates containing either levamisole or aldicarb with bacterial lawn were then stored in dark at 4 °C until next day. Assay plates were incubated at room temperature for at least 30 min before starting the experiment. Contrary to assay plates with other cholinergic drugs (
      • Kudelska M.M.
      • Lewis A.
      • Ng C.T.
      • Doyle D.A.
      • Holden-Dye L.
      • O'Connor V.M.
      • Walker R.J.
      Investigation of feeding behaviour in C. elegans reveals distinct pharmacological and antibacterial effects of nicotine.
      ), we did not observe any difference in the density or integrity of the bacterial lawn between control and drugged plates.

      Behavioral observations

      A pharyngeal pump cycle consists of contraction-relaxation of the terminal bulb in the pharyngeal muscle. Each pump was discerned by the backward-forward movement of the grinder structure in the terminal bulb. The pharynx was observed using a Nikon SMZ800 (×60 magnification) binocular dissecting microscope. The movement of the grinder within terminal bulb of the pharynx was counted by visually registering on a hand-held clicker counting. Each grinder movement was recorded as a single pump and the number of pumps measured for 1 min.
      For protracted intoxication experiments, the synchronized nematodes 1 day older than L4 stage (L4 + 1) were transferred onto the assay plates and the pumping measured after 24 h for aldicarb-intoxication assays and after 10 min, 1, 3, 6, and 24 h for levamisole-intoxication experiments. The nematodes that left the patch of food during the experiment were picked back to the bacterial lawn, and the pumping rate was scored after waiting 10 to 15 min.
      For the first 10 min of exposure to levamisole, the synchronized (L4 + 1) adults were picked onto either control or levamisole-containing plates. The delay between each pump was scored for the consecutive 10 min straight after transferring each worm using Countdown Timer tool from www.WormWeb.org website. It was then translated into pumping rate per second.
      The percentage of pharyngeal-pumping inhibition relative to the control after either 10 min or 24 h of incubation with levamisole was used to estimate IC50 values. The dose-curves were fitted according to the formula log (concentration) versus % maximum pump response measured in the absence of drug. The equation and parameters of each curve is specified in each figure legend.

      Pharynx dissection procedure

      Pharynxes were dissected according to previously published methods (
      • Franks C.J.
      • Murray C.
      • Ogden D.
      • O'Connor V.
      • Holden-Dye L.
      A comparison of electrically evoked and channel rhodopsin-evoked postsynaptic potentials in the pharyngeal system of Caenorhabditis elegans.
      ). Young adult (L4 + 1) worms were placed into dissection plates containing 3 ml of Dent’s solution (glucose 10 mM, Hepes 10 mM, NaCl 140 mM, KCl 6 mM, CaCl2 3 mM, MgCl2 1 mM; pH 7.4) supplemented with 0.2% bovine serum albumin (Merck) (
      • Calahorro F.
      • Keefe F.
      • Dillon J.
      • Holden-Dye L.
      • O'Connor V.
      Neuroligin tuning of pharyngeal pumping reveals extrapharyngeal modulation of feeding in Caenorhabditis elegans.
      ). The dishes were incubated at 4 °C for 5 min to reduce the thrashing activity of the nematodes and then placed under a binocular microscope Nikon SMZ800. The lips of the worms were dissected from the rest of the body by making an incision with a surgical scalpel blade. Because of the internal pressure of the inside organs of the worm, the content is ejected outside the cuticle of the nematode leaving the pharynx and its embedded neural circuit exposed. When the terminal bulb was clearly observed outside the cuticle, a second incision was made at the pharyngeal-intestinal valve to isolate the pharynx from the rest of the intestine (Fig. 4). The pharynxes lacking more than half of the procorpus after dissection were not considered for either imaging or for RT-PCR.

      Differential interference contrast and fluorescence imaging of pharyngeal structure and transgene expression

      The isolated pharynxes were removed from the dissection dishes using nonsticky tips within 10 μl of solution. Fat and debris were carefully removed from the pharynxes by two sequential transfers, in a volume of 10 μl, through two changes of 3 ml Dent’s 0.2% bovine serum albumin medium. After washing, the pharynxes were placed on a thin pad of 2% agarose previously deposited and solidified on a microscope slide. A 24 × 24 mm coverslip was gently located on top before observations were made. The objectives of 10×/0.30, 60× A/1.40 (oil), and 100× A/1.40 (oil) fitted in a Nikon Eclipse (E800) microscope were used to collect images through both differential interference contrast and epifluorescence filters. A Nikon C-SHG1 high pressure mercury lamp was used for illumination in fluorescence micrographs.
      The images were acquired through a Hamamatsu Photonics camera software and were cropped to size, assembled, and processed using Abode PhotoShop (Adobe Systems) and ImageJ (NIH) software.
      Three transgenic strains harboring Punc-17::gfp; Peat-4::mCherry; and Pcat-1::mCherry were used as control of the dissection procedure. These three strains are transcriptional reporters of cholinergic, glutamatergic, and monoaminergic neurons, respectively. The isolated pharynxes from the three transgenic strains were isolated and imaged after the previously explained protocol. Fluorescence from distinct neurons was observed upon the dissection procedure (Fig. 4B), indicating the pharyngeal neurons were preserved in the isolated pharynx preparations.

      Statistical analysis

      The collection of the data was performed blind, so the experimenter was unaware of the genotype and the drug present, absent, or concentration tested in each trial.
      The data were analyzed using GraphPad Prism 8 and are displayed as mean ± SD. Statistical significance was assessed using two-way ANOVA after post hoc analysis with Bonferroni corrections where applicable. This post hoc test was selected among others to avoid false positives. The sample size N of each experiment is specified in the corresponding figure.

      Data availability

      All data presented are available upon request from Patricia G. Izquierdo ([email protected]).

      Supporting information

      This article contains supporting information.

      Conflict of interest

      The authors declare that they have no conflicts of interest with the contents of this article.

      Acknowledgments

      We thank Dr Jean-Louis Bessereau, Dr Denise Walker, Dr William Schafer, Dr Mark Alkema, and Dr Michael Francis for sharing strains; and Dr Antonio Miranda-Vizuete for sharing Punc-122::gfp marker plasmid. We thank Emeritus Professor Robert Walker and Dr Helena Rawsthorne-Manning for critical reading of the article and for detailed comments.
      Additional C. elegans strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was funded by the University of Southampton (United Kingdom) and the Defence Science and Technology Laboratory, Porton Down, Wiltshire (United Kingdom). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

      Author contributions

      P. G. I., J. E. H. T., A. C. G., L. H.-D., and V. O. conceptualization; P. G. I. data curation; P. G. I. and F. C. formal analysis; P. G. I., F. C., T. T., J. H. A., J. H., and C. J. L. investigation; P. G. I., F. C., J. E. H. T., A. C. G., L. H.-D., and V. O. methodology; P. G. I. validation; P. G. I. visualization; P. G. I. writing–original draft; P. G. I., F. C., J. E. H. T., A. C. G., L. H.-D., and V. O. writing–review and editing; J. E. H. T., A. C. G., L. H.-D., and V. O. funding acquisition; J. E. H. T., A. C. G., L. H.-D., and V. O. supervision.

      Supporting information

      References

        • Karsenty G.
        • Olson E.N.
        Bone and muscle endocrine functions: Unexpected paradigms of inter-organ communication.
        Cell. 2016; 164: 1248-1256
        • Rai M.
        • Demontis F.
        Systemic nutrient and stress signaling via myokines and myometabolites.
        Annu. Rev. Physiol. 2016; 78: 85-107
        • Egan B.
        • Zierath J.R.
        Exercise metabolism and the molecular regulation of skeletal muscle adaptation.
        Cell Metab. 2013; 17: 162-184
        • Argiles J.M.
        • Stemmler B.
        • Lopez-Soriano F.J.
        • Busquets S.
        Inter-tissue communication in cancer cachexia.
        Nat. Rev. Endocrinol. 2018; 15: 9-20
        • Delanoue R.
        • Slaidina M.
        • Leopold P.
        The steroid hormone ecdysone controls systemic growth by repressing dMyc function in Drosophila fat cells.
        Dev. Cell. 2010; 18: 1012-1021
        • Demontis F.
        • Perrimon N.
        Integration of insulin receptor/Foxo signaling and dMyc activity during muscle growth regulates body size in Drosophila.
        Development. 2009; 136: 983-993
        • Rajan A.
        • Perrimon N.
        Drosophila as a model for interorgan communication: Lessons from studies on energy homeostasis.
        Dev. Cell. 2011; 21: 29-31
        • Avery L.
        • Horvitz H.R.
        Effects of starvation and neuroactive drugs on feeding in Caenorhabditis-elegans.
        J. Exp. Zool. 1990; 253: 263-270
        • Avery L.
        • Horvitz R.
        Pharyngeal pumping continues after laser killing of the pharyngeal nervous-system of C-elegans.
        Neuron. 1989; 3: 473-485
        • Dalliere N.
        • Bhatla N.
        • Luedtke Z.
        • Ma D.K.
        • Woolman J.
        • Walker R.J.
        • Holden-Dye L.
        • O'Connor V.
        Multiple excitatory and inhibitory neural signals converge to fine-tune Caenorhabditis elegans feeding to food availability.
        FASEB J. 2016; 30: 836-848
        • Sawin E.R.
        • Ranganathan R.
        • Horvitz H.R.
        C-elegans locomotory rate is modulated by the environment through a dopaminergic pathway and by experience through a serotonergic pathway.
        Neuron. 2000; 26: 619-631
        • Ben Arous J.
        • Laffont S.
        • Chatenay D.
        Molecular and sensory basis of a food related two-state behavior in C. elegans.
        PLoS One. 2009; 4e7584
        • Shtonda B.B.
        • Avery L.
        Dietary choice behavior in Caenorhabditis elegans.
        J. Exp. Biol. 2006; 209: 89-102
        • Takahashi M.
        • Takagi S.
        Optical silencing of body wall muscles induces pumping inhibition in Caenorhabditis elegans.
        PLoS Genet. 2017; 13e1007134
        • Chalfie M.
        • Sulston J.E.
        • White J.G.
        • Southgate E.
        • Thomson J.N.
        • Brenner S.
        The neural circuit for touch sensitivity in Caenorhabditis-elegans.
        J. Neurosci. 1985; 5: 956-964
        • Keane J.
        • Avery L.
        Mechanosensory inputs influence Caenorhabditis elegans pharyngeal activity via ivermectin sensitivity genes.
        Genetics. 2003; 164: 153-162
        • Albertson D.G.
        • Thomson J.N.
        The pharynx of Caenorhabditis elegans.
        Philos. Trans. R. Soc. Lond. B Biol. Sci. 1976; 275: 299-325
        • Avery L.
        The genetics of feeding in Caenorhabditis elegans.
        Genetics. 1993; 133: 897-917
        • Avery L.
        • Thomas J.H.
        Chapter 24: Feeding and defecation.
        in: Riddle D.L. Blumenthal T. Meyer B.J. Priess J.R. C. elegans II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1997
        • Avery L.
        Motor-neuron M3 controls pharyngeal muscle-relaxation timing in Caenorhabditis-elegans.
        J. Exp. Biol. 1993; 175: 283-297
        • McKay J.P.
        • Raizen D.M.
        • Gottschalk A.
        • Schafer W.R.
        • Avery L.
        eat-2 and eat-18 are required for nicotinic neurotransmission in the Caenorhabditis elegans pharynx.
        Genetics. 2004; 166: 161-169
        • Avery L.
        • Shtonda B.B.
        Food transport in the C-elegans pharynx.
        J. Exp. Biol. 2003; 206: 2441-2457
        • Avery L.
        • Horvitz H.R.
        A cell that dies during wild-type C-elegans development can function as a neuron in a Ced-3 mutant.
        Cell. 1987; 51: 1071-1078
        • Dent J.A.
        • Davis M.W.
        • Avery L.
        avr-15 encodes a chloride channel subunit that mediates inhibitory glutamatergic neurotransmission and ivermectin sensitivity in Caenorhabditis elegans.
        EMBO J. 1997; 16: 5867-5879
        • Choudhary S.
        • Buxton S.K.
        • Puttachary S.
        • Verma S.
        • Mair G.R.
        • McCoy C.J.
        • Reaves B.J.
        • Wolstenholme A.J.
        • Martin R.J.
        • Robertson A.P.
        EAT-18 is an essential auxiliary protein interacting with the non-alpha nAChR subunit EAT-2 to form a functional receptor.
        PLoS Pathog. 2020; 16e1008396
        • Mahoney T.R.
        • Luo S.
        • Nonet M.L.
        Analysis of synaptic transmission in Caenorhabditis elegans using an aldicarb-sensitivity assay.
        Nat. Protoc. 2006; 1: 1772-1777
        • Oh K.H.
        • Kim H.
        Aldicarb-induced paralysis assay to determine defects in synaptic transmission in Caenorhabditis elegans.
        Bio Protoc. 2017; 7e2400
        • Izquierdo P.G.
        • O'Connor V.
        • Green A.C.
        • Holden-Dye L.
        • Tattersall J.E.H.
        C. elegans pharyngeal pumping provides a whole organism bio-assay to investigate anti-cholinesterase intoxication and antidotes.
        Neurotoxicology. 2020; 82: 50-62
        • Holden-Dye L.
        • Joyner M.
        • O'Connor V.
        • Walker R.J.
        Nicotinic acetylcholine receptors: A comparison of the nAChRs of Caenorhabditis elegans and parasitic nematodes.
        Parasitol. Int. 2013; 62: 606-615
        • Putrenko I.
        • Zakikhani M.
        • Dent J.A.
        A family of acetylcholine-gated chloride channel subunits in Caenorhabditis elegans.
        J. Biol. Chem. 2005; 280: 6392-6398
        • Culotti J.G.
        • Klein W.L.
        Occurrence of muscarinic acetylcholine receptors in wild type and cholinergic mutants of Caenorhabditis elegans.
        J. Neurosci. 1983; 3: 359-368
        • Hwang J.M.
        • Chang D.J.
        • Kim U.S.
        • Lee Y.S.
        • Park Y.S.
        • Kaang B.K.
        • Cho N.J.
        Cloning and functional characterization of a Caenorhabditis elegans muscarinic acetylcholine receptor.
        Recept. Channels. 1999; 6: 415-424
        • Lee Y.S.
        • Park Y.S.
        • Chang D.J.
        • Hwang J.M.
        • Min C.K.
        • Kaang B.K.
        • Cho N.J.
        Cloning and expression of a G protein-linked acetylcholine receptor from Caenorhabditis elegans.
        J. Neurochem. 1999; 72: 58-65
        • Lee Y.S.
        • Park Y.S.
        • Nam Y.
        • Suh S.J.
        • Lee F.
        • Kaang B.K.
        • Cho N.J.
        Characterization of GAR-2, a novel G protein-linked acetylcholine receptor from Caenorhabditis elegans.
        J. Neurochem. 2000; 75: 1800-1809
        • Combes D.
        • Fedon Y.
        • Grauso M.
        • Toutant J.P.
        • Arpagaus M.
        Four genes encode acetylcholinesterases in the nematodes Caenorhabditis elegans and Caenorhabditis briggsae. cDNA sequences, genomic structures, mutations and in vivo expression.
        J. Mol. Biol. 2000; 300: 727-742
        • Selkirk M.E.
        • Lazari O.
        • Hussein A.S.
        • Matthews J.B.
        Nematode acetylcholinesterases are encoded by multiple genes and perform non-overlapping functions.
        Chem. Biol. Interact. 2005; 157: 263-268
        • Selkirk M.E.
        • Lazari O.
        • Matthews J.B.
        Functional genomics of nematode acetylcholinesterases.
        Parasitology. 2005; 131: S3-S18
        • Bandyopadhyay J.
        • Lee J.
        • Lee J.
        • Lee J.I.
        • Yu J.R.
        • Jee C.
        • Cho J.H.
        • Jung S.
        • Lee M.H.
        • Zannoni S.
        • Singson A.
        • Kim D.H.
        • Koo H.S.
        • Ahnn J.
        Calcineurin, a calcium/calmodulin-dependent protein phosphatase, is involved in movement, fertility, egg laying, and growth in Caenorhabditis elegans.
        Mol. Biol. Cell. 2002; 13: 3281-3293
        • Boulin T.
        • Gielen M.
        • Richmond J.E.
        • Williams D.C.
        • Paoletti P.
        • Bessereau J.L.
        Eight genes are required for functional reconstitution of the Caenorhabditis elegans levamisole-sensitive acetylcholine receptor.
        Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 18590-18595
        • Boulin T.
        • Rapti G.
        • Briseno-Roa L.
        • Stigloher C.
        • Richmond J.E.
        • Paoletti P.
        • Bessereau J.L.
        Positive modulation of a Cys-loop acetylcholine receptor by an auxiliary transmembrane subunit.
        Nat. Neurosci. 2012; 15: 1374-1381
        • Briseno-Roa L.
        • Bessereau J.L.
        Proteolytic processing of the extracellular scaffolding protein LEV-9 is required for clustering acetylcholine receptors.
        J. Biol. Chem. 2014; 289: 10967-10974
        • Gally C.
        • Eimer S.
        • Richmond J.E.
        • Bessereau J.L.
        A transmembrane protein required for acetylcholine receptor clustering in Caenorhabditis elegans.
        Nature. 2004; 431: 578-582
        • Gendrel M.
        • Rapti G.
        • Richmond J.E.
        • Bessereau J.L.
        A secreted complement-control-related protein ensures acetylcholine receptor clustering.
        Nature. 2009; 461: 992-996
        • Gottschalk A.
        • Almedom R.B.
        • Schedletzky T.
        • Anderson S.D.
        • Yates J.R.
        • Schafer W.R.
        Identification and characterization of novel nicotinic receptor-associated proteins in Caenorhabditis elegans.
        EMBO J. 2005; 24: 2566-2578
        • Maryon E.B.
        • Coronado R.
        • Anderson P.
        unc-68 encodes a ryanodine receptor involved in regulating C-elegans body-wall muscle contraction.
        J. Cell Biol. 1996; 134: 885-893
        • Pierron M.
        • Pinan-Lucarre B.
        • Bessereau J.L.
        Preventing illegitimate extrasynaptic acetylcholine receptor clustering requires the RSU-1 protein.
        J. Neurosci. 2016; 36: 6525-6537
        • Rapti G.
        • Richmond J.
        • Bessereau J.L.
        A single immunoglobulin-domain protein required for clustering acetylcholine receptors in C. elegans.
        EMBO J. 2011; 30: 706-718
        • Huang Y.C.
        • Pirri J.K.
        • Rayes D.
        • Gao S.
        • Mulcahy B.
        • Grant J.
        • Saheki Y.
        • Francis M.M.
        • Zhen M.
        • Alkema M.J.
        Gain-of-function mutations in the UNC-2/CaV2alpha channel lead to excitation-dominant synaptic transmission in Caenorhabditis elegans.
        Elife. 2019; 8e45905
        • Bhattacharya R.
        • Touroutine D.
        • Barbagallo B.
        • Climer J.
        • Lambert C.M.
        • Clark C.M.
        • Alkema M.J.
        • Francis M.M.
        A conserved dopamine-cholecystokinin signaling pathway shapes context-dependent Caenorhabditis elegans behavior.
        PLoS Genet. 2014; 10e1004584
        • Treinin M.
        • Jin Y.
        Cholinergic transmission in C. elegans: Functions, diversity, and maturation of ACh-activated ion channels.
        J. Neurochem. 2021; 158: 1274-1291
        • Fleming J.T.
        • Squire M.D.
        • Barnes T.M.
        • Tornoe C.
        • Matsuda K.
        • Ahnn J.
        • Fire A.
        • Sulston J.E.
        • Barnard E.A.
        • Sattelle D.B.
        • Lewis J.A.
        Caenorhabditis elegans levamisole resistance genes lev-1, unc-29, and unc-38 encode functional nicotinic acetylcholine receptor subunits.
        J. Neurosci. 1997; 17: 5843-5857
        • Jospin M.
        • Qi Y.B.
        • Stawicki T.M.
        • Boulin T.
        • Schuske K.R.
        • Horvitz H.R.
        • Bessereau J.L.
        • Jorgensen E.M.
        • Jin Y.S.
        A neuronal acetylcholine receptor regulates the balance of muscle excitation and inhibition in Caenorhabditis elegans.
        PLoS Biol. 2009; 7e1000265
        • Culetto E.
        • Baylis H.A.
        • Richmond J.E.
        • Jones A.K.
        • Fleming J.T.
        • Squire M.D.
        • Lewis J.A.
        • Sattelle D.B.
        The Caenorhabditis elegans unc-63 gene encodes a levamisole-sensitive nicotinic acetylcholine receptor alpha subunit.
        J. Biol. Chem. 2004; 279: 42476-42483
        • Halevi S.
        • McKay J.
        • Palfreyman M.
        • Yassin L.
        • Eshel M.
        • Jorgensen E.
        • Treinin M.
        The C-elegans ric-3 gene is required for maturation of nicotinic acetylcholine receptors.
        EMBO J. 2002; 21: 1012-1020
        • Hernando G.
        • Berge I.
        • Rayes D.
        • Bouzat C.
        Contribution of subunits to Caenorhabditis elegans levamisole-sensitive nicotinic receptor function.
        Mol. Pharmacol. 2012; 82: 550-560
        • Lewis J.A.
        • Wu C.H.
        • Berg H.
        • Levine J.H.
        The genetics of levamisole resistance in the nematode Caenorhabditis-elegans.
        Genetics. 1980; 95: 905-928
        • Lewis J.A.
        • Wu C.H.
        • Levine J.H.
        • Berg H.
        Levamisole-resistant mutants of the nematode Caenorhabditis-elegans appear to lack pharmacological acetylcholine-receptors.
        Neuroscience. 1980; 5: 967-989
        • Gottschalk A.
        • Schafer W.R.
        Visualization of integral and peripheral cell surface proteins in live Caenorhabditis elegans.
        J. Neurosci. Methods. 2006; 154: 68-79
        • Dalliere N.
        Delineation of a Gut Brain Axis That Regulates Context-Dependent Feeding Behaviour of the Nematode Caenorhabditis elegans.
        (Doctoral Thesis) University of Southampton, 2015
        • Trojanowski N.F.
        • Padovan-Merhar O.
        • Raizen D.M.
        • Fang-Yen C.
        Neural and genetic degeneracy underlies Caenorhabditis elegans feeding behavior.
        J. Neurophysiol. 2014; 112: 951-961
        • Raizen D.M.
        • Lee R.Y.N.
        • Avery L.
        Interacting genes required for pharyngeal excitation by motor-neuron Mc in Caenorhabditis-elegans.
        Genetics. 1995; 141: 1365-1382
        • Almedom R.B.
        • Liewald J.F.
        • Hernando G.
        • Schultheis C.
        • Rayes D.
        • Pan J.
        • Schedletzky T.
        • Hutter H.
        • Bouzat C.
        • Gottschalk A.
        An ER-resident membrane protein complex regulates nicotinic acetylcholine receptor subunit composition at the synapse.
        EMBO J. 2009; 28: 2636-2649
        • Blanco M.G.
        • Vela Gurovic M.S.
        • Silbestri G.F.
        • Garelli A.
        • Giunti S.
        • Rayes D.
        • De Rosa M.J.
        Diisopropylphenyl-imidazole (DII): A new compound that exerts anthelmintic activity through novel molecular mechanisms.
        PLoS Negl. Trop. Dis. 2018; 12e0007021
        • Verma S.
        • Kashyap S.S.
        • Robertson A.P.
        • Martin R.J.
        Functional genomics in Brugia malayi reveal diverse muscle nAChRs and differences between cholinergic anthelmintics.
        Proc. Natl. Acad. Sci. U. S. A. 2017; 114: 5539-5544
        • Evans W.J.
        • Morley J.E.
        • Argiles J.
        • Bales C.
        • Baracos V.
        • Guttridge D.
        • Jatoi A.
        • Kalantar-Zadeh K.
        • Lochs H.
        • Mantovani G.
        • Marks D.
        • Mitch W.E.
        • Muscaritoli M.
        • Najand A.
        • Ponikowski P.
        • et al.
        Cachexia: A new definition.
        Clin. Nutr. 2008; 27: 793-799
        • Brenner S.
        The genetics of Caenorhabditis elegans.
        Genetics. 1974; 77: 71-94
        • Fay D.
        Genetic mapping and manipulation: Chapter 7-making compound mutants.
        in: WormBook The C. elegans Research Community. WormBook, Pasadena, CA2006: 1-4
        • Miyabayashi T.
        • Palfreyman M.T.
        • Sluder A.E.
        • Slack F.
        • Sengupta P.
        Expression and function of members of a divergent nuclear receptor family in Caenorhabditis elegans.
        Dev. Biol. 1999; 215: 314-331
        • Mello C.C.
        • Kramer J.M.
        • Stinchcomb D.
        • Ambros V.
        Efficient gene transfer in C. elegans: Extrachromosomal maintenance and integration of transforming sequences.
        EMBO J. 1991; 10: 3959-3970
        • Kudelska M.M.
        • Lewis A.
        • Ng C.T.
        • Doyle D.A.
        • Holden-Dye L.
        • O'Connor V.M.
        • Walker R.J.
        Investigation of feeding behaviour in C. elegans reveals distinct pharmacological and antibacterial effects of nicotine.
        Invert. Neurosci. 2018; 18: 14
        • Franks C.J.
        • Murray C.
        • Ogden D.
        • O'Connor V.
        • Holden-Dye L.
        A comparison of electrically evoked and channel rhodopsin-evoked postsynaptic potentials in the pharyngeal system of Caenorhabditis elegans.
        Invert. Neurosci. 2009; 9: 43-56
        • Calahorro F.
        • Keefe F.
        • Dillon J.
        • Holden-Dye L.
        • O'Connor V.
        Neuroligin tuning of pharyngeal pumping reveals extrapharyngeal modulation of feeding in Caenorhabditis elegans.
        J. Exp. Biol. 2019; 222jeb189423